KR101314263B1 - Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins - Google Patents

Abstract

The present invention relates to a novel insecticidal protein, characterized in that it has been isolated from photolabdus temperata M1021 (Accession No .: KACC91627P).
The present invention also relates to a pest control composition comprising the novel pesticidal protein, and to a pest control method using the same.

Description

Novel insecticidal proteins, compositions for controlling pests and methods for controlling pests using the same. {Novel Pesticidal proteins, compound and method for controlling harmful insects using novel Pesticidal proteins}

 The present invention provides a novel insecticidal protein comprising a novel insecticidal protein, a recombinant expression vector comprising a novel insecticidal protein gene, and an expression vector, isolated from a novel strain, Poturarabdus temperata M1021 (Accession No. KACC91627P). It relates to a protein production transformant.

The present invention also relates to a pest control composition comprising the novel pesticidal protein.

The present invention also relates to a method for controlling pests using the composition for controlling pests.

Insects and other pests cost farmers tens of millions of dollars each year in crop losses and the cost of controlling these pests. Losses caused by pests in the crop production environment include reduced crop yields, lower crop quality, and increased harvest costs.

It relies heavily on chemical pesticides to ensure the desired level of control. These pesticides are bound onto or inserted into the soil, but the continued use of pesticides has allowed the resistant insects to evolve. Situations such as very large numbers of larvae, heavy rains, and improper measurements of pesticide application equipment can lead to unsatisfactory control. In addition, the use of pesticides often raises environmental concerns such as contamination of soils and surfaces and underground water sources.

The public has also been interested in the residual amounts of synthetic chemicals that can be found in food. Working with pesticides also harms those who use it. Thus, synthetic chemicals are increasingly being examined for their potential toxic environmental consequences. Examples of synthetic chemical pesticides that are widely used include organic chlorides such as DDT, mirex, kepone, lindane, aldrin, chlordane and aldicarb. ), And dieldrin; Organophosphates such as chlorpyripos, parathion, malathion, and diazinon; And carbamates.

There is a growing concern about the dangers of chemical pesticides. For example, questions about the dangers of DDT began to arise in 1957, and the half-life of DDT did not decompose well between two and fifteen years, and mainly accumulated in fatty components of the body. Research has shown that humans can induce cancer after they are absorbed after they are absorbed, prohibiting the use of DDT as a pesticide in most countries from the 1970s to the present.

In addition, BHC, which is made of chlorine or benzene, has attracted worldwide attention by leading development and synthesis in the United States because of its abundant raw materials, low cost, and strong insecticide, and less harmful to human beings. In addition, due to the recent environmental pollution problem, various countries such as Western countries and Australia are strictly restricting the use of the pesticides.

As such, organic chemical synthetic insecticides have been widely used to control pests, but over the decades of abuse, pest outbreaks or emergence of resistant pests, toxic expression of non-target insects including humans, and environmental systems It causes many side effects such as pollution. As a result of various problems caused by pesticide residue toxicity and environmental pollution around the world, an international agreement was reached to refrain from using highly toxic organic synthetic pesticides in order to protect human health. Under these international agreements, the world reduced production by 50% of the chemical synthetic organophosphorus and chlorine pesticides used in the past 10 years in 2004, and again reduced production of organophosphorus and organochlorine insecticides by 50% by 2010. It is in the phase of implementation, agreeing to international agreements to be made.

However, after the consultation on the reduction and production of toxic pesticides, many researchers around the world have tried to develop environmentally friendly pesticides, but have not been able to develop new and safe insecticides to replace the organophosphorus and organochlorine pesticides that have been used. The resolution of the World Pesticide Reduction Conference is difficult to keep. If a safe insecticide is not developed and produced soon, there will be a big problem at home and abroad due to the lack of pesticides for pest control as well as agricultural pesticides related to food and agricultural production. It is expected.

In recent years, microorganisms have been able to reduce or replace the use of chemical fertilizers or pesticides, microorganisms capable of biological control techniques that are less harmful to livestock, do not harm crops, and have less damage to the environment, such as soil ecosystems. As evidenced by several researchers, there is a growing interest and interest in biological pesticides that can complement the chemical pesticides.

 Accordingly, biological pesticides that are increasing in use recently are soil microorganisms Bacillus thuringiensis ("B.t."). Some Bacillus toxin genes have been isolated and sequenced, and products based on recombinant DNA have been produced and approved for use. In addition, new approaches are being developed to deliver these toxins to the agricultural environment with the use of genetic engineering techniques. These include the use of plants genetically engineered by toxin genes resistant to insects and the use of stabilized complete microbial cells as a means of toxin delivery. As such, isolated Bacillus toxin genes are of increasing commercial value.

