CN104046680A - Methyl DNA detection method - Google Patents
Methyl DNA detection method Download PDFInfo
- Publication number
- CN104046680A CN104046680A CN201310077102.9A CN201310077102A CN104046680A CN 104046680 A CN104046680 A CN 104046680A CN 201310077102 A CN201310077102 A CN 201310077102A CN 104046680 A CN104046680 A CN 104046680A
- Authority
- CN
- China
- Prior art keywords
- dna
- sequence
- methylate
- detection method
- methylate dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6804—Nucleic acid analysis using immunogens
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Pathology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a methyl DNA detection method, and the method includes the following steps: sample processing, probe synthesis, hybridization reaction, addition of a monoclonal antibody, addition of a coupling monoclonal antibody, addition of a detection reagent, determination, and judgment. The methyl DNA detection method has the advantages of high detection specificity, low tendency to be disturbed, low false positive rate and the like, and has important significances in tumor early detection, tumor individualized treatment, tumor condition judgment, recurrence monitoring and other detection aspects and development of the detection reagent.
Description
Technical field
The present invention relates to field of biological detection, be specifically related to a kind of detection method of methylate DNA.
Background technology
DNA methylation refers on the 5' carbon of cytosine(Cyt) (C) residue in CpG site on DNA chain has been modified a methyl.DNA methylation is one of found DNA modification the earliest, is the important component part of epigenetics.DNA methylation occurs on the cytosine(Cyt) residue of the CG dinucleotides on DNA chain characteristically, and this is common in gene 5 ' end expression regulation sequence.DNA methylation has vital role in the regulation and control of genetic expression, has participated in the processes such as Embryonic Development in Animal, Genomic Imprinting and x chromosome inactivation.Research shows, the change of DNA methylation can cause the change of chromatin Structure, DNA conformation, DNA stability and protein interaction mode, thereby controlling gene is expressed.
The change of DNA methylation state is an important factor that causes tumour.The abnormal rising of the local methylation level in CpG island, can cause not expressing of genomic unstable and cancer suppressor gene.If activated allelic inactivation in cancer suppressor gene, the probability that cancer occurs will improve, so the application of DNA methylation in tumour early detection is very noticeable.Research shows, generation and the development of tumour followed in the variation of epigenetic, thereby detects DNA methylation and change the early discovery that can contribute to tumour.The at present methylated research of tumour mainly concentrates on cancer suppressor gene, and this is may methylate the generation of tumour with CpG island, cancer suppressor gene promoter region to cause cancer suppressor gene to close relevant because it is found that.Because the local height on CpG island methylates early than the neoplasm of cell, therefore the detection of DNA methylation can be for tumorigenic early prediction.
The methylated detection method in CpG island is numerous, and its principle is the digestion with restriction enzyme method based on methylating responsive and the PCR detection method based on S-WAT modifying DNA respectively.The susceptibility that methylates restriction enzyme/Southern method (methylation-sensitive restriction Endonuclease/Southern, MSRE-Southern) is more traditional method, and sensitivity is low, and sample requirement is large.Methylate DNA specific PCR method (Methylation Specific PCR, MSP) and derivative methylate DNA detection method thereof are the common methods that detects at present DNA methylation, its sensitivity is higher, but be easily disturbed, poor specificity, thus cause the false positive rate of detection also very high.
Summary of the invention
The invention provides a kind of methylate DNA detection method, can effectively get rid of the impact of non-methylate DNA, solved well in prior art the shortcomings such as detection specificity is low, easily disturbed, false positive is high.
