WO2012167145A2 - Genome-scale analysis of aberrant dna methylation in colorectal cancer - Google Patents
Genome-scale analysis of aberrant dna methylation in colorectal cancer Download PDFInfo
- Publication number
- WO2012167145A2 WO2012167145A2 PCT/US2012/040547 US2012040547W WO2012167145A2 WO 2012167145 A2 WO2012167145 A2 WO 2012167145A2 US 2012040547 W US2012040547 W US 2012040547W WO 2012167145 A2 WO2012167145 A2 WO 2012167145A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cimp
- cpg
- gene
- seq
- promoter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- aspects of the present invention relate generally to colorectal cancer (CRC), and more particularly to methods and compositions (e.g., gene marker panels) for at least one of diagnosis, identification and classification of CRC. Further aspects relate to marker identification based on a comprehensive genome-scale analysis of aberrant DNA methylation and/or gene expression in CRC. Particular aspects relate to identification and/or classification of colorectal tumors, corresponding to distinctive DNA methylation-based subgroups of CRC including CpG island methylator phenotype (CIMP) groups and non-CIMP groups. Further aspects related to correlations of genetic mutation, and other epigenetic markers with said CRC subgroups for at least one of diagnosis, identification and classification of CRC including CIMP groups and non- CIMP groups.
- CCPCI colorectal cancer
- CRC Colorectal cancer
- PcG target genes are characterized by trimethylation of histone H3 lysine 27 (H3K27me3), are maintained at a low expression state and are poised to be activated during development (Bernstein et al., 2007).
- H3K27me3 genes targeted by H3K27me3 in normal tissues acquire DNA methylation and lose the H3K27me3 mark in cancer (Gal-Yam et al, 2008; Rodriguez et al, 2008).
- epigenetic switching of H3K27me3 and DNA methylation mainly occurs at genes that are not expressed in normal tissues.
- cancer-specific H3K27me3 -mediated gene silencing has also been shown to inactivate tumor suppressor genes independent of DNA hypermethylation in CRC (Jiang et al, 2008; Kondo et al, 2008).
- CIMP CpG island methylator phenotype
- BRAF BRAF
- CRCs with CIN and CIMP have been shown to be inversely correlated (Goel et al, 2007; Cheng et al, 2008) and appear to develop in two separate pathways (Leggett and Whitehall, 2010).
- DN hypermethylation of some CIMP-associated gene promoters have been detected in early stagi of in colorectal tumorigenesis (Ibrahim et al., 2011).
- an extensive promoter DN hypermethylation has been observed in the histologically normal colonic mucosa of patien predisposed to multiple serrated polyps, the proposed precursors of CIMP tumors (Young ar Jass, 2006).
- CIMP-associated DNA hypermethylation of MLH1 is the dominant mechanism for the development of sporadic CRC with microsatellite instability (MSI) (Weisenberger et al, 2006).
- MSI microsatellite instability
- the CIMP-specific inactivation of IGFBP7-mediatQd senescence and apoptosis pathways may provide a permissive environment for the acquisition of BRAF mutations in CIMP -positive tumors (Hinoue et al., 2009; Suzuki et al., 2010).
- CIMP-L CIMP-low tumors were originally shown to exhibit DNA hypermethylation of a reduced number of CIMP-defining loci (Ogino et al., 2006). CIMP-L was significantly associated with KRAS mutations, was observed more commonly in men than women and appeared to be independent of MSI status. Shen and colleagues described the CIMP2 subgroup, which also showed DNA hypermethylation of CIMP-associated loci, but was highly correlated (92%) to KRAS mutations and not associated with MSI (Shen et al., 2007). A recent report from Yagi, et al. reported the intermediate- methylation epigenotype (IME), which was also associated with KRAS mutations (Yagi et al., 2010).
- IME intermediate- methylation epigenotype
- DNA methylation subgroups were identified and characterized in CRC by performing comprehensive, genome-scale DNA methylation profiling of 125 primary colorectal tumors and 29 adjacent non-tumor colonic mucosa samples using the Illumina Infinium DNA methylation assay.
- Applicants developed diagnostic DNA methylation gene marker panels to identify CIMP (CIMP-H and CIMP-L), as well as to segregate CIMP-H tumors fro CIMP-L tumors based on the Infinium DNA methylation data (FIGURE 5).
- a CIMP-defining marker panel consisting of B3GAT2, FOXL KCNK13, RAB31 and SLIT1 was identified. Using the conditions that DNA methylation ⁇ three or more markers qualifies a sample as CIMP, this panel identifies CIMP-H and CIMP- tumors with 100% sensitivity and 95.6% specificity with 2.4% misclassification using a ⁇ -value threshold of > 0.1.
- a second marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 specifically identifies CIMP-H tumors with 100% sensitivity and 100% specificity (0% misclassification) using conditions that three or more markers show DNA methylation ⁇ -value threshold of > 0.1.
- a tumor sample is classified as CIMP-H if both marker panels are positive (three or more markers with DNA methylation for each panel).
- a tumor sample is classified as CIMP-L if the CIMP-defining marker panel is positive while the CIMP-H specific panel is negative (0-2 genes methylated).
- Preferred exemplary embodiments provide methods for at least one of diagnosing, detecting and classifying a colorectal cancer belonging to a distinct colorectal cancer (CRC) subgroup having frequent CpG island hypermethylation (CIMP CRC), comprising: determining, by analyzing a human subject biological sample comprising colorectal cancer (CRC) cell genomic DNA using a suitable assay, a CpG methylation status of at least one CpG dinucleotide from each gene of the gene marker panel of B3GAT2, FOXL2, KCNK13, RAB31 and SLIT1(C1MP marker panel); wherein CpG hypermethylation, relative to normal control values, of at least three genes of the CIMP marker gene panel is indicative of a frequent CpG island hypermethylation colorectal cancer subgroup (CIMP CRC), and wherein a method of at least one of diagnosing, detecting and/or classifying a colorectal cancer belonging to the distinct colorectal cancer (CRC) subgroup
- the CpG island hypermethylation colorectal cancer comprises both CIMP-H and CIMP-L subgroups of CIMP.
- CIMP-H and CIMP-L tumors are identified with about 100% sensitivity and about 95.6% specificity with about 2.4% misclassification using conditions that three or more markers show DNA methylation ⁇ -value threshold of > 0.1. as defined herein.
- determining a CpG methylation status of at least one CpG dinucleotide fro ⁇ each gene of the gene marker panel of B3GAT2, FOXL2, KCNK13, RAB31 and SLIT1 comprises determining a CpG methylation status of at least one CpG dinucleotic from each of: at least one of SEQ ID NOS:45, 46 and 278 (B3GAT2 promoter, CpG island ai amplicon, respectively); at least one of SEQ ID NOS:40, 41 and 240 (FOXL2 promoter, Cp island and amplicon, respectively); at least one of SEQ ID NOS:25, 26 and 224 (KCNKi promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:35, 36 and 236 (RAB31 promoter, CpG island and amplicon, respectively); and at least one of SEQ ID NOS:30, 31,
- Additional aspects further comprise determining, by analyzing the human subject biological using a suitable assay, a CpG methylation status of at least one CpG dinucleotide from each gene of an additional gene marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 (CIMP-H marker panel), wherein a CIMP-L subgroup of CIMP is indicated where the CIMP- defining marker panel is positive (hypermethylation of at least three genes of the CIMP marker gene panel) while the CIMP-H marker panel is negative (hypermethylation of only 0-2 genes of the CIMP-H marker gene panel), and wherein a CIMP-H subgroup of CIMP is indicated where both the CIMP-defining marker panel and the CIMP-H marker panel are positive (hypermethylation of at least three genes of each marker gene panel).
- the methods further comprise determination of at least one of KRAS, BRAF and TP53 mutant status.
- the BRAF mutation status comprises mutation status at codon 600 in exon 15 (e.g., BRAFV600E), wherein the the KRAS mutation status comprises mutation status at codon 12 and/or 13 in exon 2, and wherein the TP 53 mutation status comprises mutation status at exons 4 through 8.
- a positive mutation status comprises at least one of missense mutations, nonsense mutations, splice-site mutations, frame-shift mutations, and in- frame deletions.
- Yet additional aspects further comprise determing a MLH1 gene methylation status, wherein MLH1 hypermethylation is strongly associated with CIMP-H CRC.
- determining a CpG methylation status of at least one CpG dinucleotide from each gene of the gene marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 comprises determining a CpG methylation status of at least one CpG dinucleotide from each of: at least one of SEQ ID NOS:50, 51 and 247 (FAM78A promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:65, 66, 259, 263 and 265 (FSTL1 promoter, CpG island and amplicons, respectively); at least one of SEQ ID NOS:60, 61 and 255 (KCNC1 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:55, 56 and 251 (MYOCD promoter, CpG island and amplicon, respectively); and at least one
- determinir methylation status comprises treating the genomic DNA, or a fragment thereof, with one ⁇ more reagents (e.g., bisulfite, hydrogen sulfite, disulfite, and combinations thereof) to conve cytosine bases that are unmethylated in the 5 -position thereof to uracil or to another base that detectably dissimilar to cytosine in terms of hybridization properties.
- one ⁇ more reagents e.g., bisulfite, hydrogen sulfite, disulfite, and combinations thereof
- Yet further aspects provide methods for at least one of diagnosing, detecting and classifying a colorectal cancer belonging to a distinct colorectal cancer (CRC) subgroup having frequent CpG island hypermethylation (CIMP CRC), comprising: determining, by analyzing a human subject biological sample comprising colorectal cancer (CRC) cell genomic DNA using a suitable assay, a CpG methylation status of at least one CpG dinucleotide from each gene of the gene marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 (CIMP-H marker panel); wherein CpG hypermethylation, relative to normal control values, of at least three genes of the CIMP-H marker gene panel is indicative of a CIMP-H subgroup of CIMP CRC, and wherein a method of at least one of diagnosing, detecting and classifying a colorectal cancer belonging to the CIMP-H subgroup of CIMP CRC is afforded.
- CRC colorectal
- CIMP-H tumors are identified with about 100% sensitivity and about 100% specificity (about 0%> misclassification) using conditions that three or more markers show DNA methylation ⁇ -value threshold of > 0.1. as defined herein.
- the BRAF mutation status comprises mutation status at codon 600 in exon 15 (e.g., BRAFV600E), wherein the the KRAS mutation status comprises mutation status at codon 12 and/or 13 in exon 2, and wherein the TP 53 mutation status comprises mutation status at exons 4 through 8.
- a positive mutation comprises at least one of missense mutations, nonsense mutations, splice-site mutations, frame-shift mutations, and in-frame deletions. Certain aspects further comprise determing a MLH1 gene methylation status, wherein MLH1 hypermethylation is strongly associated with CIMP-H CRC.
- determining a CpG methylation status of at least one CpG dinucleotide from each gene of the gene marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 comprises determining a CpG methylation status of at least one CpG dinucleotide from each of: at least one of SEQ ID NOS:50, 51 and 247 (FAM78A promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:65, 66, 259, 263 and 265 (FSTL1 promoter, CpG island and amplicons, respectively); at least one of SEQ ID NOS:60, 61 and 255 (KCNC1 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:55, 56 and 251 (MYOCD promoter, CpG island and amplicon, respectively); and at least one of
- kits for performing the methods comprising, for each gene of of the gene marker panel oiB3GAT2, FOXL2, KCNK13, RAB31 and SLIT1, at least two oligonucleotides whose sequences in each case are identical, are complementary, or hybridize under stringent or highly stringent conditions to the respective marker gene; and optionally comprising a bisulfite reagent (e.g., bisulfite, hydrogen sulfite, disulfite, and combinations thereof).
- a bisulfite reagent e.g., bisulfite, hydrogen sulfite, disulfite, and combinations thereof.
- the respective marker gene sequences comprise at least one sequence from each of: at least one of SEQ ID NOS:45, 46 and 278 (B3GAT2 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:40, 41 and 240 (FOXL2 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:25, 26 and 224 (KCNK13 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:35, 36 and 236 (RAB31 promoter, CpG island and amplicon, respectively); and at least one of SEQ ID NOS:30, 31, 228 and 232 (SLIT1 promoter, CpG island and amplicons, respectively), respectively.
- kits suitable for performing the method comprising, for each gene of of the gene marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4, at least two oligonucleotides whose sequences in each case are identical, are complementary, or hybridize under stringent or highly stringent conditions to the respective marker gene; and optionally comprising a bisulfite reagent (e.g., bisulfite, hydrogen sulfite, disulfite, and combinations thereof).
- a bisulfite reagent e.g., bisulfite, hydrogen sulfite, disulfite, and combinations thereof.
- the respective marker gene sequences comprise at least one sequence from each of: at least one of SEQ ID NOS:50, 51 and 247 (FAM78A promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:65, 66, 259, 263 and 265 (FSTL1 promoter, CpG island and amplicons, respectively); at least one of SEQ ID NOS:60, 61 and 255 (KCNC1 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:55, 56 and 251 (MYOCD promoter, CpG island and amplicon, respectively); and at least one of SEQ ID NOS:70, 71, and 269 (SLC6A4 promoter, CpG island and amplicons, respectively), respectively.
- Figure 1 shows, according to particular exemplary aspects, RPMM-based classification and heatmap representation of 1 25 colorectal tumor samples using Infinium DNA methylation data.
- DNA methylation profiles of 1 ,401 probes with most variable DNA methylation values (standard deviation >0.20) in the 125 colorectal tumor sample set are shown.
- the DNA methylation ⁇ -values are represented by using a color scale from dark blue (low DNA methylation) to yellow (high DNA methylation, which is herein reproduced in gray-scale).
- Probes that are located within CpG islands are indicated by the horizontal black bars to the right of the heatmap.
- the probes are arranged based on the order of unsupervised hierarchal cluster analysis using a correlation distance metric and average linkage method.
- Pie charts below the heatmap show the proportion of tumor samples harboring BRAF mutations (blue), KRAS mutations (red), and those wild-type for both BRAF and KRAS (yellow-green), herein reproduced in grey-scale within each subgroup.
- Figures 2A-C show, according to particular exemplary aspects, DNA methylation characteristics associated with CIMP-H, CIMP-L, BRAF- and KRAS-mutant colorectal tumors.
- the foi DNA methylation-based subgroups are indicated above the heatmaps.
- a color gradient fro dark blue to yellow, herein reproduced in gray-scale was used to represent the low and hi ⁇ DNA methylation ⁇ -values, respectively.
- -1 is multiplied to logio(FDR-adjusted -value), providing positive values.
- FIGS 3A-D show, according to particular exemplary aspects and herein reproduced in gray-scale, that CIMP-L-associated DNA hypermethylation occurs independent of KRAS mutation status in CRC.
- CIMP-L and non-CIMP tumors were subdivided by their KRAS and BRAF mutation status (KRAS mutant or BRAF/KRAS wild-type), and mean DNA methylation ⁇ - values were compared between each group.
- Figure 4 shows, according to particular exemplary aspects and herein reproduced in gray-scale, ES-cell histone marks associated with genes in the five classification groups described in the text. Shown are heatmap representations of DNA methylation ⁇ -values for unique gene promoters that belong to five different categories: 1.
- Genes containing CpG islands defined by Takai and Jones are indicated by horizontal black bars immediately to the right of each heatmap.
- the bar charts to the right of each heatmap show the proportion r gene promoters with occupancy of histone H3 lysine 4 trimethylation (K4) and/or histone F lysine 27 trimethylation (K27) in human ES cells. Probes that do not have these histone mai information (listed in Table 5 as "NA") were not included in the bar chart calculations.
- Tl probes in each category are ordered according to the unsupervised hierarchal clustering usir correlation distance metric and average linkage method. The RPMM-based cluster assignments are indicated above the heatmaps.
- Figure 5 shows, according to particular exemplary aspects, diagnostic CIMP-defining gene marker panels based on the Infinium DNA methylation data.
- the Dichotomous heat map of the Infinium DNA methylation data is shown. Black bars indicate DNA methylation ⁇ -value > 0.1 , and white bars indicate DNA methylation ⁇ -value ⁇ 0.1.
- the panel of five markers shown on the top (CIMP-H & CIMP-L) is used to identify CIMP-H and CIMP-L tumors.
- the panel of five markers shown on the bottom (CIMP-H specific) is used to specifically identify CIMP-H tumors.
- Figures 6A-C show, according to particular exemplary aspects, an integrated analysis of gene expression and promoter DNA methylation changes between colorectal tumors and matched normal adjacent tissues.
- Figures 7A-D show, according to particular exemplary aspects and herein reproduced in gray-scale,
- A Delta area plot showing the relative change in area under the consensus cumulative distribution function (CDF) curve (Monti et al., 2003).
- Q The heatmap representation of 125 colorectal tumor samples using the Infinium DNA methylation data as shown in Figure 1. Cluster membership of each sample derived from RPMM-based clustering and consensus clustering are indicated as vertical bars with distinct colors above the heatmap (herein shown in gray-scale).
- D Contingency table comparing the cluster membership assignments between the two differe ⁇ clustering methods.
- Figures 8A-B show, according to particular exemplary aspects, histogram analysis of tl number of methylated CIMP-defining MethyLight-based markers in colorectal cancer sample
- A Histogram analysis of the number of CIMP loci methylated in all 125 colorectal tumi samples.
- B Histogram analysis of the number of CIMP-defining loci methylated in each RPMM-based tumor cluster membership.
- Figure 9 shows, according to particular exemplary aspects, scatter plot analyses comparing DNA methylation profiles of colorectal tumor and adjacent-normal samples, stratified by their RPMM-based cluster membership.
- Figures 10A-B show, according to particular exemplary aspects, a comparison of DNA methylation profiles between CIMP-H and CIMP-L tumors.
- A The volcano plot shows the -1 x logio-transformed FDR-adjusted P value vs. the mean DNA methylation difference between CIMP-H and CIMP-L tumors.
- FDR-adjusted P 0.001 and
- 0.2 are used as a cutoff for differential methylation.
- Two CpG sites that are hypermethylated in CIMP-L tumors compared with CIMP-H tumors are indicated in green, herein reproduced in gray-sclae.
- the four DNA methylation-based subgroups are indicated above the heatmap.
- a color gradient from dark blue to yellow, herein reproduced in gray-scale was used to represent the low and high DNA methylation ⁇ -values, respectively.
- Figures 1 1A-E show, according to particular exemplary aspects, DNA structural and sequence characteristics associated with five different gene categories based on DNA methylation profiles in colorectal tumors.
- the five categories include: 1 , CIMP-associated DNA methylation markers specific for the CIMP-H subgroup only; 2, CIMP-specific DNA methylation shared between both the CIMP-H and CIMP-L subgroups; 3, non-CIMP cancer- specific DNA methylation; 4, constitutively unmethylated across tumor and adjacent normal tissue samples; 5, constitutively methylated across tumor and adjacent normal tissue samples.
- Figures 12A-D show, according to particular exemplary aspects, validation of tl Infinium DNA methylation data and gene expression array data using MethyLight ar quantitative RT-PCR (qRT-PCR), respectively.
- the validations were performed for three gem indicated above each scatter plot ⁇ A) Comparison of Infinium DNA methylation ⁇ -value (x-axi and log2-transformed gene expression value from Illumina expression array (y-axis).
- the x-axis represents Infinium DNA methylation ⁇ -value and the y-axis represents PMR value from MethyLight assay.
- gene' refers to the respective genomic DNA sequence, including any promoter and regulatory sequences of the gene (e.g., enhancers and other gene sequences involved in regulating expression of the gene), and in particular embodiments, portions of said gene.
- a gene sequence may be an expressed sequence (e.g., expressed RNA, mRNA, cDNA).
- the term “gene” shall be taken to include all transcript variants thereof (e.g., the term “B3GAT2" shall include for example its transcripts and any truncated transcript, etc) and all promoter and regulatory elements thereof.
- SNPs are known within genes the term shall be taken to include all sequence variants thereof.
- promoter refers to the respective contiguous gene DNA sequence extending from 1.5kb upstream to 1.5kb downstream relative to the transcription start site (TSS), or contiguous portions thereof.
- promoter refers to the respective contiguous gene DNA sequence extending fro
- promoter 1.5kb upstream to 0.5kb downstream relative to the TSS.
- gene promoter refers to the respective contiguous gene DNA sequence extending from 1.51 upstream to the downstream edge of a CpG island that overlaps with the region from 1.51 upstream to 1.5kb downstream from TSS (and is such cases, my thus extend even further beyor
- any CpG dinulcleotide of the particular recited gene that is coordinately methylated with the "promoter” or “gene promoter” of said recited gene has substantial diagnostic/classification utility as disclosed herein, as one of ordinary skill in the art could readily practice the disclosed invention using any such coordinately methylated CpG dinucleotide sequences.
- a "CpG” island refers to the NCBI relaxed definition defined bioinformatically as DNA sequences (200 based window) with a GC base composition greater than 50% and a CpG observed/expected ratio [o/e] of more than 0.6 (Takai & Jones Proc. Natl Acad. Sci. USA 99:3740-3745, 2002; Takai & Jones In Silico Biol.
- CpG island refers to the more strick definition (Id).
- “Stringent hybridisation conditions,” as defined herein, involve hybridising at 68°C in 5x SSC/5x Denhardfs solution/1.0% SDS, and washing in 0.2x SSC/O.l % SDS at room temperature, or involve the art-recognized equivalent thereof (e.g., conditions in which a hybridisation is carried out at 60°C in 2.5 x SSC buffer, followed by several washing steps at 37°C in a low buffer concentration, and remains stable).
- Moderately stringent conditions as defined herein, involve including washing in 3x SSC at 42°C, or the art-recognized equivalent thereof.
- the parameters of salt concentration and temperature can be varied to achieve the optimal level of identity between the probe and the target nucleic acid.
- methylation state refers to the presence or absence of 5-methylcytosine ("5-mCyt") at one or a plurality of CpG dinucleotides within a DNA sequence.
- Methylation states at one or more particular CpG methylation sites (each having two CpG dinucleotide sequences) within a DNA sequence include "unmethylated,” “fully-methylatec 1 " and "hemi-methylated.”
- hemi-methylation or “hemimethylation” refers to the methylation state of double stranded DNA wherein only one strand thereof is methylated.
- hypomethylation refers to the average methylation state corresponding to increased presence of 5-mCyt at one or a plurality of CpG dinucleotides within a DNA sequen ⁇ of a test DNA sample, relative to the amount of 5-mCyt found at corresponding CpG dinucleotides within a normal control DNA sample.
- hypomethylation refers to the average methylation state corresponding to a decreased presence of 5-mCyt at one or a plurality of CpG dinucleotides within a DNA sequence of a test DNA sample, relative to the amount of 5-mCyt found at corresponding CpG dinucleotides within a normal control DNA sample.
- bisulfite reagent refers to a reagent comprising bisulfite, disulfite, hydrogen sulfite or combinations thereof, useful as disclosed herein to distinguish between methylated and unmethylated CpG dinucleotide sequences.
- Methods refers to any assay for determining the methylation state of one or more CpG dinucleotide sequences within a sequence of DNA.
- MS.AP-PCR Methods of PCR (Methylation-Sensitive Arbitrarily-Primed Polymerase Chain Reaction) refers to the art-recognized technology that allows for a global scan of the genome using CG-rich primers to focus on the regions most likely to contain CpG dinucleotides, and described by Gonzalgo et al, Cancer Research 57:594-599, 1997.
- Methods of Methods of the art-recognized fluorescence-based real-time PCR technique described by Eads et al, Cancer Res. 59:2302-2306, 1999.
- HeavyMethylTM assay in the embodiment thereof implemented herein, refers to an assay, wherein methylation specific blocking probes (also referred to herein as blockers) covering CpG positions between, or covered by the amplification primers enable methylation- specific selective amplification of a nucleic acid sample.
- methylation specific blocking probes also referred to herein as blockers
- HeavyMethylTM MethyLightTM assay in the embodiment thereof implemented herein, refers to a HeavyMethylTM MethyLightTM assay, which is a variation of the MethyLightTM assay, wherein the MethyLightTM assay is combined with methylation specific blocking probes covering CpG positions between the amplification primers.
- Ms-SNuPE Metal-sensitive Single Nucleotide Primer Extension
- MSP Metal-specific PCR
- COBRA Combin Bisulfite Restriction Analysis
- MCA Metal CpG Island Amplification
- CRC Colorectal cancer
- Colorectal cancer is a heterogeneous disease in which unique subtypes are characterized by distinct genetic and epigenetic alterations.
- Comprehensive genome-scale DNA methylation profiling of 125 colorectal tumors and 29 adjacent normal tissues was performed, and four DNA methylation-based subgroups of CRC were identified using model-based cluster analyses. Each subtype shows characteristic genetic and clinical features, indicating that they represent biologically distinct subgroups.
- CIMP-high (CIMP-H) subgroup which exhibits an exceptionally high frequency of cancer-specific DNA hypermethylation, is strongly associated with MLH1 DNA hypermethylation and the BRAFV600E mutation.
- a CIMP-low (CIMP-L) subgroup is enriched for KRAS mutations and characterized by DNA hypermethylation of a subset of CIMP-H associated markers rather than a unique group of CpG islands.
- non-CIMP tumors are separated into two distinct clusters.
- One non- CIMP subgroup is distinguished by a significantly higher frequency of TP53 mutations and frequent occurrence in the distal colon, while the tumors that belong to the fourth group exhibit a low frequency of both cancer-specific DNA hypermethylation and gene mutations, and are significantly enriched for rectal tumors.
- 112 genes were identified that were downregulated more than 2- fold in CIMP-H tumors together with promoter DNA hypermethylation. These represent approximately 7% of genes that acquired promoter DNA methylation in CIMP-H tumors. Intriguingly, 48/112 genes were also transcriptionally silent in non-CIMP subgroups, but this was not attributable to promoter DNA hypermethylation.
- CRC can be classified based on various molecular features. Identification ar characterization of these subtypes has been not only essential to better understand the disea; (Jass, 2007), but also valuable in selection of optimal drug treatments, prediction of patie survival, and discovery of risk factors linked to a particular subtype (Walther et al, 200 Limsui et al., 2010). The Illumina Infmium DNA methylation assay was used herein investigate DNA methylation-based subgroups in CRC.
- This BeadArray platform interrogates the gene promoter DNA methylation of all 14,495 consensus coding DNA sequence (CCDS) genes in multiple samples simultaneously and is therefore suitable for a study requiring large- scale promoter DNA methylation profiling of a large number of samples (Bibikova, 2009).
- CCDS consensus coding DNA sequence
- CIMP-H contained all of the CIMP -positive tumors characterized by the MethyLight five-marker panel (i.e., CACNA1G, IGF2, NEUROG1, RUNX3, SOCS1)) previously developed in Applicants' laboratory (Weisenberger et al, 2006) (see also FIGURE 1 herein).
- CIMP-H subgroup we described here are in agreement with those observed in the CIMP1 subtype (Shen et al., 2007) and the high- methylation epigenotype (HME) (Yagi et al, 2010) described previously.
- the instant results provide new diagnostic DN methylation marker panels to identify CIMP (CIMP-H and CIMP-L), as well as to segrega CIMP-H tumors from CIMP-L tumors (see EXAMPLE 6, and FIGURE 5 herein).
- Figure 5 shows, according to particular exemplary aspects, diagnostic CIMP-definii gene marker panels based on the Infinium DNA methylation data.
- the Dichotomous heat m of the Infinium DNA methylation data is shown. Black bars indicate DNA methylation ⁇ -value > 0.1 , and white bars indicate DNA methylation ⁇ -value ⁇ 0.1.
- the panel of five markers shown on the top (CIMP-H & CIMP-L) is used to identify CIMP-H and CIMP-L tumors.
- the panel of five markers shown on the bottom (CIMP-H specific) is used to specifically identify CIMP-H tumors.
- KRAS mutations are enriched in CIMP-L tumors, this subtype may not be driven by KRAS mutations, since DNA hypermethylation profiles in KRAS wild-type and mutant tumors within CIMP-L tumors were highly correlated across the CpG sites we examined.
- the independence of KRAS mutations from CIMP-L status suggests that a more complex molecular signature exists in driving CIMP-L DNA methylation profiles.
- BRAF mutations might be favorably selected in the specific environment that CIMP creates (Hinoue et al., 2009; Suzuki et al., 2010). Similar mechanisms may also result in the enrichment of KRAS mutations in the CIMP-L subgroup.
- Applicants also obtained gene expression profiles in pairs of CIMP- H and non-CIMP tumor-normal adjacent tissues to gain insight into the role of CIMP-specific DNA hypermethylation in colorectal tumorigenesis.
- Aberrant DNA methylation of promoter CpG islands has been established as an important mechanism that inactivates tumor suppressor genes in cancer (Jones and Baylin, 2007).
- cancer-specific CpG island hypermethylation events are also found in promoter regions of genes that are not normally expressed, and these may represent "passenger” events that do not have functional consequences (Widschwendter et al, 2007; Gal- Yam et al, 2008).
- 112 genes were identified herein that showed both promoter DNA hypermethylation and reduction in gene expression in CIMP-H tumors (see EXAMPLE 7, and FIGURES 6A-C herein).
- 12 of these genes were found to also show DNA hypermethylation with concomitant reduction in gene expression level in non-CIMP tumors, indicating that aberrant DNA methylation and transcriptional silencing of these genes may be important in the development of CRC, irrespective of molecular subtype.
- ther ⁇ include SFRP1 and SFRP2, which function as negative regulators of Wnt signaling.
- DN hypermethylation of SFRP genes has been observed in the majority of aberrant crypt fo (ACFs) and tumorigenesis (Baylin and Ohm, 2006). DNA hypermethylation and transcription silencing of other genes such as TMEFF2 and SLIT3 have also been reported (Young et a 2001; Dickinson et al., 2004). However, the functional significance of the inactivation of these genes has not been established in CRC.
- CIMP status in CRC has been found to be inversely correlated with the occurrence of chromosomal instability (CIN), which is characterized by aneuploidy, gain and loss of subchromosomal genomic regions and high frequencies of loss of heterozygosity (LOH) (Goel et al, 2007; Cheng et al, 2008). Recently, Chan and colleagues identified genes that are inactivated by both genetic mechanisms (mutation or deletion) and DNA hypermethylation in breast and colorectal cancer (Chan et al., 2008).
- CIN chromosomal instability
- LH loss of heterozygosity
- CIMP arises through a distinct pathway originating in a variant of hyperplastic polyps and sessile serrated adenomas due to the similar histological and molecular features shared by the CIMP tumors and these lesions (O'Brien, 2007).
- Some individuals and families with hyperplastic polyposis syndrome have an increased risk of developing CIMP CRC, indicating the existence of a genetic predisposition that could lead to CIMP (Young et al, 2007).
- Environmental exposures might also influence the risk of developing CIMP CRC. Cigarette smoking was found to be associated with increased risk of developing CIMP CRC in a recent report (Limsui et al, 2010)
- BRAF NM 004333.4; GL 187608632 mutations at codon 600 in exon 15
- KRAS NG 007524.1; GI: 17686616 mutations at codons 12 and 13 in exon 2 were identified using the pyrosequencing assay.
- a 224 bp fragment of the BRAF gene containing exon 15 was amplified from genomic DNA using the following primers: 5' TCA TAA TGC TTG CTC TGA TAG GA 3' (SEQ ID NO: l) and 5'Biotin-GGC CAA AAA TTT AAT CAG TGG A 3 '(SEQ ID NO:2), and genotyped with the sequencing primer 5' CCA CTC CAT CGA GAT T 3' (SEQ ID NO:3).
- a 214 bp fragment of the KRAS gene containing exon 2 was amplified from each genomic DNA sample using the following primers: 5'Biotin-GTG TGA CAT GTT CTA ATA TAG TCA 3' (SEQ ID NO:4) and 5' GAA TGG TCC TGC ACC AGT AA 3' (SEQ ID NO:5), and genotyped with the sequencing primer 5' GCA CTC TTG CCT ACG 3' (SEQ ID NO:6).
- PCR amplification was performed using a touchdown protocol with an initial step of 95°C for 12 minutes, then 5 cycles of 95°C for 25 sec, Tm + 15°C for 1 min and 72°C for 1 min, then 5 cycles of 95°C for 25 sec, Tm + 10°C for 1 min and 72°C for 1 min, followed by 5 cycles of 95°C for 25 sec, Tm + 5°C for 1 min and 72°C for 1 min, finishing with 35 cycles of 95°C for 25 sec, Tm°C for 1 min and 72°C for 1 min.
- Sequencing of the purified PCR products was performed using an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA). Cycle sequencing reactions were performed in a thermal cycler for 25 cycles at 96°C for 10 sec, annealing at 50°C for 5 sec, and extension at 60°C for 4 min. Prior to capillary electrophoresis, unincorporated dye terminators were removed from the extension product using a DyeEx 96 Plate (Qiagen, Valencia, CA) according to the manufacturer's instructions. The purified extension products were denatured at 90°C for 2 min and placed on ice for 1 min. Sequencing was performed on an ABI PRISM 3730x1 DNA Analyzer (Applied Biosystems).