However, the successful use of Bacillus toxin has been attributed to insect B.t. It caused resistance to toxins. Some insects are less likely to benefit from Bacillus toxins, and examples of such insects include, but are not limited to, insects such as weevils or black cutworms. Adults of most species have been shown that have not shown markedly noticeable sensitivity to δ-endotoxin. Thus, B.t. Although resistance management methods have been of great interest in transgenic plant engineering, there remains a need to develop additional genes that can be expressed in plants in order to effectively control various insects.

Accordingly, the present inventors have made efforts to search for genes that can be used for pest control from new microorganisms with the aim of developing new biological pesticides using novel insecticidal proteins that can control pests on crops. The protein was discovered and the present invention was completed.

It is an object of the present invention to provide a pesticidal protein and a gene encoding the same, an expression vector containing the gene, a transformant for producing a novel insecticidal protein which is recognized as a novel biological insecticide.

Another object of the present invention to provide a pest control composition comprising a novel pesticidal protein and to provide a new biological pest control method using the same.

In order to solve the above problems, the present invention provides an insecticidal protein having an amino acid sequence of SEQ ID NO: 1 or 3.

Also provided is an insecticidal protein gene, characterized by encoding the amino acid sequence of SEQ ID NO: 1 or 3.

In another aspect, the present invention provides a recombinant expression vector comprising a novel insecticidal protein gene and a transformant manufacturing a pesticidal protein comprising the same.

As another aspect of the present invention, the present invention provides a pest control composition comprising the novel pesticidal protein.

In addition, the present invention provides a pest control method using a pest control composition comprising a novel pesticidal protein.

In accordance with the present invention, a novel pesticidal picture drawer Douce tempering rata M1021 (picture drawer tooth temperate M1021, KACC91627P) can be secured to the novel pesticidal proteins of origin, and may be useful as a new biological insecticide with them.

1 shows a PCR condition table. (* Annealing temperature (AT): Tcc F1 / R1; 50 ° C, TcdF2 / R2; 54 ° C, TcaC F3 / R3; 54 ° C)
2 shows an equation for calculating the ideal number of clones.
Figure 3 shows positive cosmid clones for tcd locus and tcc locus using pooling and subpooling PCR. (M; size marker (λ / HindIII), A) Screening of groups with positive clones of tcdB2 by pooling PCR method B) Securing positive clones of tcdB2 by subpooling PCR method (PtC 49, 64, 267) C) Screening of groups with positive clones of tccC by pooling PCR method D) Securing positive clones of tccC by subpooling PCR method (PtC 28). * PtC; Photorhabdus temperata M1021's cosmid library)
Figure 4 shows the analysis of recombinant cosmid plasmid by restriction enzyme digestion.
Figure 5 shows the configuration of ORFs in cosmid plasmids pS49 (A) and pS28 (B) (A: red, B: yellow C: green)
Figure 6 shows the results of the insecticidal test for honeybees moth larvae of the positive cosmid clone.
7 shows the result of SDS-PAGE analysis of recombinant toxin protein. (M: Molecular protein standard, arrow indicates location of recombinant toxin protein, 6% SDS-PAGE gel shows Coomassie brilliant blue A) TccA, B) TccB, C) TccC, D) TcaC, E) TcdA1- like, F) TcdB2, G) TccC3)
8 shows insecticidal results for honeybee moth larvae.
9 shows insecticidal results for brown larva larvae.
Figure 10 shows the appearance of the insecticidal toxin protein in the honeybee moth larva (A) and brown mealworm larva (B). (Top: before treatment, bottom: after treatment)

According to the present invention, insecticidal proteins having the amino acid sequences represented by SEQ ID NO: 1 and SEQ ID NO: 3 are provided, and also nucleotide sequences encoding these amino acids are provided.

In the present invention, the insecticidal protein may be characterized in that it is isolated from Photolabdus temperata M1021 (Accession Number: KACC91627P).

In addition, the protein according to the present invention is an insecticidal protein consisting of the amino acid sequence of SEQ ID NO: 1. Preferably, the base sequence of SEQ ID NO: 2 may be used to encode the amino acid of SEQ ID NO: 1, but is not limited thereto.

The present invention also relates to an insecticidal protein consisting of the amino acid sequence of SEQ ID NO. Preferably, the base sequence of SEQ ID NO: 4 may be used to encode the amino acid of SEQ ID NO: 3, but is not limited thereto.