For achieving the above object, technical scheme of the present invention is, a kind of methylate DNA detection method, and described methylate DNA detection method comprises the steps:
Step 1, adopts sulfiting testing sample DNA, and the non-methylate DNA of known standard and known standard methylation DNA;
Step 2, determines the surveyed area of testing gene, and select target detects sequence, designs and synthesizes detection probes sequence according to gene order;
Step 3, the standard methylation DNA crossing with sulfiting and the non-methylate DNA of standard, as the positive criteria contrast and the negative standard control that detect, are made gradient dilution in proportion; Carry out respectively hybridization with standard methylation DNA sample and the non-methylate DNA sample of standard of described detection probes and gradient dilution; Carry out hybridization by described detection probes with the testing sample DNA crossing with sulfiting simultaneously;
Step 4, adds the reactant of step 3 gained with on the coated reaction carriers of avidin, catches the probe being labeled that has passed through hybridization, and washing;
Step 5, adds anti-methylated cytosine monoclonal antibody to react, and washing;
Step 6, adds HRP coupling monoclonal antibody to react, and washing;
Step 7, adds HRP detection reagent to react, and measures, and calculate concentration and the amount of methylate DNA after termination reaction;
Step 8, judges whether to exist methylate DNA.
Preferably, in described step 1, sulphite used is S-WAT, and concentration is 5M, pH5.0.
Preferably, the temperature of reaction of described step 1 is 60 degree, and the reaction times is 4 hours.
Preferably, in described step 2, determine surveyed area and the target detect sequence of testing gene and design synthesising probing needle, refer to and in testing gene, select one section of sequence A, make this sequence A contain CpG as much as possible site, sequence length is 18-120 base, methylation state using sequence A after sulfiting carries out detection probes design as target detect sequence, using the complementary sequence of sequence A as detection probes sequence 1; In testing gene group DNA on another chain of sequence A downstream area, select one section of sequence B, make sequence B be rich in CpG site and not overlap with sequence A, sequence length is 18-120 base, methylation state using sequence B after sulfiting carries out detection probes design as target detect sequence, using the complementary sequence of sequence B as detection probes sequence 2, synthetic detection probes, and carry out mark at 5 ' end of synthetic probe.
Preferably, described synthetic probe is carried out to mark, refer to and carry out mark with vitamin H or the material with detectability matter.
Preferably, the standard methylation DNA in described step 3 and the non-methylate DNA of standard, be pure mankind's methylate DNA and the non-methylate DNA through determining; Described hybridization is to carry out under the salt concn of 2xSSC, pH value are the temperature of reaction condition of 8.0,60 DEG C.
Preferably, the reaction carriers of described step 4 is enzyme plate or glass microspheres coated with avidin.
Preferably, the monoclonal antibody adding in described step 5 is the anti-methylated cytosine monoclonal antibody of mouse, and the reaction of described step 5 is to carry out under as encapsulant, the temperature of reaction condition of 25 DEG C at the salt concn of 1xPBST, pH8.0,0.5% skim-milk.
Preferably, the coupling antibody adding in described step 6 is the goat-anti mouse monoclonal antibody of HRP coupling, and the reaction of described step 6 is to carry out under as encapsulant, the temperature of reaction condition of 25 DEG C at the salt concn of 1xPBST, pH8.0,0.5% skim-milk.
Preferably, the HRP detection reagent in described step 7 is HRP substrate: TMB, TMB.
Preferably, described testing sample is the sample of the mankind normal and cancer cells DNA, tumor tissues genomic dna, hemocyte DNA, serum DNA, body fluid DNA or movement DNA.
Preferably, described cancer cells is lung carcinoma cell, stomach cancer cell, colon cell, rectum cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell; Described tumor tissues is cancerous lung tissue, stomach organization, colon, rectal tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or Pancreatic Adenocarcinoma; Described body fluid comprises blood, celiolymph, gastric juice and Digestive system, seminal fluid, saliva, tear, sweat, urine, vaginal secretion.
Preferably, judging whether to exist methylate DNA in described step 8, is the corresponding characteristic curve of methylate DNA that detects with standard substance of contrast, judges in testing sample, whether there is methylate DNA.
In the DNA to be measured processing with bisulfite, because non-methylated cytosine(Cyt) (C) is converted into uridylic (U), methylated cytosine(Cyt) (C) remains unchanged, thereby GC content overall on DNA chain is reduced, be conducive to the specific hybrid of detection probes and target dna.Undertaken after hybrid capture by specific detection probes, effectively eliminate the impact of DNA methylation of overall importance (Global DNA methylation), make only to have the methylate DNA in target detect region to be preserved, thereby the methylate DNA of the denier existing in sample can be detected.