- the sequencing output files were processed using the Phred/Phrap software package developed at the University of Washington (Nickerson et al, 1997; Ewing and Green, 1998; Ewing et al, 1998; Gordon et al, 1998). Sequence Alignments for each exon read were viewed in the Consed Viewer Software and sequence variations were annotated and recorded.
- DNA methylation assays DNA methylation assays.
- genomic DNAs were treated with sodium bisulfite using the Zymo EZ DNA Methylation Kit (Zymo Research, Orange, CA) and subsequently analyzed by MethyLight as previously described (Campan et al, 2009; incorporated herein by reference it its entirety).
- the primer and probe sequences for the MethyLight reactions for the five-gene CIMP marker panel and MLHl were reported previously (Weisenberger et al., 2006; incorporated herein by reference in its entirety).
- the Infinium DNA methylation assay was performed at the USC Epigenome Center according to the manufacturer's specifications (Illumina, San Diego, CA).
- the Illumina Infinium DNA methylation assay examines DNA methylation status of 27,578 CpG sites located at promoter regions of 14,495 protein-coding genes and 110 microRNAs.
- a measure of the level of DNA methylation at each CpG site is scored as beta ( ⁇ ) values ranging from 0 to 1 , with values close to 0 indicating low levels of DNA methylation and close to 1 high levels of DNA methylation (Bibikova, 2009).
- the detection P values measure the difference of the signal intensities at the interrogated CpG site compared to those from a set of 16 negative control probes embedded in the assay.
- NA single-nucleotide polymorphisms
- the assay probe sequences and detailed information on each interrogated CpG site ar the associated genomic characteristics on the HumanMethylation27 BeadChip can be obtained at www.illumina.com, and these data are incorporated herein by reference in their entirety. All Infinium DNA methylation data are available at the NCBI Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE25062, and these data are incorporated herein by reference in their entirety.
- Primers and probes used for validation are as follows and are listed as 5' to 3' : SFRP1, forward primer: 5' GAA TTC GTT CGC GAG GGA 3' (SEQ ID NO: 13), reverse primer: 5' AAA CGA ACC GCA CTC GTT ACC 3' (SEQ ID NO:14), probe: 6FAM-CCG TCA CCG ACG CGA AAA CCA AT- BHQ-1 (SEQ ID NO: 15); TMEFF2, forward primer: 5' GTT AAA TTC GCG TAT GAT TTC GAG A 3' (SEQ ID NO: 16), reverse primer: 5' TTC CCG CGT CTC CGA C 3' (SEQ ID NO: 17), probe: 6FAM-AAC GAA CGA CCC TCT CGC TCC GAA-BHQ-1 (SEQ ID NO: 18); LMODl, forward primer: 5' TTT TAA AGA TAA GGG GTT ACG TAA TGA G 3' (SEQ ID NO: 19), reverse primer: 5' CCG
- Gene expression assay was performed on 25 pairs of colorectal tumor and non-tumor adjacent tissue samples using the Illumina Ref-8 whole-genome expression BeadChip (HumanRef-8 v3.0, 24,526 transcripts) (Illumina). Scanned image and bead-level data processing were performed using the BeadStudio 3.0.1 software (Illumina). The summarized data for each bead type were then processed using the lumi package in Bioconductor (Du et al., 2008). The data were log 2 transformed and normalized using Robust Spline Normalization (RSN) as implemented in the lumi package. Specifically, total RNA from
- RNA samples were processed using the Illumina TotalPn R A Amplification Kit (Illumina).
- RNA (500ng) from each sample was subject to reverse transcription with an oligo(dT) primer bearing a T7 promoter.
- the cDNA then underwent second strand synthesis and purification.
- Biotinylated cR A was then generated from the double-stranded cDNA template through in vitro transcription with T7 RNA polymerase.
- the biotinylated cRNA (750ng) from each patient was then hybridized to the BeadChips.
- the hybridized chips were stained and scanned using the Illumina HD BeadArray scanner (Illumina). Scanned image and bead-level data processing were performed using the BeadStudio 3.0.1 software (Illumina).
- RNA sample from 25 pairs of colorectal tumor and non-tumor adjacent tissue samples were treated with DNase using ⁇ -freeTM kit (Applied Biosystems) to remove contaminating DNA. Reverse transcription reaction was performed using iScript Reverse Transcription Supermix for RT-PCR (Bio-Rad). Quantitative RT-PCR assays were performed with primers and probes obtained from Applied Biosystems (SFRP1: Hs00610060_ml_M; TMEFF2: Hs00249367_ml_M; LMOD1: Hs00201704_ml_M). The raw expression values were normalized to those oiHPRTl (Hs99999909_ml_M).
- RPMM Recursively partitioned mixture model
- a fanny algorithm (a fuzzy clustering algorithm) was used for initialization and level-weighted version of Bayesian information criterion (BIC) as a split criterion for an existing cluster as implemented in the R-based RPMM package.
- BIC Bayesian information criterion
- the log :i (logistic) transformation was applied to DNA methylation ⁇ -values and each probe was medial centered across the tumor samples. Consensus clustering was then performed using the san 2,728 Infinium DNA methylation probes that were used for RPMM-based clustering.
- the top 20 Infinium DNA methylation probes that are significantly hypermethylated in CIMP (CIMP-H and CIMP-L) compared with non-CIMP tumors based on the Wilcoxon rank-sum test were first selected. Using the conditions that DNA methylation ⁇ -value > 0.1 of three or more markers qualifies a sample as CIMP, a five-probe panel was determined that best classify CIM" (CIMP-H and CIMP-L) by calculating sensitivity and specificity, and overall misclassficatic rate for each random combination of the top 20 probes.
- CIMP-H-specific marker pane top 20 probes were first selected that are significantly hypermethylated in CIMP-H compare with CIMP-L tumors. A five-marker panel was then chosen that showed the best sensitivity ar specificity, and overall misclassfication rate to classify CIMP-H using the conditions that three or more markers show DNA methylation ⁇ -value threshold of > 0.1.
- Probes that might be unreliable and probes that are designed for sequences on either the X- or Y-chromosome were excluded.
- the top ten percent of probes with the highest DNA methylation variability based on standard deviation of the DNA methylation ⁇ -value across the entire colorectal tumor panel (2,758 probes) was selected, and then unsupervised clustering was performed using a recursively partitioned mixture model (RPMM).
- RPMM is a model-based unsupervised clustering method specifically developed for beta-distributed DNA methylation data such as obtained on the Infinium DNA methylatic ⁇ assay platform (Houseman et al, 2008).
- Figure 1 show according to particular exemplary aspects, RPMM-based classification and heami representation of 125 colorectal tumor samples using Infinium DNA methylation data. DN methylation profiles of 1,401 probes with most variable DNA methylation values (standai deviation >0.20) in the 125 colorectal tumor sample set are shown. The DNA methylation ⁇ - values are represented by using a color scale from dark blue (low DNA methylation) to yellow (high DNA methylation), herein reproduced in gray-scale.
- Probes that are located within CpG islands are indicated by the horizontal black bars to the right of the heatmap.
- the probes are arranged based on the order of unsupervised hierarchal cluster analysis using a correlation distance metric and average linkage method.
- Pie charts below the heatmap show the proportion of tumor samples harboring BRAF mutations (blue), KRAS mutations (red), and those wild-type for both BRAF and KRAS (yellow-green) within each subgroup, herein reproduced in gray-scale.
- Cluster 1 Cluster 2
- the cluster 1 subgroup is enriched for CIMP -positive colorectal tumors, as determined by the CIMP-specific MethyLight five-marker panel developed previously in Applicants' laboratory (CACNA1G, IGF2, NEUROG1, RUNX3, SOCS1) (Weisenberger et al, 2006), as well as MLH1 DNA hypermethylation using MethyLight technology (see Figure 1 herein). All of tl tumors with BRAF mutation belong to this subgroup, and nearly half of the tumors in th subgroup that do not harbor BRAF mutations carry mutant KRAS ( Figure 1). The cluster subgroup is also characterized by a low frequency of TP53 mutations (1 1%>).
- Figures 8A-B show, according to particular exemplary aspects, histogram analysis of the number of methylated CIMP-defining MethyLight-based markers in colorectal cancer samples.
- A Histogram analysis of the number of CIMP (e.g., CIMP-defining) loci methylated in all 125 colorectal tumor samples.
- B Histogram analysis of the number of CIMP- defining loci methylated in each RPMM-based tumor cluster membership.
- CIMP-H CIMP-high
- CIMP-L CIMP-low
- Applicants' RPMM-based clustering analysis identified two other CRC subtypes, designated as clusters 3 and 4, in addition to the CIMP-H and CIMP-L subgroups ( Figure 1 and Table 1). The difference between these two subgroups is not apparent based on DNA hypermethylation at the CIMP-defining five-gene loci ( Figure 8), indicating that DNA methylation signatures unrelated to CIMP might discriminate between these two CRC subsets.
- the frequency and level of cancer-specific DNA hypermethylation in the tumors in cluster 4 subgroup appear to be the lowest among the four subclasses (Figure 9,).
- Figure 9 shows, according to particular exemplary aspects, scatter plot analyses comparing DNA methylatic " profiles of colorectal tumor and adjacent-normal samples, stratified by their RPMM-basi cluster membership.
- GSEA Gene set enrichment analysis
- DNA methylation markers associated with CIMP-H and CIMP-L subgroups we investigated. To accomplish this, the DNA methylation ⁇ -values for each probe was compare between CIMP-H and non-CIMP tumors (cluster 3 and 4 combined) as well as the ⁇ -valui between CIMP-L and non-CIMP tumors using the Wilcoxon rank-sum test. Applican identified 1 ,618 CpG sites that showed significant DNA hypermethylation in CIMP-H versus non-CIMP tumors (FDR-adjusted P ⁇ 0.0001) (Figure 2A).
- Figures 2A-C show, according to particular exemplary aspects, DNA methylation characteristics associated with CIMP-H, CIMP-L, BRAF- and KRAS-mutSLvA colorectal tumors.
- Probe ID Gene ID Symbol Mean P value FDR- Mean P value FDR- beta- (vs. Non- adjusted P beta- (vs. Non- adjusted P value CIMP) value value CIMP) value cg00107187 388021 TMEM179 0.65 1.87E-10 8.17E-09 0.63 4.24E-09 1.23E-06 cg00243313 50805 IRX4 0.60 5.23E-07 9.07E-06 0.66 3.13E-10 2.69E-07 cg00273068 90187 EMILIN3 0.57 8.49E-08 1.79E-06 0.58 7.13E-09 1.70E-06 cg00318573 1137 CHRNA4 0.66 1.07E-09 3.63E-08 0.64 6.80E-09 1.66E-06 cg00472814 9510 ADAMTS1 0.66 5.67E-08 1.25E-06 0.65 1.50E-07 1.48E-05 cg00512279 6571 SLC18A2 0.55 2.77E-06 4.
- Probe ID Gene ID Symbol Mean P value FDR- Mean P value FDR- beta- (vs. Non- adjusted P beta- (vs. Non- adjusted P value CIMP) value value CIMP) value cg04274487 11031 RAB31 0.59 2.22E-14 3.54E-11 0.29 1.64E-08 3.07E-06 cg04330449 4762 NEUROG1 0.76 3.37E-06 4.81E-05 0.77 2.72E-07 2.28E-05 cg04369341 84969 TOX2 0.59 4.52E-10 1.76E-08 0.50 1.27E-07 1.32E-05 cg04391111 7161 TP73 0.56 2.77E-06 4.03E-05 0.62 3.34E-09 1.04E-06
- Probe ID Gene ID Symbol Mean P value FDR- Mean P value FDR- beta- (vs. Non- adjusted P beta- (vs. Non- adjusted P value CIMP) value value CIMP) value cg09053680 8433 UTF1 0.75 1.94E-06 2.93E-05 0.75 5.98E-07 4.09E-05 cg09147222 131034 CPNE4 0.49 7.27E-06 9.55E-05 0.56 4.45E-09 1.25E-06 cg09191327 59335 PRDM12 0.61 2.77E-09 8.31E-08 0.58 1.19E-08 2.51E-06 cg09231514 125988 C19orf70 0.37 3.37E-09 9.94E-08 0.30 2.61E-07 2.21E-05 cg09313439 1000 CDH2 0.55 1.79E-06 2.74E-05 0.57 4.43E-08 6.05E-06 cg09416313 4145 MATK 0.63 2.91E-09 8.67
- Probe ID Gene ID Symbol Mean P value FDR- Mean P value FDR- beta- (vs. Non- adjusted P beta- (vs. Non- adjusted P value CIMP) value value CIMP) value eg L3436799 4036 LRP2 0.54 6.29E-13 9.54E-11 0.31 1.83E-06 9.35E-05 eg L3488201 8038 ADAM 12 0.77 1.56E-08 3.94E-07 0.77 1.88E-08 3.38E-06 eg L3562542 2850 GPR27 0.68 6.10E-11 3.25E-09 0.64 5.91E-09 1.55E-06 eg L3686115 84457 PHYHIPL 0.37 1.72E-08 4.29E-07 0.36 4.67E-07 3.33E-05 eg L3749822 64399 HHIP 0.66 1.07E-09 3.63E-08 0.56 5.07E-07 3.54E-05 eg L3756879 3481 IGF2 0.66 1.90E-13 5.10E-11 0.
- Probe ID Gene ID Symbol Mean P value FDR- Mean P value FDR- beta- (vs. Non- adjusted P beta- (vs. Non- adjusted P value CIMP) value value CIMP) value cgl9141563 22843 PPM IE 0.56 8.88E-11 4.38E-09 0.47 2.40E-07 2.09E-05 cgl9332710 140730 RIMS4 0.78 6.29E-13 9.54E-11 0.57 4.49E-07 3.22E-05 cgl9355190 1959 EGR2 0.63 3.39E-12 3.11E-10 0.50 4.87E-07 3.42E-05 eg 19358442 60529 ALX4 0.60 3.73E-07 6.69E-06 0.61 1.57E-08 3.01E-06 eg 19358493 2018 EMX2 0.41 4.30E-09 1.22E-07 0.44 4.06E-08 5.75E-06 cgl9439399 6785 ELOVL4 0.53 1.53E-09 4.99E-
- Probe ID Gene ID Symbol Mean P value FDR- Mean P value FDR- beta- (vs. Non- adjusted P beta- (vs. Non- adjusted P value CIMP) value value CIMP) value cg23219720 219578 ZNF804B 0.49 1.94E-06 2.93E-05 0.52 5.78E-08 7.39E-06 cg23273897 4311 MME 0.47 4.52E-08 1.02E-06 0.50 2.17E-09 8.97E-07 cg23473904 1292 COL6A2 0.56 7.07E-13 1.02E-10 0.42 5.29E-08 6.88E-06 cg23582408 1917 EEF1A2 0.50 1.88E-08 4.65E-07 0.50 1.31E-08 2.70E-06 cg24053587 5800 PTPRO 0.38 7.57E-11 3.80E-09 0.28 1.50E-06 8.08E-05 cg24068372 349136 WDR86 0.81 4.24E-07 7.49E-06
- Figures 10A-B show, according to particular exemplary aspects, a comparison of DNA methylation profiles between CIMP-H and CIMP-L tumors.
- A The volcano plot shows the -1 x logio-transformed FDR-adjusted P value vs. the mean DNA methylation difference between CIMP-H and CIMP-L tumors.
- FDR-adjusted P 0.001 and
- 0.2 are used as a cutoff for differential methylation.
- Two CpG sites that are hypermethylated in CIMP-L tumors compared with CIMP-H tumors are indicated in green.
- KRAS mutations either induce DNA hypermethylation of a group of CpG loci or they might synergi; with a specific DNA methylation profile associated with CIMP-L tumors.
- Shen al. proposed a CIMP2 subtype of CRC, found to be tightly linked with KRAS mutations (92% of cases), using a limited number of DNA methylation markers (Shen et al., 2007).
- a large number of CpG sites (715, FDR-adjusted P ⁇ 0.0001) were identified that are significantly hypermethylated in tumors with BRAF mutation, all of which belong to the CIMP-H subgroup, as compared with tumors with wild-type for BRAF and KRAS (Fig. 2C).
- CIMP-L and non-CIMP tumors were subdivided by their KRAS mutation status and the mean DNA methylation ⁇ -values were compared among these groups.
- Mean DNA methylation ⁇ -values for KRAS mutant tumors and those BRAF/KRAS wild-type tumors were observed to be well correlated within both the CIMP-L and non-CIMP subgroups ( Figures 3 A and 3B).
- the CIMP-L subgroup exhibits higher mean DNA methylation in a number of CpG sites irrespective of KRAS mutation status ( Figures 3C and 3D).
- Figures 3A-D show, according to particular exemplary aspects, that CIMP- L-associated DNA hypermethylation occurs independent of KRAS mutation status in CRC.
- CIMP-L and non-CIMP tumors were subdivided by their KRAS and BRAF mutation stati (KRAS mutant or BRAF/KRAS wild-type), and mean DNA methylation ⁇ -values were compare between each group.
- gene promoters that acquired cancer-specific DNA methylation were classified into three categories based on their DNA methylation level profiles across colorectal tumor subtypes (see Methods of Example 1 herein, and Table 5 below): 1) CIMP- associated DNA methylation markers specific for the CIMP-H subgroup only, 2) CIMP-specific DNA methylation shared between both the CIMP-H and CIMP-L subgroups, and 3) non-CIMP cancer- specific DNA methylation.
- 500 gene promoters were included in two additional groups that did not exhibit cancer-specific DNA methylation profiles, and were either constitutively methylated or unmethylated across tumor and adjacent-normal tissue samples (Figure 4).
- Figure 4 shows, according to particular exemplary aspects, ES-cell histone marks associated with genes in the five classification groups described in the text. Shown are heatmap representations of DNA methylation ⁇ -values for unique gene promoters that belong to five different categories: 1.
- Figures 1 1A-E show, according to particular exemplary aspects, DNA structural and sequence characteristics associated with five different gene categories based on DNA methylation profiles in colorectal tumors.
- the five categories include: 1 , CIMP-associated DNA methylation markers specific for the CIMP-H subgroup only; 2, CIMP-specific DNA methylation shared between both the CIMP-H and CIMP-L subgroups; 3, non-CIMP cancer- specific DNA methylation; 4, constitutively unmethylated across tumor and adjacent normal tissue samples; 5, constitutively methylated across tumor and adjacent normal tissue samples.
- Applicants also considered that specific sequence motifs or repeat sequences surrounding CpG islands may have a role in differential DNA hypermethylation specifically in CIMP tumors. There was no enrichment or depletion of any di- or tetranucleotide sequences and known transcription factor binding sites in the CIMP-associated CpG islands (data not shown). Recently, Estecio and colleagues reported that retrotransposons are more frequently associated with CpG islands that are resistant to DNA hypermethylation than those that are susceptible to DNA hypermethylation (Estecio et al., 2010).
- H3K4me3 histone H3 lysine 4
- H3K27me3 histone H3 lysine 27
- the fraction of genes that coincide with ES-cell bivalent domains is substantially higher for the genes that undergo cancer-specific DNA methylation than those that are constitutively methylated or unmethylated across tumor and adjacent-normal tissue samples.
- Applicants found that more than 50% of colorectal cancer-specific DNA hypermethylation occurs at ES-cell bivalent domains.
- the proportion of the ES-cell bivalent domains among CIMP- associated and non-CIMP-associated genes is similar, suggesting that the features associated with these targets are not specific for CIMP-positive tumors nor CIMP genes, but general features of colorectal cancer (Figure 4).
- Table 5 Gene promoter classification among colorectal samples.
- a CIMP-defining marker panel consisting of B3GAT2, FOXL2, KCNK13, RAB31 and SLIT1 was identified. Using the conditions that DNA methylation of three or more markers qualifies a sample as CIMP, this panel identifies CIMP-H and CIMP-L tumors with 100% sensitivity and 95.6% specificity with 2.4% misclassification using a ⁇ -value threshold of > 0.1.
- a second marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 specifically identifies CIMP-H tumors with 100% sensitivity and 100% specificity (0% misclassification) using conditions that three or more markers show DNA methylation ⁇ -value threshold of > 0.1.
- a tumor sample is classified as CIMP-H if both marker panels a positive (three or more markers with DNA methylation for each panel).
- a tumor sample is classified as CIMP-L if the CIMP-defining mark panel is positive while the CIMP-H specific panel is negative (0-2 genes methylated).
- Table 7 lists the gene and CpG island locations and sequences for the 10 marker genes comprising these two marker panels (i.e., B3GAT2, FOXL2, KCNK13, RAB31 and SLITI; and FAM78A, FSTLl, KCNCl, MYOCD, and SLC6A4).
- Table 11 lists the primer, probe and unconverted amplicon sequences for the MethyLight reactions for the 10 marker genes comprising these two marker panels (i.e., B3GAT2, FOXL2, KCNK13, RAB31 and SLITI; and FAM78A, FSTLl, KCNCl, MYOCD, and SLC6A4), and for the MLH1 gene.
- identification and/or classification of CIMP-H and CIMP-L subgroups is provided by a panel comprising at least one of the additional markers listed in Table 8. According to particular aspects,
- identification and/or classification of CIMP-H subgroups is provided by a panel comprising at least one of the additional markers listed in Table 9.
- MethyLight five-marker panel i.e., CACNA1G, IGF2, NEUROG1, RUNX3, SOCSl
- markers thereof previously developed in Applicants' laboratory (Weisenberger et al, Nat Genet 38: 787-793, 2006; see also published US Patent Application Serial No. 11/913,535, DNA METHYLATION MARKERS ASSOCIATED WITH THE CPG ISLAND METHYLATOR PHENOTYPE (CIMP) IN HUMAN COLORECTAL CANCER, published as US-2009-0053706-A1 to Laird; all incorporated by reference herein in their entirety; and see Table 10) are used in combination with the panels disclosed herein to provide for identification and/or classification of CRC.
- CIMP DNA METHYLATION MARKERS ASSOCIATED WITH THE CPG ISLAND METHYLATOR PHENOTYPE
- H- cg22469841 CATCGAAATTTT AACTCGATCCCC AAACGCGCGTCC CGCAGACCCAAGAGGCCCCGG
- H- cg22469841 CATCGAAATTTT CCCGAAACCTCTT AAACGCGCGTCC CGCAGACCCAAGAGGCCCCGG
- Promoter CpG island DNA hypermethylation can lead to transcriptional silencing of the associated gene.
- the majority of cancer-specific CpG island hypermethylation may occur in gene promoters that are not normally expressed, and therefore may not be involved in tumor initiation or progression (Widschwendter et al, 2007; Gal- Yam et al, 2008).
- Applicants examined the extent to which cancer-specific DNA hypermethylation affects gene expression in colorectal tumors, by performing an integrated analysis of promoter DNA methylation and gene expression data from six CIMP-H normal adjacent-tumor pairs and 13 pairs of non-CIMP tumors and adjacent-normal tissues. Applicants found that 7.3% of genes that showed DNA hypermethylation (
- Figures 6A-C show, according to particular exemplary aspects, an integrated analysis of gene expression and promoter DNA methylation changes between colorectal tumors and matched normal adjacent tissues.
- B Pie chart showing the gene expression changes of 1 ,534 hypermethylated genes in CIMP-H tumors compared with adjacent normal tissues.
- Bar chart showing the number of genes that exhibit DNA hypermethylation and/or gene expression changes in non-CIMP tumors among the 1 12 genes that are hypermethylated and downregulated in CIMP-H tumors.
- Figures 12A-D show, according to particular exemplary aspects, validation of the Infimum DNA methylation data and gene expression array data using MethyLight and quantitative RT-PCR (qRT-PCR), respectively.
- the validations were performed for three genes indicated above each scatter plot ⁇ A) Comparison of Infimum DNA methylation ⁇ -value (x-axis) and iog2 -transformed gene expression value from l ilumina expression array (y-axis).
- the x-axis represents Infimum DNA methylation ⁇ -value and the y-axis represents PMR value from MethyLight assay.
- Pearson correlation coefficients between the assays 0.85 for SFRPl, 0.91 for TMEFF2 and 0.96 for LMOD1.
- the x-axis represents log2-transformed array-based gene expression value and the y-axis represents log2-transformed relative copy number normalized to HTPR1 using qRT-PCR assay.
- Pearson correlation coefficients between the gene expression platforms 0.93 for SFRPl, 0.89 for TMEFF2 and 0.91 for LMOD1.
- D Comparison of MethyLight PMR values (x-axis) and log2- transformed normalized relative copy number from qRT-PCR assay (y-axis).
- Model-based clustering of DNA methylation array data a recursive-partitioning algorithm for high-dimensional data arising as a mixture of beta distributions.
- DACT3 is an epigenetic regulator of Wnt/beta-catenin signaling in colorectal cancer and is a therapeutic target of histone modifications. Cancer Cell 13: 529- 541.
- CpG island methylator phenotype-low (CIMP-low) in colorectal cancer possible associations with male sex and KRAS mutations. J Mol Diagn 8: 582-588.
- a stem cell-like chromatin pattern may predispose tumor suppressor genes to DNA hypermethylation and heritable silencing. Nat Genet 39: 237- 242.
- Bivalent domains enforce transcriptional memory of DNA methylated genes in cancer cells.
- IGFBP7 is a p53 -responsive gene specifically silenced in colorectal cancer with CpG island methylator phenotype.
- Widschwendter M., H. Fiegl, D. Egle, E. Mueller-Holzner, G. Spizzo, C. Marth, D.J.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Particular aspects provide methods and compositions (e.g., gene marker panels) having substantial utility for at least one of diagnosis, identification and classification of colorectal cancer (CRC) (e.g., tumors) relating to distinctive DNA methylation-based subgroups of CRC including CpG island methylator phenotype (CIMP) groups (e.g., CIMP-H and CIMP-L) and non-CIMP groups. Exemplary marker panels include: B3GAT2, FOXL2, KCNK13, RAB31 and SLIT1 (CIMP marker panel); and FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 (CIMP-H marker panel). Further aspects relate to genetic mutations, and other epigenetic markers relating to said CRC subgroups that can be used in combination with the gene marker panels for at least one of diagnosis, identification and classification of colorectal cancer (CRC) (e.g., tumors) relating to distinctive CIMP and non-CIMP groups.
Description
GENOME-SCALE ANALYSIS OF ABERRANT DNA METHYLATION IN
COLORECTAL CANCER
CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to United States Provisional Patent
Application Serial Nos. 61/492,749 filed 02 June 2011, and 61/492,325 filed 01 June 2011, both of which are incorporated by reference herein in their entirety.
FIELD OF THE INVENTION
Aspects of the present invention relate generally to colorectal cancer (CRC), and more particularly to methods and compositions (e.g., gene marker panels) for at least one of diagnosis, identification and classification of CRC. Further aspects relate to marker identification based on a comprehensive genome-scale analysis of aberrant DNA methylation and/or gene expression in CRC. Particular aspects relate to identification and/or classification of colorectal tumors, corresponding to distinctive DNA methylation-based subgroups of CRC including CpG island methylator phenotype (CIMP) groups and non-CIMP groups. Further aspects related to correlations of genetic mutation, and other epigenetic markers with said CRC subgroups for at least one of diagnosis, identification and classification of CRC including CIMP groups and non- CIMP groups.
STATEMENT REGARDING FEDERALLY-SPONSORED RESEARCH This invention was made with government support under Contract No. 5R01CA118699 awarded by the National Institutes of Health. The government has certain rights in the invention.
SEQUENCE LISTING A Sequence Listing (in .txt format) comprising SEQ ID NOS: 1-278 was filed as part of this application, and is incorporated by reference herein in its entirety.
BACKGROUND
Colorectal cancer (CRC) arises through the accumulation of multiple genetic ar epigenetic changes. Somatic mutations in APC, BRAF, KRAS, PIK3CA, TP53 and other gem have been frequently observed in CRC and are considered to be drivers of colorect tumorigenesis (Wood et al, 2007). In addition, the majority of sporadic CRCs (65-70%) disph chromosomal instability (CIN), characterized by aneuploidy, amplifications and deletions < subchromosomal genomic regions and loss of heterozygosity (LOH) (Pino and Chung, 2010).
Two major types of epigenetic modifications closely linked to CRC are DNA methylation and covalent histone modifications (Jones and Baylin, 2007). Aberrant DNA methylation of CpG islands has been reported in the earliest detectable lesions in the colonic mucosa, aberrant crypt foci (ACF) (Chan et al., 2002). Promoter CpG island DNA hypermethylation is associated with transcriptional gene silencing, and can cooperate with other genetic mechanisms to alter key signaling pathways critical to colorectal tumorigenesis (Baylin and Ohm, 2006). A recent large-scale comparison between genes mutated and hypermethylated in CRC revealed significant overlap between these two alterations (Chan et al., 2008). Importantly, DNA hypermethylation appeared to be the preferred mechanism when a gene can be inactivated by either mutation or promoter DNA hypermethylation.
New insights into the mechanisms and the role of CpG island hypermethylation in cancer have emerged from recent studies using integrated analyses of the two types of epigenetic modifications. We and other groups have reported that genes that are targeted by Polycomb group (PcG) proteins in embryonic stem (ES) cells are susceptible to cancer-specific DNA hypermethylation (Ohm et al, 2007; Schlesinger et al, 2007; Widschwendter et al, 2007). PcG target genes are characterized by trimethylation of histone H3 lysine 27 (H3K27me3), are maintained at a low expression state and are poised to be activated during development (Bernstein et al., 2007). More recently, it has been found that genes targeted by H3K27me3 in normal tissues acquire DNA methylation and lose the H3K27me3 mark in cancer (Gal-Yam et al, 2008; Rodriguez et al, 2008). Importantly, epigenetic switching of H3K27me3 and DNA methylation mainly occurs at genes that are not expressed in normal tissues. Furthermore, cancer-specific H3K27me3 -mediated gene silencing has also been shown to inactivate tumor suppressor genes independent of DNA hypermethylation in CRC (Jiang et al, 2008; Kondo et al, 2008).
Colorectal tumors with a CpG island methylator phenotype (CIMP) exhibit a high frequency of cancer-specific DNA hypermethylation at a subset of genomic loci and are highly
V600E
enriched for activating mutation of BRAF (BRAF ) (Weisenberger et al., 2006). CRCs with CIN and CIMP have been shown to be inversely correlated (Goel et al, 2007; Cheng et al, 2008) and appear to develop in two separate pathways (Leggett and Whitehall, 2010). DN hypermethylation of some CIMP-associated gene promoters have been detected in early stagi of in colorectal tumorigenesis (Ibrahim et al., 2011). Furthermore, an extensive promoter DN hypermethylation has been observed in the histologically normal colonic mucosa of patien predisposed to multiple serrated polyps, the proposed precursors of CIMP tumors (Young ar Jass, 2006). Notably, some of the distinct genetic and histopathological characteristi<
associated with CIMP tumors may be directly attributable to CIMP -mediated gene silencing. Applicants have reported that CIMP-associated DNA hypermethylation of MLH1 is the dominant mechanism for the development of sporadic CRC with microsatellite instability (MSI) (Weisenberger et al, 2006). Furthermore, the CIMP-specific inactivation of IGFBP7-mediatQd senescence and apoptosis pathways may provide a permissive environment for the acquisition of BRAF mutations in CIMP -positive tumors (Hinoue et al., 2009; Suzuki et al., 2010).
Recent studies from several groups indicated that colorectal tumors with KRAS mutations may also be associated with a unique DNA methylation profile. CIMP-low (CIMP-L) tumors were originally shown to exhibit DNA hypermethylation of a reduced number of CIMP-defining loci (Ogino et al., 2006). CIMP-L was significantly associated with KRAS mutations, was observed more commonly in men than women and appeared to be independent of MSI status. Shen and colleagues described the CIMP2 subgroup, which also showed DNA hypermethylation of CIMP-associated loci, but was highly correlated (92%) to KRAS mutations and not associated with MSI (Shen et al., 2007). A recent report from Yagi, et al. reported the intermediate- methylation epigenotype (IME), which was also associated with KRAS mutations (Yagi et al., 2010).
In light of these findings, there is confusion in the art with regards to DNA methylation subtypes in CRC. It is not established whether CIMP-L, CIMP2 or IME represent unique DNA methylation-based subgroups in CRC, as limited numbers of genomic regions were used to derive membership in these studies. Moreover, the types of genes targeted for DNA methylation in each subgroup and the effects of DNA hypermethylation on gene expression in each subtype have not yet been fully explored.
SUMMARY OF THE INVENTION
In particular aspects, four distinct DNA methylation subgroups were identified and characterized in CRC by performing comprehensive, genome-scale DNA methylation profiling of 125 primary colorectal tumors and 29 adjacent non-tumor colonic mucosa samples using the Illumina Infinium DNA methylation assay.
In certain aspects, Applicants developed diagnostic DNA methylation gene marker panels to identify CIMP (CIMP-H and CIMP-L), as well as to segregate CIMP-H tumors fro CIMP-L tumors based on the Infinium DNA methylation data (FIGURE 5).