On the other hand, as another aspect of the present invention can provide a recombinant vector for intracellular delivery comprising a novel insecticidal protein gene.

The term “recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been re-introduced into the cell by an artificial means as modified.

In the present invention, the gene may be introduced into various vectors including a plasmid vector, a bacteriophage vector, a cosmid vector, and a yeast artificial chromosome (YAC) vector. For the purposes of the present invention, it is preferable to use a plasmid vector, but is not limited thereto. Vectors used in the art for expression of a target gene in a microorganism may be used without limitation.

The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.

The present invention also relates to TccB of the present invention or Provided is a transformant that expresses a pesticidal protein transformed with a recombinant vector comprising a TccC3 gene. Preferred host cells for transformation into suitable host cells are prokaryotic cells. Suitable prokaryotic host cells are E. coli strain DH5a, E. coli strain JM101, E. coli K12 strain 294, E. coli strain W3110, E. coli strain X1776, E. coli XL-1Blue (Stratagene) and E. coli B And the like. However, E. coli strains such as FMB101, NM522, NM538 and NM539 and other prokaryotic species and genera may also be used. Thus, in addition to E. coli, which is a preferred embodiment on the present specification, Agrobacterium sp. Strains such as Agrobacterium A4. Other enterobacteria such as bacilli, such as Bacillus subtilis, Salmonella typhimurium or Serratia marcescens, and various Pseudomonas genus strains as host cells It can be used without limitation.

As the method for inserting the gene on the chromosome of the host cell in the present invention can be used a commonly known genetic engineering method, for example retrovirus vector, adenovirus vector, adeno-associated virus vector, herpes simplex virus vector , Poxvirus vectors, lentiviral vectors or non-viral vectors.

Nucleic acids are "operably linked" when placed in a functional relationship with other nucleic acid sequences. This may be genes and regulatory sequence (s) linked in such a way as to allow gene expression when appropriate molecules (eg, transcriptional activating proteins) bind to regulatory sequence (s). For example, the DNA for a pre-sequence or secretion leader is operably linked to the DNA for the polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when positioned to facilitate translation. In general, "operably linked" means that the linked DNA sequence is in contact, and in the case of a secretory leader, is in contact and present within the reading frame. However, the enhancer need not be in contact. Linking of these sequences is performed by ligation (linking) at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used.

As used herein, the term “expression vector” generally refers to a fragment of DNA that is generally double stranded as a recombinant carrier into which fragments of heterologous DNA have been inserted. Here, heterologous DNA refers to heterologous DNA, which is DNA not naturally found in host cells. Once an expression vector is in a host cell, it can replicate independently of the host chromosomal DNA, and several copies of the vector and its inserted (heterologous) DNA can be generated. As a preferred embodiment of the present invention can be used pET21a (+) vector, but is not limited thereto.

As is well known in the art, to raise the expression level of a transfected gene in a host cell, the gene must be operably linked to transcriptional and translational expression control sequences that function in the selected expression host. Preferably, the expression control sequence and the gene of interest are included in one expression vector including the bacterial selection marker and the replication origin. If the host cell is a eukaryotic cell, the expression vector must further comprise an expression marker useful in the eukaryotic expression host.

Host cells transformed or transfected with the above-described expression vectors constitute another aspect of the present invention. As used herein, the term “transformation” means introducing DNA into a host so that the DNA is replicable as an extrachromosomal factor or by chromosomal integration.

The present invention also provides a pest control composition comprising the novel pesticidal protein provided by the present invention. Examples of pests that can be controlled with the compositions of the present invention may preferably be butterfly neck pests or coleopteran pests, but are not limited thereto and may be used in all applicable general pests.

Lepidoptera pests of the present invention are honey bee moth (Galleria mellonella), Chinese cabbage moth (Plutella xylostella), tobacco moth (Spodoptera litura), moth Antler (Alcis angulifera), mother-of-law leaf moth (Adoxophyes orana), persimmon tree Leafy Moth (Ptycholoma lecheana), Chestnut Leafy Moth (Cydia Kurokoi), Peach Nettle Moth (Grapholita molesta), Silver Moth (Lyonetia prunifoliella), Peach Core Moth (Carposina sasakii), Parrot Moth (Spodoptera exigua) Selected from the group consisting of Diaphania indica, Cnaphalocrocis medinalis, Chilo suppressalis, and Helicoverpa armigera, the coleopteran pest is Tenebrio molitor Linnaeus, Alder Leaf beetle (Agelastica coerulea Baly), apple tree bark (Xyleborus apicalis Blandford), Seoul tree bark (Scolytus seulensis), rice weevil (Scolytus seulensis), pine bark Tomicus piniperda, chestnut weevil (Culculi) o may be a pest selected from the group consisting of sikkimensis).