Than prior art, the present invention can effectively get rid of the impact of non-methylate DNA, make the methylate DNA in sample be able to enrichment, therefore the present invention have detection specificity high, be not easy the advantages such as disturbed, false positive rate is low, also have that the scope of application is large simultaneously, method is simple, need sample size little, be suitable for the benefits such as mixing sample, have great significance at aspects such as tumour early detection, personalized treatment, state of an illness judgement and recurrence monitoring.
Brief description of the drawings
Fig. 1 is methylate DNA detection method schema of the present invention.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.In addition should be understood that, after having read content of the present invention, those skilled in the art can make various changes or modifications the present invention, these equivalent form of values fall within equally the application the scope that limits of attached claims.
Embodiment 1,
Step 1, with the non-methylate DNA of known standard and methylate DNA as detecting sample; Adopt the sodium sulfite solution that concentration is 5M to process testing sample DNA, temperature of reaction is 60 degree, and the treatment time is 4 hours;
Step 2, determines the surveyed area of testing gene, designs and synthesizes the sequence of the methylate DNA sequence complementary pairing that can cross with sulfiting as the probe sequence detecting according to gene order; On two corresponding chains of genome sequence, a probe sequence of each design, makes this section of long 18-120 base of sequence, and the sequence of two probes is not overlapped; 5 ' the end to designed and synthetic probe carries out biotin labeling;
Step 3, the standard methylation DNA crossing with sulfiting and the non-methylate DNA of gradient dilution step 1 gained by 1/2 carry out hybridization with the standard DNA sample of gradient dilution by the detection probes of step 2 gained under the salt concn of 2xSSC, temperature of reaction condition that pH value is 8.0,60 DEG C;
Step 4, adds respectively the enzyme plate coated with avidin by the reactant of step 3, catches the biotin labeled probe through carrying out hybridization, and washing;
Step 5, adds the anti-methylated cytosine of mouse (Anti-5-Methylcytosine) monoclonal antibody, reacts under as encapsulant, the temperature of reaction condition of 25 DEG C at the salt concn of 1xPBST, pH8.0,0.5% skim-milk, and washing;
Step 6, add the goat-anti mouse monoclonal antibody (Goat Anti-Mouse IgG (H+L)-HRP pAb) of HRP coupling, react under as encapsulant, the temperature of reaction condition of 25 DEG C at the salt concn of 1xPBST, pH8.0,0.5% skim-milk, and washing;
Step 7, adds HRP detection reagent (HRP substrate: TMB, TMB) to react, then termination reaction measuring by microplate reader, and calculate concentration and the amount of methylate DNA;
Step 8, judges whether to exist methylate DNA, determination methods for: by the data that calculate in step 7, the corresponding characteristic curve of methylate DNA that detects with standard substance of contrast, judges in testing sample, whether there is methylate DNA.
Embodiment 2,
Get normal people and turned out to be 5 grams, colon cancer patient ight soil, add 5 times of volume 1xTE and fully mix, with the extracting of equal-volume chloroform once, obtain total DNA with the isopropanol precipitating of 0.6 times.Taking this DNA as testing sample, under the condition identical with embodiment 1, check practicality of the present invention.
The wherein condition identical with embodiment 1, referring to divided by the DNA of actual clinical sample extraction is outside testing sample, all operations is identical with embodiment 1.
DNA sample to be measured in embodiment bis-, for the mankind are normal and the sample of cancer cells DNA, tumor tissues genomic dna, hemocyte DNA, serum DNA, various body fluid DNA or various movement DNA.
Described cancer cells is lung carcinoma cell, stomach cancer cell, colon cell, rectum cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell; Described tumor tissues is cancerous lung tissue, stomach organization, colon, rectal tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or Pancreatic Adenocarcinoma; Described various body fluid comprises blood, celiolymph, gastric juice and various Digestive system, seminal fluid, saliva, tear, sweat, urine, vaginal secretion etc.