In particular aspects, a CIMP-defining marker panel consisting of B3GAT2, FOXL KCNK13, RAB31 and SLIT1 was identified. Using the conditions that DNA methylation < three or more markers qualifies a sample as CIMP, this panel identifies CIMP-H and CIMP-
tumors with 100% sensitivity and 95.6% specificity with 2.4% misclassification using a β-value threshold of > 0.1.
In particular aspects, a second marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 specifically identifies CIMP-H tumors with 100% sensitivity and 100% specificity (0% misclassification) using conditions that three or more markers show DNA methylation β-value threshold of > 0.1.
In certain asepcts, a tumor sample is classified as CIMP-H if both marker panels are positive (three or more markers with DNA methylation for each panel).
In further aspects, a tumor sample is classified as CIMP-L if the CIMP-defining marker panel is positive while the CIMP-H specific panel is negative (0-2 genes methylated).
Gene expression data was also obtained for paired tumor and adjacent normal samples in order to assess the biological implications of DNA methylation-mediated gene silencing in CRC.
Preferred exemplary embodiments. Preferred aspects provide methods for at least one of diagnosing, detecting and classifying a colorectal cancer belonging to a distinct colorectal cancer (CRC) subgroup having frequent CpG island hypermethylation (CIMP CRC), comprising: determining, by analyzing a human subject biological sample comprising colorectal cancer (CRC) cell genomic DNA using a suitable assay, a CpG methylation status of at least one CpG dinucleotide from each gene of the gene marker panel of B3GAT2, FOXL2, KCNK13, RAB31 and SLIT1(C1MP marker panel); wherein CpG hypermethylation, relative to normal control values, of at least three genes of the CIMP marker gene panel is indicative of a frequent CpG island hypermethylation colorectal cancer subgroup (CIMP CRC), and wherein a method of at least one of diagnosing, detecting and/or classifying a colorectal cancer belonging to the distinct colorectal cancer (CRC) subgroup having frequent CpG island hypermethylation (CIMP CRC) is afforded. In certain aspects, the CpG island hypermethylation colorectal cancer (CIMP CRC), comprises both CIMP-H and CIMP-L subgroups of CIMP. In particular embodiments, CIMP-H and CIMP-L tumors are identified with about 100% sensitivity and about 95.6% specificity with about 2.4% misclassification using conditions that three or more markers show DNA methylation β-value threshold of > 0.1. as defined herein. In certain aspects of the methods disclosed herein, determining a CpG methylation status of at least one CpG dinucleotide fro ~ each gene of the gene marker panel of B3GAT2, FOXL2, KCNK13, RAB31 and SLIT1 (CIM marker panel), comprises determining a CpG methylation status of at least one CpG dinucleotic from each of: at least one of SEQ ID NOS:45, 46 and 278 (B3GAT2 promoter, CpG island ai amplicon, respectively); at least one of SEQ ID NOS:40, 41 and 240 (FOXL2 promoter, Cp island and amplicon, respectively); at least one of SEQ ID NOS:25, 26 and 224 (KCNKi
promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:35, 36 and 236 (RAB31 promoter, CpG island and amplicon, respectively); and at least one of SEQ ID NOS:30, 31, 228 and 232 (SLIT1 promoter, CpG island and amplicons, respectively), respectively. Additional aspects further comprise determining, by analyzing the human subject biological using a suitable assay, a CpG methylation status of at least one CpG dinucleotide from each gene of an additional gene marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 (CIMP-H marker panel), wherein a CIMP-L subgroup of CIMP is indicated where the CIMP- defining marker panel is positive (hypermethylation of at least three genes of the CIMP marker gene panel) while the CIMP-H marker panel is negative (hypermethylation of only 0-2 genes of the CIMP-H marker gene panel), and wherein a CIMP-H subgroup of CIMP is indicated where both the CIMP-defining marker panel and the CIMP-H marker panel are positive (hypermethylation of at least three genes of each marker gene panel). In additional aspects, the methods further comprise determination of at least one of KRAS, BRAF and TP53 mutant status. In ceratin aspects, the BRAF mutation status comprises mutation status at codon 600 in exon 15 (e.g., BRAFV600E), wherein the the KRAS mutation status comprises mutation status at codon 12 and/or 13 in exon 2, and wherein the TP 53 mutation status comprises mutation status at exons 4 through 8. In certain aspects, a positive mutation status comprises at least one of missense mutations, nonsense mutations, splice-site mutations, frame-shift mutations, and in- frame deletions. Yet additional aspects further comprise determing a MLH1 gene methylation status, wherein MLH1 hypermethylation is strongly associated with CIMP-H CRC. In particular embodiments of the methods disclosed herein, determining a CpG methylation status of at least one CpG dinucleotide from each gene of the gene marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 (CIMP-H marker panel), comprises determining a CpG methylation status of at least one CpG dinucleotide from each of: at least one of SEQ ID NOS:50, 51 and 247 (FAM78A promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:65, 66, 259, 263 and 265 (FSTL1 promoter, CpG island and amplicons, respectively); at least one of SEQ ID NOS:60, 61 and 255 (KCNC1 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:55, 56 and 251 (MYOCD promoter, CpG island and amplicon, respectively); and at least one of SEQ ID NOS:70, 71, and 269 (SLC6A4 promote CpG island and amplicons, respectively), respectively. In certain embodiements, determinir methylation status comprises treating the genomic DNA, or a fragment thereof, with one < more reagents (e.g., bisulfite, hydrogen sulfite, disulfite, and combinations thereof) to conve cytosine bases that are unmethylated in the 5 -position thereof to uracil or to another base that detectably dissimilar to cytosine in terms of hybridization properties.
Yet further aspects provide methods for at least one of diagnosing, detecting and classifying a colorectal cancer belonging to a distinct colorectal cancer (CRC) subgroup having frequent CpG island hypermethylation (CIMP CRC), comprising: determining, by analyzing a human subject biological sample comprising colorectal cancer (CRC) cell genomic DNA using a suitable assay, a CpG methylation status of at least one CpG dinucleotide from each gene of the gene marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 (CIMP-H marker panel); wherein CpG hypermethylation, relative to normal control values, of at least three genes of the CIMP-H marker gene panel is indicative of a CIMP-H subgroup of CIMP CRC, and wherein a method of at least one of diagnosing, detecting and classifying a colorectal cancer belonging to the CIMP-H subgroup of CIMP CRC is afforded. In certain aspects, CIMP-H tumors are identified with about 100% sensitivity and about 100% specificity (about 0%> misclassification) using conditions that three or more markers show DNA methylation β-value threshold of > 0.1. as defined herein. Certain aspects, further comprise determination of at least one of KRAS, BRAF and TP53 mutant status. In certain aspects, the BRAF mutation status comprises mutation status at codon 600 in exon 15 (e.g., BRAFV600E), wherein the the KRAS mutation status comprises mutation status at codon 12 and/or 13 in exon 2, and wherein the TP 53 mutation status comprises mutation status at exons 4 through 8. In particular aspects, a positive mutation comprises at least one of missense mutations, nonsense mutations, splice-site mutations, frame-shift mutations, and in-frame deletions. Certain aspects further comprise determing a MLH1 gene methylation status, wherein MLH1 hypermethylation is strongly associated with CIMP-H CRC. In certain aspects of the methods disclosed herein, determining a CpG methylation status of at least one CpG dinucleotide from each gene of the gene marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 (CIMP-H marker panel), comprises determining a CpG methylation status of at least one CpG dinucleotide from each of: at least one of SEQ ID NOS:50, 51 and 247 (FAM78A promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:65, 66, 259, 263 and 265 (FSTL1 promoter, CpG island and amplicons, respectively); at least one of SEQ ID NOS:60, 61 and 255 (KCNC1 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:55, 56 and 251 (MYOCD promoter, CpG island and amplicon, respectively); and at least one of SEQ I1^ NOS:70, 71, and 269 (SLC6A4 promoter, CpG island and amplicons, respectively), respectivel In particular embodiments, determining methylation status comprises treating the genom DNA, or a fragment thereof, with one or more reagents (e.g., bisulfite, hydrogen sulfit disulfite, and combinations thereof) to convert cytosine bases that are unmethylated in the ; position thereof to uracil or to another base that is detectably dissimilar to cytosine in terms <
hybridization properties.
Yet additional aspects, provide kits for performing the methods, comprising, for each gene of of the gene marker panel oiB3GAT2, FOXL2, KCNK13, RAB31 and SLIT1, at least two oligonucleotides whose sequences in each case are identical, are complementary, or hybridize under stringent or highly stringent conditions to the respective marker gene; and optionally comprising a bisulfite reagent (e.g., bisulfite, hydrogen sulfite, disulfite, and combinations thereof). In certain aspects of the kits disclosed herein, the respective marker gene sequences comprise at least one sequence from each of: at least one of SEQ ID NOS:45, 46 and 278 (B3GAT2 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:40, 41 and 240 (FOXL2 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:25, 26 and 224 (KCNK13 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:35, 36 and 236 (RAB31 promoter, CpG island and amplicon, respectively); and at least one of SEQ ID NOS:30, 31, 228 and 232 (SLIT1 promoter, CpG island and amplicons, respectively), respectively.
Further aspects provide kits suitable for performing the method comprising, for each gene of of the gene marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4, at least two oligonucleotides whose sequences in each case are identical, are complementary, or hybridize under stringent or highly stringent conditions to the respective marker gene; and optionally comprising a bisulfite reagent (e.g., bisulfite, hydrogen sulfite, disulfite, and combinations thereof). In certain aspects of the kits disclosed herein, the respective marker gene sequences comprise at least one sequence from each of: at least one of SEQ ID NOS:50, 51 and 247 (FAM78A promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:65, 66, 259, 263 and 265 (FSTL1 promoter, CpG island and amplicons, respectively); at least one of SEQ ID NOS:60, 61 and 255 (KCNC1 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:55, 56 and 251 (MYOCD promoter, CpG island and amplicon, respectively); and at least one of SEQ ID NOS:70, 71, and 269 (SLC6A4 promoter, CpG island and amplicons, respectively), respectively.
The data presented and discussed in this specification have also been deposited in NCBI's Gene Expression Omnibus (GEO) and are accessible through GEO Series accessic ~ numbers GSE25062 and GSE25070, incorporated by reference herein. The following links ha1 been created to review these record http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=xpannsgssikcuvq&acc=GSE25062; ar http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=rzgzzwyyqqqgklu&acc=GSE25070.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows, according to particular exemplary aspects, RPMM-based classification and heatmap representation of 1 25 colorectal tumor samples using Infinium DNA methylation data. DNA methylation profiles of 1 ,401 probes with most variable DNA methylation values (standard deviation >0.20) in the 125 colorectal tumor sample set are shown. The DNA methylation β-values are represented by using a color scale from dark blue (low DNA methylation) to yellow (high DNA methylation, which is herein reproduced in gray-scale). Four subgroups were derived by RPMM-based clustering and are indicated above the heatmap: lightsky blue, cluster 1 (n=28); lightcoral, cluster 2 (n=29); yellow, cluster 3 (n=37) and dark gray, cluster 4 (n=31), all of which colors are herein reproduced in gray-scale. CIMP-positive tumors as classified by the MethyLight five-marker panel (Weisenberger et al., 2006) are indicated by black bars. Presence of MLH1 DNA methylation, BRAF mutation, KRAS mutation, and TP53 mutations are indicated by orange, blue, red, and purple bars, respectively, herein reproduced in gray-scale. Probes that are located within CpG islands (Takai- Jones) are indicated by the horizontal black bars to the right of the heatmap. The probes are arranged based on the order of unsupervised hierarchal cluster analysis using a correlation distance metric and average linkage method. Pie charts below the heatmap show the proportion of tumor samples harboring BRAF mutations (blue), KRAS mutations (red), and those wild-type for both BRAF and KRAS (yellow-green), herein reproduced in grey-scale within each subgroup.
Figures 2A-C show, according to particular exemplary aspects, DNA methylation characteristics associated with CIMP-H, CIMP-L, BRAF- and KRAS-mutant colorectal tumors. (A) Comparison of CIMP-H- and CIMP-L-associated DNA methylation profiles. Each data point represents the logio-transformed FDR-adjusted -value comparing DNA methylation in CIMP-H (n=28) vs. non-CIMP tumors (n=68) (x-axis) and in CIMP-L (n=29) vs. non-CIMP tumors (n=68) (y-axis) for each Infinium DNA methylation probe. For the probes with higher mean DNA methylation in CIMP-H or CIMP-L tumors compared to non-CIMP tumors, -1 is multiplied to logi0(FDR-adjusted -value), providing positive values. The blue and red points, herein reproduced in gray-scale, highlight probes that are significantly hypermethylated in CIMP-H and CIMP-L tumors compared to non-CIMP tumors, respectively. (B) Heatmr" representing Infinium DNA methylation β-values for 575 CpG sites that are significant hypermethylated in CIMP-H compared with non-CIMP tumors (top) and 22 CpG sites that a significantly hypermethylated in CIMP-L compared with non-CIMP tumors (bottom). The foi DNA methylation-based subgroups are indicated above the heatmaps. A color gradient fro dark blue to yellow, herein reproduced in gray-scale was used to represent the low and hi^
DNA methylation β-values, respectively. (Q Comparison of BRAF mutant- and KRAS mutant- associated DNA hypermethylation signatures in CRC. The logio-transformed FDR-adjusted P- value for each probe is plotted for tumors harboring KRAS mutations (KRAS-M) (n=34) vs. BRAF/KRAS wild-type (n=74) (y-axis) and those containing BRAF mutations (BRAF-M) (n=17) vs. BRAF/KRAS wild-type (n=74) (x-axis). For the probes with higher mean DNA methylation β-values in BRAF or KRAS mutant tumors compared to wild-type tumors, -1 is multiplied to logio(FDR-adjusted -value), providing positive values.
Figures 3A-D show, according to particular exemplary aspects and herein reproduced in gray-scale, that CIMP-L-associated DNA hypermethylation occurs independent of KRAS mutation status in CRC. CIMP-L and non-CIMP tumors were subdivided by their KRAS and BRAF mutation status (KRAS mutant or BRAF/KRAS wild-type), and mean DNA methylation β- values were compared between each group. Scatter plots comparing mean DNA methylation β- values between (A) KRAS mutant and BRAF/KRAS wild-type tumors within the CIMP-L subgroup, (B) KRAS mutant and BRAF/KRAS wild-type tumors within the non-CIMP subgroup, (Q KRAS mutant, CIMP-L tumors versus KRAS mutant, non-CIMP tumors and (D) BRAF/KRAS wild-type, CIMP-L tumors compared to non-CIMP tumors with the same genotype.
Figure 4 shows, according to particular exemplary aspects and herein reproduced in gray-scale, ES-cell histone marks associated with genes in the five classification groups described in the text. Shown are heatmap representations of DNA methylation β-values for unique gene promoters that belong to five different categories: 1. CIMP-H specific: CIMP- associated DNA methylation markers specific for CIMP-H subgroup only (n=415 genes), 2. CIMP-H & CIMP-L: CIMP-specific DNA methylation shared between the CIMP-H and CIMP- L subgroups (n=73 genes), 3. Non-CIMP: cancer-specific DNA methylation but outside of the CIMP context (n=547 genes), 4. Constitutive-Low: Constitutively unmethylated genes in both tumor and adjacent normal tissue samples (n=500 genes), 5. Constitutive-High: Constitutively methylated in both tumor and adjacent normal tissue samples (n=500 genes). Genes containing CpG islands defined by Takai and Jones are indicated by horizontal black bars immediately to the right of each heatmap. The bar charts to the right of each heatmap show the proportion r gene promoters with occupancy of histone H3 lysine 4 trimethylation (K4) and/or histone F lysine 27 trimethylation (K27) in human ES cells. Probes that do not have these histone mai information (listed in Table 5 as "NA") were not included in the bar chart calculations. Tl probes in each category are ordered according to the unsupervised hierarchal clustering usir
correlation distance metric and average linkage method. The RPMM-based cluster assignments are indicated above the heatmaps.
Figure 5 shows, according to particular exemplary aspects, diagnostic CIMP-defining gene marker panels based on the Infinium DNA methylation data. The Dichotomous heat map of the Infinium DNA methylation data is shown. Black bars indicate DNA methylation β-value > 0.1 , and white bars indicate DNA methylation β-value < 0.1. The panel of five markers shown on the top (CIMP-H & CIMP-L) is used to identify CIMP-H and CIMP-L tumors. The panel of five markers shown on the bottom (CIMP-H specific) is used to specifically identify CIMP-H tumors.
Figures 6A-C show, according to particular exemplary aspects, an integrated analysis of gene expression and promoter DNA methylation changes between colorectal tumors and matched normal adjacent tissues. (A) Mean DNA methylation β-value differences between CIMP-H tumors and matched normal colonic tissues (n=6) are plotted on the x-axis and mean log2-transformed gene expression values differences are plotted on the y-axis for each gene. Red data points, herein reproduced in gray-scale, highlight those genes that are hypermethylated with β-value difference >0.20 and show more than 2-fold decrease in their gene expression levels in CIMP-H tumors. (B) Pie chart showing the gene expression changes of 1 ,534 hypermethylated genes in CIMP-H tumors compared with adjacent normal tissues. ( ) Bar chart showing the number of genes that exhibit DNA hypermethylation and/or gene expression changes in non-CIMP tumors among the 1 12 genes that are hypermethylated and downregulated in CIMP-H tumors.
Figures 7A-D show, according to particular exemplary aspects and herein reproduced in gray-scale, (A) Delta area plot showing the relative change in area under the consensus cumulative distribution function (CDF) curve (Monti et al., 2003). (B) Consensus matrix produced by K-means clustering (K = 4). (Q The heatmap representation of 125 colorectal tumor samples using the Infinium DNA methylation data as shown in Figure 1. Cluster membership of each sample derived from RPMM-based clustering and consensus clustering are indicated as vertical bars with distinct colors above the heatmap (herein shown in gray-scale). (D) Contingency table comparing the cluster membership assignments between the two differe ^ clustering methods.
Figures 8A-B show, according to particular exemplary aspects, histogram analysis of tl number of methylated CIMP-defining MethyLight-based markers in colorectal cancer sample (A) Histogram analysis of the number of CIMP loci methylated in all 125 colorectal tumi
samples. (B) Histogram analysis of the number of CIMP-defining loci methylated in each RPMM-based tumor cluster membership.
Figure 9 shows, according to particular exemplary aspects, scatter plot analyses comparing DNA methylation profiles of colorectal tumor and adjacent-normal samples, stratified by their RPMM-based cluster membership.
Figures 10A-B show, according to particular exemplary aspects, a comparison of DNA methylation profiles between CIMP-H and CIMP-L tumors. (A) The volcano plot shows the -1 x logio-transformed FDR-adjusted P value vs. the mean DNA methylation difference between CIMP-H and CIMP-L tumors. FDR-adjusted P = 0.001 and |Δβ| = 0.2 are used as a cutoff for differential methylation. Two CpG sites that are hypermethylated in CIMP-L tumors compared with CIMP-H tumors are indicated in green, herein reproduced in gray-sclae. (B) Heatmap representing Infinium DNA methylation β-values for the two CpG sites (labeled in green in panel A, herein reproduced in gray-scale) that are significantly hypermethylated in CIMP-L compared with CIMP-H tumors. The four DNA methylation-based subgroups are indicated above the heatmap. A color gradient from dark blue to yellow, herein reproduced in gray-scale was used to represent the low and high DNA methylation β-values, respectively.
Figures 1 1A-E show, according to particular exemplary aspects, DNA structural and sequence characteristics associated with five different gene categories based on DNA methylation profiles in colorectal tumors. The five categories include: 1 , CIMP-associated DNA methylation markers specific for the CIMP-H subgroup only; 2, CIMP-specific DNA methylation shared between both the CIMP-H and CIMP-L subgroups; 3, non-CIMP cancer- specific DNA methylation; 4, constitutively unmethylated across tumor and adjacent normal tissue samples; 5, constitutively methylated across tumor and adjacent normal tissue samples. Distribution of (A) observed CpG/expected CpG ratio and (B) GC content over 250 bp upstream and 250 bp downstream from the interrogated CpG dinucleotide on the Infinium DNA methylation BeadArray, (Q the Takai and Jones-calculated CpG island length (Takai and Jones, 2002), (D, E) distances of Infinium DNA methylation probes to the nearest (D) ALU and (E) LINE repetitive element. In each box plot, the top and bottom edges are the 25th and 75th quartiles, respectively. The horizontal line within each box identifies the median. The whiske "~ above and below the box extend to at most 1.5 times the interquartile range (IQR).
Figures 12A-D show, according to particular exemplary aspects, validation of tl Infinium DNA methylation data and gene expression array data using MethyLight ar quantitative RT-PCR (qRT-PCR), respectively. The validations were performed for three gem indicated above each scatter plot {A) Comparison of Infinium DNA methylation β-value (x-axi
and log2-transformed gene expression value from Illumina expression array (y-axis). (B) Validation of Infinium DNA methylation data by MethyLight technology. The x-axis represents Infinium DNA methylation β-value and the y-axis represents PMR value from MethyLight assay. Pearson correlation coefficients between the assays: 0.85 for SFRP1, 0.91 for TMEFF2 and 0.96 for LMOD1. (Q Validation of Illumina expression array data by qRT-PC assay. The x-axis represents log2 -transformed array-based gene expression value and the y-axis represents log2-transformed relative copy number normalized to HTPR! using qRT-PCR assay. Pearson correlation coefficients between the gene expression platforms: 0.93 for SFRP1, 0.89 for TMEFF2 and 0.91 for LMOD1. (Z>) Comparison of MethyLight PMR values (x-axis) and log2~ transformed normalized relative copy number from qRT-PCR assay (y-axis). Black open circle: adjacent norma! (n = 25), red open circle (herein reproduced in gray-scale): tumors in CIMP-L, Cluster 3 and Cluster 4 (n = 19), blue open circle (herein reproduced in gray-scale): CIMP-H tumors (n ::: 6).
DETAILED DESCRIPTION OF THE INVENTION
Definitions:
In particular aspects, "gene' refers to the respective genomic DNA sequence, including any promoter and regulatory sequences of the gene (e.g., enhancers and other gene sequences involved in regulating expression of the gene), and in particular embodiments, portions of said gene. In certain embodiment a gene sequence may be an expressed sequence (e.g., expressed RNA, mRNA, cDNA). In particular aspects, the term "gene" shall be taken to include all transcript variants thereof (e.g., the term "B3GAT2" shall include for example its transcripts and any truncated transcript, etc) and all promoter and regulatory elements thereof. Furthermore where SNPs are known within genes the term shall be taken to include all sequence variants thereof.
In particular aspects, "promoter" or "gene promoter" refers to the respective contiguous gene DNA sequence extending from 1.5kb upstream to 1.5kb downstream relative to the transcription start site (TSS), or contiguous portions thereof. In particular aspects, "promoter" or "gene promoter" refers to the respective contiguous gene DNA sequence extending fro
1.5kb upstream to 0.5kb downstream relative to the TSS. In certain aspects, "promoter" <
"gene promoter" refers to the respective contiguous gene DNA sequence extending from 1.51 upstream to the downstream edge of a CpG island that overlaps with the region from 1.51 upstream to 1.5kb downstream from TSS (and is such cases, my thus extend even further beyor
1.5 kb downstream), and contiguous portions thereof. In particular aspects, with respect to ar
particular recited gene, any CpG dinulcleotide of the particular recited gene that is coordinately methylated with the "promoter" or "gene promoter" of said recited gene, has substantial diagnostic/classification utility as disclosed herein, as one of ordinary skill in the art could readily practice the disclosed invention using any such coordinately methylated CpG dinucleotide sequences.
In particular aspects, a "CpG" island (CGI) refers to the NCBI relaxed definition defined bioinformatically as DNA sequences (200 based window) with a GC base composition greater than 50% and a CpG observed/expected ratio [o/e] of more than 0.6 (Takai & Jones Proc. Natl Acad. Sci. USA 99:3740-3745, 2002; Takai & Jones In Silico Biol. 3 :235-240, 2003; see also NCBI Map Viewer help document describing relaxed vs strick definition of CpG islands at www.ncbi.nlm.nih.gov/projects/mapview/static/humansearch.html#cpg; all of which are incorporated by referenence herein in their entirety). In particular aspects "CpG" island (CGI) refers to the more strick definition (Id).
"Stringent hybridisation conditions," as defined herein, involve hybridising at 68°C in 5x SSC/5x Denhardfs solution/1.0% SDS, and washing in 0.2x SSC/O.l % SDS at room temperature, or involve the art-recognized equivalent thereof (e.g., conditions in which a hybridisation is carried out at 60°C in 2.5 x SSC buffer, followed by several washing steps at 37°C in a low buffer concentration, and remains stable). Moderately stringent conditions, as defined herein, involve including washing in 3x SSC at 42°C, or the art-recognized equivalent thereof. The parameters of salt concentration and temperature can be varied to achieve the optimal level of identity between the probe and the target nucleic acid. Guidance regarding such conditions is available in the art, for example, by Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; and Ausubel et al. (eds.), 1995, Current Protocols in Molecular Biology, (John Wiley & Sons, N.Y.; incorporated herein by reference) at Unit 2.10.
The term "methylation state" or "methylation status" refers to the presence or absence of 5-methylcytosine ("5-mCyt") at one or a plurality of CpG dinucleotides within a DNA sequence. Methylation states at one or more particular CpG methylation sites (each having two CpG dinucleotide sequences) within a DNA sequence include "unmethylated," "fully-methylatec1" and "hemi-methylated."
The term "hemi-methylation" or "hemimethylation" refers to the methylation state of double stranded DNA wherein only one strand thereof is methylated.
The term "hypermethylation" refers to the average methylation state corresponding to increased presence of 5-mCyt at one or a plurality of CpG dinucleotides within a DNA sequen<
of a test DNA sample, relative to the amount of 5-mCyt found at corresponding CpG dinucleotides within a normal control DNA sample.
The term "hypomethylation" refers to the average methylation state corresponding to a decreased presence of 5-mCyt at one or a plurality of CpG dinucleotides within a DNA sequence of a test DNA sample, relative to the amount of 5-mCyt found at corresponding CpG dinucleotides within a normal control DNA sample.
The term "bisulfite reagent" refers to a reagent comprising bisulfite, disulfite, hydrogen sulfite or combinations thereof, useful as disclosed herein to distinguish between methylated and unmethylated CpG dinucleotide sequences.
The term "Methylation assay" refers to any assay for determining the methylation state of one or more CpG dinucleotide sequences within a sequence of DNA.
The term "MS.AP-PCR" (Methylation-Sensitive Arbitrarily-Primed Polymerase Chain Reaction) refers to the art-recognized technology that allows for a global scan of the genome using CG-rich primers to focus on the regions most likely to contain CpG dinucleotides, and described by Gonzalgo et al, Cancer Research 57:594-599, 1997.
The term "MethyLight™" refers to the art-recognized fluorescence-based real-time PCR technique described by Eads et al, Cancer Res. 59:2302-2306, 1999.
The term "HeavyMethyl™" assay, in the embodiment thereof implemented herein, refers to an assay, wherein methylation specific blocking probes (also referred to herein as blockers) covering CpG positions between, or covered by the amplification primers enable methylation- specific selective amplification of a nucleic acid sample.
The term "HeavyMethyl™ MethyLight™" assay, in the embodiment thereof implemented herein, refers to a HeavyMethyl™ MethyLight™ assay, which is a variation of the MethyLight™ assay, wherein the MethyLight™ assay is combined with methylation specific blocking probes covering CpG positions between the amplification primers.
The term "Ms-SNuPE" (Methylation-sensitive Single Nucleotide Primer Extension) refers to the art-recognized assay described by Gonzalgo & Jones, Nucleic Acids Res. 25:2529- 2531, 1997.
The term "MSP" (Methylation-specific PCR) refers to the art-recognized methylatic assay described by Herman et al. Proc. Natl. Acad. Sci. USA 93:9821-9826, 1996, and by L Patent No. 5,786,146.
The term "COBRA" (Combined Bisulfite Restriction Analysis) refers to the ai recognized methylation assay described by Xiong & Laird, Nucleic Acids Res. 25:2532-253 1997.
The term "MCA" (Methylated CpG Island Amplification) refers to the methylation assay described by Toyota et al, Cancer Res. 59:2307-12, 1999, and in WO 00/26401 Al .
Colorectal cancer (CRC):
Colorectal cancer (CRC) is a heterogeneous disease in which unique subtypes are characterized by distinct genetic and epigenetic alterations. Comprehensive genome-scale DNA methylation profiling of 125 colorectal tumors and 29 adjacent normal tissues was performed, and four DNA methylation-based subgroups of CRC were identified using model-based cluster analyses. Each subtype shows characteristic genetic and clinical features, indicating that they represent biologically distinct subgroups.
In particular aspects, a CIMP-high (CIMP-H) subgroup, which exhibits an exceptionally high frequency of cancer-specific DNA hypermethylation, is strongly associated with MLH1 DNA hypermethylation and the BRAFV600E mutation.
In additional aspects, a CIMP-low (CIMP-L) subgroup is enriched for KRAS mutations and characterized by DNA hypermethylation of a subset of CIMP-H associated markers rather than a unique group of CpG islands.
In further aspects, non-CIMP tumors are separated into two distinct clusters. One non- CIMP subgroup is distinguished by a significantly higher frequency of TP53 mutations and frequent occurrence in the distal colon, while the tumors that belong to the fourth group exhibit a low frequency of both cancer-specific DNA hypermethylation and gene mutations, and are significantly enriched for rectal tumors.
In yet further aspects, 112 genes were identified that were downregulated more than 2- fold in CIMP-H tumors together with promoter DNA hypermethylation. These represent approximately 7% of genes that acquired promoter DNA methylation in CIMP-H tumors. Intriguingly, 48/112 genes were also transcriptionally silent in non-CIMP subgroups, but this was not attributable to promoter DNA hypermethylation.
In particular aspects, therefore, four distinct DNA methylation subgroups of CRC were identified, and provide novel insight regarding the role of CIMP-specific DNA hypermethylation in gene silencing.
CRC can be classified based on various molecular features. Identification ar characterization of these subtypes has been not only essential to better understand the disea; (Jass, 2007), but also valuable in selection of optimal drug treatments, prediction of patie survival, and discovery of risk factors linked to a particular subtype (Walther et al, 200 Limsui et al., 2010). The Illumina Infmium DNA methylation assay was used herein
investigate DNA methylation-based subgroups in CRC. This BeadArray platform interrogates the gene promoter DNA methylation of all 14,495 consensus coding DNA sequence (CCDS) genes in multiple samples simultaneously and is therefore suitable for a study requiring large- scale promoter DNA methylation profiling of a large number of samples (Bibikova, 2009). Using this platform, four DNA methylation subgroups of CRC were identified herein, based on model-based unsupervised cluster analyses. Importantly, the genetic and clinical correlations observed with each subtype indicate that they represent biologically distinct subgroups.
One subgroup, designated here as CIMP-H, contained all of the CIMP -positive tumors characterized by the MethyLight five-marker panel (i.e., CACNA1G, IGF2, NEUROG1, RUNX3, SOCS1)) previously developed in Applicants' laboratory (Weisenberger et al, 2006) (see also FIGURE 1 herein). Other features associated with the CIMP-H subgroup we described here are in agreement with those observed in the CIMP1 subtype (Shen et al., 2007) and the high- methylation epigenotype (HME) (Yagi et al, 2010) described previously.
Six CIMP-H tumors were identified herein, based on the Infinium DNA methylation data, that did not meet the criteria for CIMP using the MethyLight five-gene panel. The MethyLight-based marker panel was developed based on the screening of 195 MethyLight markers (Weisenberger et al, 2006). In the current study, Applicants measured DNA methylation at a much larger number of loci using the Illumina Infinium DNA methylation platform (27,578 CpG sites located at 14,495 gene promoters). According to particular aspects, the additional loci present on the array more accurately identified CIMP tumors, compared to the conventional MethyLight-based five -marker panel. This increased accuracy is likely a reflection of both the inclusion of additional markers which are more tightly associated with CIMP, and the mere fact that a larger number of informative loci will usually outperform a small panel of informative loci. The limited MethyLight panel was designed to be particularly compatible with cost-effective processing of large numbers of formalin-fixed, paraffin-embedded (FFPE) samples, and evertheless, the five-marker CIMP panel has been found to be very useful in large- scale studies of FFPE samples. However, any small panel of markers will likely have some misclassification error in identifying a complex molecular profile, regardless of the composition of the panel.
According to particular aspects, the instant results provide new diagnostic DN methylation marker panels to identify CIMP (CIMP-H and CIMP-L), as well as to segrega CIMP-H tumors from CIMP-L tumors (see EXAMPLE 6, and FIGURE 5 herein).
Figure 5 shows, according to particular exemplary aspects, diagnostic CIMP-definii gene marker panels based on the Infinium DNA methylation data. The Dichotomous heat m
of the Infinium DNA methylation data is shown. Black bars indicate DNA methylation β-value > 0.1 , and white bars indicate DNA methylation β-value < 0.1. The panel of five markers shown on the top (CIMP-H & CIMP-L) is used to identify CIMP-H and CIMP-L tumors. The panel of five markers shown on the bottom (CIMP-H specific) is used to specifically identify CIMP-H tumors.