In addition, in the preparation of the novel pesticidal proteins of the present invention in pest control compositions, for example, ester compounds, saturated hydrocarbons and esters and other pesticidal active ingredients, acaricide active ingredients, repulsive active ingredients, synergists, Flavors and the like can be prepared by mixing and dissolving at room temperature or under heating.

When the composition of the invention is used for pest control, the composition of the invention may be applied on its own or in the form of a pest control formulation comprising the composition of the invention, for example oils, emulsions, water Dispersible powders, flowable agents (aqueous suspensions, aqueous emulsions, etc.), powders, granules, aerosols, heated vaporizers (insecticide coils, electric insecticide mattes, liquid-absorbing shafts) heated insecticide-vaporizers with shafts), heated fumigants (self-burning fumigants, chemical-reactive fumigants, porous-ceramic fumigants, etc.), unheated vaporizers (resin vaporizers, impregnated paper vapors) And the like), sprays (fogging, etc.), ULV agents, and poisonous bait.

The pest control method using the pest control composition of the present invention is carried out by applying the composition of the present invention or a formulation thereof to a pest or a place where the pests live. The method of applying the composition of the present invention or the formulation thereof may be appropriately selected and applied according to the shape, location of use, and the like of the composition of the present invention or the formulation thereof.

Hereinafter, the present invention will be described in detail by experimental examples. However, the following experimental examples are merely illustrative of the present invention, and the content of the present invention is not limited by the following experimental examples.

Experimental Example 1 Photo Labudus Temperata M1021 ( KACC91627p )from genomic Cosmid  Library production.

The chromosomal DNA of P. temperata M1021 for genomic library was isolated according to Wilson's method (Short Protocols in Molecular Biology, Unit 2.4). The total DNA isolated was partially digested with Sau3AI (Fermentas, USA), and then the size fraction of DNA fragments was averaged 35-45 kb by ultracentrifugation using a sucrose gradient, followed by cosmid vector SuperCos 1 cut with BamHI and XbaI. Ligation to (Stratagene, Germany). This was packaged using Epicentre's MaxPlax lambda Packaging Extracts (EPICENTRE, USA) and then infected with XL1-Blue MRF 'to prepare a cosmid library of M1021 strain. Clones of the prepared cosmid library were added to LB medium and glycerol (25% final concentration) and then 200µl of each was stored in the deep freezer (-70 ℃).

Experimental Example 2 Cosmid  Acquisition and analysis of toxin complex related clones from the library.

2.1 Preparation of Toxin Complex (tc) Related Primers.

Prior to obtaining cosmid clones with toxin complex (tc) from the cosmid library of P. temperata M1021 strain, two genomic data of photorhabdus luminescens W14 and TT01 strains with known genome sequences are shown in Table 1 Primers were prepared (Gennotek, Daejeon, Korea). The tccF1 and tccR1 primers were for the tcc locus in the toxin complex, and the TcdF2 and TcdR2 primers were prepared to identify the tcd locus, TcaC F3 and TcaC R3 primers for the tca locus. The prepared primers were subjected to PCR (FIG. 1) on genomic DNA of M1021 to confirm their presence. Each PCR product was purified using a PCR purification kit (solgent, Daejeon, Korea), and then sequence confirmation was performed. Commissioned by Solgent (Daejeon, Korea).

Oligonucleotide Relevant sequence (5 '→ 3') Tcc F1
Tcc R1
TcdF2
TcdR2
TcaC F3
TcaC R3 AARYTGCGTGAAGAGCAY
GTGCAATACCCTTACCTGTGC
ARGACCGTTTTTCCCGTTATGARTA
ATCACCGGATTGCACCACATC
AGCGCATTCAACTGCAACAAGATAT
CTATGGGGTTCTTGAYGCGGTATC

2.2 Acquiring a tc positioned clone from the genome cosmid clone of Photorabbitus temperata M1021.

PCR was performed under the conditions described above to obtain cosmid clones containing tcc , tcd , and tca from the cosmid library of the Photolaptus temperata M1021 strain (see FIG. 1), and PCR was performed stepwise through pooling and subpooling processes. Was carried out.