Step 1, is to detect sample with above-mentioned DNA sample to be measured, and the non-methylate DNA of known standard and methylate DNA are as negative control and positive control; To adopt concentration be 5M sodium sulfite solution processes respectively testing sample DNA and negative control, positive control, temperature of reaction is 60 degree, the treatment time is 4 hours;
Step 2, determine surveyed area and the target detect sequence of testing gene and design synthesising probing needle: in testing gene, selecting one section of sequence A, make this sequence A contain CpG as much as possible site, sequence length is 18-120 base, methylation state using sequence A after sulfiting carries out detection probes design as target detect sequence, using the complementary sequence of sequence A as detection probes sequence 1; In testing gene group DNA on another chain of sequence A downstream area, select one section of sequence B, make sequence B be rich in CpG site and not overlap with sequence A, sequence length is 18-120 base, methylation state using sequence B after sulfiting carries out detection probes design as target detect sequence, using the complementary sequence of sequence B as detection probes sequence 2, synthetic detection probes, and carry out mark at 5 ' end of synthetic probe;
Step 3, the standard methylation DNA crossing with sulfiting and the non-methylate DNA of gradient dilution step 1 gained by 1/2 carry out respectively hybridization with the standard DNA sample of the testing sample DNA crossing with sulfiting, gradient dilution by the detection probes of step 2 gained under the salt concn of 2xSSC, temperature of reaction condition that pH value is 8.0,60 DEG C;
Step 4, adds respectively the enzyme plate coated with avidin by the reactant of step 3, catches the biotin labeled probe through carrying out hybridization, and washing;
Step 5, adds the anti-methylated cytosine of mouse (Anti-5-Methylcytosine) monoclonal antibody, reacts under as encapsulant, the temperature of reaction condition of 25 DEG C at the salt concn of 1xPBST, pH8.0,0.5% skim-milk, and washing;
Step 6, add the goat-anti mouse monoclonal antibody (Goat Anti-Mouse IgG (H+L)-HRP pAb) of HRP coupling, react under as encapsulant, the temperature of reaction condition of 25 DEG C at the salt concn of 1xPBST, pH8.0,0.5% skim-milk, and washing;
Step 7, adds HRP detection reagent (HRP substrate: TMB, TMB) to react, then termination reaction measuring by microplate reader, and calculate concentration and the amount of methylate DNA;
Step 8, judges whether to exist methylate DNA, determination methods for: by the data of the testing sample DNA calculating in step 7, the corresponding characteristic curve of methylate DNA that detects with standard substance of contrast, judges in testing sample, whether there is methylate DNA.
Embodiment 3,
The design of detection probes
Methylating of P16 genetic transcription promoter region is the feature that the kinds cancer cells such as lung cancer have.The sequence of P16 genetic transcription promoter region is as follows, and the part that has underscore is selected surveyed area.
Homo?sapiens?p16?protein?(CDKN2A)?gene,?CpG?island?and?partial?cds，DQ325544.1
Genomic dna normal chain (sense strand):
5’-CGGACCGCGTGCGCTCGGCGGCTGCGGAGAGGGGGAGAGCAGGCAGCGGGCGGCGGGGAGCAGCATGGAGCGGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGCTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGGCGCTGCCCAACGCACCGAATAGTTACGGTCGGAGGCCG-3’
The secondary chain of genomic dna (anti-sense strand):
3’-GCCTGGCGCACGCGAGCCGCCGACGCCTCTCCCCCTCTCGTCCGTCGCCCGCCGCCCCTCGTCGTACCTCGCCCGCCGCCCCTCGTCGTACCTCGGAAGCCGACTGACCGACCGGTGCCGGCGCCGGGCCCGAGCCCATCTCCTCCACGCCCGCGACGACCTCCGCCCCCGCGACGGGTTGCGTGGCTTATCAATGCCAGCCTCCGGC-5’
Positive chain DNA is the sequence after sulfiting (underscore part is designed probe location):
5’-
CGGATCGCGTGCGTTCGGCGGTTGCGGAGAGGGGGAGAGTAGGTAGCGGGCGGCGGGGAGTAGTATGGAGCGGGCGGCGGGGAGTAGTATGGAGTTTTCGGTTGATTGGTTGGTTACGGTCGCGGTTCGGGTTCGGGTAGAGGAGGTGCGGGCGTTGTTGGAGGCGGGGGCGTTGTTTAACGTATCGAATAGTTACGGTCGGAGGTCG-3’
Secondary chain DNA is the sequence after sulfiting (underscore part is designed probe location):