Ogino and colleagues proposed the CIMP-low subgroup, which showed DNA hypermethylation of CIMP-defining markers despite at a low frequency and enrichment for KRAS mutations (Ogino et al., 2006). Applicants herein identified the CIMP-L subgroup through a genome-scale approach and provided a comprehensive DNA methylation profile of these tumors. Importantly, the CIMP-L-associated DNA methylation appears to occur only at a subset of CIMP-H-associated sites, as Applicants did not find evidence for strong CIMP-L- specific DNA methylation at a unique set of CpG sites. Moreover, Applicants found that although KRAS mutations are enriched in CIMP-L tumors, this subtype may not be driven by KRAS mutations, since DNA hypermethylation profiles in KRAS wild-type and mutant tumors within CIMP-L tumors were highly correlated across the CpG sites we examined. The independence of KRAS mutations from CIMP-L status suggests that a more complex molecular signature exists in driving CIMP-L DNA methylation profiles. Recently, Applicants and others have hypothesized that BRAF mutations might be favorably selected in the specific environment that CIMP creates (Hinoue et al., 2009; Suzuki et al., 2010). Similar mechanisms may also result in the enrichment of KRAS mutations in the CIMP-L subgroup.
Shen and colleagues (Shen et al, 2007) reported the CIMP2 subset, along with CIMP1 (CIMP-H) and non-CIMP subsets of CRC, using a 28-gene panel. They found a very strong association of CIMP2 with KRAS mutations (92%), together with DNA hypermethylation of several CIMP-H-associated loci. The CIMP2 subgroup may be similar to the CIMP-L subgroup we identified in our study. However, the present Applicants only detected a KRAS mutation frequency of approximately 50% in CIMP-L tumors. The differences in KRAS mutation frequencies between Applicants' CIMP-L and CIMP2 of Shen et al. likely arise from differences in the CRC patient collections and in the genomic features and technologies used to analyze DNA methylation subgroups of CRC in both studies.
Applicants did not find a statistically significant association of MGMT DN hypermethylation and CIMP-L status. However, Ogino and colleagues reported statistic significance in their recent report (Ogino et al., 2007). The differences between the insta results and those of Ogino and colleagues may arise from several sources. First, Ogino ar colleagues used a different criterion for classifying CIMP-L tumors. Specifically, they classify
a tumor sample as CIMP-L if one or two markers from the MethyLight-based CIMP panel showed DNA methylation. By contrast, Applicants' CIMP-L classification was based on Infinium DNA methylation data, a more robust resource of CIMP-L gene markers. Additionally, possible disparities in the CRC sample collections between the studies, such as ethnic population differences, may contribute to CIMP-L classification differences. Finally, there are differences in sample sizes between both studies, which may also contribute to statistical evaluation of CIMP in both collections of CRC tumors.
In particular aspects, Applicants also obtained gene expression profiles in pairs of CIMP- H and non-CIMP tumor-normal adjacent tissues to gain insight into the role of CIMP-specific DNA hypermethylation in colorectal tumorigenesis. Aberrant DNA methylation of promoter CpG islands has been established as an important mechanism that inactivates tumor suppressor genes in cancer (Jones and Baylin, 2007). However, many cancer-specific CpG island hypermethylation events are also found in promoter regions of genes that are not normally expressed, and these may represent "passenger" events that do not have functional consequences (Widschwendter et al, 2007; Gal- Yam et al, 2008). In additional aspects, therefore, Applicants examined effects of CIMP-associated DNA hypermethylation on gene expression, and determined found that only 7.3% of the CIMP-H-specific DNA methylation markers showed a strong inverse relationship with their gene expression levels (see EXAMPLE 7, and FIGURES 6A-C herein). Similar observations have been made in the glioma-CpG island methylator phenotype (G-CIMP) (Noushmehr et al., 2010). Although a larger sample size is required for better estimates, the present Applicants' observations might reinforce the hypothesis that CIMP represents a broad epigenetic control defect that accompanies a large number of "passenger" DNA hypermethylation events (Weisenberger et al., 2006).
In particular aspects, 112 genes were identified herein that showed both promoter DNA hypermethylation and reduction in gene expression in CIMP-H tumors (see EXAMPLE 7, and FIGURES 6A-C herein). Importantly, 12 of these genes were found to also show DNA hypermethylation with concomitant reduction in gene expression level in non-CIMP tumors, indicating that aberrant DNA methylation and transcriptional silencing of these genes may be important in the development of CRC, irrespective of molecular subtype. Intriguingly, ther~ include SFRP1 and SFRP2, which function as negative regulators of Wnt signaling. DN hypermethylation of SFRP genes has been observed in the majority of aberrant crypt fo (ACFs) and tumorigenesis (Baylin and Ohm, 2006). DNA hypermethylation and transcription silencing of other genes such as TMEFF2 and SLIT3 have also been reported (Young et a
2001; Dickinson et al., 2004). However, the functional significance of the inactivation of these genes has not been established in CRC.
In yet further aspects, Applicants observed that of the 112 genes that exhibited DNA hypermethylation and reduced gene expression in CIMP-H tumors, 48 were also silenced in non-CIMP tumors, but without substantial increases in DNA methylation. CIMP status in CRC has been found to be inversely correlated with the occurrence of chromosomal instability (CIN), which is characterized by aneuploidy, gain and loss of subchromosomal genomic regions and high frequencies of loss of heterozygosity (LOH) (Goel et al, 2007; Cheng et al, 2008). Recently, Chan and colleagues identified genes that are inactivated by both genetic mechanisms (mutation or deletion) and DNA hypermethylation in breast and colorectal cancer (Chan et al., 2008). They observed that these genetic and epigenetic changes are generally mutually exclusive in a given tumor, and that silencing of these genes was associated with poor clinical outcome (Chan et al, 2008). Together, these genes may act as key tumor suppressor genes in CRC and the gene silencing mechanisms can be determined by the underlying molecular pathways involved in colorectal tumorigenesis.
The molecular mechanisms that account for CIMP have not been identified. It has been proposed that CIMP arises through a distinct pathway originating in a variant of hyperplastic polyps and sessile serrated adenomas due to the similar histological and molecular features shared by the CIMP tumors and these lesions (O'Brien, 2007). Some individuals and families with hyperplastic polyposis syndrome have an increased risk of developing CIMP CRC, indicating the existence of a genetic predisposition that could lead to CIMP (Young et al, 2007). Environmental exposures might also influence the risk of developing CIMP CRC. Cigarette smoking was found to be associated with increased risk of developing CIMP CRC in a recent report (Limsui et al, 2010)
Applicant's present sturdy provides the most comprehensive genome-scale analysis of
DNA methylation-based subgroups of CRC to date. In particular aspects, the unique DNA methylation profiles in CRC, together with genomic changes, provide a detailed molecular landscape of colorectal tumors. According to particular aspects, the findings have substantial clinical utility for identification and diagnosis of colorectal cancer, as well as for determinir ~ particular treatments for CRC patients.
EXAMPLE 1
(Methods)
Primary colorectal tissue sample collection and processing. Twenty-five paired colorectal tumor and histologically normal adjacent colonic tissue samples were obtained from colorectal cancer patients who underwent surgical resection at the department of surgery in the Groene Hart Hospital, Gouda, The Netherlands. Tissue samples were stored at -80°C within one hour after resection. Tissue sections from the surgical resection margin were examined by a pathologist (CM. van Dijk) by microscopic observation. All patients provided written informed consent for the collection of samples and subsequent analysis. The study was approved by the Institutional Review Board of the Groene Hart Hospital in Gouda and the Leiden University Medical Center and University of Southern California. An additional collection of 100 fresh- frozen colorectal tumor samples and four matched histologically normal-adjacent colonic mucosa tissue samples were obtained from the Ontario Tumor Bank Network (The Ontario Institute for Cancer Research, Ontario, Canada). The tissue collection and analyses were approved by the University of Southern California Institutional Review Board. Genomic DNA and total RNA were extracted simultaneously from the same tissue sample using the TRIZOL® Reagent (Invitrogen, Burlington, ON) according to the manufacturer's protocol.
Mutation analysis. BRAF (NM 004333.4; GL 187608632) mutations at codon 600 in exon 15 and KRAS (NG 007524.1; GI: 17686616) mutations at codons 12 and 13 in exon 2 were identified using the pyrosequencing assay. Sepecifically, a 224 bp fragment of the BRAF gene containing exon 15 was amplified from genomic DNA using the following primers: 5' TCA TAA TGC TTG CTC TGA TAG GA 3' (SEQ ID NO: l) and 5'Biotin-GGC CAA AAA TTT AAT CAG TGG A 3 '(SEQ ID NO:2), and genotyped with the sequencing primer 5' CCA CTC CAT CGA GAT T 3' (SEQ ID NO:3). Similarly, a 214 bp fragment of the KRAS gene containing exon 2 was amplified from each genomic DNA sample using the following primers: 5'Biotin-GTG TGA CAT GTT CTA ATA TAG TCA 3' (SEQ ID NO:4) and 5' GAA TGG TCC TGC ACC AGT AA 3' (SEQ ID NO:5), and genotyped with the sequencing primer 5' GCA CTC TTG CCT ACG 3' (SEQ ID NO:6).
Mutations in TP53 exons 4 through 8 were determined by direct sequencing of PC" products. Specifically, TP53 exons 4 through 8 were amplified by PCR using three exoi specific primer sets: Exon 4, 5*-GTT CTG GTA AGG ACA AGG GTT-3* (forward) (SEQ I NO:7) and 5*-CCA GGC ATT GAA GTC TCA TG-3* (reverse) (SEQ ID NO:8) (Tm = 49°C Exons 5 and 6, 5*-GGT TGC AGG AGG TGC TTA C-3* (forward) (SEQ ID NO:9) and 5*-CC CTG ACA ACC ACC CTT AAC-3* (reverse) (SEQ ID NO: 10) (Tm = 5 FC); Exons 7 and 8, i
CCT GCT TGC CAC AGG TCT C-3* (forward) (SEQ ID NO: l 1) and 5*-TGA ATC TGA GGC ATA ACT GCA C-3* (reverse) (SEQ ID NO:12) (Tm = 51°C). PCR amplification was performed using a touchdown protocol with an initial step of 95°C for 12 minutes, then 5 cycles of 95°C for 25 sec, Tm + 15°C for 1 min and 72°C for 1 min, then 5 cycles of 95°C for 25 sec, Tm + 10°C for 1 min and 72°C for 1 min, followed by 5 cycles of 95°C for 25 sec, Tm + 5°C for 1 min and 72°C for 1 min, finishing with 35 cycles of 95°C for 25 sec, Tm°C for 1 min and 72°C for 1 min.
Sequencing of the purified PCR products was performed using an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA). Cycle sequencing reactions were performed in a thermal cycler for 25 cycles at 96°C for 10 sec, annealing at 50°C for 5 sec, and extension at 60°C for 4 min. Prior to capillary electrophoresis, unincorporated dye terminators were removed from the extension product using a DyeEx 96 Plate (Qiagen, Valencia, CA) according to the manufacturer's instructions. The purified extension products were denatured at 90°C for 2 min and placed on ice for 1 min. Sequencing was performed on an ABI PRISM 3730x1 DNA Analyzer (Applied Biosystems). The sequencing output files (.abl) were processed using the Phred/Phrap software package developed at the University of Washington (Nickerson et al, 1997; Ewing and Green, 1998; Ewing et al, 1998; Gordon et al, 1998). Sequence Alignments for each exon read were viewed in the Consed Viewer Software and sequence variations were annotated and recorded.
Samples containing missense mutations, nonsense mutations, splice-site mutations, frame-shift mutations, and in-frame deletions were considered positive for a mutation.
DNA methylation assays. For MethyLight-based assays, genomic DNAs were treated with sodium bisulfite using the Zymo EZ DNA Methylation Kit (Zymo Research, Orange, CA) and subsequently analyzed by MethyLight as previously described (Campan et al, 2009; incorporated herein by reference it its entirety). The primer and probe sequences for the MethyLight reactions for the five-gene CIMP marker panel and MLHl were reported previously (Weisenberger et al., 2006; incorporated herein by reference in its entirety). The results of the MethyLight assays were scored as PMR (Percent of Methylated Reference) values as previously defined, with a PMR of >10 was used as a threshold for positive DNA methylation in eac1" sample (Weisenberger et al, 2006; Campan et al, 2009). A sample was scored as CIM1 positive if > 3 of the five CIMP-defming markers gave PMR values > 10.
The Illumina Infmium HumanMethylation27 DNA methylation assay technology hi been described previously (Bibikova, 2009; incorporated herein by reference in its entirety Briefly, genomic DNA was bisulfite converted using the EZ-96 DNA Methylation Kit (Zyn
Research) according to the manufacturer's instructions. The amount of bisulfite converted DNA and completeness of bisulfite conversion was assessed using a panel of MethyLight-based quality control (QC) reactions as previously described (Campan et al, 2009). All of the samples in this study passed Applicants' QC tests and entered into the Infinium DNA methylation assay pipeline. The Infinium DNA methylation assay was performed at the USC Epigenome Center according to the manufacturer's specifications (Illumina, San Diego, CA). The Illumina Infinium DNA methylation assay examines DNA methylation status of 27,578 CpG sites located at promoter regions of 14,495 protein-coding genes and 110 microRNAs. A measure of the level of DNA methylation at each CpG site is scored as beta (β) values ranging from 0 to 1 , with values close to 0 indicating low levels of DNA methylation and close to 1 high levels of DNA methylation (Bibikova, 2009). The detection P values measure the difference of the signal intensities at the interrogated CpG site compared to those from a set of 16 negative control probes embedded in the assay. All data points with a detection P value >0.05 were identified as not statistically significantly different from background measurements, and therefore not trustworthy measures of DNA methylation. These data points were replaced by "NA" values as previously described (Noushmehr et al., 2010). More specifically, for the Illumina Infinium DNA methylation data analysis, data points were masked as "NA" for probes that might be unreliable (see the Supplemental Methods). All data points with a detection P value >0.05 were identified and replaced by "NA" values. Finally, probes that are designed for sequences on either the X- or Y-chromosome were excluded. DNA methylation data sets which did not contain any "NA"-masked data points were analyzed. DNA methylation Pvalues were normalized to eliminate the batch effects. Briefly, the batch means of β-values were brought closer to the overall mean while retaining the original range of DNA methylation data (0 to 1) (Pan et al., manuscript in preparation). Only the tumor samples were used to calculate the batch means and overall mean in estimating the scaling factor for each batch. For the gene expression analysis, unreliable probes (9%), as described by Barbosa-Morais et al, were removed from the subsequent analysis (Barbosa-Morais et al, 2010). Data point were masked as "NA" for probes that contained single-nucleotide polymorphisms (SNPs) (dbSNP NCBI build 130/hgl8) within the five base pairs from the interrogated CpG site or that overlap with a repetitive element th" covers the targeted CpG dinucleotide. Furthermore, data points were replaced with "NA" fi probes that are not uniquely aligned to the human genome (NCBI build 36/hgl8) at 1 nucleotides at the 3' terminus of the probe sequence, and those that overlap with regions i insertions and deletions in the human genome. Together, data points for 4,484 probes we masked. The assay probe sequences and detailed information on each interrogated CpG site ar
the associated genomic characteristics on the HumanMethylation27 BeadChip can be obtained at www.illumina.com, and these data are incorporated herein by reference in their entirety. All Infinium DNA methylation data are available at the NCBI Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE25062, and these data are incorporated herein by reference in their entirety.
Validation of Infinium DNA methylation data by MethyLight assay. Genomic DNA from
25 pairs of colorectal tumor and their adjacent normal samples were treated with sodium bisulfite using the Zymo EZ96 DNA Methylation Kit (Zymo Research) and subsequently analyzed by MethyLight as previously described (Campan et al., 2009). Primers and probes used for validation are as follows and are listed as 5' to 3' : SFRP1, forward primer: 5' GAA TTC GTT CGC GAG GGA 3' (SEQ ID NO: 13), reverse primer: 5' AAA CGA ACC GCA CTC GTT ACC 3' (SEQ ID NO:14), probe: 6FAM-CCG TCA CCG ACG CGA AAA CCA AT- BHQ-1 (SEQ ID NO: 15); TMEFF2, forward primer: 5' GTT AAA TTC GCG TAT GAT TTC GAG A 3' (SEQ ID NO: 16), reverse primer: 5' TTC CCG CGT CTC CGA C 3' (SEQ ID NO: 17), probe: 6FAM-AAC GAA CGA CCC TCT CGC TCC GAA-BHQ-1 (SEQ ID NO: 18); LMODl, forward primer: 5' TTT TAA AGA TAA GGG GTT ACG TAA TGA G 3' (SEQ ID NO: 19), reverse primer: 5' CCG AAC TAA CGA ATT CAC CGA C 3' (SEQ ID NO:20), probe: 6FAM-TCG TCC CTA CTT ATC TAA CTC TCC GTA-MGBNFQ (SEQ ID NO:21). The results of the MethyLight assays were scored as PMR (Percent of Methylated Reference) values as previously defined (Weisenberger et al, 2006; Campan et al, 2009).
Gene expression assay. Gene expression assay was performed on 25 pairs of colorectal tumor and non-tumor adjacent tissue samples using the Illumina Ref-8 whole-genome expression BeadChip (HumanRef-8 v3.0, 24,526 transcripts) (Illumina). Scanned image and bead-level data processing were performed using the BeadStudio 3.0.1 software (Illumina). The summarized data for each bead type were then processed using the lumi package in Bioconductor (Du et al., 2008). The data were log2transformed and normalized using Robust Spline Normalization (RSN) as implemented in the lumi package. Specifically, total RNA from
26 pairs of colorectal tumor and non-tumor adjacent tissue samples was isolated using the TRIZOL® Reagent (Invitrogen, Burlington, ON) according to the manufacturer's protocol. Tr ~ concentrations of RNA samples were measured using the NanoDrop 8000 (Thermo Fish Scientific, Waltham, MA). The quality of the RNA samples was assessed using the Experic RNA StdSens analysis kit (Bio-Rad, Hercules, CA). Expression analysis was performed usir the Illumina Ref-8 whole-genome expression BeadChip (HumanRef-8 v3.0, 24,526 transcript (Illumina, San Diego, CA). Briefly, RNA samples were processed using the Illumina TotalPn
R A Amplification Kit (Illumina). Total RNA (500ng) from each sample was subject to reverse transcription with an oligo(dT) primer bearing a T7 promoter. The cDNA then underwent second strand synthesis and purification. Biotinylated cR A was then generated from the double-stranded cDNA template through in vitro transcription with T7 RNA polymerase. The biotinylated cRNA (750ng) from each patient was then hybridized to the BeadChips. The hybridized chips were stained and scanned using the Illumina HD BeadArray scanner (Illumina). Scanned image and bead-level data processing were performed using the BeadStudio 3.0.1 software (Illumina). The summarized probe profile data and processed expression data are available at the NCBI Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/) under accession number GSE25070, and these data are incorporated herein by reference in their entirety.
Validation of the Illumina gene expression array data by quantitative RT-PCR assay. Total RNA sample from 25 pairs of colorectal tumor and non-tumor adjacent tissue samples were treated with DNase using ΌΝΑ-free™ kit (Applied Biosystems) to remove contaminating DNA. Reverse transcription reaction was performed using iScript Reverse Transcription Supermix for RT-PCR (Bio-Rad). Quantitative RT-PCR assays were performed with primers and probes obtained from Applied Biosystems (SFRP1: Hs00610060_ml_M; TMEFF2: Hs00249367_ml_M; LMOD1: Hs00201704_ml_M). The raw expression values were normalized to those oiHPRTl (Hs99999909_ml_M).
Unsupervised clustering. Recursively partitioned mixture model (RPMM) was used for the identification of colorectal tumor subgroups based on the Illumina Infinium DNA methylation data. RPMM is a model-based unsupervised clustering approach developed for beta-distributed DNA methylation measurements that lie between 0 and 1 and implemented as RPMM Bioconductor package (Houseman et al., 2008). Probes were identified that do not contain any "NA"-masked data points and then RPMM clustering was performed on 2,758 probes (ten percent of original probes) that showed the most variable DNA methylation levels across the colorectal tumor panel. A fanny algorithm (a fuzzy clustering algorithm) was used for initialization and level-weighted version of Bayesian information criterion (BIC) as a split criterion for an existing cluster as implemented in the R-based RPMM package. The log:i (logistic) transformation was applied to DNA methylation β-values and each probe was medial centered across the tumor samples. Consensus clustering was then performed using the san 2,728 Infinium DNA methylation probes that were used for RPMM-based clustering. Tl optimal number of clusters was assessed based on 1,000 re-sampling iterations (seed valu
1022) of K-means clustering for K=2,3,4,5,6 with Pearson correlation as the distance metric as implemented in the R/Bioconductor ConsensusClusterPlus package.
Statistical analysis and visualization. Statistical analysis and data visualization were carried out using the R/Biocoductor software packages (http://www.bioconductor.org). The Wilcoxon Rank Sum test and the Wilcoxon Signed Rank test were used to evaluate the difference in DNA methylation β-value for each probe between two independent groups and between tumor and matched adjacent normal tissues, respectively. False-discovery rate (FDR) adjusted P values for multiple comparisons were calculated using Benjamini and Hochberg approach. The Illumina Infinium DNA methylation Pvalues were represented graphically using a heatmap, generated by the R/Bioconductor packages gplots and Heatplus. Ordering of the samples within a RPMM class in the heatmaps was obtained by using the function "seriate" in the seriation package.
Classification and selection of cancer-specific DNA methylation markers. Gene promoters that exhibited cancer- specific DNA methylation were categorized into three groups. Four hundred fifteen (415) unique gene promoters were selected that showed significant CIMP- H-specific DNA hypermethylation (FDR-adjusted P < 0.0001 for CIMP-H vs. non-CIMP tumors and P > 0.05 for CIMP-L vs. non-CIMP tumors), and seventy three (73) gene promoters were selected that showed DNA hypermethylation in both CIMP-H and CIMP-L tumors (FDR- adjusted P < 0.0001 for CIMP-H vs. non-CIMP and CIMP-L vs. non-CIMP). For the third category, five hundred forty seven (547) genes were identified that acquired cancer-specific DNA hypermethylation irrespective of CIMP status (FDR-adjusted P < 0.00001 for 29 paired tumor vs. adjacent non-tumor tissue). The genes are listed in Table 4. (Supplemental Table 4 for a list of genes).
Identification of diagnostic CIMP -associated DNA methylation gene marker panels. The top 20 Infinium DNA methylation probes that are significantly hypermethylated in CIMP (CIMP-H and CIMP-L) compared with non-CIMP tumors based on the Wilcoxon rank-sum test were first selected. Using the conditions that DNA methylation β-value > 0.1 of three or more markers qualifies a sample as CIMP, a five-probe panel was determined that best classify CIM" (CIMP-H and CIMP-L) by calculating sensitivity and specificity, and overall misclassficatic rate for each random combination of the top 20 probes. For the CIMP-H-specific marker pane top 20 probes were first selected that are significantly hypermethylated in CIMP-H compare with CIMP-L tumors. A five-marker panel was then chosen that showed the best sensitivity ar
specificity, and overall misclassfication rate to classify CIMP-H using the conditions that three or more markers show DNA methylation β-value threshold of > 0.1.
Integrated analyses of the IUumina Infinium DNA methylation and gene expression data. One probe was selected for each gene that showed the highest absolute mean β-value difference between tumor and normal-adjacent samples. The DNA methylation was then merged with the gene expression data set using Entrez Gene IDs using the R merge function. Expression data points with a detection P value >0.01, computed by BeadStudio software, were considered as not distinguishable from the negative control measurements, and therefore not expressed. A mean β-value difference (|Δβ|) of 0.20 was used as a threshold for differential DNA methylation. This threshold of |Δβ| = 0.20 was determined previously as a stringent estimate of Δβ detection sensitivity across the range of β-values (Bibikova, 2009).
EXAMPLE 2
(DNA methylation-based colorectal cancer classification was established; four distinct tumor subgroups were identified)
Comprehensive genome-scale DNA methylation profiling of 125 colorectal tumor samples and 29 histologically normal-adjacent colonic tissue samples was performed using the Illumina Infinium DNA methylation assay, which assesses the DNA methylation status of 27,578 CpG sites located at the promoter regions of 14,495 protein-coding genes (Bibikova, 2009) (see working Example 1 above for more details). The mutation status of the BRAF, KRAS, and TP53 genes was also identified in the tumor samples. CRC subtypes were first determined based on DNA methylation profiles in the collection of 125 tumor samples. Probes that might be unreliable (see the Supplemental Methods section) and probes that are designed for sequences on either the X- or Y-chromosome were excluded. The top ten percent of probes with the highest DNA methylation variability based on standard deviation of the DNA methylation β-value across the entire colorectal tumor panel (2,758 probes) was selected, and then unsupervised clustering was performed using a recursively partitioned mixture model (RPMM). RPMM is a model-based unsupervised clustering method specifically developed for beta-distributed DNA methylation data such as obtained on the Infinium DNA methylatic ~ assay platform (Houseman et al, 2008). We identified four distinct tumor subgroups we identified by this approach, and designated as clusters 1, 2, 3 and 4 (Figure 1). Figure 1 show according to particular exemplary aspects, RPMM-based classification and heami representation of 125 colorectal tumor samples using Infinium DNA methylation data. DN methylation profiles of 1,401 probes with most variable DNA methylation values (standai
deviation >0.20) in the 125 colorectal tumor sample set are shown. The DNA methylation β- values are represented by using a color scale from dark blue (low DNA methylation) to yellow (high DNA methylation), herein reproduced in gray-scale. Four subgroups were derived by RPMM-based clustering and are indicated above the heatmap: lightsky blue, cluster 1 (n=28); lightcoral, cluster 2 (n=29); yellow, cluster 3 (n=37) and dark gray, cluster 4 (n=31), herein reproduced in gray-scale. CIMP-positive tumors as classified by the MethyLight five-marker panel (Weisenberger et al., 2006) are indicated by black bars. Presence of MLH1 DNA methylation, BRAF mutation, KRAS mutation, and TP53 mutations are indicated by orange, blue, red, and purple bars, respectively, herein reproduced in gray-scale. Probes that are located within CpG islands (Takai- Jones) are indicated by the horizontal black bars to the right of the heatmap. The probes are arranged based on the order of unsupervised hierarchal cluster analysis using a correlation distance metric and average linkage method. Pie charts below the heatmap show the proportion of tumor samples harboring BRAF mutations (blue), KRAS mutations (red), and those wild-type for both BRAF and KRAS (yellow-green) within each subgroup, herein reproduced in gray-scale.
Genetic and clinical features of each cluster are summarized in Table 1 below.
Table 1. Genetic and clinical features found in each of the four DNA methylation-based subtypes
Cluster 1 Cluster 2
Overall Cluster 3 Cluster 4
(CIMP-H) (CIMP-L)
Variable
n % n % n % n % n %
Total 125 100 28 22 29 23 37 30 31 25
Gender Female 65 52 20 71 12 41 22 59 11 35
Male 60 48 8 29 17 59 15 41 20 65
Subsite Proximal 54 43 24 86 15 52 7 19 8 26
Transverse 7 6 1 4 1 3 2 5 3 10
Distal 49 39 3 11 11 38 24 65 11 36
Rectum 15 12 0 0 2 7 4 11 9 29
Stage 1 or 2 50 50 9 41 16 66 12 41 13 52
3 or 4 50 50 13 59 8 34 17 59 12 48
No info 25
BRAF Mutant 17 14 17 61 0 0 0 0 0 C mutation Wild-type 108 86 11 39 29 100 37 100 31
KRAS Mutant 34 27 5 18 13 45 11 30 5 li mutation Wild-type 91 73 23 82 16 55 26 70 26 8-
TP53 Mutant 43 34 3 11 11 38 24 65 5 li
mutation Wild-type 82 66 25 89 18 62 13 35 26 84
Age Median 68 71 70 65 69
Range 33-90 51-90 33-87 44-88 34-87
No info 25
For comparison, resampling-based unsupervised consensus clustering (Monti et al, 2003) of the DNA methylation data set was also performed, and four DNA methylationbased clusters were also identified using this method. The DNA methylation consensus cluster assignments for each sample were compared to their RPMM-based cluster assignments and substantial overlap was found with 80% (100/125) of the tumors showing agreement in cluster membership calls between these two different clustering methods (Figures 7A-D). Figures 7A- D show, according to particular exemplary aspects, (A) Delta area plot showing the relative change in area under the consensus cumulative distribution function (CDF) curve (Monti et al., 2003). (2?) Consensus matrix produced by K-means clustering (K = 4). ( ) The heatmap representation of 125 colorectal tumor samples using the Infinium DNA methylation data as shown in Figure 1. Cluster membership of each sample derived from RPMM-based clustering and consensus clustering are indicated as vertical bars with distinct colors above the heatmap (herein reproduced in gray-scale). (D) Contingency table comparing the cluster membership assignments between the two different clustering methods.
Subsequent analyses were based on cluster membership derived from RPMM-based unsupervised clustering method, which is particularly well-suited for beta-distributed DNA measurements, and has successfully identified DNA methylation profiles that are clinically relevant in normal and tumor samples from diverse tissues types (e.g., Christensen et al, 2009a; Christensen et al, 2009b; Marsit et al, 2009; Christensen et al, 2010; Christensen et al, 201 1 ; Marsit et al., 201 1).
The cluster 1 subgroup is enriched for CIMP -positive colorectal tumors, as determined by the CIMP-specific MethyLight five-marker panel developed previously in Applicants' laboratory (CACNA1G, IGF2, NEUROG1, RUNX3, SOCS1) (Weisenberger et al, 2006), as well as MLH1 DNA hypermethylation using MethyLight technology (see Figure 1 herein). All of tl tumors with BRAF mutation belong to this subgroup, and nearly half of the tumors in th subgroup that do not harbor BRAF mutations carry mutant KRAS (Figure 1). The cluster subgroup is also characterized by a low frequency of TP53 mutations (1 1%>). Clinically, tl majority of these tumors were found in female patients (71%) and have a proximal location
the colon (86%), both of which characteristics have been previously found to be associated with CIMP -positive CRC defined by the MethyLight fivemarker panel (Weisenberger et al., 2006).
Previous studies with a limited number of DNA methylation markers from several groups indicated the existence of additional DNA methylation-based subtypes in CRC which are associated with KRAS mutations. These subgroups have been variously described as CIMP-low (Ogino et al., 2006), CIMP2 (Shen et al., 2007), and Intermediate -methylation epigenotype (IME) (Yagi et al., 2010). It is not clear whether these classifications represent the same tumor subgroup or different subgroups within CRC. We found that although KRAS mutant tumors are represented across the four classes, they are more common in the cluster 2 subgroup compared to the other clusters (Figure 1 and Table 1). Interestingly, the proportion of the tumors that show DNA methylation at one or two loci of the MethyLight-based five-marker panel is substantially higher in the cluster 2 subgroup (62%>) than in the cluster 3 (1 1%) or cluster 4 tumors (13%) (Figures 8A-B). Figures 8A-B show, according to particular exemplary aspects, histogram analysis of the number of methylated CIMP-defining MethyLight-based markers in colorectal cancer samples. (A) Histogram analysis of the number of CIMP (e.g., CIMP-defining) loci methylated in all 125 colorectal tumor samples. (B) Histogram analysis of the number of CIMP- defining loci methylated in each RPMM-based tumor cluster membership.
These genetic and epigenetic characteristics observed in the cluster 2 subgroup are consistent with the CIMP-low subtype described previously (Ogino et al, 2006). Therefore, in this study, we refer to the tumors that belong to the cluster 1 subgroup as CIMP-high (CIMP-H) and the cluster 2 subgroup tumors as CIMP-low (CIMP-L).
Applicants' RPMM-based clustering analysis identified two other CRC subtypes, designated as clusters 3 and 4, in addition to the CIMP-H and CIMP-L subgroups (Figure 1 and Table 1). The difference between these two subgroups is not apparent based on DNA hypermethylation at the CIMP-defining five-gene loci (Figure 8), indicating that DNA methylation signatures unrelated to CIMP might discriminate between these two CRC subsets. The frequency and level of cancer-specific DNA hypermethylation in the tumors in cluster 4 subgroup appear to be the lowest among the four subclasses (Figure 9,). Figure 9 shows, according to particular exemplary aspects, scatter plot analyses comparing DNA methylatic " profiles of colorectal tumor and adjacent-normal samples, stratified by their RPMM-basi cluster membership.
Importantly, the tumors included in cluster 3 are distinguished by a significantly high frequency of TP53 mutations (65%) [P = 6.5x 10-5 (vs. cluster 4), Fisher's exact test] and the location in the distal colon (65%) [P = 0.028 (vs. cluster 4), Fisher's exact test]. In contrast, tl
tumors that belong to cluster 4 exhibit a lower frequency of both KRAS (16%) and TP 53 (16%) mutations, and their occurrence shows significant enrichment in the rectum compared to all the other groups (P = 2.1 x 10-3, Fisher's exact test). Cluster 4 tumors also show borderline statistical significance to be more commonly found in males compared to the cluster 3 tumors (P = 0.056, Fisher's exact test), providing additional lines of evidence that cluster 3 and 4 tumors are distinct.