2.3 Plasmid Analysis of Positive Cosmid Clones.

Plasmids for the four cosmid clones (PtC 49, PtC 64, PtC 267, PtC 28) obtained by the PCR screening method were obtained using the alkaline lysis method (Birnboim and Doly, 1979) and inserted into each plasmid. Sequencing was performed using T3 and T7 primers in SuperCos1 to identify both ends of the prepared DNA (Gennote, Daejeon, Korea). In addition, each plasmid was analyzed by restriction enzyme patterns using restriction enzymes such as Not I, Bam HI, Hind III, EcoR I, Kpn I, and Pst I.

2.4 Investigation of the insecticide of positive cosmid clones.

Insecticidal test of the four cosmid clones obtained from the above was used beetle moth larvae (4-5 years old), each cosmid clone was incubated for 16 hours in 5 ml LB medium, followed by centrifugation ( 12,000rpm, 5min) to recover only the cell pellet was suspended in sterile saline solution and injected into the larval cavity of the larval body by using microsyringe 3 ㎕ each. As a control, the same amount of sterile LB broth and 0.85% NaCl solution was injected and stored in a 25 ° C. incubator, respectively.

2.5 Sequence and ORF Analysis of Positive Cosmid Plasmids.

In order to confirm the genetic information of each plasmid for tcd locus and tcc locus, sequencing of cosmid plasmid was commissioned by Genotech (Daejeon, Korea) .Sequencing of pS49 and pS28 was carried out using primer walking and shot gun. The analysis was carried out. The obtained DNA sequences were assembled using DNA star (DNASTAR, USA), and the completed contigs were opened using ORF finder of vector NTI program (Invitrogen, USA) and ORF finder of National Center for Biotechnology Information (NCBI). We confirmed the reading frame (ORF) configuration. Each ORF compared the homology between the nucleotide sequence and the amino acid sequence using BLAST of NCBI.

Experimental Example 3 Toxin Gene Cloning  And recombinant expression.]

3.1 Preparation of Toxin Protein Expression Vectors.

PET21a (+) was used as the expression vector of the toxin protein, and the primers (genotech, Daejeon, Korea) prepared for cloning each toxin gene are shown in Table 2. As shown in Table 2, the primer (C-ter 6His-tag / TEV primer) attached to the TEV sequence and the 6His tag sequence excluding the stop codon at the C-terminus and the C-terminus was finally attached for the purification of the toxin protein. Sal I or Hind III cassettes were prepared and used for restriction enzymes. PCR reaction was carried out as shown in Figure 1, the cloning process is as follows. PCR was performed using Pfu- X polymerase (Solgent, Daejeon, Korea) with each C primer which linked the TEV sequence to each N primer including start codon and C-terminal part except stop codon. PCR was performed using the C-ter 6His-tag / TEV primer and cassette primer in order to insert 6His tag, unique restriction enzyme and stop codon. As the PCR template, each cosmid plasmid and genomic DNA were used, and the polymerase was Pfu- X polymerase (Solgent, Daejeon, Korea) .The annealing temperature was 50-60 ℃ and the extension time was 1kb / min. The reaction cycle of conditions was repeated 30 times. The reaction product was confirmed by 0.8% agarose gel (w / v) and the PCR product was purified using a PCR purification kit (solgent, Daejeon, Korea). Each purified PCR product and pET21a (+) were digested with specific restriction enzymes attached to the ends of the PCR product, and then linked using T4 DNA ligase (Fermentas, Canada), followed by Escherichia. coli The recombinant plasmid was obtained by transformation with DH5α. The obtained recombinant plasmid was confirmed by sequencing (T3 and T7 primers).

Gene Oligonucleotide Relevant sequence (5 '→ 3') tcdB2 TcdB2-N
TcdB2-C
C-ter 6His-tag / TEV
SalI cassette GCG GGATCC ATGCAAAATTCACAAGAA
CTGAAAGTACAGGTTCTCCATTTTCACCTCAGCAGC
CGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
ACGC GTCGAC CGAATTCATTAGTGGTGG tccC3 TccC3-N
TccC3-C
C-ter 6His-tag / TEV
HindⅢ cassette CCTGCAG CATATG ATGGAAAACTTTGACCCC
CTGAAAGTACAGGTTCTCGCTATATCTATGTTTAGG
CGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
CGC AAGCTT CGAATTCATTAGTGGTGG tccA TccA-N
TccB-C
C-ter 6His-tag / TEV GGAATTC GCTAGC ATGAATCAACTCGCCAGT
CTGAAAGTACAGGTTCTCATGACTGCCCTTGACATG
C GAATTC ATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC tccB TccB-N
TccB-C
C-ter 6His-tag / TEV CCTG CAGCAT ATGATGTTATCGACAATGGAA
CTGAAAGTACAGGTTCTCAATAAGTGTTTTCTTGAC
C GAATTC ATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC tccC TccC-N
TccC-C
C-ter 6His-tag / TEV
HindⅢ cassette CCTGCAG CATATG AGTACGTCTGATACCA
CTGAAAGTACAGGTTCTCCAAAGAAATAACCCGTCG
CGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC
CGC AAGCTT CGAATTCATTAGTGGTGG tcaC TcaC-N
TcaC-C
C-ter 6His-tag / TEV GGAATTC GCTAGC ATGCAGGATTCATCAGAA
CTGAAAGTACAGGTTCTCTGGGGTTCTTGACGCGGT
CGAATTCATTAGTGGTGGTGGTGGTGGTGGCCCTGAAAGTACAGGTTCTC