3’-GCTTGGCGCATGCGAGCTGCTGATGCTTTTTTTTTTTTTGTTTGTTGCTTGCTGCTTTTTGTTGTATTTTGCTTGCTGCTTTTTGTTGTATTTTGGAAGCTGATTGATTGATTGGTGCTGGCGCTGGGCTTGAGCTTATTTTTTTTAT
GCTTGCGATGATTTTTGCTTTTGCGATGGGTTGCGTGGCTTATTAATGCTAGCTTTTGGC-5’
The upstream probe of design:
5’-biotin-CCCGCCGCCCGCTACCTACTCTCCCCCTCTCCGCAACCGCCGAACGCACGCGATCCG-3’
The downstream probe of design:
5’-biotin-CGAACGCTACTAAAAACGAAAACGCTACCCAACGCACCGAATAATTACGATCGAAAACCG-3’
Foregoing is exemplifying of specific embodiments of the invention, for the wherein not reagent of detailed description, equipment, working method etc., should be understood to take the existing common and conventional reagent in this area, equipment, working method etc. to be implemented.
Be more than the description to the embodiment of the present invention, by the above-mentioned explanation to the disclosed embodiments, make professional and technical personnel in the field can realize or use the present invention.To be apparent for those skilled in the art to the multiple amendment of these embodiment, General Principle as defined herein can, in the situation that not departing from the spirit or scope of the present invention, realize in other embodiments.Therefore, the present invention will can not be restricted to these embodiment shown in this article, but will meet the widest scope consistent with principle disclosed herein and features of novelty.
Claims (10)
1. a methylate DNA detection method, is characterized in that, described methylate DNA detection method comprises the steps:
Step 1, adopts sulfiting testing sample DNA, and the non-methylate DNA of known standard and known standard methylation DNA;
Step 2, determines the surveyed area of testing gene, and select target detects sequence, designs and synthesizes detection probes sequence according to gene order;
Step 3, the standard methylation DNA crossing with sulfiting and the non-methylate DNA of standard, as the positive criteria contrast and the negative standard control that detect, are made gradient dilution in proportion; Carry out respectively hybridization with standard methylation DNA sample and the non-methylate DNA sample of standard of described detection probes and gradient dilution; Carry out hybridization by described detection probes with the testing sample DNA crossing with sulfiting simultaneously;
Step 4, joins the reactant of step 3 gained respectively in reaction carriers, catches the probe being labeled that has passed through hybridization, and washing;
Step 5, adds anti-methylated cytosine monoclonal antibody to react, and washing;
Step 6, adds HRP coupling monoclonal antibody to react, and washing;
Step 7, adds HRP detection reagent to react, and measures, and calculate concentration and the amount of methylate DNA after termination reaction;
Step 8, judges whether to exist methylate DNA.
2. methylate DNA detection method according to claim 1, is characterized in that, in described step 1, sulphite used is S-WAT, and concentration is 5M, pH5.0, and the temperature of reaction of described step 1 is 60 degree, the reaction times is 4 hours.
3. methylate DNA detection method according to claim 1, it is characterized in that, in described step 2, determine surveyed area and the target detect sequence of testing gene and design synthesising probing needle, refer to and in testing gene, select one section of sequence A, make this sequence A contain CpG as much as possible site, sequence length is 18-120 base, and the methylation state using sequence A after sulfiting carries out detection probes design as target detect sequence, using the complementary sequence of sequence A as detection probes sequence 1; In testing gene group DNA on another chain of sequence A downstream area, select one section of sequence B, make sequence B be rich in CpG site and not overlap with sequence A, sequence length is 18-120 base, methylation state using sequence B after sulfiting carries out detection probes design as target detect sequence, using the complementary sequence of sequence B as detection probes sequence 2, synthetic detection probes, and carry out mark at 5 ' end of synthetic probe.