A panel of 119 gene promoters was also identified that are constitutively methylated in normal samples, but show variable levels of DNA methylation in tumors (Figure 1, and see Table 2 for the list of genes). It has long been established that the human genome is comprised primarily of sequences of low CpG density which are usually highly methylated in normal somatic tissues, and which undergo loss of DNA methylation in cancer (Feinberg and Vogelstein, 1983; Gama-Sosa et al, 1983; Miranda and Jones, 2007). Applicants found that indeed the majority of these probes are targeted to low-CpG density regions. The variable loss of DNA methylation among Applicants' tumor clusters is consistent with earlier reports that the degree of global DNA hypomethylation can vary considerably among colorectal tumors (Estecio et al., 2007). A gene set enrichment analysis (GSEA) was performed herein on these 119 genes using The Database for Annotation, Visualization and Integrated Discovery tool (DAVID). Applicants found enrichment of genes involved in secretion (3.1 -fold enrichment, P = 1.9 x 10- 6), signaling (2.2-fold enrichment, P = 6.8 x 10-6), signal peptide (2.2-fold enrichment, P = 2.5 x 10-5), disulfide bond (2.3-fold enrichment, P = 1.8 x IO-5) and extracellular regions (2.3-fold enrichment, P = 6.8 x IO-4).
Table 2. Genes that are constitutively methylated in normal samples, but show variable levels of DNA hypomethylation in tumors
Observed
GC Content CpG/expected Mean
Standard over 250 bp CpG ratio beta-
ChromoDeviation
IlluminJD Symbol Gene_ID upstream over 250 bp value
some Adjacent and 250 bp upstream and adjacent
normal downstream 250 bp normal
downstream
cg24240626 REG3A 5068 2 0.52 0.09 0.70 0.08 cgl9728382 STC2 8614 5 0.53 0.61 0.46 0.16 cg22718139 HMGCS2 3158 1 0.51 0.28 0.50 0.15 cg26153642 HTR3E 285242 3 0.53 0.35 0.48 0.13 cg26777475 PCOLCE 5118 7 0.64 0.3 0.64 0.07 cg23640701 ACVRL1 94 12 0.64 0.61 0.43 0.08 cgl5914863 CYP2W1 54905 7 0.69 0.29 0.47 0.09 cgl9890739 GINS2 51659 16 0.57 0.44 0.41 0.09
Observed
GC Content CpG/expected Mean
Standard over 250 bp CpG ratio beta-
Chromo¬
IHumin ID Deviation
Svmbol Gene ID upstream over 250 bp value
some Adjacent and 250 bp upstream and adjacent
normal downstream 250 bp normal
downstream
cg26970800 GIF 2694 11 0.47 0.18 0.78 0.10 cgl 7741572 CFB 629 6 0.58 0.29 0.82 0.08 cgl9524009 NEK3 4752 13 0.4 0.46 0.51 0.14 eg 17044311 ABCC2 1244 10 0.35 0.27 0.81 0.07 cg21820890 PLA2G12B 84647 10 0.53 0.28 0.92 0.09 cg26628847 PIP 5304 7 0.52 0.09 0.64 0.07 cg22241 124 CNGA3 1261 2 0.49 0.27 0.77 0.05 cg22268164 TRHR 7201 8 0.46 0.24 0.77 0.05 cgl2188416 TP63 8626 3 0.43 0.31 0.56 0.09 cgl 5320474 UBD 10537 6 0.43 0.32 0.75 0.08 cg01053621 APOA2 336 1 0.47 0.18 0.74 0.07 cg01430430 SRRM3 222183 7 0.56 0.41 0.54 0.12 cgl0968815 BPIL1 80341 20 0.59 0.14 0.75 0.04 cgl3320683 RHOBTB1 9886 10 0.5 0.55 0.72 0.06 cgl2958813 ATP6V1G3 127124 1 0.42 0.09 0.81 0.07 cg03483654 DAK 26007 11 0.54 0.3 0.96 0.10 cg06277277 NR1I3 9970 1 0.49 0.17 0.66 0.09 cgl l871280 SLC16A7 9194 12 0.38 0.17 0.81 0.07 cg05187322 CARD 14 79092 17 0.54 0.56 0.63 0.16 cg04968426 PPP1R14D 54866 15 0.58 0.19 0.50 0.16 cgl0321723 PDZK1 5174 1 0.51 0.18 0.57 0.14 cgl 1518240 FKBP4 2288 12 0.5 0.86 0.88 0.06 cgl2582008 OLFM4 10562 13 0.47 0.33 0.63 0.13 cg0680671 1 MS4A1 931 11 0.45 0.12 0.69 0.07 cg07703337 ZNF610 162963 19 0.48 0.21 0.84 0.06 cgl0037068 WIPF1 7456 2 0.5 0.09 0.85 0.03 cgl l003133 AIM2 9447 1 0.48 0.21 0.64 0.13 cg24765446 WFDC6 140870 20 0.52 0.12 0.80 0.05 cgl0379687 SPINLW1 57119 20 0.51 0.12 0.67 0.05 eg 14662172 CPB2 1361 13 0.42 0.18 0.82 0.03 cg27609819 PLCL1 5334 2 0.44 0.12 0.83 0.05 cgl 8678121 SEC61A2 55176 10 0.51 0.88 0.75 0.12 cg25683185 ACRBP 84519 12 0.62 0.58 0.61 0.10 cgl4141399 HAS1 3036 19 0.61 0.37 0.69 0.12 cg27592318 HEMGN 55363 9 0.41 0.16 0.89 0.03 cgl 7829936 TAAR5 9038 6 0.5 0.26 0.72 0.10 cg21660392 ABCA8 10351 17 0.37 0.12 0.70 0.05 cgl4258236 OR5V1 81696 6 0.44 0.17 0.86 0.04 cg22983092 KRT25 147183 17 0.49 0.23 0.91 0.03 cgl3675849 TRPV5 56302 7 0.53 0.31 0.89 0.03 cg21122774 SARDH 1757 9 0.6 0.23 0.72 0.10
Observed
GC Content CpG/expected Mean
Standan over 250 bp CpG ratio beta-
Chromo¬
Illumin ID Symbol Gene_ID Deviatioi upstream over 250 bp value
some Adjacem and 250 bp upstream and adjacent
normal downstream 250 bp normal
downstream
cgl9241311 DEFB123 245936 20 0.55 0.19 0.68 0.05 cg26390526 FLG 2312 1 0.41 0.27 0.86 0.05 cgl 8982568 KRT77 374454 12 0.53 0.18 0.75 0.06 cg25995212 SCN7A 6332 2 0.44 0.12 0.84 0.05 cg23984130 IGKV7-3 28905 2 0.48 0.11 0.83 0.04 cgl4826683 SPRR2D 6703 1 0.45 0.12 0.75 0.06 cg20312687 DEFB1 18 117285 20 0.5 0.1 0.79 0.04 cgl 8152517 STRA8 346673 7 0.5 0.03 0.84 0.03 cgl7423978 SIRPD 128646 20 0.46 0.35 0.81 0.05 cg20556988 CCL1 6346 17 0.55 0.11 0.83 0.03 cg01910481 PLUNC 51297 20 0.46 0.07 0.88 0.05 cg06531741 HTR3B 9177 11 0.44 0.17 0.81 0.08 cgl2718562 TBC1D21 161514 15 0.49 0.17 0.83 0.04 cgl 1009736 MARCO 8685 2 0.52 0.21 0.62 0.06 cg00079056 SPI K4 27290 9 0.46 0.43 0.84 0.04 cg06275635 PGLYRP3 114771 1 0.44 0.09 0.76 0.04 cg08332212 MLN 4295 6 0.47 0.3 0.78 0.05 cgl0539808 KCTD1 284252 18 0.5 0.22 0.72 0.05 cgl 0784090 CLD 18 51208 3 0.52 0.39 0.87 0.04 cgO 1796228 LIFR 3977 5 0.5 0.58 0.75 0.05 cg09440243 PTPRD 5789 9 0.41 0.39 0.80 0.04 cgl0054857 C18orl20 221241 18 0.44 0.25 0.76 0.06 cg03109316 ZNF80 7634 3 0.56 0.44 0.90 0.02 cg08947964 GJA10 84694 6 0.36 0.26 0.83 0.06 cg05241571 KRTDAP 388533 19 0.57 0.2 0.91 0.02 cg03167883 FLJ46365 401459 8 0.51 0.19 0.69 0.08 cg07950803 CD1A 909 1 0.37 0.13 0.81 0.05 cg00463848 KRT2 3849 12 0.49 0.13 0.84 0.05 cg09458237 HSPA12B 116835 20 0.52 0.18 0.72 0.06 cg06501070 LPAR3 23566 1 0.42 0.23 0.71 0.07 cg01497576 SLC24A5 283652 15 0.55 0.19 0.76 0.04 cgl2682367 FLJ46358 4001 10 13 0.56 0.2 0.71 0.06 cg03731898 CPO 130749 2 0.43 0.13 0.80 0.04 cg08786003 FCRL3 115352 1 0.41 0.24 0.68 0.10 cgl2878228 PRSS1 5644 7 0.51 0.19 0.76 0.04 cgO 1446692 CER1 9350 9 0.38 0.22 0.70 0.06 cg02786019 TRPV6 55503 7 0.52 0.27 0.62 0.08 cgl0057218 GSDMB 55876 17 0.5 0.2 0.80 0.06 cg04457794 CTSE 1510 1 0.57 0.27 0.60 0.12 cg05109049 EVI2B 2124 17 0.32 0.24 0.48 0.14 cgl 1783497 IL1RN 3557 2 0.54 0.19 0.68 0.13
Observed
GC Content CpG/expected Mean
Standan over 250 bp CpG ratio beta-
ChromoDeviatioi
IlluminJD Symbol Gene_ID upstream over 250 bp value
some Adjacem and 250 bp upstream and adjacent
normal downstream 250 bp normal
downstream
eg 19099213 SPP2 6694 2 0.39 0.11 0.84 0.06 cg23067535 FAM83A 84985 8 0.65 0.44 0.62 0.14 cg22442090 GIMAP5 55340 7 0.52 0.21 0.72 0.04 cg26718420 C12orf59 120939 12 0.41 0.24 0.80 0.07 cgl7030820 MSMB 4477 10 0.49 0.3 0.84 0.08 cgl7827767 LRIT1 26103 10 0.63 0.23 0.82 0.05 eg 18959422 MYBPH 4608 1 0.6 0.22 0.61 0.06 cg20227165 PRDM11 56981 11 0.57 0.15 0.69 0.05 cgl7778867 KRTAP10-8 386681 21 0.6 0.14 0.70 0.11 cgl5075718 MFRP 83552 11 0.59 0.16 0.75 0.06 cg21044104 LYZL4 131375 3 0.46 0.16 0.67 0.08 cg20383064 BFSP2 8419 3 0.49 0.1 0.86 0.05 cg24490338 TPM3 7170 1 0.48 0.07 0.83 0.04 cgl7761453 LOR 4014 1 0.47 0.07 0.79 0.07 egl 8848394 KRT38 8687 17 0.42 0.18 0.72 0.06 cg02034222 DQX1 165545 2 0.49 0.24 0.56 0.14 cgl4401837 NPSR1 387129 7 0.45 0.27 0.52 0.14 cgl 8738906 SC N1A 6337 12 0.62 0.49 0.61 0.15 cg24607535 CDH26 60437 20 0.44 0.21 0.63 0.11 cg00808492 REG4 83998 1 0.4 0.36 0.50 0.14 cg21682902 HAL 3034 12 0.4 0.2 0.75 0.13 cgl4898779 STK31 56164 7 0.51 0.84 0.76 0.10 cg22213042 CPA2 1358 7 0.41 0.09 0.43 0.15 cgl4934821 GPSM1 26086 9 0.65 0.44 0.70 0.17 eg 15021292 PIK3R1 5295 5 0.49 0.29 0.50 0.14 cg21906716 TP73 7161 1 0.55 0.59 0.68 0.12 cgl7003970 CHFR 55743 12 0.56 0.73 0.78 0.21 cg04117029 UROS 7390 10 0.41 0.24 0.61 0.14 cg20916523 VHL 7428 3 0.52 0.43 0.71 0.12
EXAMPLE 3
(The CIMP-H and CIMP-L subgroups were characterized)
DNA methylation markers associated with CIMP-H and CIMP-L subgroups we investigated. To accomplish this, the DNA methylation β-values for each probe was compare between CIMP-H and non-CIMP tumors (cluster 3 and 4 combined) as well as the β-valui between CIMP-L and non-CIMP tumors using the Wilcoxon rank-sum test. Applican
identified 1 ,618 CpG sites that showed significant DNA hypermethylation in CIMP-H versus non-CIMP tumors (FDR-adjusted P < 0.0001) (Figure 2A). In contrast, 435 CpG sites were found that are significantly hypermethylated in CIMP-L tumors compared with non-CIMP tumors (FDRadjusted P < 0.0001) (Figure 2A). Substantial overlap was observed between the CIMP-H- and CIMP-L-associated markers, as these appear to exhibit a higher frequency of promoter DNA hypermethylation in both tumor subgroups compared with non-CIMP tumors (Figure 2A). Interestingly, 20% of CIMP-H-associated CpG sites (318 CpGs) were also found to be methylated in CIMP-L tumors (FDR-adjusted P < 0.0001 vs. non-CIMP; see list of genes in Table 3).
Specifically, Figures 2A-C show, according to particular exemplary aspects, DNA methylation characteristics associated with CIMP-H, CIMP-L, BRAF- and KRAS-mutSLvA colorectal tumors. A) Comparison of CIMP-H- and CIMP-L-associated DNA methylation profiles. Each data point represents the logio-transformed FDR-adjusted P-value comparing DNA methylation in CIMP-H (n=28) vs. non-CIMP tumors (n=68) (x-axis) and in CIMP-L (n=29) vs. non-CIMP tumors (n=68) (y-axis) for each Infinium DNA methylation probe. For the probes with higher mean DNA methylation in CIMP-H or CIMP-L tumors compared to non- CIMP tumors, -1 is multiplied to logi0(FDR-adjusted P-value), providing positive values. The blue and red points (herein reproduced in gray-scale) highlight probes that are significantly hypermethylated in CIMP-H and CIMP-L tumors compared to non-CIMP tumors, respectively. (B) Heatmap representing Infinium DNA methylation β-values for 575 CpG sites that are significantly hypermethylated in CIMP-H compared with non-CIMP tumors (top) and 22 CpG sites that are significantly hypermethylated in CIMP-L compared with non-CIMP tumors (bottom). The four DNA methylation-based subgroups are indicated above the heatmaps. A color gradient from dark blue to yellow (herein reproduced in gray-scale) was used to represent the low and high DNA methylation β-values, respectively. ( ) Comparison of BRAF mutant- and KRAS mutant-associated DNA hypermethylation signatures in CRC. The logio-transformed FDR-adjusted P-value for each probe is plotted for tumors harboring KRAS mutations (KRAS- M) (n=34) vs. BRAF/KRAS wild-type (n=74) (y-axis) and those containing BRAF mutations (BRAF-M) (n=17) vs. BRAF/KRAS wild-type (n=74) (x-axis). For the probes with higher mer" DNA methylation β-values in BRAF or KRAS mutant tumors compared to wild-type tumors, - is multiplied to logio(FDR-adjusted P-value), providing positive values.
Table 3. List of probes that are significantly more methylated in both CIMP-H and CIMP-L tumors compared with non-CIMP tumors.
Infinium ENTREZ HUGO Gene CIMP-H tumors CIMP-L tumors
Probe ID Gene ID Symbol Mean P value FDR- Mean P value FDR- beta- (vs. Non- adjusted P beta- (vs. Non- adjusted P value CIMP) value value CIMP) value cg00107187 388021 TMEM179 0.65 1.87E-10 8.17E-09 0.63 4.24E-09 1.23E-06 cg00243313 50805 IRX4 0.60 5.23E-07 9.07E-06 0.66 3.13E-10 2.69E-07 cg00273068 90187 EMILIN3 0.57 8.49E-08 1.79E-06 0.58 7.13E-09 1.70E-06 cg00318573 1137 CHRNA4 0.66 1.07E-09 3.63E-08 0.64 6.80E-09 1.66E-06 cg00472814 9510 ADAMTS1 0.66 5.67E-08 1.25E-06 0.65 1.50E-07 1.48E-05 cg00512279 6571 SLC18A2 0.55 2.77E-06 4.03E-05 0.60 5.29E-08 6.88E-06 cg00557354 8874 ARHGEF7 0.78 3.03E-14 3.54E-11 0.49 1.97E-08 3.48E-06 cg00565688 7161 TP73 0.54 3.60E-08 8.30E-07 0.53 5.29E-08 6.88E-06 cg00625653 7476 WNT7A 0.70 1.07E-12 1.41E-10 0.54 1.86E-07 1.71E-05 cg00654814 146664 MGAT5B 0.72 1.69E-09 5.42E-08 0.74 6.64E-11 1.83E-07 cg00685836 8499 PPFIA2 0.48 3.72E-09 1.08E-07 0.41 1.83E-06 9.35E-05 cg00687686 65009 NDRG4 0.71 3.80E-12 3.34E-10 0.66 3.13E-10 2.69E-07 cg00746981 3068 HDGF 0.43 6.34E-12 5.01E-10 0.36 1.32E-07 1.35E-05 cg00756058 22873 DZIP1 0.66 1.87E-10 8.17E-09 0.54 7.94E-07 5.03E-05 cg00826384 5803 PTPRZ1 0.52 4.66E-11 2.62E-09 0.41 2.21E-07 1.96E-05 cg00902195 341359 SYT10 0.60 1.01E-07 2.10E-06 0.59 3.36E-07 2.63E-05 cg00995327 9435 CHST2 0.77 1.21E-07 2.45E-06 0.74 9.33E-07 5.67E-05 cg01173186 140767 NRSN1 0.61 3.24E-06 4.67E-05 0.61 1.83E-06 9.35E-05 cgO 1192900 54766 BTG4 0.76 2.61E-08 6.22E-07 0.75 2.36E-08 3.92E-06 cg01291404 1280 COL2A1 0.51 4.67E-13 7.99E-11 0.36 1.14E-08 2.42E-06 cg01313514 89780 WNT3A 0.55 3.80E-12 3.34E-10 0.50 1.69E-10 2.16E-07 cg01322134 89780 WNT3A 0.72 5.06E-12 4.19E-10 0.65 1.27E-09 7.05E-07 cg01468621 9024 BRSK2 0.57 2.18E-10 9.37E-09 0.46 1.14E-06 6.58E-05 cgO 1519742 152789 JAKMIP1 0.70 1.51E-10 6.84E-09 0.63 4.66E-09 1.28E-06 cg01555431 9590 AKAP12 0.74 1.35E-06 2.13E-05 0.74 1.14E-06 6.58E-05 cg01593190 9509 ADAMTS2 0.53 1.42E-08 3.63E-07 0.50 2.26E-08 3.77E-06 cg01643580 3777 KCNK3 0.63 4.52E-08 1.02E-06 0.62 2.06E-08 3.58E-06 cg01656955 84618 NT5C1A 0.56 8.88E-11 4.38E-09 0.43 1.83E-06 9.35E-05 cgO 1697732 54757 FAM20A 0.85 3.27E-13 6.76E-11 0.55 1.14E-06 6.58E-05 cgO 1699584 386617 KCTD8 0.44 5.48E-11 2.97E-09 0.27 7.32E-07 4.72E-05 cg01775414 112885 PHF21B 0.71 2.64E-09 7.99E-08 0.66 2.72E-07 2.28E-05 cg01946574 5797 PTPRM 0.69 5.67E-08 1.25E-06 0.71 8.20E-09 1.89E-06 cg02136132 56659 KCNK13 0.55 2.36E-14 3.54E-11 0.27 1.40E-09 7.40E-07 cg02361557 22854 NTNG1 0.56 9.95E-12 7.15E-10 0.40 1.78E-07 1.67E-05 cg02407785 5101 PCDH9 0.32 7.17E-10 2.59E-08 0.26 1.34E-06 7.49E-05 cg02503850 140766 ADAMTS14 0.57 5.01E-07 8.73E-06 0.58 3.65E-07 2.82E-05 cg02508567 83439 TCF7L1 0.66 2.15E-13 5.69E-11 0.41 3.09E-07 2.49E-05 cg02860342 10021 HCN4 0.61 1.86E-06 2.84E-05 0.61 1.45E-06 7.85E-05 cg02899772 54550 NECAB2 0.56 2.91E-09 8.67E-08 0.52 3.88E-08 5.65E-06 cg02932167 9427 ECEL1 0.77 5.16E-06 7.04E-05 0.79 2.26E-08 3.77E-06 cg02982690 27319 BHLHE22 0.48 2.55E-12 2.46E-10 0.39 2.39E-09 9.25E-07 cg03038003 79656 BEND5 0.62 2.51E-09 7.67E-08 0.56 1.71E-07 1.64E-05 cg03168582 1761 DMRT1 0.71 5.23E-07 9.07E-06 0.73 1.32E-07 1.35E-05 cg03285457 10660 LBX1 0.52 5.36E-06 7.29E-05 0.53 1.50E-06 8.08E-05 cg03414321 3055 HCK 0.40 1.51E-10 6.84E-09 0.29 8.58E-08 9.86E-06 cg03455458 79805 VASH2 0.35 9.74E-09 2.54E-07 0.38 3.68E-09 l .l lE-l cg03732545 6900 CNTN2 0.55 1.38E-09 4.57E-08 0.54 1.78E-07 1.67E-I cg03734874 388021 TMEM179 0.73 2.73E-08 6.44E-07 0.73 4.04E-09 1.20E-I cg03777459 140628 GATA5 0.59 1.56E-08 3.94E-07 0.62 1.97E-09 8.97E-I cg03848675 2295 FOXF2 0.30 3.00E-08 7.01E-07 0.29 3.80E-07 2.87E-I cg04080057 59285 CACNG6 0.65 9.29E-09 2.44E-07 0.63 3.71E-08 5.48E-I cg04101379 22873 DZIP1 0.60 6.04E-09 1.66E-07 0.55 8.61E-07 5.34E-I cg04251363 10402 ST3GAL6 0.41 2.23E-07 4.21E-06 0.32 1.39E-06 7.66E-I cg04270799 3798 KIF5A 0.62 1.07E-08 2.79E-07 0.59 4.43E-08 6.05E-I
Infinium ENTREZ HUGO Gene CIMP-H tumors CIMP-L tumors
Probe ID Gene ID Symbol Mean P value FDR- Mean P value FDR- beta- (vs. Non- adjusted P beta- (vs. Non- adjusted P value CIMP) value value CIMP) value cg04274487 11031 RAB31 0.59 2.22E-14 3.54E-11 0.29 1.64E-08 3.07E-06 cg04330449 4762 NEUROG1 0.76 3.37E-06 4.81E-05 0.77 2.72E-07 2.28E-05 cg04369341 84969 TOX2 0.59 4.52E-10 1.76E-08 0.50 1.27E-07 1.32E-05 cg04391111 7161 TP73 0.56 2.77E-06 4.03E-05 0.62 3.34E-09 1.04E-06
Cg04418492 9420 CYP7B1 0.55 1.44E-07 2.86E-06 0.52 2.03E-07 1.83E-05 cg04549333 60529 ALX4 0.61 8.42E-11 4.18E-09 0.51 1.38E-07 1.40E-05 cg04603031 1136 CHRNA3 0.68 1.36E-08 3.48E-07 0.71 7.36E-10 4.70E-07 cg04713521 51450 PRRX2 0.65 3.15E-10 1.27E-08 0.62 7.73E-10 4.80E-07 cg04765277 399717 FLJ45983 0.64 3.73E-07 6.69E-06 0.62 9.71E-07 5.84E-05 cg04897683 4762 NEUROG1 0.72 3.44E-08 7.96E-07 0.71 2.47E-08 4.01E-06 cg04981492 85360 SYDE1 0.60 1.72E-07 3.34E-06 0.57 3.65E-07 2.82E-05 cg04988423 60529 ALX4 0.65 5.22E-09 1.45E-07 0.65 1.37E-08 2.77E-06 cg05028467 6620 SNCB 0.66 3.91E-13 7.25E-11 0.52 1.18E-10 1.83E-07 cg05056120 1879 EBF 1 0.52 9.71E-08 2.01E-06 0.51 3.09E-07 2.49E-05 cg05421688 148753 FAM163A 0.49 7.51E-12 5.66E-10 0.35 3.96E-07 2.96E-05 cg05436658 5579 PRKCB 0.60 3.77E-08 8.61E-07 0.59 2.84E-07 2.35E-05 cg05774801 6423 SFRP2 0.60 1.94E-06 2.93E-05 0.61 7.32E-07 4.72E-05 cg05882522 30845 EHD3 0.54 2.86E-08 6.73E-07 0.48 1.63E-06 8.57E-05 cg05899618 151449 GDF7 0.64 1.80E-12 1.92E-10 0.55 2.69E-10 2.65E-07 cg05942574 8913 CACNA1G 0.43 2.27E-09 7.02E-08 0.39 3.80E-07 2.87E-05 cg06110728 4753 NELL2 0.48 8.86E-09 2.34E-07 0.45 1.05E-06 6.22E-05 cg06243556 65982 Z SCAN 18 0.67 4.59E-06 6.33E-05 0.70 2.61E-07 2.21E-05 cg06268694 9620 CELSR1 0.79 1.60E-12 1.79E-10 0.65 1.19E-06 6.81E-05 cg06321883 1310 COL19A1 0.62 3.43E-14 3.54E-11 0.40 1.56E-06 8.34E-05 cg06339657 8622 PDE8B 0.61 1.88E-08 4.65E-07 0.57 7.63E-07 4.84E-05 cg06357925 5800 PTPRO 0.66 1.59E-10 7.16E-09 0.61 1.72E-08 3.14E-06 cg06557358 124842 TMEM132E 0.60 1.77E-09 5.67E-08 0.61 1.47E-09 7.41E-07 cg06668300 4118 MAL 0.59 2.43E-07 4.56E-06 0.65 3.83E-10 2.87E-07 cg06894812 4163 MCC 0.54 1.55E-11 1.02E-09 0.37 1.45E-06 7.85E-05 cg06905514 816 CAMK2B 0.72 7.51E-12 5.66E-10 0.63 2.47E-08 4.01E-06 cg07015629 2066 ERBB4 0.67 6.49E-08 1.40E-06 0.66 2.96E-07 2.41E-05 cg07017374 2322 FLT3 0.81 1.43E-12 1.73E-10 0.70 1.72E-08 3.14E-06 cg07075930 5797 PTPRM 0.56 3.87E-10 1.54E-08 0.45 2.40E-07 2.09E-05 cg07109287 9355 LHX2 0.85 3.22E-14 3.54E-11 0.52 1.94E-07 1.76E-05 cg07143898 6585 SLIT1 0.60 9.19E-14 3.63E-11 0.36 2.06E-09 8.97E-07 cg07236943 23089 PEG10 0.29 2.07E-08 5.04E-07 0.25 8.96E-07 5.53E-05 cg07295678 10570 DPYSL4 0.69 1.38E-07 2.75E-06 0.71 1.31E-08 2.70E-06 cg07570142 26002 MOXD1 0.73 7.93E-10 2.80E-08 0.68 1.11E-07 1.18E-05 cg07651242 107 ADCY1 0.73 4.10E-09 1.17E-07 0.68 4.30E-07 3.10E-05 cg07696033 60529 ALX4 0.41 2.43E-10 1.02E-08 0.41 2.89E-09 9.97E-07 cg07703401 3049 HBQ1 0.72 1.16E-07 2.36E-06 0.69 1.39E-06 7.66E-05 cg07710481 26050 SLITRK5 0.41 5.36E-06 7.29E-05 0.47 2.59E-08 4.13E-06 cg07935568 2862 MLNR 0.66 4.67E-13 7.99E-11 0.48 3.96E-07 2.96E-05 cg08045570 2295 FOXF2 0.65 1.12E-08 2.91E-07 0.69 2.43E-10 2.65E-07 cg08132931 119 ADD2 0.62 2.14E-07 4.05E-06 0.65 1.47E-09 7.41E-07 cg08190044 57198 ATP8B2 0.75 2.73E-08 6.44E-07 0.75 7.83E-09 1.83E-I cg08209133 201780 SLC10A4 0.54 2.57E-13 6.07E-11 0.40 4.24E-08 5.86E-I cg08244522 7056 THBD 0.46 1.88E-07 3.60E-06 0.46 4.06E-08 5.75E-I cg08315770 89822 KCNK17 0.70 9.77E-14 3.66E-11 0.50 4.87E-07 3.42E-I cg08555612 60675 PROK2 0.65 1.35E-12 1.65E-10 0.37 7.32E-07 4.72E-I cg08575537 2056 EPO 0.79 3.43E-07 6.22E-06 0.82 6.19E-09 1.58E-I cg08859916 5728 PTEN 0.55 5.29E-14 3.54E-11 0.32 9.78E-08 l .lOE-l cg08876932 401 PHOX2A 0.55 6.74E-06 8.92E-05 0.61 3.04E-09 9.98E-I cg08896945 797 CALCB 0.57 1.91E-12 1.99E-10 0.43 1.76E-06 9.10E-I
Infinium ENTREZ HUGO Gene CIMP-H tumors CIMP-L tumors
Probe ID Gene ID Symbol Mean P value FDR- Mean P value FDR- beta- (vs. Non- adjusted P beta- (vs. Non- adjusted P value CIMP) value value CIMP) value cg09053680 8433 UTF1 0.75 1.94E-06 2.93E-05 0.75 5.98E-07 4.09E-05 cg09147222 131034 CPNE4 0.49 7.27E-06 9.55E-05 0.56 4.45E-09 1.25E-06 cg09191327 59335 PRDM12 0.61 2.77E-09 8.31E-08 0.58 1.19E-08 2.51E-06 cg09231514 125988 C19orf70 0.37 3.37E-09 9.94E-08 0.30 2.61E-07 2.21E-05 cg09313439 1000 CDH2 0.55 1.79E-06 2.74E-05 0.57 4.43E-08 6.05E-06 cg09416313 4145 MATK 0.63 2.91E-09 8.67E-08 0.62 6.49E-09 1.62E-06 cg09437522 2778 GNAS 0.60 4.10E-09 1.17E-07 0.56 7.63E-07 4.84E-05 cg09440289 5800 PTPRO 0.58 3.75E-11 2.17E-09 0.46 7.63E-07 4.84E-05 cg09495977 94031 HTRA3 0.53 5.06E-12 4.19E-10 0.49 7.00E-11 1.83E-07 cg09622447 875 CBS 0.68 7.96E-13 1.09E-10 0.43 1.71E-07 1.64E-05 cg09628601 4861 NPAS1 0.65 5.84E-10 2.19E-08 0.65 1.54E-09 7.60E-07 cg09660171 4010 LMX1B 0.53 1.36E-10 6.27E-09 0.47 1.57E-07 1.54E-05 cg09750385 2982 GUCY1A3 0.29 4.59E-06 6.33E-05 0.31 4.30E-07 3.10E-05 cg09874752 6425 SFRP5 0.58 1.18E-11 8.13E-10 0.45 1.14E-08 2.42E-06 cg09945801 7486 WRN 0.67 7.43E-08 1.59E-06 0.68 2.17E-09 8.97E-07 cg09949775 1311 COMP 0.66 6.79E-11 3.48E-09 0.55 2.30E-07 2.02E-05 cg09979256 84870 RSP03 0.58 6.04E-09 1.66E-07 0.58 9.89E-09 2.19E-06 cgl0158080 6660 SOX5 0.64 9.72E-10 3.35E-08 0.68 2.55E-11 1.30E-07 cgl0247252 8811 GALR2 0.43 7.17E-11 3.65E-09 0.40 2.61E-07 2.21E-05 cgl0486998 2587 GALR1 0.65 8.61E-07 1.43E-05 0.63 1.90E-06 9.61E-05 cgl0605520 11255 HRH3 0.52 1.04E-10 5.02E-09 0.29 1.90E-06 9.61E-05 cgl0646402 5800 PTPRO 0.69 4.08E-10 1.61E-08 0.63 7.53E-08 8.88E-06 cgl0647513 3039 HBA1 0.50 3.89E-07 6.95E-06 0.50 2.16E-08 3.66E-06 cgl0920957 57338 JPH3 0.57 5.48E-11 2.97E-09 0.44 5.07E-07 3.54E-05 cgl 1189837 9510 ADAMTS1 0.61 5.01E-10 1.92E-08 0.54 3.36E-07 2.63E-05 cgl 1248413 4762 NEUROG1 0.75 1.20E-12 1.55E-10 0.54 1.07E-07 1.16E-05 cgl 1260848 60529 ALX4 0.60 6.79E-11 3.48E-09 0.52 6.75E-07 4.46E-05 cgl l319389 84969 TOX2 0.60 6.47E-10 2.37E-08 0.56 7.53E-08 8.88E-06 cgl 1399100 25789 TMEM59L 0.59 6.29E-13 9.54E-11 0.40 9.44E-09 2.11E-06 cgl 1428724 5081 PAX7 0.83 6.34E-12 5.01E-10 0.82 1.33E-11 1.14E-07 cgl 1438428 256297 PTF 1A 0.79 4.97E-09 1.40E-07 0.76 3.18E-09 1.02E-06 cgl 1668923 8038 ADAM 12 0.70 4.67E-13 7.99E-11 0.59 3.47E-10 2.69E-07 cgl 1670211 50507 NOX4 0.50 7.10E-08 1.52E-06 0.42 1.34E-06 7.49E-05 cgl 1747771 2731 GLDC 0.71 4.76E-10 1.84E-08 0.64 8.96E-08 1.02E-05 cgl 1768886 55351 STK32B 0.34 3.94E-06 5.51E-05 0.37 1.76E-06 9.10E-05 cgl 1847808 2046 EPHA8 0.58 7.95E-12 5.95E-10 0.53 4.46E-10 3.23E-07 cgl l935147 9659 PDE4DIP 0.70 6.36E-14 3.54E-11 0.58 8.60E-09 1.96E-06 cgl 1939071 1840 DTX1 0.65 6.24E-06 8.32E-05 0.70 4.24E-09 1.23E-06 cgl l981631 6833 ABCC8 0.64 1.25E-13 4.16E-11 0.44 1.14E-08 2.42E-06 cgl2005098 387700 SLC16A12 0.71 8.26E-07 1.38E-05 0.71 4.67E-07 3.33E-05 eg 12374431 25806 VAX2 0.53 1.13E-09 3.81E-08 0.43 5.53E-08 7.15E-06 cgl2539975 59335 PRDM12 0.50 3.28E-08 7.64E-07 0.52 2.63E-09 9.81E-07 eg 12699371 2587 GALR1 0.56 7.93E-10 2.80E-08 0.49 4.30E-07 3.10E-05 cgl2768605 284348 LYPD5 0.65 5.36E-06 7.29E-05 0.66 1.34E-06 7.49E-05 cgl2874092 7431 VIM 0.60 6.65E-09 1.81E-07 0.63 8.54E-10 5.01E-07 eg 12995941 3645 INSRR 0.56 2.43E-10 1.02E-08 0.44 1.76E-06 9.10E-I cgl3031432 65009 NDRG4 0.66 1.24E-11 8.49E-10 0.61 1.09E-09 6.25E-I cgl3168683 152789 JAKMIP1 0.60 9.95E-12 7.15E-10 0.51 2.16E-08 3.66E-I cgl3216057 27122 DKK3 0.51 7.67E-09 2.06E-07 0.42 2.96E-07 2.41E-I cgl3274713 6909 TBX2 0.65 5.92E-13 9.53E-11 0.43 5.98E-07 4.09E-I cgl3297865 6785 ELOVL4 0.67 1.91E-12 1.99E-10 0.55 1.78E-07 1.67E-I cgl3346411 887 CCKBR 0.64 1.60E-12 1.79E-10 0.54 4.45E-09 1.25E-I cgl3351583 53358 SHC3 0.52 2.46E-06 3.61E-05 0.53 1.63E-06 8.57E-I cgl3378388 7424 VEGFC 0.62 1.10E-06 1.78E-05 0.64 3.36E-07 2.63E-I