3.2 Expression of Recombinant Toxin Protein.

The recombinant plasmids obtained above were expressed in E. coli for the expression of toxin proteins. Each was transformed to BL21 (DE3). The transformed Escherichia coli was grown overnight in 3 ml LB broth (Ap ^r , 100㎍ / ml) and inoculated 1% in 100 ml LB broth to raise the OD ₆₀₀ value to 0.8 at 37 ℃ shake incubator (220rpm), followed by IPTG (Isopropyl β-D-1-thiogalactopyranoside) was added to the final 1 mM and then recovered over time to observe the expression level. As a control, E. coli BL21 (DE3) / pET21a (+) was used. The expression of the recombinant protein was confirmed by SDS-PAGE. The supernatant was removed by centrifugation of the culture solution collected over time, and then suspended in a cell pellet with 1 × Laemmli loading dye, and the cells were disrupted by heating at 99 ° C. for 5 minutes. . The cell lysate was centrifuged (12,000 rpm, 10 min, 4 ° C.) to confirm the expression of the recombinant protein using the supernatant SDS-PAGE.

Experiments to confirm the active expression pattern of recombinant toxin protein were confirmed by changing the culture temperature, IPTG concentration and medium composition, IPTG concentration is 0.1mM, 0.5mM, 1mM, the culture temperature is 15 ℃, 25 ℃, 37 ℃ , The medium was tested using LB, 2 × YT, TB (Terrific broth), SB (Super broth), M9 Minimal medium (Table 3).

LB 2 × YT TB SB M9 Medium composition Tryptone 10 g
Yeast extract 5 g
10 g NaCl




per 1 liter Tryptone 12 g
Yeast extract 10 g
NaCl 5 g




per 1 liter Tryptone 12 g
Yeast extract 24 g
K ₂ HPO ₄ 12.54 g
KH ₂ PO ₄ 2.31 g
4 ml of Glycerol


per 1 liter Tryptone 32 g
Yeast extract 20 g
NaCl 5 g




per 1 liter Na ₂ HPO ₄ 7 H ₂ O 6 g
KH ₂ PO ₄ 3 g
0.5 g of NaCl
NH ₄ Cl 1 g
10 ml of 20% glucose
0.1 M CaCl2 1 ml
1 M MgSO4 1 ml
per 1 liter

Experimental Example 4 Using Escherichia Coli with Recombinant Protein Insecticidal  inspection.

Toxicity test for honeybee moth larvae was performed by centrifuging 2 ml of the culture medium at the time of maximum expression of the recombinant protein to remove the supernatant, washing the cell pellet twice with sterile 0.85% NaCl solution, and then 10 times the culture medium. Suspension was used to concentration. Cell suspensions were injected into the blood cavity of bee-lipped moth larvae using microsyringe (Hamilton, USA) at 10 μl each. The injected larvae were kept in a constant temperature room (25 ° C, 50% humidity) and observed for 24 hours. In addition, in order to check the cell concentration in the cell suspension was plated on LB agar plate containing empicillin and incubated in an incubator (37 ℃). As a control, a sterilized 0.85% NaCl solution and E. coli BL21 (DE3) / pET21a (+) were treated in the same manner as the above method.

Experimental Example 5 Results.