4. methylate DNA detection method according to claim 3, is characterized in that, described synthetic probe is carried out to mark, refers to and carries out mark with vitamin H or the material with detectability matter.
5. methylate DNA detection method according to claim 1, is characterized in that, the standard methylation DNA in described step 3 and the non-methylate DNA of standard are pure mankind's methylate DNA and the non-methylate DNAs through determining; Described hybridization is to carry out under the salt concn of 2xSSC, pH value are the temperature of reaction condition of 8.0,60 DEG C.
6. methylate DNA detection method according to claim 1, it is characterized in that, the monoclonal antibody adding in described step 5 is the anti-methylated cytosine monoclonal antibody of mouse, and the reaction of described step 5 is to carry out under as encapsulant, the temperature of reaction condition of 25 DEG C at the salt concn of 1xPBST, pH8.0,0.5% skim-milk.
7. methylate DNA detection method according to claim 1, it is characterized in that, the coupling antibody adding in described step 6 is the goat-anti mouse monoclonal antibody of HRP coupling, and the reaction of described step 6 is to carry out under as encapsulant, the temperature of reaction condition of 25 DEG C at the salt concn of 1xPBST, pH8.0,0.5% skim-milk.
8. methylate DNA detection method according to claim 1, is characterized in that, the HRP detection reagent in described step 7 is HRP substrate: TMB, TMB.
9. methylate DNA detection method according to claim 1, is characterized in that, described testing sample is the sample of the mankind normal and cancer cells DNA, tumor tissues genomic dna, hemocyte DNA, serum DNA, body fluid DNA or movement DNA.
10. methylate DNA detection method according to claim 9, it is characterized in that, described cancer cells is lung carcinoma cell, stomach cancer cell, colon cell, rectum cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell; Described tumor tissues is cancerous lung tissue, stomach organization, colon, rectal tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or Pancreatic Adenocarcinoma; Described body fluid comprises blood, celiolymph, gastric juice and Digestive system, seminal fluid, saliva, tear, sweat, urine, vaginal secretion.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310077102.9A CN104046680B (en) | 2013-03-11 | 2013-03-11 | Methylate DNA detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310077102.9A CN104046680B (en) | 2013-03-11 | 2013-03-11 | Methylate DNA detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104046680A true CN104046680A (en) | 2014-09-17 |
| CN104046680B CN104046680B (en) | 2016-04-06 |
Family
ID=51500076
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310077102.9A Active CN104046680B (en) | 2013-03-11 | 2013-03-11 | Methylate DNA detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104046680B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2319943A1 (en) * | 2009-11-05 | 2011-05-11 | Epigenomics AG | Methods of predicting therapeutic efficacy of cancer therapy |
| CN102399865A (en) * | 2010-09-16 | 2012-04-04 | 上海迦美生物科技有限公司 | Endonuclease digestion based quantitative detection method for methylated DNA |
| EP2479283A1 (en) * | 2006-04-17 | 2012-07-25 | Epigenomics AG | Methods and nucleic acids for the detection of colorectal cell proliferative disorders |
| WO2012167145A2 (en) * | 2011-06-01 | 2012-12-06 | University Of Southern California | Genome-scale analysis of aberrant dna methylation in colorectal cancer |
| CN102888461A (en) * | 2012-10-15 | 2013-01-23 | 辽宁大学 | PCR (polymerase chain reaction) method for quickly and efficiently detecting DNA (deoxyribonucleic acid) methylation modification after sulfite treatment |
-
2013
- 2013-03-11 CN CN201310077102.9A patent/CN104046680B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2479283A1 (en) * | 2006-04-17 | 2012-07-25 | Epigenomics AG | Methods and nucleic acids for the detection of colorectal cell proliferative disorders |