Infinium ENTREZ HUGO Gene CIMP-H tumors CIMP-L tumors
Probe ID Gene ID Symbol Mean P value FDR- Mean P value FDR- beta- (vs. Non- adjusted P beta- (vs. Non- adjusted P value CIMP) value value CIMP) value eg L3436799 4036 LRP2 0.54 6.29E-13 9.54E-11 0.31 1.83E-06 9.35E-05 eg L3488201 8038 ADAM 12 0.77 1.56E-08 3.94E-07 0.77 1.88E-08 3.38E-06 eg L3562542 2850 GPR27 0.68 6.10E-11 3.25E-09 0.64 5.91E-09 1.55E-06 eg L3686115 84457 PHYHIPL 0.37 1.72E-08 4.29E-07 0.36 4.67E-07 3.33E-05 eg L3749822 64399 HHIP 0.66 1.07E-09 3.63E-08 0.56 5.07E-07 3.54E-05 eg L3756879 3481 IGF2 0.66 1.90E-13 5.10E-11 0.61 1.57E-11 1.14E-07 eg L3878010 111 ADCY5 0.68 9.89E-11 4.79E-09 0.59 6.90E-08 8.36E-06 eg [4046986 92241 RCSD1 0.43 7.50E-13 1.06E-10 0.22 1.07E-07 1.16E-05 eg [4049461 2895 GRID2 0.38 2.43E-10 1.02E-08 0.31 1.14E-06 6.58E-05 eg L4135551 23500 DAAM2 0.38 2.36E-06 3.49E-05 0.41 5.29E-08 6.88E-06 eg [4144305 60529 ALX4 0.53 1.16E-07 2.36E-06 0.53 3.39E-08 5.15E-06 eg L 4242042 6660 SOX5 0.62 7.17E-10 2.59E-08 0.64 1.12E-10 1.83E-07 eg L4312526 668 FOXL2 0.61 4.67E-14 3.54E-11 0.40 7.03E-07 4.60E-05 eg L4662379 547 KIF1A 0.66 1.25E-13 4.16E-11 0.49 3.50E-09 1.07E-06 eg L4823162 5454 POU3F2 0.46 2.55E-12 2.46E-10 0.31 1.11E-07 1.18E-05 eg L4958635 4762 NEUROG1 0.66 1.06E-06 1.72E-05 0.70 1.50E-08 2.98E-06 eg L5014549 55244 SLC47A1 0.60 1.59E-13 4.48E-11 0.35 4.87E-07 3.42E-05 eg L5057581 140885 SIRPA 0.50 8.13E-14 3.54E-11 0.40 2.06E-08 3.58E-06 eg L5107670 7490 WT1 0.64 4.30E-09 1.22E-07 0.64 2.50E-09 9.54E-07 eg L5205507 55422 ZNF331 0.56 1.51E-10 6.84E-09 0.58 2.69E-10 2.65E-07 eg L5461516 8534 CHST1 0.65 5.22E-09 1.45E-07 0.63 7.13E-09 1.70E-06 eg L5565872 5806 PTX3 0.50 4.13E-08 9.36E-07 0.45 1.71E-07 1.64E-05 eg L5640375 79948 LPPR3 0.66 3.39E-12 3.11E-10 0.60 3.00E-11 1.30E-07 eg [5749748 140628 GATA5 0.61 2.65E-07 4.93E-06 0.63 4.06E-08 5.75E-06 eg L5753757 26053 AUTS2 0.59 1.32E-13 4.17E-11 0.35 1.11E-07 1.18E-05 eg L5817236 60529 ALX4 0.62 8.05E-09 2.15E-07 0.63 8.13E-10 4.90E-07 eg L6041660 144165 PRICKLE 1 0.74 1.64E-11 1.07E-09 0.64 1.32E-07 1.35E-05 eg L6042149 4744 NEFH 0.65 2.07E-08 5.04E-07 0.62 2.21E-07 1.96E-05 eg L 6248277 2253 FGF8 0.64 1.36E-10 6.27E-09 0.61 1.97E-08 3.48E-06 eg L6257091 627 BDNF 0.50 4.73E-08 1.06E-06 0.47 1.45E-06 7.85E-05 eg L6584573 2253 FGF8 0.73 1.27E-12 1.60E-10 0.63 3.47E-10 2.69E-07 eg L 6604516 2199 FBLN2 0.74 5.06E-12 4.19E-10 0.63 3.80E-07 2.87E-05 eg L6708281 200350 FOXD4L1 0.56 2.33E-07 4.38E-06 0.55 1.50E-07 1.48E-05 eg L6852892 4325 MMP16 0.11 3.57E-07 6.47E-06 0.12 1.94E-07 1.76E-05 eg L6884569 9770 RASSF2 0.50 1.01E-07 2.10E-06 0.48 7.03E-07 4.60E-05 eg L 6907566 7373 COL14A1 0.61 1.96E-09 6.17E-08 0.57 1.01E-06 6.04E-05 eg L 6969623 55422 ZNF331 0.57 5.01E-10 1.92E-08 0.55 2.17E-09 8.97E-07 eg L7018527 53346 TM6SF1 0.35 8.49E-08 1.79E-06 0.34 2.72E-07 2.28E-05 eg L7108819 925 CD 8 A 0.73 4.42E-07 7.78E-06 0.75 5.07E-08 6.75E-06 eg L7133183 1381 CRABP1 0.61 3.88E-14 3.54E-11 0.22 1.34E-06 7.49E-05 eg L7188046 6862 T 0.68 6.49E-08 1.40E-06 0.64 1.90E-06 9.61E-05 eg L7194182 2056 EPO 0.60 2.56E-10 1.06E-08 0.52 1.05E-06 6.22E-05 eg L7503456 668 FOXL2 0.68 2.36E-14 3.54E-11 0.39 2.71E-08 4.29E-06 eg L7775235 4884 NPTX1 0.67 9.77E-14 3.66E-11 0.50 1.53E-10 2.07E-07 eg L7834752 51305 KCNK9 0.62 1.22E-10 5.69E-09 0.57 3.65E-07 2.82E-05 eg L7880199 4629 MYH11 0.61 3.91E-13 7.25E-11 0.46 5.07E-08 6.75E-I eg L 8396533 143241 DYDC1 0.70 9.71E-08 2.01E-06 0.68 3.36E-07 2.63E-I eg L 8403396 135152 B3GAT2 0.53 7.57E-11 3.80E-09 0.34 9.10E-11 1.83E-I eg L 8581445 56961 SHD 0.52 5.48E-11 2.97E-09 0.39 3.80E-07 2.87E-I eg L 8602314 9945 GFPT2 0.43 2.30E-10 9.82E-09 0.38 3.10E-08 4.81E-I eg L 8938204 90187 EMILIN3 0.66 1.07E-08 2.79E-07 0.70 8.63E-11 1.83E-I eg L 8943599 6752 SSTR2 0.24 8.26E-07 1.38E-05 0.22 3.39E-08 5.15E-I eg L 8952560 140885 SIRPA 0.62 3.27E-13 6.76E-11 0.48 6.49E-09 1.62E-I eg L9063972 11166 SOX21 0.61 6.15E-10 2.27E-08 0.57 1.78E-07 1.67E-I
Infinium ENTREZ HUGO Gene CIMP-H tumors CIMP-L tumors
Probe ID Gene ID Symbol Mean P value FDR- Mean P value FDR- beta- (vs. Non- adjusted P beta- (vs. Non- adjusted P value CIMP) value value CIMP) value cgl9141563 22843 PPM IE 0.56 8.88E-11 4.38E-09 0.47 2.40E-07 2.09E-05 cgl9332710 140730 RIMS4 0.78 6.29E-13 9.54E-11 0.57 4.49E-07 3.22E-05 cgl9355190 1959 EGR2 0.63 3.39E-12 3.11E-10 0.50 4.87E-07 3.42E-05 eg 19358442 60529 ALX4 0.60 3.73E-07 6.69E-06 0.61 1.57E-08 3.01E-06 eg 19358493 2018 EMX2 0.41 4.30E-09 1.22E-07 0.44 4.06E-08 5.75E-06 cgl9439399 6785 ELOVL4 0.53 1.53E-09 4.99E-08 0.50 1.39E-06 7.66E-05 cgl9461621 81035 COLEC12 0.68 1.24E-06 1.99E-05 0.68 6.23E-07 4.24E-05 cgl9674669 112937 GLB1L3 0.74 2.16E-09 6.72E-08 0.69 1.07E-07 1.16E-05 cgl9697981 7101 NR2E1 0.58 3.73E-07 6.69E-06 0.62 5.13E-09 1.37E-06 cgl9850348 26108 PYGOl 0.68 1.80E-08 4.47E-07 0.66 6.90E-08 8.36E-06 cgl9917856 342897 NCCRP1 0.69 9.74E-09 2.54E-07 0.66 3.80E-07 2.87E-05 cgl9918758 10451 VAV3 0.44 6.24E-06 8.32E-05 0.46 1.11E-07 1.18E-05 cg20025656 58 ACTA1 0.68 3.60E-08 8.30E-07 0.68 2.16E-08 3.66E-06 cg20161179 4487 MSX1 0.39 2.54E-07 4.74E-06 0.40 4.24E-08 5.86E-06 cg20209009 30009 TBX21 0.61 2.06E-09 6.47E-08 0.64 2.43E-10 2.65E-07 cg20256494 164633 CABP7 0.74 3.91E-13 7.25E-11 0.59 7.00E-10 4.61E-07 cg20291049 5455 POU3F3 0.77 1.96E-07 3.75E-06 0.78 7.53E-08 8.88E-06 cg20339230 8128 ST8SIA2 0.77 1.69E-09 5.42E-08 0.80 4.59E-11 1.66E-07 cg20357628 116154 PHACTR3 0.75 6.44E-11 3.36E-09 0.70 2.59E-08 4.13E-06 cg20530314 185 AGTR1 0.71 7.93E-07 1.33E-05 0.78 5.13E-09 1.37E-06 cg20624391 11149 BVES 0.60 2.43E-07 4.56E-06 0.59 2.84E-07 2.35E-05 cg20674577 116154 PHACTR3 0.57 1.10E-06 1.78E-05 0.60 2.27E-09 8.97E-07 cg20699736 25806 VAX2 0.38 1.18E-08 3.04E-07 0.34 3.39E-08 5.15E-06 cg20792294 51214 IGF2AS 0.71 6.10E-11 3.25E-09 0.63 9.36E-08 1.06E-05 cg20804555 145258 GSC 0.60 9.37E-11 4.57E-09 0.62 6.91E-12 1.14E-07 cg21017752 5507 PPP1R3C 0.55 3.68E-10 1.46E-08 0.52 2.83E-08 4.42E-06 cg21269934 339983 NAT8L 0.65 1.22E-10 5.69E-09 0.62 2.89E-09 9.97E-07 cg21321735 547 KIF1A 0.55 1.74E-11 1.12E-09 0.30 2.76E-09 9.81E-07 cg21435336 126549 ANKLE 1 0.62 1.35E-12 1.65E-10 0.52 6.80E-09 1.66E-06 cg21513553 1292 COL6A2 0.72 3.05E-09 9.07E-08 0.74 2.69E-10 2.65E-07 cg21547708 6752 SSTR2 0.60 3.79E-06 5.33E-05 0.63 5.78E-08 7.39E-06 cg21553524 130733 TMEM178 0.53 6.97E-09 1.88E-07 0.47 1.16E-07 1.23E-05 cg21604803 126129 CPT1C 0.54 6.79E-08 1.46E-06 0.50 1.76E-06 9.10E-05 cg21652958 7058 THBS2 0.45 6.21E-08 1.35E-06 0.43 4.13E-07 3.05E-05 cg21937886 9945 GFPT2 0.83 1.39E-11 9.32E-10 0.67 4.64E-08 6.29E-06 cg21942082 134526 ACOT12 0.45 4.29E-10 1.69E-08 0.39 1.98E-06 9.88E-05 cg22007439 63951 DMRTA1 0.44 8.35E-10 2.91E-08 0.37 1.07E-07 1.16E-05 cg22036988 92369 SPSB4 0.69 5.55E-10 2.10E-08 0.64 1.38E-07 1.40E-05 cg22063989 284654 RSPOl 0.52 7.67E-09 2.06E-07 0.55 5.19E-10 3.63E-07 cg22123464 6543 SLC8A2 0.62 4.10E-09 1.17E-07 0.54 5.29E-07 3.68E-05 cg22197787 3756 KCNH1 0.25 1.64E-11 1.07E-09 0.19 4.30E-07 3.10E-05 cg22336401 377841 ENTPD8 0.10 8.42E-11 4.18E-09 0.08 3.80E-07 2.87E-05 cg22594309 127833 SYT2 0.64 7.50E-13 1.06E-10 0.51 6.90E-08 8.36E-06 cg22679003 1000 CDH2 0.59 1.80E-07 3.47E-06 0.63 6.19E-09 1.58E-06 cg22777952 27023 FOXB1 0.47 3.18E-11 1.90E-09 0.35 3.50E-07 2.73E-05 cg22815110 27022 FOXD3 0.70 6.65E-09 1.81E-07 0.66 1.16E-07 1.23E-I cg22967284 6585 SLIT1 0.24 9.74E-09 2.54E-07 0.16 9.71E-07 5.84E-I cg22975913 7490 WT1 0.49 3.77E-08 8.61E-07 0.54 2.27E-09 8.97E-I cg22994720 25884 CHRDL2 0.46 1.94E-06 2.93E-05 0.46 6.04E-08 7.58E-I cg23029193 133584 EGFLAM 0.50 2.46E-06 3.61E-05 0.53 3.71E-08 5.48E-I cg23040064 57338 JPH3 0.55 5.06E-12 4.19E-10 0.42 4.24E-08 5.86E-I cg23089840 81543 LRRC3 0.59 1.10E-06 1.78E-05 0.64 2.30E-07 2.02E-I cg23166362 5293 PIK3CD 0.63 4.18E-11 2.38E-09 0.37 7.63E-07 4.84E-I cg23196831 7373 COL14A1 0.61 1.64E-08 4.10E-07 0.63 3.04E-09 9.98E-I
Infinium ENTREZ HUGO Gene CIMP-H tumors CIMP-L tumors
Probe ID Gene ID Symbol Mean P value FDR- Mean P value FDR- beta- (vs. Non- adjusted P beta- (vs. Non- adjusted P value CIMP) value value CIMP) value cg23219720 219578 ZNF804B 0.49 1.94E-06 2.93E-05 0.52 5.78E-08 7.39E-06 cg23273897 4311 MME 0.47 4.52E-08 1.02E-06 0.50 2.17E-09 8.97E-07 cg23473904 1292 COL6A2 0.56 7.07E-13 1.02E-10 0.42 5.29E-08 6.88E-06 cg23582408 1917 EEF1A2 0.50 1.88E-08 4.65E-07 0.50 1.31E-08 2.70E-06 cg24053587 5800 PTPRO 0.38 7.57E-11 3.80E-09 0.28 1.50E-06 8.08E-05 cg24068372 349136 WDR86 0.81 4.24E-07 7.49E-06 0.80 8.27E-07 5.19E-05 cg24396745 10021 HCN4 0.67 2.02E-12 2.08E-10 0.54 6.23E-07 4.24E-05 cg24662718 10451 VAV3 0.73 2.33E-07 4.38E-06 0.73 1.71E-07 1.64E-05 cg24723331 6489 ST8SIA1 0.44 7.00E-06 9.23E-05 0.49 1.63E-06 8.57E-05 cg24834740 26051 PPP1R16B 0.65 7.93E-07 1.33E-05 0.69 3.71E-08 5.48E-06 cg24879335 7018 TF 0.57 2.43E-10 1.02E-08 0.51 8.27E-07 5.19E-05 cg24924779 3755 KCNG1 0.74 1.35E-06 2.13E-05 0.76 6.90E-08 8.36E-06 cg25014318 2740 GLP1R 0.71 7.54E-10 2.70E-08 0.65 2.21E-07 1.96E-05 cg25070637 6383 SDC2 0.51 2.89E-07 5.31E-06 0.47 8.96E-07 5.53E-05 cg25094569 7490 WT1 0.60 6.49E-08 1.40E-06 0.59 6.04E-08 7.58E-06 cg25167643 5803 PTPRZ1 0.75 3.90E-09 1.13E-07 0.67 1.39E-06 7.66E-05 cg25228126 2535 FZD2 0.55 5.78E-06 7.80E-05 0.56 7.32E-07 4.72E-05 cg25302419 1501 CTN D2 0.65 2.70E-11 1.64E-09 0.61 2.76E-09 9.81E-07 cg25332298 1995 ELAVL3 0.54 1.70E-12 1.87E-10 0.47 2.17E-09 8.97E-07 cg25363445 60529 ALX4 0.54 1.72E-08 4.29E-07 0.53 1.21E-07 1.27E-05 cg25431974 9427 ECEL1 0.86 2.89E-07 5.31E-06 0.89 1.18E-10 1.83E-07 cg25434223 1995 ELAVL3 0.56 9.35E-07 1.53E-05 0.57 2.50E-07 2.16E-05 cg25465406 3000 GUCY2D 0.60 8.26E-07 1.38E-05 0.59 9.71E-07 5.84E-05 cg25834568 84870 RSP03 0.25 6.79E-11 3.48E-09 0.22 1.57E-08 3.01E-06 cg25875213 163115 ZNF781 0.59 6.44E-11 3.36E-09 0.49 6.75E-07 4.46E-05 cg25905812 1761 DMRT1 0.58 6.49E-08 1.40E-06 0.59 6.04E-08 7.58E-06 cg25942450 30012 TLX3 0.75 6.01E-06 8.07E-05 0.78 1.71E-07 1.64E-05 cg25971347 2294 FOXF1 0.59 3.44E-08 7.96E-07 0.63 1.53E-10 2.07E-07 cg25999867 112937 GLB1L3 0.67 2.91E-09 8.67E-08 0.60 9.71E-07 5.84E-05 cg26164310 9890 LPPR4 0.64 1.94E-06 2.93E-05 0.63 7.63E-07 4.84E-05 cg26195812 56896 DPYSL5 0.78 5.98E-14 3.54E-11 0.60 4.66E-09 1.28E-06 cg26232187 4916 NTRK3 0.27 1.58E-07 3.10E-06 0.30 6.66E-10 4.52E-07 cg26365854 60529 ALX4 0.64 2.77E-07 5.10E-06 0.67 3.18E-09 1.02E-06 cg26466094 26289 AK5 0.51 1.65E-07 3.21E-06 0.52 7.87E-08 9.18E-06 cg26525091 8174 MADCAM1 0.61 2.07E-08 5.04E-07 0.60 2.06E-09 8.97E-07 cg26557658 163933 FAM43B 0.54 1.51E-07 2.98E-06 0.56 7.83E-09 1.83E-06 cg26607785 30009 TBX21 0.56 2.05E-11 1.29E-09 0.42 1.28E-06 7.31E-05 cg26702254 3751 KCND2 0.46 7.43E-08 1.59E-06 0.43 7.32E-07 4.72E-05 cg26705553 64386 MMP25 0.47 1.80E-07 3.47E-06 0.47 3.22E-07 2.58E-05 cg26747293 133584 EGFLAM 0.68 3.72E-09 1.08E-07 0.69 1.70E-09 8.20E-07 cg26756083 4325 MMP16 0.57 3.77E-08 8.61E-07 0.56 7.87E-08 9.18E-06 cg27138584 56660 KCNK12 0.41 5.84E-10 2.19E-08 0.37 1.80E-08 3.26E-06 cg27196745 5800 PTPRO 0.73 2.43E-10 1.02E-08 0.70 2.76E-09 9.81E-07 cg27286999 10439 OLFM1 0.39 3.77E-08 8.61E-07 0.43 1.18E-10 1.83E-07 cg27319898 219578 ZNF804B 0.63 4.42E-07 7.78E-06 0.64 8.22E-08 9.49E-06 cg27320127 56660 KCNK12 0.52 3.01E-11 1.81E-09 0.46 4.24E-08 5.86E-I cg27351358 627 BDNF 0.49 6.74E-06 8.92E-05 0.51 6.90E-08 8.36E-I cg27376271 147381 CBLN2 0.29 2.39E-09 7.31E-08 0.22 1.07E-07 1.16E-I
In order to determine whether there are DNA methylation markers specifically associate with CIMP-L subgroup, 22 CpG sites were examined that showed significant DN hypermethylation in CIMP-L tumors, but not in CIMP-H tumors, as compared to non-CIM
tumors [FDR-adjusted P < 0.001 (CIMP-L vs. non-CIMP) and P > 0.05 (CIMP-H vs. non- CIMP)] (Figure 2A). Although these markers exhibited statistically significant DNA methylation differences, they did not show strong CIMP-L-specificity when visualized and compared with individual tumor samples using a heatmap (Figure 2B). The DNA methylation levels of each CpG locus was also directly compared between CIMP-H tumor and CIMP-L tumors (Figure 10A). Two CpG loci in the promoter regions of SRRM2 and NTF3 were identified that are significantly hypermethylated in CIMP-L tumors compared with CIMP-H tumors (P < 0.001 and mean β-value difference > 0.2). Interestingly however, these two gene loci exhibit CIMP-H-specific DNA hypomethylation, as these are methylated in normal-adjacent tissues, as well as in tumors that belong to the cluster 3 and cluster 4 subgroups (Figure 10B).
Figures 10A-B show, according to particular exemplary aspects, a comparison of DNA methylation profiles between CIMP-H and CIMP-L tumors. (A) The volcano plot shows the -1 x logio-transformed FDR-adjusted P value vs. the mean DNA methylation difference between CIMP-H and CIMP-L tumors. FDR-adjusted P = 0.001 and |Δβ| = 0.2 are used as a cutoff for differential methylation. Two CpG sites that are hypermethylated in CIMP-L tumors compared with CIMP-H tumors are indicated in green. (B) Heatmap representing Infinium DNA methylation β-values for the two CpG sites (labeled in green in panel A, herein reproduced in gray-scale, herein reproduced in gray-scale, that are significantly hypermethylated in CIMP-L compared with CIMP-H tumors. The four DNA methylation-based subgroups are indicated above the heatmap. A color gradient from dark blue to yellow (herein reproduced in gray-scale) was used to represent the low and high DNA methylation β-values, respectively.
Specifically, we also did not find a significant increase in MGMT DNA hypermethylation in CIMP-L tumors compared with non-CIMP tumors (P > 0.05), as reported previously (Ogino et al, 2007). Clinically, Ogino and colleagues observed a significant association between CIMP-L and male sex (Ogino et al., 2006). Present Applicants also found that CIMP-L tumors are slightly more common in men (59%) than women (41%), although the association did not achieve statistical significance (P > 0.05, Fisher's exact test).
EXAMPLE 4
(DNA methylation associated with KRAS-mutant tumors was analyzed)
Significant enrichment of KRAS mutations in the CIMP-L may suggest that KRA mutations either induce DNA hypermethylation of a group of CpG loci or they might synergi; with a specific DNA methylation profile associated with CIMP-L tumors. Interestingly, Shen
al. proposed a CIMP2 subtype of CRC, found to be tightly linked with KRAS mutations (92% of cases), using a limited number of DNA methylation markers (Shen et al., 2007).
In this Example, Applicants investigated whether KRAS mutations themselves are associated with DNA hypermethylation of specific sets of genes in CRC. We stratified tumors into three groups by their BRAF and KRAS mutation status: 1) BRAF mutant (n=17), 2) KRAS mutant (n=34), and 3) wild-type for both BRAF and KRAS (n=74), and then compared DNA methylation profiles between each group. A large number of CpG sites (715, FDR-adjusted P < 0.0001) were identified that are significantly hypermethylated in tumors with BRAF mutation, all of which belong to the CIMP-H subgroup, as compared with tumors with wild-type for BRAF and KRAS (Fig. 2C). In contrast, only one CpG locus located in the promoter of JPH3 showed DNA hypermethylation in the KRAS-mutant tumors compared to the BRAF/KRAS wild-type tumors at the 0.01 significance level (Figure 2C). Using a less stringent significance threshold (FDR-adjusted P < 0.05), 157 CpGs were identified that showed more frequent DNA methylation in KRAS-mutant tumors (Figure 2C). However, the mean β-value differences for the majority of these probes between tumors with KRAS mutation and those with BRAF/KRAS wild-type were found to be small (0.08 ± 0.09, mean |Δβ| ± s.d.). Among the 157 probes, the 22 CpG sites that showed substantial mean β-value difference ((|Δβ| >0.20) between KRAS-mutant tumors and BRAF/KRAS wild-type tumors were further examined. Importantly, we found that all of these CpG sites exhibit CIMP-L-specific DNA hypermethylation with much higher significance levels (Wilcoxon rank-sum test between CIMP-L and Non-CIMP tumors) (see Table 4 below). These observations indicate that the significant association between DNA methylation at these loci and KRAS mutation is mainly due to CIMP-L-based DNA hypermethylation. Table 4. CpG sites associated with KRAS mutant tumors based on P value < 0.05 (Wilcoxon rank- sum test) and mean DNA methylation β-value difference > 0.20 between KRAS mutant and BRAF/KRAS wild-type tumors.
To further examine the DNA methylation profiles in KRAS mutant tumors and BRAFIKRAS wild-type tumors, CIMP-L and non-CIMP tumors were subdivided by their KRAS mutation status and the mean DNA methylation β-values were compared among these groups. Mean DNA methylation β-values for KRAS mutant tumors and those BRAF/KRAS wild-type tumors were observed to be well correlated within both the CIMP-L and non-CIMP subgroups (Figures 3 A and 3B). Moreover, the CIMP-L subgroup exhibits higher mean DNA methylation in a number of CpG sites irrespective of KRAS mutation status (Figures 3C and 3D). These observations highlight the involvement of more complex molecular mechanisms in driving these DNA methylation clusters.
Specifically, Figures 3A-D show, according to particular exemplary aspects, that CIMP- L-associated DNA hypermethylation occurs independent of KRAS mutation status in CRC. CIMP-L and non-CIMP tumors were subdivided by their KRAS and BRAF mutation stati (KRAS mutant or BRAF/KRAS wild-type), and mean DNA methylation β-values were compare between each group. Scatter plots comparing mean DNA methylation β-values between ( KRAS mutant and BRAF/KRAS wild-type tumors within the CIMP-L subgroup, (B) KRA mutant and BRAFIKRAS wild-type tumors within the non-CIMP subgroup, ( ) KRAS mutar
CIMP-L tumors versus KRAS mutant, non-CIMP tumors and (D) BRAFIKRAS wild-type, CIMP- L tumors compared to non-CIMP tumors with the same genotype.
EXAMPLE 5
(Sequence characteristics of CIMF '-associated gene promoters were analyzed)
In this working example, gene promoters that acquired cancer-specific DNA methylation were classified into three categories based on their DNA methylation level profiles across colorectal tumor subtypes (see Methods of Example 1 herein, and Table 5 below): 1) CIMP- associated DNA methylation markers specific for the CIMP-H subgroup only, 2) CIMP-specific DNA methylation shared between both the CIMP-H and CIMP-L subgroups, and 3) non-CIMP cancer- specific DNA methylation. For comparison, 500 gene promoters were included in two additional groups that did not exhibit cancer-specific DNA methylation profiles, and were either constitutively methylated or unmethylated across tumor and adjacent-normal tissue samples (Figure 4).
Applicants explored whether the distinction between these groups of promoters can be attributable to simple structural and sequence characteristics. The majority of genes in all three groups that exhibited cancer-specific DNA methylation as well as the genes that were constitutively unmethylated in normal and tumor tissues are located within CpG islands defined by Takai and Jones (Takai and Jones, 2002) (see Figure 4 herein).
Figure 4 shows, according to particular exemplary aspects, ES-cell histone marks associated with genes in the five classification groups described in the text. Shown are heatmap representations of DNA methylation β-values for unique gene promoters that belong to five different categories: 1. CIMP-H specific: CIMP-associated DNA methylation markers specific for CIMP-H subgroup only (n=415 genes), 2. CIMP-H & CIMP-L: CIMP-specific DNA methylation shared between the CIMP-H and CIMP-L subgroups (n=73 genes), 3. Non-CIMP: cancer-specific DNA methylation but outside of the CIMP context (n=547 genes), 4. Constitutive-Low: Constitutively unmethylated genes in both tumor and adjacent normal tissue samples (n=500 genes), 5. Constitutive-High: Constitutively methylated in both tumor and adjacent normal tissue samples (n=500 genes). Genes containing CpG islands defined by Tak~ : and Jones are indicated by horizontal black bars immediately to the right of each heatmap. Tl bar charts to the right of each heatmap show the proportion of gene promoters with occupanc of histone H3 lysine 4 trimethylation (K4) and/or histone H3 lysine 27 trimethylation (K27) human ES cells. Probes that do not have these histone mark information (listed in Table 5 ; "NA") were not included in the bar chart calculations. The probes in each category are orden
according to the unsupervised hierarchal clustering using correlation distance metric and average linkage method. The RPMM-based cluster assignments are indicated above the heatmaps.
Present Applicants did not observe significant differences in the overall distribution with respect to the CpG observed-to-expected ratio, G:C content, and CpG island length among these four groups of DNA sequences (Figure 1 1A-C). Therefore, these DNA sequence characteristics do not discriminate among CIMP-associated, non-CIMP-associated, and constitutively unmethylated sequences.