5.1. Cosmid library of Photorabbitus temperarat M1021 strain.

A genomic cosmid library of Photorabbitus temperata M1021 strain was prepared and a 7.14 × 105 cosmid clone was obtained. P. luminescens subsp. laumondii TT01 and P. asymbiotica subsp. Given that the total genome sizes of the asymbiotica ATCC43949 are 5.69 Mb and 5.06 Mb, respectively, the genome size of the Photolabus temperata M1021 strain belonging to the same family is expected to be between 5 and 6 Mb. Assuming that the total genome size of the Photolaptus temperata M1021 strain is about 5.6 Mb, and the genomic DNA fragment size of M1021 inserted into the cosmid vector is 40 kb, the ideal number of clones needed to contain 99.99% of the total genome is ( N) Substituting into the equation of FIG. 2, it appears as 1.28 × 10 ³ clones. Therefore, the number of 7.14 × 10 ⁵ cosmid clones obtained in this experiment was found to contain 99.99% or more of the entire genome of the Photorabbitus temperata M1021 strain. Plasmids of some cosmid clones were isolated from the cosmid library and digested with restriction enzymes. As a result, the size of the inserted DNA fragment was about 35-45 kb and the restriction enzymes showed different patterns.

5.2 Analysis of Toxin Complex-Related Clones from Cosmid Library.

5.2.1 Acquisition of tc positive clones.

PCR products were obtained by using the tcc, Tcd and Tca pair primers of Table 1 on genomic DNA of photolabus temperata M1021, and the respective PCR products were obtained through sequence analysis. Loyal toxin complex protein.

Prime sets PCR amplicon (kb) % nucleotide homology Compared strain (protein) tcc F1 / tcc R1 0.84 87 P. luminescens strain TT01 (TccC) TcdF2 / TcdR2 0.77 84 P. luminescens strain TT01 (TcdF2) TcaC F3 / TcaC R3 1.64 82/83 P. luminescens TT01
P. asymbiotica ATCC43949 (TcaC)

5.2.2 Plasmid Assay.

In order to confirm the genetic information on the plasmid, the entire sequencing operation was commissioned by Genotech, Daejeon, Korea, a genome analysis institute. The overall sequencing of pS49 and pS28 was performed through primer walking and shot gun analysis. . The sequences of DNA inserted into pS49 and pS28 were all secured through the above sequencing analysis, and the obtained DNA sequences were assembled using DNA star. The completed contigs were ORF finder of Vector NTI program (Invitrogen, USA). And the ORF finder of the National Center for Biotechnology Information (NCBI) to determine the open reading frame (ORF) configuration. Each ORF compared the homology between the nucleotide sequence and the amino acid sequence using BLAST of NCBI. The configuration of the ORFs in pS49 and pS28 is shown in FIG. 5, the homology to each of the ORF and the expected genes and functions are shown in Table 5. Comparing the composition of ORFs in pS49 with previously reported strains of P. luminescens W14 and TT01 and tcd islands of P. asymbiotica ATCC43949, the tcdA2, tcdB2 and tccC3 genes were transcribed in the same direction and also between tcdB2 and tccC3. tchA, which encodes a phage holin protein, was also present. No other copies of tcdA-like, tcdB-like, or tccC-like genes were identified in the sequence in pS49. Only the “core” region of the tcd locus (tcdA1-like, tcdA2, tcdB2 and tccC3) was identified. However, the tcdA1-like gene was found to be considerably smaller in size than the previously reported tcdA-like gene, and the gene encoding the hemolysins-related protein in the upstream direction of the tcdA1-like gene, ie, the insertion end of pS49. Appeared to contain some. The composition of the tcd island of photolapus temperata M1021 is similar to that of P. asymbiotica ATCC43949, which has fewer or one copies of the toxin gene than that of P. luminescens TT01, which has a large number of toxin genes. Multidrug transporter proteins and polyphosphatase proteins have been identified. Amino acid homology with previously reported pesticidal proteins was 66% for TcdA2, 81% for TcdB2, and 57% for TccC3 (Table 5). The difference was shown. In addition, in the case of the A, B, and C components of the toxin protein, the A component is tcdA2, the B component is tcdB2, and the C component is tccC3.

The pS28 containing tcc locus contained all of tccA, tccB and tccC, and it was shown to have a Type VI secretion system (T6SS) downstream of the toxin gene. Type VI secretion system is a type 6 secretion system that causes pathogenicity of microorganisms belonging to Proteobacteria. T6SS is known to be composed of several proteins such as Hcp and VgrG. This type of secretion system is known to be highly related to toxin proteins of pathogenic microorganisms and various virulence factors, and this type of secretion system was also found in the photoccus temperata M1021 strain tcc locus (Fig. 5). ). Amino acid homology with the pesticidal protein was 89% for TccA, 90% for TccB and TccC, and it was found to have an A component, tccB (Table 5).