| EP2319943A1 (en) * | 2009-11-05 | 2011-05-11 | Epigenomics AG | Methods of predicting therapeutic efficacy of cancer therapy |
| CN102399865A (en) * | 2010-09-16 | 2012-04-04 | 上海迦美生物科技有限公司 | Endonuclease digestion based quantitative detection method for methylated DNA |
| WO2012167145A2 (en) * | 2011-06-01 | 2012-12-06 | University Of Southern California | Genome-scale analysis of aberrant dna methylation in colorectal cancer |
| CN102888461A (en) * | 2012-10-15 | 2013-01-23 | 辽宁大学 | PCR (polymerase chain reaction) method for quickly and efficiently detecting DNA (deoxyribonucleic acid) methylation modification after sulfite treatment |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104046680B (en) | 2016-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Tumor heterogeneity and circulating tumor cells | |
| Lin et al. | Emerging utility of urinary cell-free nucleic acid biomarkers for prostate, bladder, and renal cancers | |
| CN102399862B (en) | A kind of methylate DNA detection method based on melting curve | |
| Tanić et al. | Epigenome-wide association studies for cancer biomarker discovery in circulating cell-free DNA: technical advances and challenges | |
| EP3828273A1 (en) | Methylation modification-based tumor marker stamp-ep2 | |
| CN104164474A (en) | Fluorescent quantitative PCR method for detecting expression quantities of PCA3 gene and PSA gene in urine and diagnosis kit thereof | |
| Campuzano et al. | Electrochemical biosensing to move forward in cancer epigenetics and metastasis: A review | |
| Ji et al. | A miRNA combination as promising biomarker for hepatocellular carcinoma diagnosis: a study based on bioinformatics analysis | |
| Bai et al. | Single-cell sequencing technology in tumor research | |
| CN108103198A (en) | A kind of and the relevant blood plasma miRNA marker of cancer of pancreas auxiliary diagnosis and its application | |
| Rose et al. | Circulating and urinary tumour DNA in urothelial carcinoma—Upper tract, lower tract and metastatic disease | |
| CN102399861A (en) | Methylated DNA (Deoxyribonucleic Acid) detection method based on endonuclease digestion | |
| CN102399860A (en) | Methylated DNA (Deoxyribonucleic Acid) detection method based on DNA polymerase chain reaction | |
| CN109609634A (en) | One kind circulation miRNA marker relevant to carcinoma of endometrium auxiliary diagnosis and its application | |
| Wang et al. | Methylation-powered engineering of a dual-color light-up RNA nanosensor for label-free and ultrasensitive sensing of multiple DNA methyltransferases | |
| CN109652541A (en) | Tumor marker STAMP-EP6 based on methylation modification | |
| CN102399859A (en) | Methylated DNA detection method based on fluorescence resonance energy transfer | |
| CN108103199A (en) | A kind of Xun Huan miRNA marker relevant with oophoroma auxiliary diagnosis and its application | |
| CN102796811A (en) | Reagent and method for detecting KRAS mutation | |
| CN102159728A (en) | Breast cancer metastasis determination method and blood serum evaluation method | |
| CN104046680B (en) | Methylate DNA detection method | |
| CN106119361A (en) | The test kit detected for the NDRG4 gene methylation of early gastric caacer diagnosis and prognosis evaluation and application thereof | |
| CN102399865A (en) | Endonuclease digestion based quantitative detection method for methylated DNA | |
| CN106636306A (en) | Method for detecting methylation of relevant gene promoters in colorectal cancer | |
| CN105385760A (en) | Kit capable of being used for detecting SHISA3 gene promotor region methylation level related to laryngocarcinoma and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200806 Address after: 225300 west side of the second floor of G59, building 0004, east side of Lujia Road, west side of taikou Road, China Pharmaceutical City, Taizhou City, Jiangsu Province Patentee after: Jiangsu Yuanhen Biotechnology Co.,Ltd. Address before: 215200 science and Technology Pioneer Park, Wujiang economic and Technological Development Zone, Suzhou, Jiangsu Patentee before: SUZHOU CHENGMEI BIOTECHNOLOGY Co.,Ltd. |
|
| TR01 | Transfer of patent right |