Figures 1 1A-E show, according to particular exemplary aspects, DNA structural and sequence characteristics associated with five different gene categories based on DNA methylation profiles in colorectal tumors. The five categories include: 1 , CIMP-associated DNA methylation markers specific for the CIMP-H subgroup only; 2, CIMP-specific DNA methylation shared between both the CIMP-H and CIMP-L subgroups; 3, non-CIMP cancer- specific DNA methylation; 4, constitutively unmethylated across tumor and adjacent normal tissue samples; 5, constitutively methylated across tumor and adjacent normal tissue samples. Distribution of (A) observed CpG/expected CpG ratio and (B) GC content over 250 bp upstream and 250 bp downstream from the interrogated CpG dinucleotide on the Infmium DNA methylation BeadArray, (Q the Takai and Jones-calculated CpG island length (Takai and Jones, 2002), (D, E) distances of Infmium DNA methylation probes to the nearest (D) ALU and (E) LINE repetitive element. In each box plot, the top and bottom edges are the 25th and 75th quartiles, respectively. The horizontal line within each box identifies the median. The whiskers above and below the box extend to at most 1.5 times the interquartile range (IQR).
Applicants also considered that specific sequence motifs or repeat sequences surrounding CpG islands may have a role in differential DNA hypermethylation specifically in CIMP tumors. There was no enrichment or depletion of any di- or tetranucleotide sequences and known transcription factor binding sites in the CIMP-associated CpG islands (data not shown). Recently, Estecio and colleagues reported that retrotransposons are more frequently associated with CpG islands that are resistant to DNA hypermethylation than those that are susceptible to DNA hypermethylation (Estecio et al., 2010). Consistent with their observations, we found that the distances of Infmium DNA methylation probes to the nearest ALU repetitive element we ~~ significantly different between cancer-specifically methylated DNA promoter sequenci (median distance: 4,300 bp) and those that do not exhibit cancer-specific DNA methylatic changes (median distance: 1 ,730 bp) (P < 2.2x 10-16, Wilcoxon rank-sum test) (Figure HE Similarly, cancer-specifically methylated DNA promoter sequences showed a greater medic distance to LINE repetitive elements compared with those that do not show cancer-specific DN
methylation changes (3,880 bp vs. 2,710 bp; P = 1.9x 10-13, Wilcoxon rank-sum test). Interestingly, differences in the proximity to ALU repeat sequences between CIMP-H-associated and non-CIMP-associated promoters were observed to be statistically significant with median distances of 3,410 bp and 4,730 bp respectively (P = 1.8x 10-6, Wilcoxon rank-sum test; Figure 1 ID). However, no such significant differences for LINE repetitive element between CIMP-H-associated and non-CIMP-associated promoters (P = 0.18) were observed.
The trimethylation status of histone H3 lysine 4 (H3K4me3) and histone H3 lysine 27 (H3K27me3) were next identified in human ES cells for genes in the five classification groups described above using a previously published dataset (Ku et al, 2008). The genes that are constitutively unmethylated across tumor and adjacent-normal tissue samples were found to be highly enriched for H3K4me3, whereas those that are constitutively methylated are enriched for chromatin states with neither marks in ES cells (Figure 4). As has previously been reported, the fraction of genes that coincide with ES-cell bivalent domains is substantially higher for the genes that undergo cancer-specific DNA methylation than those that are constitutively methylated or unmethylated across tumor and adjacent-normal tissue samples. Applicants found that more than 50% of colorectal cancer-specific DNA hypermethylation occurs at ES-cell bivalent domains. However, the proportion of the ES-cell bivalent domains among CIMP- associated and non-CIMP-associated genes is similar, suggesting that the features associated with these targets are not specific for CIMP-positive tumors nor CIMP genes, but general features of colorectal cancer (Figure 4).
Table 5. Gene promoter classification among colorectal samples.
EXAMPLE 6
(Diagnostic CIMP-associated DNA methylation gene marker panels were identified) In this working example, Applicants developed diagnostic DNA methylation gene marker panels to identify CIMP (CIMP-H and CIMP-L), as well as to segregate CIMP-H tumors from CIMP-L tumors based on the Infinium DNA methylation data (Figure 5).
In particular aspects, a CIMP-defining marker panel consisting of B3GAT2, FOXL2, KCNK13, RAB31 and SLIT1 was identified. Using the conditions that DNA methylation of three or more markers qualifies a sample as CIMP, this panel identifies CIMP-H and CIMP-L tumors with 100% sensitivity and 95.6% specificity with 2.4% misclassification using a β-value threshold of > 0.1.
In particular aspects, a second marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 specifically identifies CIMP-H tumors with 100% sensitivity and 100% specificity (0% misclassification) using conditions that three or more markers show DNA methylation β-value threshold of > 0.1.
In certain asepcts, a tumor sample is classified as CIMP-H if both marker panels a positive (three or more markers with DNA methylation for each panel).
In further aspects, a tumor sample is classified as CIMP-L if the CIMP-defining mark panel is positive while the CIMP-H specific panel is negative (0-2 genes methylated).
Table 7 lists the gene and CpG island locations and sequences for the 10 marker genes comprising these two marker panels (i.e., B3GAT2, FOXL2, KCNK13, RAB31 and SLITI; and FAM78A, FSTLl, KCNCl, MYOCD, and SLC6A4).
Table 11 lists the primer, probe and unconverted amplicon sequences for the MethyLight reactions for the 10 marker genes comprising these two marker panels (i.e., B3GAT2, FOXL2, KCNK13, RAB31 and SLITI; and FAM78A, FSTLl, KCNCl, MYOCD, and SLC6A4), and for the MLH1 gene.
In yet further aspects, identification and/or classification of CIMP-H and CIMP-L subgroups is provided by a panel comprising at least one of the additional markers listed in Table 8. According to particular aspects,
In yet further aspects, identification and/or classification of CIMP-H subgroups is provided by a panel comprising at least one of the additional markers listed in Table 9.
In additional aspects the MethyLight five-marker panel (i.e., CACNA1G, IGF2, NEUROG1, RUNX3, SOCSl), or markers thereof, previously developed in Applicants' laboratory (Weisenberger et al, Nat Genet 38: 787-793, 2006; see also published US Patent Application Serial No. 11/913,535, DNA METHYLATION MARKERS ASSOCIATED WITH THE CPG ISLAND METHYLATOR PHENOTYPE (CIMP) IN HUMAN COLORECTAL CANCER, published as US-2009-0053706-A1 to Laird; all incorporated by reference herein in their entirety; and see Table 10) are used in combination with the panels disclosed herein to provide for identification and/or classification of CRC.
Table 7. Gene and CpG island locations and sequences for the 10 marker genes comprising two preferred marker panels for identification an classification of CRC.
HUGO Entrez Illumina Chrom Genome Source Unmethylate Methylated Accession; Promoter UCSC UCSC Genomi Symbol Gene ID Probe o-some Build Sequence d AlleleA AlleleB Probe and sequence CpG CpG promote
ID Probe Sequence Version position island island sequenc
Sequence (GI) Start and Number and
End; of CpGs Genomi
CpG isl
(CpG sequenc island
length)
KCNK 56659 cg02136 Human GTAGGTG ATAAATA ATAAATACC NM 02205 chrl4:905266 89596449 240 (SEQ I 13 132 chr 14 Feb. CCTCCCCA CCTCCCCA TCCCCAAAT 4.2; 08-90529608 to NO:25);
2009 GGTAGAT AATAAAT AAATCGACG 89598704 and
(GRCh3 CGACGAT CAACAAT ATAATACCT GI: 1630655 (2255) (SEQ I
7/hgl9) GGTGCCT AATACCT CCTAATTATA 4; NO:26)
CCTAGTTG CCTAATTA ATCG (SEQ ID
TGGTCG TAATCA NO:24)
(SEQ ID (SEQ ID NC 000014
NO:22) NO:23) .8
(90,528,108
to
90,652,195)
GL2245898
05
SLIT1 6585 cg07143 chrlO Human CGGTGGA AAATATA AAATATATT NM 00306 chrl0:989441 chrl0:989 108 SEQ ID
898 Feb. CTGCCAC TTCTTAAA CTTAAAAAT 1.2; 83-98947183 45063- NO:30);
2009 GGCACGG AATAACC AACCTACAA 98946239 and
(GRCh3 GGCTGCA TACAACC CCCCGTACC GI: 1885286 (SEQ I
7/hgl9) GGCCATT CCATACC GTAACAATC 74 (1177) NO:31)
CCCAAGA ATAACAA CACCG (SEQ
ATATACCT TCCACCA ID NO:29)
(SEQ ID (SEQ ID
NO:27) NO:28)
Table 8. Gene and CpG island locations and sequences for additional markers comprising preferred marker panels for identification an classification of of CIMP-H and CIMP-L CRC subgroups.
HUGO Entrez Illumina Chromo Genome Source Unmethylated Methylated Accession; Promoter UCSC CpG UCSC Genomi
Symbol Gene ID Probe -some Build Sequecne: AlleleA AlleleB Probe and sequence island Start CpG promote
ID Probe Sequence Version position and End; island sequenc
Position Sequence (GI) Number and and (CpG of CpGs Genomi sequence island CpG isl length) sequenc chrl0:8962 (SEQ I
4102- NO: 109
89624151 and
(SEQ I NO: 110
GATGGA
AATGGC AATAAAAA
TCTGGAC TAACTCTA AATAAAAAT
TTGGCG AACTTAAC AACTCTAAA
GTAGCT AATAACTA CTTAACGAT
Human GATGCC ATACCCCT AACTAATAC NM 00031
Feb. CCTCGCT CACTCTAC CCCTCGCTCT 4.4
2009 CTGCCG CA ACCG chrl0:8962
cg0885 (GRCh3 (SEQ ID (SEQ ID (SEQ ID GI: 110224 chrl0:896216 1773-
PTEN 5728 9916 7/hgl9) NO: 106) NO: 107) NO: 108) 474 95-89624695 89624128
chr7:69064 (SEQ I
347- NO: 114
69064396 and
(SEQ I NO: 115
AGTGTG
GGGCTC
CCCACA AATATAAA
GCACCG ACTCCCCA AATATAAAA
AGGGTC CAACACCA CTCCCCACA
GGAGAT AAAATCAA ACACCGAAA
Human GCCTGG AAATACCT ATCGAAAAT NM 01557
Feb. GAGCAG AAAAACA ACCTAAAAA 0.2
2009 CG ACA CAACG chr7:69062
cgl575 (GRCh3 (SEQ ID (SEQ ID (SEQ ID GI: 187829 chr7:6906240 375-
AUTS2 26053 3757 7/hgl9) NO: 111) NO: 112) NO: 113) 443 6-69065406 69065037
Table 9. Gene and CpG island locations and sequences for additional markers comprising preferred marker panels for identification an classification of of CIMP-H CRC subgroups.
Table 10. Table 6 of published US-2009-0053706-A1 to Laird.
Table 11. Primer, probe and unconverted amplicon sequences for the MethyLight reactions for the 10 marker genes comprising these two ma panels (i.e., B3GAT2, FOXL2, KCNK13, RAB31 and SLITl; and FAM78A, FSTLl, KCNCl, MYOCD, and SLC6A4), and for the MLHl gene.
Reaction HUGO Gene Reaction Iiifiiiium Forward Primer Reverse Primer Probe Oligo
No. Nomenclature ID Target eg Sequence Sequence Sequence Amplicon sequence unconverted
TCCATCCCTAAGCCCCGGCAG
6FAM- CCGATTCGGAGACTCGGGAGG
CIMP TTTATTTTTAAGT GACGATAATACC TCGCGCTAAACCT CCACAGGCTCAGCGCGACACC
H- Infinium TTCGGTAGTCGA TCCTAATTATAAT ATAACCTCCCGA ACGACCACAACTAGGAGGCAC
KCNK1 target T CGTAA(SEQ ID ATC-BHQ1 CATCGTC
HB-973 KCNK13 3-M1B cg02136132 (SEQ ID NO:221) NO:222) (SEQ ID NO:223) (SEQ ID NO:224)
CIMP AGGACCCCCACCCGGGAGTCA
Infinium 6FAM- GCGCCATGGTGCCCTCACAGC target CCGTCTAACTCGC GTCCCGCTCGCGAGCCAGACG
H- cg07143898 AGGATTTTTATT CGAACGAAAATA GAACGAAACGCT GCAGCAGCCGCTGACCATCCC
SLIT1- (not CGGGAGTTAGC ATCAACGACTAC ATAAA-BHQl CGTCCG
HB-974 SLIT1 M1B overlapping) (SEQ ID NO:225) (SEQ ID NO:226) (SEQ ID NO:227) (SEQ ID NO:228)
AATGGCCTGCAGCCCCGTGCC
6FAM- GTGGCAGTCCACCGTGGTTCC
CIMP CCCTCTACACCTA GGTGCAGGTGCAGAGGGCGG
H- Infinium AATGGTTTGTAG ACGCCTAAATAC CACCGAAACCAC GGCACGCCGAGGCACCCAGGC
SLIT1- target TTTCGTGTCG CTCGACGT GA-BHQ1 GC
HB-975 SLIT1 M2B cg07143898 (SEQ ID NO:229) (SEQ ID NO:230) (SEQ ID NO:231) (SEQ ID NO:232)
CATGATGGCGATACGGGAGCT
6FAM- CAAAGTGTGCCTTCTCGGGGT
CIMP ACGAATAACGAC GAGTCCTGGCCGCCACCCGCC
H- Infinium TATGATGGCGAT CGAAAACGCGAA CAAAACTCACCC GGCGGACCCCGGCCCGCGCTC
RAB31- target ACGGGAGT CCGA CGAA-BHQ1 TCG
HB-976 RAB31 M1B cg04274487 (SEQ ID NO:233) (SEQ ID NO:234) (SEQ ID NO:235) (SEQ ID NO:236)
GGCTCCACCGAGTTCCGCTTG
6FAM- CGTCAGGCGCCTTCGCCCCTA
CIMP CGACTAACCGCC TAGCGGGGCGGCCAGCCGCGC
H- Infinium GGTTTTATCGAG AACTTAAAAATA CCGCTATAAAAA ACGGGCGAGTTCATCTCCAAG
FOXL2/C30 C30RF7 target TTTCGTTTGC AACTCGCCCGTA CGA-BHQ1 TC
HB-977 RF72 2-M1B cgl7503456 (SEQ ID NO:237) (SEQ ID NO:238) (SEQ ID NO:239) (SEQ ID NO:240)
GGCGCTGCAGAGACCTGGAGC
6FAM- CGCGGGGCTCACTACCTGGGC
CIMP CTACCGCTCCTCC GTGGAGGAGCGGCAGGTTCGC
H- Infinium GGCGTTGTAGAG CGCCTACACCCCT ACGCCCAAA- GCAAGCTAGAGCGACAAGGG
B3GAt2- target ATTTGGAGTC TATCG BHQ1 GTGCAGGCG
HB-978 B3GAT2 M1B cg!8403396 (SEQ ID NO:241) (SEQ ID NO:242) (SEQ ID NO:243) (SEQ ID NO:278)
Reaction HUGO Gene Reaction Iiifiiiium Forward Primer Reverse Primer Probe Oligo
No. Nomenclature ID Target eg Sequence Sequence Sequence Amplicon sequence unconverted
CGCACGACCGCGCGCACCAGC
6FAM- GAATAATAGCCGCCCGTGACA
CIMP CCGCCCGTCCGA TCTCCGCTGATACCGTCCCGG
H- Infinium CGTACGATCGCG CCCTACAACGAC AACGATATCAA- ACGGGCGGGGTGGGGGGCGA
FAM78 target CGTATTA AACCGCT BHQ1 GCGGCTGCCGCTGCAGGG
HB-979 FAM78A A-M2B cgl2998491 (SEQ ID NO:244) (SEQ ID NO:245) (SEQ ID NO:246) (SEQ ID NO:247)
GGCCCGCCGCAAAGAGTTAAG
6FAM- AGCCGGTTCCCGAGACGGCTT
CIMP GGTTCGTCGTAA AAACCGCCGAAA CGGCGGCTCCGGGTCCCCAGA
H- Infinium AGAGTTAAGAGT CAATCAAAAACG CCGTCTCGAAA- CCCCGCTCGCCGCTCCTGATT
MYOCD target C ACGAACGA BHQ1 G
HB-980 MYOCD -M1B cg21665000 (SEQ ID NO:248) (SEQ ID NO:249) (SEQ ID NO:250) (SEQ ID NO:251)
CAGCCCAGCGGAACCCCAGCT
6FAM- CGAGCCCGGGCTCACGGAGAG
CIMP TAGTTTAGCGGA CAAAAACACCCG TAACGCCGAACG CAGCGCTCGGCGTTAGCCGCA
H- Infinium ATTTTAGTTCGA AAATATTACTCGT CTACTCTCCGTAA CGAGCAACACCCCGGGTGCCC
KCNC1- target GT A ACC-BHQ1 CTG
HB-981 KCNC1 M1B cg06763078 (SEQ ID NO:252) (SEQ ID NO:253) (SEQ ID NO:254) (SEQ ID NO:255)
CIMP CCTCGGCCCCTCGCCTACCTC
Infinium 6FAM- GGCGCGGACCCAGGCGACCGC target CTCGCGCTAATA CACCAGCGCGAGCGCGAGCGC
H- cg22469841 TTTCGGTTTTTCG CTTCCGCAAATAT ACGATCGCCTAA GAGCCAGCGTTTCCACATCTG
FSTL1- (not TTTATTTCG AAAAACGCT ATCCG-BHQ1 CGGAAG
HB-982 FSTL1 M1B overlapping) (SEQ ID NO:256) (SEQ ID NO:257) (SEQ ID NO:258) (SEQ ID NO:259)
CIMP GACCGAAACTCCCAGCGCCAC
Infinium 6FAM- CCCGGGAGAGCATCCCCAGGA target CGCTAAACGAAT CGCGCGCCCACCCGCCCAGCG
H- cg22469841 CATCGAAATTTT AACTCGATCCCC AAACGCGCGTCC CGCAGACCCAAGAGGCCCCGG
FSTL1- (not TAGCGTTATTTC GAAACC T-BHQ1 GGACCGAGTT
HB-983 FSTL1 M2B overlapping) (SEQ ID NO:260) (SEQ ID NO:261) (SEQ ID NO:262) (SEQ ID NO:263)
CIMP GACCGAAACTCCCAGCGCCAC
Infinium 6FAM- CCCGGGAGAGCATCCCCAGGA target CGCTAAACGAAT CGCGCGCCCACCCGCCCAGCG
H- cg22469841 CATCGAAATTTT CCCGAAACCTCTT AAACGCGCGTCC CGCAGACCCAAGAGGCCCCGG
FSTL1- (not TAGCGTTATTTC AAATCTACG T-BHQ1 G
HB-984 FSTL1 M3B overlapping) (SEQ ID NO:260) (SEQ ID NO:264) (SEQ ID NO:262) (SEQ ID NO:265)
EXAMPLE 7
(Effects of DNA hypermethylation on gene expression were characterized) Promoter CpG island DNA hypermethylation can lead to transcriptional silencing of the associated gene. However, the majority of cancer-specific CpG island hypermethylation may occur in gene promoters that are not normally expressed, and therefore may not be involved in tumor initiation or progression (Widschwendter et al, 2007; Gal- Yam et al, 2008).
In this working example, Applicants examined the extent to which cancer-specific DNA hypermethylation affects gene expression in colorectal tumors, by performing an integrated analysis of promoter DNA methylation and gene expression data from six CIMP-H normal adjacent-tumor pairs and 13 pairs of non-CIMP tumors and adjacent-normal tissues. Applicants found that 7.3% of genes that showed DNA hypermethylation (|Δβ| >0.20) in CIMP-H tumors also showed more than a 2-fold reduction in gene expression (Figures 6 A and 6B). Applicants identified 464 genes that are downregulated more than 2-fold in CIMP-H tumors compared with adjacent normal tissue (Figure 6A).
Figures 6A-C show, according to particular exemplary aspects, an integrated analysis of gene expression and promoter DNA methylation changes between colorectal tumors and matched normal adjacent tissues. (A) Mean DNA methylation β-value differences between CIMP-H tumors and matched normal colonic tissues (n=6) are plotted on the x-axis and mean log2-transformed gene expression values differences are plotted on the y-axis for each gene. Red data points highlight those genes that are hypermethylated with β-value difference >0.20 and show more than 2-fold decrease in their gene expression levels in CIMP-H tumors. (B) Pie chart showing the gene expression changes of 1 ,534 hypermethylated genes in CIMP-H tumors compared with adjacent normal tissues. ( ) Bar chart showing the number of genes that exhibit DNA hypermethylation and/or gene expression changes in non-CIMP tumors among the 1 12 genes that are hypermethylated and downregulated in CIMP-H tumors.
Applicants found that 1 12 genes (24%) that are downregulated in CIMP-H are directly associated with promoter DNA hypermethylation (Table 6 below).
Furthermore, 12 genes were identified that are both downregulated and cancer- specifically hypermethylated in both CIMP-H and non-CIMP tumors (Figure 6C and Table - below). DNA hypermethylation and transcriptional silencing of these genes may play a critic role in the development of CRC, irrespective of molecular subgroups. These include SFRP1 ar SFRP2, which function as negative regulators of Wnt signaling and have been proposed ; epigenetic gatekeeper genes in colorectal tumorigenesis (Baylin and Ohm, 2006). Applican
validated the DNA methylation and gene expression findings for SFRPl and TMEFF2 using MethyLight and quantitative RT-PCR (qRT-PCR) technologies, respectively (Figure 12).
Figures 12A-D show, according to particular exemplary aspects, validation of the Infimum DNA methylation data and gene expression array data using MethyLight and quantitative RT-PCR (qRT-PCR), respectively. The validations were performed for three genes indicated above each scatter plot {A) Comparison of Infimum DNA methylation β-value (x-axis) and iog2 -transformed gene expression value from l ilumina expression array (y-axis). (B) Validation of Infinium DNA methylation data by MethyLight technology. The x-axis represents Infimum DNA methylation β-value and the y-axis represents PMR value from MethyLight assay. Pearson correlation coefficients between the assays: 0.85 for SFRPl, 0.91 for TMEFF2 and 0.96 for LMOD1. (Q Validation of li lumina expression array data by qRT-PCR assay. The x-axis represents log2-transformed array-based gene expression value and the y-axis represents log2-transformed relative copy number normalized to HTPR1 using qRT-PCR assay. Pearson correlation coefficients between the gene expression platforms: 0.93 for SFRPl, 0.89 for TMEFF2 and 0.91 for LMOD1. (D) Comparison of MethyLight PMR values (x-axis) and log2- transformed normalized relative copy number from qRT-PCR assay (y-axis). Black open circle: adjacent normal (n = 25), red open circle (herein reproduced in gray-scale): tumors in CIMP-L, Cluster 3 and Cluster 4 (n =: 19), blue open circle (herein reproduced in gray-scale): CIMP-H tumors (n = 6).
Intriguingly, 48/1 12 genes were also identified that are downregulated in both CIMP-H and non-CIMP tumors compared with the matched adjacent normal colon. However, substantial increases in promoter DNA methylation for these genes were observed only in CIMP-H tumors. This finding was confirmed for the LMOD1 gene using MethyLight and qRT-PCR technologies (Figure 12). LMOD1 has been found to be somatically mutated in human cancer and cancer cell lines (http://www.sanger.ac.uk/genetics/CGP/cosmic/). However, DNA hypermethylation of this gene has not yet been reported. These findings indicate that genetic or other epigenetic mechanismd such as chromatin modifications might be involved in silencing of these genes in non-CIMP tumors.
Table 6. Genes that are hypermethylated with β-value difference > 0.2 and show more than a 2-fold decrease in their gene expression levels in CIMP-H tumors compared with normal adjacent tissue.
Cited References; and that are incorporated by reference herein in their entirety):
Barbosa-Morais, N.L., M.J. Dunning, S.A. Samarajiwa, J.F. Darot, M.E. Ritchie, A.G. Lynch and S. Tavare. 2010. A re-annotation pipeline for Illumina BeadArrays: improving the interpretation of gene expression data. Nucleic Acids Res 38: el7.
Baylin, S.B. and J.E. Ohm. 2006. Epigenetic gene silencing in cancer - a mechanism for early oncogenic pathway addiction? Nat Rev Cancer 6: 107-116. Bernstein, B.E., A. Meissner and E.S. Lander. 2007. The mammalian epigenome. Cell 128: 669- 681.
Bibikova, M. 2009. Genome-wide DNA methylation profiling using Infinium assay.
Epigenomics 1: 177-200.
Campan, M., D.J. Weisenberger, B. Trinh and P.W. Laird. 2009. MethyLight. Methods Mol Biol 507: 325-337.Chan, A.O., R.R. Broaddus, P.S. Houlihan, J.P. Issa, S.R. Hamilton and A.
Rashid. 2002. CpG island methylation in aberrant crypt foci of the colorectum. Am J Pathol 160: 1823-1830.
Chan, T.A., S. Glockner, J.M. Yi, W. Chen, L. Van Neste, L. Cope, J.G. Herman, V.
Velculescu, K.E. Schuebel, N. Ahuja et al. 2008. Convergence of mutation and epigenetic alterations
identifies common genes in cancer that predict for poor prognosis. PLoS Med 5: el 14.
Cheng, Y.W., H. Pincas, M.D. Bacolod, G. Schemmann, S.F. Giardina, J. Huang, S. Barral, K. Idrees, S.A. Khan, Z. Zeng et al. 2008. CpG island methylator phenotype associates with low- degree chromosomal abnormalities in colorectal cancer. Clin Cancer Res 14: 6005-6013. Christensen, B.C., E.A. Houseman, J.J. Godleski, C.J. Marsit, J.L. Longacker, C.R. Roelofs, M.R. Karagas, M.R. Wrensch, R.F. Yeh, H.H. Nelson et al. 2009a. Epigenetic Profiles
Distinguish Pleural Mesothelioma from Normal Pleura and Predict Lung Asbestos Burden and Clinical Outcome. Cancer Res 69: 227-234.
Christensen, B.C., E.A. Houseman, C.J. Marsit, S. Zheng, M.R. Wrensch, J.L. Wiemels, H.H. Nelson, M.R. Karagas, J.F. Padbury, R. Bueno et al. 2009b. Aging and environmental exposures alter tissue-specific DNA methylation dependent upon CpG island context. PLoS Genet 5:
el000602.
Christensen, B.C., K.T. Kelsey, S. Zheng, E.A. Houseman, C.J. Marsit, M.R. Wrensch, J.L. Wiemels, H.H. Nelson, M.R. Karagas, L.H. Kushi et al. 2010. Breast cancer DNA methylation profiles are associated with tumor size and alcohol and folate intake. PLoS Genet 6: el 001043. Christensen, B.C., A.A. Smith, S. Zheng, D.C. Koestler, E.A. Houseman, C.J. Marsit, J.L.
Wiemels, H.H. Nelson, M.R. Karagas, M.R. Wrensch et al. 2011. DNA methylation, isocitrate dehydrogenase mutation, and survival in glioma. J Natl Cancer Inst 103: 143-153.
Dickinson, R.E., A. Dallol, I. Bieche, D. Krex, D. Morton, E.R. Maher and F. Latif. 2004.
Epigenetic inactivation of SLIT3 and SLIT1 genes in human cancers. Br J Cancer 91: 2071- 2078.
Du, P., W.A. Kibbe and S.M. Lin. 2008. lumi: a pipeline for processing Illumina microarray. Bioinformatics 24: 1547-1548.
Estecio, M.R., J. Gallegos, C. Vallot, R.J. Castoro, W. Chung, S. Maegawa, Y. Oki, Y. Kondo, J. Jelinek, L. Shen et al. 2010. Genome architecture marked by retrotransposons modulates predisposition to DNA methylation in cancer. Genome Res 20: 1369-1382. Estecio, M.R., V. Gharibyan, L. Shen, A.E. Ibrahim, K. Doshi, R. He, J. Jelinek, A.S. Yang, P.S. Yan, T.H. Huang et al. 2007. LINE-1 hypomethylation in cancer is highly variable and inversely correlated with microsatellite instability. PLoS ONE 2: e399.
Ewing, B. and P. Green. 1998. Base-calling of automated sequencer traces usingPhred. II. error probabilities. Genome research 8: 186.
Ewing, B., L.D. Hillier, M.C. Wendl and P. Green. 1998. Base-calling of automated sequencer traces usingPhred. I. Accuracy assessment. Genome research 8: 175.
Feinberg, A.P. and B. Vogelstein. 1983. Hypomethylation distinguishes genes of some human cancers from their normal counterparts. Nature 301: 89-92.
Gal- Yam, E.N., G. Egger, L. Iniguez, H. Holster, S. Einarsson, X. Zhang, J.C. Lin, G. Liang, P.A. Jones and A. Tanay. 2008. Frequent switching of Polycomb repressive marks and DNA hypermethylation in the PC3 prostate cancer cell line. Proc Natl Acad Sci U S A 105: 12979- 12984.
Gama-Sosa, M.A., V.A. Slagel, R.W. Trewyn, R. Oxenhandler, K.C. Kuo, C.W. Gehrke and M. Ehrlich. 1983. The 5-methylcytosine content of DNA from human tumors. Nucleic Acids Res 11: 6883-6894.
Goel, A., T. Nagasaka, C.N. Arnold, T. Inoue, C. Hamilton, D. Niedzwiecki, C. Compton, R.J. Mayer, R. Goldberg, M.M. Bertagnolli et al. 2007. The CpG island methylator phenotype and chromosomal instability are inversely correlated in sporadic colorectal cancer. Gastroenterology 132: 127-138.
Gordon, D., C. Abajian and P. Green. 1998. Consed: a graphical tool for sequence finishing. Genome research 8: 195.
Hinoue, T., D.J. Weisenberger, F. Pan, M. Campan, M. Kim, J. Young, V.L. Whitehall, B.A. Leggett and P.W. Laird. 2009. Analysis of the Association between CIMP and BRAF in Colorectal Cancer by DNA Methylation Profiling. PLoS One 4: e8357. Houseman, E.A., B.C. Christensen, R.F. Yeh, C.J. Marsit, M.R. Karagas, M. Wrensch, H.H. Nelson, J. Wiemels, S. Zheng, J.K. Wiencke et al. 2008. Model-based clustering of DNA methylation array data: a recursive-partitioning algorithm for high-dimensional data arising as a mixture of beta distributions. BMC Bioinformatics 9: 365. Ibrahim, A.E., M.J. Arends, A.L. Silva, A.H. Wyllie, L. Greger, Y. Ito, S.L. Vowler, T.H.
Huang, S. Tavare, A. Murrell et al. 2011. Sequential DNA methylation changes are associated with DNMT3B overexpression in colorectal neoplastic progression. Gut 60: 499-508.
Jass, J.R. 2007. Classification of colorectal cancer based on correlation of clinical, morphological and molecular features. Histopathology 50: 113-130.
Jiang, X., J. Tan, J. Li, S. Kivimae, X. Yang, L. Zhuang, P.L. Lee, M.T. Chan, L.W. Stanton, E.T. Liu et al. 2008. DACT3 is an epigenetic regulator of Wnt/beta-catenin signaling in colorectal cancer and is a therapeutic target of histone modifications. Cancer Cell 13: 529- 541.
Jones, P.A. and S.B. Baylin. 2007. The epigenomics of cancer. Cell 128: 683-692. Kondo, Y., L. Shen, A.S. Cheng, S. Ahmed, Y. Boumber, C. Charo, T. Yamochi, T. Urano, K. Furukawa, B. Kwabi-Addo et al. 2008. Gene silencing in cancer by histone H3 lysine 27 trimethylation independent of promoter DNA methylation. Nat Genet 40: 741-750.
Ku, M., R.P. Koche, E. Rheinbay, E.M. Mendenhall, M. Endoh, T.S. Mikkelsen, A. Presser, C. Nusbaum, X. Xie, A.S. Chi et al. 2008. Genomewide Analysis of PRCl and PRC2 Occupancy Identifies Two Classes of Bivalent Domains. PLoS Genet 4: el000242.
Leggett, B. and V. Whitehall. 2010. Role of the serrated pathway in colorectal cancer pathogenesis. Gastroenterology 138: 2088-2100.
Limsui, D., R.A. Vierkant, L.S. Tillmans, A.H. Wang, D.J. Weisenberger, P.W. Laird, C.F. Lynch, K.E. Anderson, A.J. French, R.W. Haile et al. 2010. Cigarette smoking and colorectal cancer risk by molecularly defined subtypes. J Natl Cancer Inst 102: 1012-1022. Marsit, C.J., B.C. Christensen, E.A. Houseman, M.R. Karagas, M.R. Wrensch, R.F. Yeh, H.H. Nelson, J.L. Wiemels, S. Zheng, M.R. Posner et al. 2009. Epigenetic profiling reveals etio logically distinct patterns of DNA methylation in head and neck squamous cell carcinoma. Carcinogenesis 30: 416-422. Marsit, C.J., D.C. Koestler, B.C. Christensen, M.R. Karagas, E.A. Houseman and K.T. Kelsey. 2011. DNA methylation array analysis identifies profiles of blood-derived DNA methylation associated with bladder cancer. J Clin Oncol 29: 1133-1139.