No. Predicted product Homology
(%) Organism pS49 One insecticidal toxin, TcdA like 73 P. asymbiotica ATCC43949 2 insecticidal toxin, TcdA2 66 P. luminescens TT01 3 insecticidal toxin, TcdB2 81 P. luminescens TT01 4 insecticidal toxin, TccC3 70 P. luminescens TT01 5 peptide synthetase 87 P. luminescens TT01 6 thiothemplate mechanism natural product synthetase 58 Erwinia amylovora ATCC BAA-2158 7 polyketide synthase type I 46 E. amylovora ATCC49946 8 gramicidin S synthetase 2 45 E. amylovora ATCC BAA-2158 9 폴리켓이드 synthase 38 E. amylovora ATCC BAA-2158 10 peptide synthetase 86 P. luminescens TT01 11 심포치 87 P. luminescens TT01 12 5'-nucleotidase family protein 86 P. asymbiotica ATCC43949 pS28 One insecticidal toxin, TccA 89 P. luminescens TT01 2 insecticidal toxin, TccB 90 P. luminescens TT01 3 insecticidal toxin, TccC 90 P. luminescens TT01

5.2.3 Results of insecticidal experiments.

The insecticidal investigation result of the positive cosmid clone obtained above is as follows (FIG. 6). As shown in FIG. 6, PtC28 clone had the highest insecticidal effect and was 100% killed at 7 days after injection. PtC49 showed 50% insecticidal at 6 days after injection, while PtC 64 and 267 clones reached 50% at 7 days after injection. In this experiment, the larval beetle larvae injected with XL-1 Blue MRF 'containing only sterile saline (0.85% NaCl) and the cosmid vector SuperCos1 showed no change in appearance.

5.3 Toxin Gene Cloning and Recombinant Expression Results.

The nine toxin complex ( tc ) -related genes so far acquired are E. coli As a result of expression in BL21 (DE3), most of the toxin proteins except TcdA-like were induced only by isopropyl-β-D-thiogalactoside (IPTG), and the expected protein size was confirmed by SDS-PAGE (FIG. 7). ). Most of the toxin proteins were effectively overexpressed, and the expression patterns were observed by changing the temperature, IPTG concentration and media conditions. The expression temperature of TccB and TcdB2 was found to be most suitable at 30 ° C and TccC3 at 37 ° C. The concentration of IPTG was 0.5-1 mM, and the medium was SB (Super broth).

5.4 Insecticidal Testing

Recombinant Escherichia coli with the highest expression of each toxin protein was injected into the larvae of honey bee moths. It appeared to die. In addition, TccC3 showed 62.5% insecticidal at 7 days after injection and 57.5% at 6 days after injection, but other toxin proteins showed very low insecticides with less than 20% (Fig. 8). Brown larvae showed the highest insecticidal activity in TccB-expressing Escherichia coli, and all larvae were killed at 5 days after injection. In addition, even when the injection concentration was reduced by 50%, it showed high insecticidality of 80%. In the case of TccC3 57.5%, TcdB2 showed a 35% insecticide (Fig. 9). The amount of cells injected into the larvae was 2.7 × 10 ⁴ cells for TccB, 1.4 × 10 ⁵ cells for TccC3, and 3.7 × 10 ⁴ cells for TcdB2, and 3.6 × 104 for E. coli containing pET21a (+). cells. In the case of honeybee moth larvae injected with sterile 0.85% NaCl or E. coli BL21 (DE3) / pET21a (+), 90% of the larvae develop into pupae after 7 days of injection. The steps were shown to proceed. However, the recombinant Escherichia coli other than the four toxin proteins that exhibited insecticidal properties did not show insecticidality but did not progress to pupa, so it is thought to be involved in larval development rather than direct insecticidal activity. Injecting E. coli BL21 (DE3) / pETccB with high insecticidal properties to both larvae showed melaninization as shown in FIG. 10.

Agricultural Biotechnology Research Institute KACC91627P 20110104

Attach an electronic file to a sequence list

Claims (24)

For honeybee moth ( Galleria mellonella ) or brown mealworm (Tenebrio molitor Linnaeus) containing an insecticidal protein consisting of the amino acid sequence of SEQ ID NO. Control composition.


delete delete delete delete delete delete delete delete delete delete Method for controlling honeybee moth ( Galleria mellonella ) or brown meal (Tenebrio molitor Linnaeus), characterized in that using the composition for control of claim 1.








delete delete delete delete delete delete delete delete delete delete delete delete

Images