Miranda, T.B. and P.A. Jones. 2007. DNA methylation: the nuts and bolts of repression. J Cell Physiol 213: 384-390.
Monti, S., P. Tamayo, J. Mesirov, T. Golub. 2003. Consensus Clustering: A Resampling-Based Method for Class Discovery and Visualization of Gene Expression Microarray Data. Machine Learning Journal 52 (1-2): 91-118.
Nickerson, DA., V.O. Tobe and S.L. Taylor. 1997. PolyPhred: automating the detection and genotyping of single nucleotide substitutions using fluorescence-based resequencing. Nucleic Acids Res 25: 2745-2751.
Noushmehr, H., D.J. Weisenberger, K. Diefes, H.S. Phillips, K. Pujara, B.P. Berman, F. Pan, C.E. Pelloski, E.P. Sulman, K.P. Bhat et al. 2010. Identification of a CpG island methylator phenotype that defines a distinct subgroup of glioma. Cancer Cell 17: 510-522.
O'Brien, M.J. 2007. Hyperplastic and serrated polyps of the colorectum. Gastroenterol Clin North Am 36: 947-68, viii.
Ogino, S., T. Kawasaki, G.J. Kirkner, M. Loda and C.S. Fuchs. 2006. CpG island methylator phenotype-low (CIMP-low) in colorectal cancer: possible associations with male sex and KRAS mutations. J Mol Diagn 8: 582-588.
Ogino, S., T. Kawasaki, G.J. Kirkner, Y. Suemoto, J.A. Meyerhardt and C.S. Fuchs. 2007. Molecular correlates with MGMT promoter methylation and silencing support CpG island methylator phenotype-low (CIMP-low) in colorectal cancer. Gut 56: 1564-1571.
Ohm, J.E., K.M. McGarvey, X. Yu, L. Cheng, K.E. Schuebel, L. Cope, H.P. Mohammad, W. Chen, V.C. Daniel, W. Yu et al. 2007. A stem cell-like chromatin pattern may predispose tumor suppressor genes to DNA hypermethylation and heritable silencing. Nat Genet 39: 237- 242.
Pino, M.S. and D.C. Chung. 2010. The chromosomal instability pathway in colon cancer.
Gastroenterology 138: 2059-2072.
Rodriguez, J., M. Munoz, L. Vives, C.G. Frangou, M. Groudine and M.A. Peinado. 2008.
Bivalent domains enforce transcriptional memory of DNA methylated genes in cancer cells. Proc Natl Acad Sci U S A 105: 19809-19814. Schlesinger, Y., R. Straussman, I. Keshet, S. Farkash, M. Hecht, J. Zimmerman, E. Eden, Z.
Yakhini, E. Ben-Shushan, B.E. Reubinoff et al. 2007. Polycomb-mediated methylation on Lys27 of histone H3 pre-marks genes for de novo methylation in cancer. Nat Genet 39: 232-236.
Shen, L., M. Toyota, Y. Kondo, E. Lin, L. Zhang, Y. Guo, N.S. Hernandez, X. Chen, S. Ahmed, K. Konishi et al. 2007. Integrated genetic and epigenetic analysis identifies three different subclasses of colon cancer. Proc Natl Acad Sci USA 104: 18654-18659.
Suzuki, H., S. Igarashi, M. Nojima, R. Maruyama, E. Yamamoto, M. Kai, H. Akashi, Y.
Watanabe, H. Yamamoto, Y. Sasaki et al. 2010. IGFBP7 is a p53 -responsive gene specifically silenced in colorectal cancer with CpG island methylator phenotype. Carcinogenesis 31: 342- 349.
Takai, D. and P.A. Jones. 2002. Comprehensive analysis of CpG islands in human chromosomes 21 and 22. Proc Natl Acad Sci USA 99: 3740-3745.
Walther, A., E. Johnstone, C. Swanton, R. Midgley, I. Tomlinson and D. Kerr. 2009. Genetic prognostic and predictive markers in colorectal cancer. Nat Rev Cancer 9: 489-499.
Weisenberger, D.J., K.D. Siegmund, M. Campan, J. Young, T.I. Long, M.A. Faasse, G.H. Kang, M. Widschwendter, D. Weener, D. Buchanan et al. 2006. CpG island methylator phenotype underlies sporadic microsatellite instability and is tightly associated with BRAF mutation in colorectal cancer. Nat Genet 38: 787-793.
Widschwendter, M., H. Fiegl, D. Egle, E. Mueller-Holzner, G. Spizzo, C. Marth, D.J.
Weisenberger, M. Campan, J. Young, I. Jacobs et al. 2007. Epigenetic stem cell signature in cancer. Nat Genet 39: 157-158.
Wood, L.D., D.W. Parsons, S. Jones, J. Lin, T. Sjoblom, R.J. Leary, D. Shen, S.M. Boca, T. Barber, J. Ptak et al. 2007. The genomic landscapes of human breast and colorectal cancers. Science 318: 1108-1113.
Yagi, K., K. Akagi, H. Hayashi, G. Nagae, S. Tsuji, T. Isagawa, Y. Midorikawa, Y. Nishimura, H. Sakamoto, Y. Seto et al. 2010. Three DNA methylation epigenotypes in human colorectal cancer. Clin Cancer Res 16: 21-33.
Young, J., K.G. Biden, L.A. Simms, P. Huggard, R. Karamatic, H.J. Eyre, G.R. Sutherland, N. Herath, M. Barker, G.J. Anderson et al. 2001. HPP1 : a transmembrane protein-encoding gene commonly methylated in colorectal polyps and cancers. Proc Natl Acad Sci U S A 98: 265-270. Young, J. and J.R. Jass. 2006. The case for a genetic predisposition to serrated neoplasia in the colorectum: hypothesis and review of the literature. Cancer Epidemiol Biomarkers Prev 15: 1778-1784.
Young, J., M. Jenkins, S. Parry, B. Young, D. Nancarrow, D. English, G. Giles and J. Jass. 2007. Serrated pathway colorectal cancer in the population: genetic consideration. Gut 56: 1453- 1459.
Claims
1. A method of at least one of diagnosing, detecting and classifying a colorectal cancer belonging to a distinct colorectal cancer (CRC) subgroup having frequent CpG island hypermethylation (CIMP CRC), comprising:
determining, by analyzing a human subject biological sample comprising colorectal cancer (CRC) cell genomic DNA using a suitable assay, a CpG methylation status of at least one CpG dinucleotide from each gene of the gene marker panel of B3GAT2, FOXL2, KCNK13, RAB31 and SLIT1 (CIMP marker panel); wherein CpG hypermethylation, relative to normal control values, of at least three genes of the CIMP marker gene panel is indicative of a frequent CpG island hypermethylation colorectal cancer subgroup (CIMP CRC), and wherein a method of at least one of diagnosing, detecting and/or classifying a colorectal cancer belonging to the distinct colorectal cancer (CRC) subgroup having frequent CpG island hypermethylation (CIMP CRC) is afforded.
2. The method of claim 1, wherein CpG island hypermethylation colorectal cancer (CIMP CRC), comprises both CIMP-H and CIMP-L subgroups of CIMP.
3. The method of claim 1, wherein CIMP-H and CIMP-L tumors are identified with about 100% sensitivity and about 95.6%> specificity with about 2.4%> misclassification using conditions that three or more markers show DNA methylation β-value threshold of > 0.1. as defined herein.
4. The method of claim 1, further comprising:
determining, by analyzing the human subject biological using a suitable assay, a CpG methylation status of at least one CpG dinucleotide from each gene of an additional gene marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 (CIMP-H marker panel), wherein a CIMP-L subgroup of CIMP is indicated where the CIMP-defining marker panel is positive (hypermethylation of at least three genes of the CIMP marker gene panel) while the CIMP-H marker panel is negative (hypermethylation of only 0-2 genes of the CIMP-H marker gene panel), and wherein a CIMP-H subgroup of CIMP is indicated where both the CIMP-defining marker panel and the CIMP-H marker panel are positive (hypermethylation of at least three genes of each marker gene panel).
5. The method of claim 1, wherein determining a CpG methylation status of at least one CpG dinucleotide from each gene of the gene marker panel of B3GAT2, FOXL2, KCNK13,
RAB31 and SLIT1 (CIMP marker panel), comprises determining a CpG methylation status of at least one CpG dinucleotide from each of: at least one of SEQ ID NOS:45, 46 and 278 (B3GAT2 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:40, 41 and 240 (FOXL2 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:25, 26 and 224 (KCNK13 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:35, 36 and 236 (RAB31 promoter, CpG island and amplicon, respectively); and at least one of SEQ ID NOS:30, 31, 228 and 232 (SLIT1 promoter, CpG island and amplicons, respectively), respectively.
6. The method of claim 4, wherein determining a CpG methylation status of at least one CpG dinucleotide from each gene of the gene marker panel of FAM78A, FSTL1, KCNC1, MYOCD, and SLC6A4 (CIMP-H marker panel), comprises determining a CpG methylation status of at least one CpG dinucleotide from each of: at least one of SEQ ID NOS:50, 51 and 247 (FAM78A promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:65, 66, 259, 263 and 265 (FSTL1 promoter, CpG island and amplicons, respectively); at least one of SEQ ID NOS:60, 61 and 255 (KCNC1 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:55, 56 and 251 (MYOCD promoter, CpG island and amplicon, respectively); and at least one of SEQ ID NOS:70, 71, and 269 (SLC6A4 promoter, CpG island and amplicon, respectively), respectively.
7. The method of claim 1, further comprising determination of at least one of KRAS, BRAF and TP 53 mutant status.
8. The method of claim 7, wherein the BRAF mutation status comprises mutation status at codon 600 in exon 15 (e.g., BRAFV600E), wherein the the KRAS mutation status comprises mutation status at codon 12 and/or 13 in exon 2, and wherein the TP 53 mutation status comprises mutation status at exons 4 through 8.
9. The method of claim 8, wherein a positive mutation status comprises at least one of missense mutations, nonsense mutations, splice-site mutations, frame-shift mutations, and in- frame deletions.
10. The method of claim 1, further comprising determing a MLH1 gene methylation status, wherein MLH1 hypermethylation is strongly associated with CIMP-H CRC.
11. The method of claim 1, wherein determining methylation status comprises treating the genomic DNA, or a fragment thereof, with one or more reagents (e.g., bisulfite, hydrogen sulfite, disulfite, and combinations thereof) to convert cytosine bases that are unmethylated in the 5-position thereof to uracil or to another base that is detectably dissimilar to cytosine in terms of hybridization properties.
12. A method of at least one of diagnosing, detecting and classifying a colorectal cancer belonging to a distinct colorectal cancer (CRC) subgroup having frequent CpG island hypermethylation (CIMP CRC), comprising: determining, by analyzing a human subject biological sample comprising colorectal cancer (CRC) cell genomic DNA using a suitable assay, a CpG methylation status of at least one CpG dinucleotide from each gene of the gene marker panel of FAM78A, FSTL1, KCNCl, MYOCD, and SLC6A4 (CIMP-H marker panel); wherein CpG hypermethylation, relative to normal control values, of at least three genes of the CIMP-H marker gene panel is indicative of a CIMP-H subgroup of CIMP CRC, and wherein a method of at least one of diagnosing, detecting and classifying a colorectal cancer belonging to the CIMP-H subgroup of CIMP CRC is afforded.
13. The method of claim 12 wherein CIMP-H tumors are identified with about 100% sensitivity and about 100% specificity (about 0% misclassification) using conditions that three or more markers show DNA methylation β-value threshold of > 0.1. as defined herein.
14. The method of claim 12, further comprising determination of at least one of KRAS, BRAF and TP 53 mutant status.
15. The method of claim 14, wherein the BRAF mutation status comprises mutation status at codon 600 in exon 15 (e.g., BRAFV600E), wherein the the KRAS mutation status comprises mutation status at codon 12 and/or 13 in exon 2, and wherein the TP 53 mutation status comprises mutation status at exons 4 through 8.
16. The method of claim 15, wherein a positive mutation status comprises at least one of missense mutations, nonsense mutations, splice-site mutations, frame-shift mutations, and in- frame deletions.
17. The method of claim 12, wherein determining a CpG methylation status of at least one CpG dinucleotide from each gene of the gene marker panel of FAM78A, FSTL1, KCNCl, MYOCD, and SLC6A4 (CIMP-H marker panel), comprises determining a CpG methylation status of at least one CpG dinucleotide from each of: at least one of SEQ ID NOS:50, 51 and 247 (FAM78A promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:65, 66, 259, 263 and 265 (FSTL1 promoter, CpG island and amplicons, respectively); at least one of SEQ ID NOS:60, 61 and 255 (KCNCl promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:55, 56 and 251 (MYOCD promoter, CpG island and amplicon, respectively); and at least one of SEQ ID NOS:70, 71, and 269 (SLC6A4 promoter, CpG island and amplicon, respectively), respectively.
18. The method of claim 12, further comprising determing a MLH1 gene methylation status, wherein MLH1 hypermethylation is strongly associated with CIMP-H CRC.
19. The method of claim 12, wherein determining methylation status comprises treating the genomic DNA, or a fragment thereof, with one or more reagents (e.g., bisulfite, hydrogen sulfite, disulfite, and combinations thereof) to convert cytosine bases that are unmethylated in the 5-position thereof to uracil or to another base that is detectably dissimilar to cytosine in terms of hybridization properties.
20. A kit suitable for performing the methods according to claim 1, comprising, for each gene of the gene marker panel of B3GAT2, FOXL2, KCNK13, RAB31 and SLIT1, at least two oligonucleotides whose sequences in each case are identical, are complementary, or hybridize under stringent or highly stringent conditions to the respective marker gene; and optionally comprising a bisulfite reagent (e.g., bisulfite, hydrogen sulfite, disulfite, and combinations thereof).
21. The kit of claim 20, wherein the respective marker gene sequences comprise at least one sequence from each of: at least one of SEQ ID NOS:45, 46 and 278 (B3GAT2 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:40, 41 and 240 (FOXL2 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:25, 26 and 224 (KCNK13 promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:35, 36 and 236 (RAB31 promoter, CpG island and amplicon, respectively); and at least one of SEQ ID NOS:30, 31, 228 and 232 (SLIT1 promoter, CpG island and amplicons, respectively), respectively.
22. A kit suitable for performing the method according to claim 12, comprising, for each gene of the gene marker panel of FAM78A, FSTL1, KCNCl, MYOCD, and SLC6A4, at least two oligonucleotides whose sequences in each case are identical, are complementary, or hybridize under stringent or highly stringent conditions to the respective marker gene; and optionally comprising a bisulfite reagent (e.g., bisulfite, hydrogen sulfite, disulfite, and combinations thereof).
23. The method of claim 22, wherein the respective marker gene sequences comprise at least one sequence from each of: at least one of SEQ ID NOS:50, 51 and 247 (FAM78A promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:65, 66, 259, 263 and 265 (FSTL1 promoter, CpG island and amplicons, respectively); at least one of SEQ ID NOS:60, 61 and 255 (KCNCl promoter, CpG island and amplicon, respectively); at least one of SEQ ID NOS:55, 56 and 251 (MYOCD promoter, CpG island and amplicon, respectively); and at least one of SEQ ID NOS:70, 71, and 269 (SLC6A4 promoter, CpG island and amplicon, respectively), respectively.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161492325P | 2011-06-01 | 2011-06-01 | |
| US61/492,325 | 2011-06-01 | ||
| US201161492749P | 2011-06-02 | 2011-06-02 | |
| US61/492,749 | 2011-06-02 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012167145A2 true WO2012167145A2 (en) | 2012-12-06 |
| WO2012167145A3 WO2012167145A3 (en) | 2013-02-28 |
Family
ID=47260400
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/040547 Ceased WO2012167145A2 (en) | 2011-06-01 | 2012-06-01 | Genome-scale analysis of aberrant dna methylation in colorectal cancer |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20130065228A1 (en) |
| WO (1) | WO2012167145A2 (en) |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104046680A (en) * | 2013-03-11 | 2014-09-17 | 苏州承美生物科技有限公司 | Methyl DNA detection method |
| EP2816121A3 (en) * | 2013-05-29 | 2015-04-08 | Sysmex Corporation | Method for obtaining information on hepatocellular carcinoma and marker and kit for obtaining information on hepatocellular carcinoma |
| CN105400865A (en) * | 2015-07-06 | 2016-03-16 | 中国人民解放军总医院 | Detection of DNA methylation in the promoter region of TMEM176A gene |
| EP2977467A3 (en) * | 2014-07-11 | 2016-05-11 | Sysmex Corporation | Method, use of marker, and determination device for obtaining information on plural types of cancers |
| JPWO2016060278A1 (en) * | 2014-10-17 | 2017-08-31 | 国立大学法人東北大学 | How to predict the sensitivity of drug therapy to colorectal cancer |
| EP3126529A4 (en) * | 2014-03-31 | 2018-04-25 | Mayo Foundation for Medical Education and Research | Detecting colorectal neoplasm |
| IT201700072650A1 (en) * | 2017-06-28 | 2018-12-28 | Univ Degli Studi Cagliari | METHOD FOR READING AND / OR FOR THE PROGNOSIS OF COLON RECTAL NEOPLASES |
| WO2019068082A1 (en) * | 2017-09-29 | 2019-04-04 | Arizona Board Of Regents On Behalf Of The University Of Arizona | DNA METHYLATION BIOMARKERS FOR THE DIAGNOSIS OF CANCER |
| EP3543360A3 (en) * | 2013-03-14 | 2020-01-08 | Mayo Foundation for Medical Education and Research | Detecting neoplasm |
| EP3521448A4 (en) * | 2016-09-29 | 2020-07-29 | Hanumat Co., Ltd. | METHOD FOR DETERMINING THE RISK OF SPORADIC COLON CANCER |
| WO2020239896A1 (en) * | 2019-05-31 | 2020-12-03 | Universal Diagnostics, S.L. | Detection of colorectal cancer |
| WO2021072786A1 (en) * | 2019-10-16 | 2021-04-22 | 厦门信道生物技术有限公司 | Primer set for methylation of a specific region of a human colorectal cancer-related gene, test, test kit and application thereof |
| US11001898B2 (en) | 2019-05-31 | 2021-05-11 | Universal Diagnostics, S.L. | Detection of colorectal cancer |
| CN113249477A (en) * | 2021-05-19 | 2021-08-13 | 北京艾克伦医疗科技有限公司 | Method and kit for early diagnosis of colorectal cancer |
| CN114032313A (en) * | 2021-11-18 | 2022-02-11 | 广东海洋大学 | Method for evaluating, detecting and/or predicting beef quality traits of yak consumption |
| US11396679B2 (en) | 2019-05-31 | 2022-07-26 | Universal Diagnostics, S.L. | Detection of colorectal cancer |
| US11530453B2 (en) | 2020-06-30 | 2022-12-20 | Universal Diagnostics, S.L. | Systems and methods for detection of multiple cancer types |
| WO2023273257A1 (en) * | 2021-06-30 | 2023-01-05 | 武汉艾米森生命科技有限公司 | Diagnostic or auxiliary diagnostic reagent for colorectal cancer or precancerous lesions and use thereof, nucleic acid combination, and kit |
| RU2791172C1 (en) * | 2019-10-16 | 2023-03-03 | Сямынь Сайндокх Биолоджикал Текнолоджи Ко., Лтд. | Primer kit, reagent and commercial kit for methylation of specific gene regions associated with human colorectal cancer and use of the commercial kit |
| US11898199B2 (en) | 2019-11-11 | 2024-02-13 | Universal Diagnostics, S.A. | Detection of colorectal cancer and/or advanced adenomas |
| EP4098755A4 (en) * | 2020-01-28 | 2024-06-26 | Gencurix Inc. | COMPOSITION USING CPG METHYLATION CHANGES IN SPECIFIC GENES TO DIAGNOSE BLADDER CANCER, AND USE THEREOF |
| US12319969B2 (en) | 2015-03-27 | 2025-06-03 | Exact Sciences Corporation | Detecting esophageal disorders |
| US12467096B2 (en) | 2020-05-15 | 2025-11-11 | Universal Diagnostics, S.A. | Methods and systems for identifying methylation biomarkers |
| US12601011B2 (en) | 2015-08-31 | 2026-04-14 | Mayo Foundation For Medical Education And Research | Detecting gastric neoplasm |
| US12606872B2 (en) | 2022-11-16 | 2026-04-21 | Universal Diagnostics, S.A. | Methods for stratification and early detection of advanced adenoma and/or colorectal cancer using DNA methylation markers |
Families Citing this family (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110236916A1 (en) | 2010-03-26 | 2011-09-29 | Mayo Foundation For Medical Education And Research | Methods and materials for detecting colorectal neoplasm |
| US10184154B2 (en) | 2014-09-26 | 2019-01-22 | Mayo Foundation For Medical Education And Research | Detecting cholangiocarcinoma |
| CN105624273A (en) * | 2014-11-04 | 2016-06-01 | 香港中文大学深圳研究院 | Colorectal cancer detection primer, method and kit |
| WO2016112488A1 (en) * | 2015-01-13 | 2016-07-21 | BGI Shenzhen Co.,Limited | Biomarkers for colorectal cancer related diseases |
| US10030272B2 (en) | 2015-02-27 | 2018-07-24 | Mayo Foundation For Medical Education And Research | Detecting gastrointestinal neoplasms |
| CN105177155A (en) * | 2015-10-11 | 2015-12-23 | 苏州承美生物科技有限公司 | PCR detection primer system of human excrement methylated DNA |
| US11078543B2 (en) | 2016-04-14 | 2021-08-03 | Mayo Foundation For Medical Education And Research | Detecting pancreatic high-grade dysplasia |
| US10370726B2 (en) | 2016-04-14 | 2019-08-06 | Mayo Foundation For Medical Education And Research | Detecting colorectal neoplasia |
| CN105779635B (en) * | 2016-05-18 | 2019-10-22 | 黄文林 | A kit for prognostic judgment of colorectal cancer based on OLFM1 gene |
| CN106636444B (en) * | 2017-02-28 | 2020-03-31 | 青岛泱深生物医药有限公司 | Use of FAM78A gene |
| CN110431241B (en) | 2017-02-28 | 2024-04-19 | 梅约医学教育与研究基金会 | Detection of prostate cancer |
| WO2018160880A1 (en) * | 2017-03-01 | 2018-09-07 | Bioventures, Llc | Compositions and methods for detecting sessile serrated adenomas/polyps |
| JP7277460B2 (en) | 2017-11-30 | 2023-05-19 | マヨ ファウンデーション フォア メディカル エデュケーション アンド リサーチ | breast cancer detection |
| KR102478720B1 (en) * | 2019-11-08 | 2022-12-19 | 주식회사 아이엠비디엑스 | Biomarker panel of DNA methylation for blood-based diagnossis of colon cancer |
| PH12022552766A1 (en) * | 2020-04-29 | 2024-05-06 | Eg Biomed Co Ltd | Method for early detection, prediction of treatment response and prognosis of colorectal cancer |
| EP4172369A1 (en) * | 2020-06-29 | 2023-05-03 | Epify B.V. | Method for detecting colorectal cancer |
| CN113789388B (en) * | 2021-11-15 | 2022-03-25 | 苏州艾米森生物科技有限公司 | Esophageal cancer gene methylation level detection reagent and application thereof |
| CN114561465B (en) * | 2021-12-20 | 2024-01-26 | 上海锐翌生物科技有限公司 | A marker composition for detecting colorectal adenoma and its early diagnostic reagent |
| CN115820849A (en) * | 2022-08-25 | 2023-03-21 | 复旦大学附属中山医院 | Biomarkers, kits and systems for assessing the prognosis of stage II colorectal cancer |
| EP4594534A1 (en) * | 2022-09-30 | 2025-08-06 | The Regents of The University of Michigan | Compositions and methods for monitoring and selecting therapies |
| CN116103398A (en) * | 2022-12-13 | 2023-05-12 | 重庆伯豪诊断技术有限公司 | Primer probe combination and its kit for screening colorectal cancer methylation double sites |
| CN116004834A (en) * | 2023-01-19 | 2023-04-25 | 哈尔滨医科大学 | DNA methylation marker for predicting colon cancer immunotherapy effect and application thereof |
| CN116377072B (en) * | 2023-03-27 | 2025-07-22 | 中国人民解放军海军军医大学第一附属医院 | Application of CGI methylation phenotype genome in preparation of colorectal cancer typing or prognosis kit |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2528669A1 (en) * | 2003-06-09 | 2005-01-20 | The Regents Of The University Of Michigan | Compositions and methods for treating and diagnosing cancer |
| CA2606296C (en) * | 2005-04-15 | 2019-05-21 | Epigenomics Ag | Methods and nucleic acids for analyses of cellular proliferative disorders |
| EP2386654A1 (en) * | 2005-05-02 | 2011-11-16 | University of Southern California | DNA Methylation markers associated with the CpG island methylator phenotype (cimp) in human colorectal cancer |
| US20090125247A1 (en) * | 2007-08-16 | 2009-05-14 | Joffre Baker | Gene expression markers of recurrence risk in cancer patients after chemotherapy |
| WO2009044899A1 (en) * | 2007-10-03 | 2009-04-09 | Kyowa Hakko Kirin Co., Ltd. | Nucleic acid capable of regulating the proliferation of cell |
| WO2010074924A1 (en) * | 2008-12-23 | 2010-07-01 | University Of Utah Research Foundation | Identification and regulation of a novel dna demethylase system |
-
2012
- 2012-06-01 WO PCT/US2012/040547 patent/WO2012167145A2/en not_active Ceased
- 2012-06-01 US US13/486,988 patent/US20130065228A1/en not_active Abandoned
Cited By (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104046680A (en) * | 2013-03-11 | 2014-09-17 | 苏州承美生物科技有限公司 | Methyl DNA detection method |
| CN104046680B (en) * | 2013-03-11 | 2016-04-06 | 苏州承美生物科技有限公司 | Methylate DNA detection method |
| US12606873B2 (en) | 2013-03-14 | 2026-04-21 | Mayo Foundation For Medical Education And Research | Detecting neoplasm |
| EP3543360A3 (en) * | 2013-03-14 | 2020-01-08 | Mayo Foundation for Medical Education and Research | Detecting neoplasm |
| EP2816121A3 (en) * | 2013-05-29 | 2015-04-08 | Sysmex Corporation | Method for obtaining information on hepatocellular carcinoma and marker and kit for obtaining information on hepatocellular carcinoma |
| EP3126529A4 (en) * | 2014-03-31 | 2018-04-25 | Mayo Foundation for Medical Education and Research | Detecting colorectal neoplasm |
| EP2977467A3 (en) * | 2014-07-11 | 2016-05-11 | Sysmex Corporation | Method, use of marker, and determination device for obtaining information on plural types of cancers |
| JPWO2016060278A1 (en) * | 2014-10-17 | 2017-08-31 | 国立大学法人東北大学 | How to predict the sensitivity of drug therapy to colorectal cancer |
| US12319969B2 (en) | 2015-03-27 | 2025-06-03 | Exact Sciences Corporation | Detecting esophageal disorders |
| CN105400865B (en) * | 2015-07-06 | 2018-10-23 | 中国人民解放军总医院 | Detection of DNA methylation in the promoter region of TMEM176A gene |
| CN105400865A (en) * | 2015-07-06 | 2016-03-16 | 中国人民解放军总医院 | Detection of DNA methylation in the promoter region of TMEM176A gene |
| US12601011B2 (en) | 2015-08-31 | 2026-04-14 | Mayo Foundation For Medical Education And Research | Detecting gastric neoplasm |
| EP3521448A4 (en) * | 2016-09-29 | 2020-07-29 | Hanumat Co., Ltd. | METHOD FOR DETERMINING THE RISK OF SPORADIC COLON CANCER |
| EP3842543A1 (en) * | 2016-09-29 | 2021-06-30 | Hanumat Co., Ltd. | Method for determining onset risk of sporadic colon cancer |
| IT201700072650A1 (en) * | 2017-06-28 | 2018-12-28 | Univ Degli Studi Cagliari | METHOD FOR READING AND / OR FOR THE PROGNOSIS OF COLON RECTAL NEOPLASES |
| WO2019068082A1 (en) * | 2017-09-29 | 2019-04-04 | Arizona Board Of Regents On Behalf Of The University Of Arizona | DNA METHYLATION BIOMARKERS FOR THE DIAGNOSIS OF CANCER |
| US11851711B2 (en) | 2017-09-29 | 2023-12-26 | Arizona Board Of Regents On Behalf Of The University Of Arizona | DNA methylation biomarkers for cancer diagnosing |
| US11001898B2 (en) | 2019-05-31 | 2021-05-11 | Universal Diagnostics, S.L. | Detection of colorectal cancer |
| US11396679B2 (en) | 2019-05-31 | 2022-07-26 | Universal Diagnostics, S.L. | Detection of colorectal cancer |
| WO2020239896A1 (en) * | 2019-05-31 | 2020-12-03 | Universal Diagnostics, S.L. | Detection of colorectal cancer |
| EP3963111B1 (en) | 2019-05-31 | 2024-04-17 | Universal Diagnostics, S.A. | Detection of colorectal cancer |
| RU2791172C1 (en) * | 2019-10-16 | 2023-03-03 | Сямынь Сайндокх Биолоджикал Текнолоджи Ко., Лтд. | Primer kit, reagent and commercial kit for methylation of specific gene regions associated with human colorectal cancer and use of the commercial kit |
| WO2021072786A1 (en) * | 2019-10-16 | 2021-04-22 | 厦门信道生物技术有限公司 | Primer set for methylation of a specific region of a human colorectal cancer-related gene, test, test kit and application thereof |
| US11898199B2 (en) | 2019-11-11 | 2024-02-13 | Universal Diagnostics, S.A. | Detection of colorectal cancer and/or advanced adenomas |
| EP4098755A4 (en) * | 2020-01-28 | 2024-06-26 | Gencurix Inc. | COMPOSITION USING CPG METHYLATION CHANGES IN SPECIFIC GENES TO DIAGNOSE BLADDER CANCER, AND USE THEREOF |
| US12467096B2 (en) | 2020-05-15 | 2025-11-11 | Universal Diagnostics, S.A. | Methods and systems for identifying methylation biomarkers |
| US11530453B2 (en) | 2020-06-30 | 2022-12-20 | Universal Diagnostics, S.L. | Systems and methods for detection of multiple cancer types |
| CN113249477A (en) * | 2021-05-19 | 2021-08-13 | 北京艾克伦医疗科技有限公司 | Method and kit for early diagnosis of colorectal cancer |
| WO2023273257A1 (en) * | 2021-06-30 | 2023-01-05 | 武汉艾米森生命科技有限公司 | Diagnostic or auxiliary diagnostic reagent for colorectal cancer or precancerous lesions and use thereof, nucleic acid combination, and kit |
| CN114032313A (en) * | 2021-11-18 | 2022-02-11 | 广东海洋大学 | Method for evaluating, detecting and/or predicting beef quality traits of yak consumption |
| US12606872B2 (en) | 2022-11-16 | 2026-04-21 | Universal Diagnostics, S.A. | Methods for stratification and early detection of advanced adenoma and/or colorectal cancer using DNA methylation markers |
Also Published As
| Publication number | Publication date |
|---|---|
| US20130065228A1 (en) | 2013-03-14 |
| WO2012167145A3 (en) | 2013-02-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230212691A1 (en) | Detecting colorectal neoplasia | |
| AU2023229554B2 (en) | Detecting pancreatic high-grade dysplasia | |
| US12606873B2 (en) | Detecting neoplasm | |
| Hinoue et al. | Genome-scale analysis of aberrant DNA methylation in colorectal cancer | |
| USRE50806E1 (en) | Detecting breast cancer | |
| US20230028856A1 (en) | Detecting gastrointestinal neoplasms | |
| US20130065228A1 (en) | Genome-scale analysis of aberrant dna methylation in colorectal cancer | |
| AU2018229294B2 (en) | Detecting prostate cancer | |
| CA3154354A1 (en) | Detecting ovarian cancer | |
| CN104411835B (en) | Diagnostic gene marker panel for colorectal cancer | |
| US20130225420A1 (en) | Molecular subtyping of oral squamous cell carcinoma to distinguish a subtype that is unlikely to metastasize | |
| WO2020109818A1 (en) | Differential methylation | |
| WO2008066878A9 (en) | Methods and products for diagnosing cancer | |
| WO2013064163A1 (en) | Methylation markers for colorectal cancer | |
| US20130143210A1 (en) | Method for the prognosis of ovarian carcinoma | |
| US20100143899A1 (en) | Methods and products for diagnosing cancer | |
| Loi | DNA METHYLATION ALTERATIONS AS FUNCTIONALLY RELEVANT MECHANISMS, PROMISING TUMOUR BIOMARKERS AND THERAPEUTIC TARGETS | |
| Sriram et al. | Array-Comparative Genomic Hybridization Reveals Loss of SOCS6 Is |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12792151 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12792151 Country of ref document: EP Kind code of ref document: A2 |













































