CN102399860A - Methylated DNA (Deoxyribonucleic Acid) detection method based on DNA polymerase chain reaction - Google Patents

Abstract

The invention relates to a methylated DNA (Deoxyribonucleic Acid) detection method which comprises the following steps of: (1) treating DNA to be detected by using sulfite; (2) selecting a segment of consecutive sequence in a target region to be detected to synthesize a PCR (Polymerase Chain Reaction) primer; (3) carrying out a PCR reaction by using specific DNA polymerase sensitive to uracil to detect an amplification reaction signal; and (4) analyzing the reaction result of a PCR amplification instrument and judging whether methylated DNA exists in the sample. The invention has the advantages of large application scope, simple method and the like, the methylated DNA detection method requires small sample size, is not easy to be interfered and is applicable to mixed samples. The methylated DNA detection method has important significance in the fields of early detection, individualized treatment, condition judgment, relapse monitoring and the like for tumors.

Description

Methylate DNA detection method based on the archaeal dna polymerase chain reaction

Technical field

The present invention relates to a kind of methylate DNA detection method, relate in particular to a kind of scope of application and greatly, be not subject to interferential methylate DNA detection method.

Background technology

Dna methylation be meant CpG site on the DNA chain cytosine(Cyt) (C) residue 5 'Modified a methyl on the carbon.Dna methylation is one of dna modification of finding the earliest, is the important component part of epigenetics.Occur on the cytosine(Cyt) residue of the CpG dinucletide on the DNA chain to the dna methylation characteristic, this is common in gene 5 'The end expression regulation sequence.Dna methylation has vital role in the regulation and control of genetic expression, participated in processes such as animal embryo growth, the gene marking and x chromosome inactivation.Research shows that the change of dna methylation can cause the change of chromatin Structure, DNA conformation, dna stability and protein interaction mode, thereby controlling gene is expressed.

The change of dna methylation state is an important factor that causes tumour.The unusual rising of the local methylation level in CpG island can cause not expressing of genomic instability and cancer suppressor gene.If activated allelic inactivation in the cancer suppressor gene, the probability that cancer then takes place will improve.So the noticeable place of dna methylation is exactly the application in the early detection of tumour, because showing the variation of epigenetic, research follows the generation and the development of tumour, detect dna methylation and change the early discovery that can help tumour.

The methylated research of tumour at present mainly concentrates on cancer suppressor gene.This is the generation of tumour possibly methylate with the CpG island of cancer suppressor gene promoter region to cause cancer suppressor gene to close relevant because it is found that.Because the local height on CpG island methylates early than the neoplasm of cell, so the detection of dna methylation can be used for tumorigenic early prediction.

The methylated detection method in CpG island is numerous, and its principle is respectively based on methylating responsive digestion with restriction enzyme method and based on the PCR detection method of S-WAT modifying DNA.The susceptibility that methylates restriction enzyme/Southern method (methylation-sensitive restriction Endonuclease/Southern, MSRE-Southern) is more traditional method, and sensitivity is low, and the sample requirement is big.(Methylation Specific PCR MSP) and deutero-methylate DNA detection method, is the domestic method that detects dna methylation at present to methylate DNA specific PCR method, has the highly sensitive while, and false positive rate is also very high.

Summary of the invention

The present invention provides a kind of methylate DNA detection method.Can get rid of the influence of non-methylate DNA effectively, make the methylate DNA in the sample be able to enrichment, the prior art detection sensitivity is low, method is complicated in order to solve, easily by shortcomings such as interference.

Methylation detecting method of the present invention, step is following:

Step 1 is with sulfiting DNA to be measured, standard methylation DNA and the non-methylate DNA of standard;

Step 2 in the target area that will detect, is selected one section successive sequence, and includes at least one in the selected successive sequence and be in this section sequence middle part or near 3 'The CpG site, position of end, but the C except that the CpG site does not appear; With selected sequence or selected sequence 5 'The part of end is as forward primer, with selected sequence 3 'The complementary sequence of one section sequence in end downstream is as reverse primer;

Step 3; With step 2 synthetic PCR primer, the template so that the DNA sample of crossing with sulfiting to be measured reacts as PCR adds the specific archaeal dna polymerase that uridylic is had susceptibility; Carry out pcr amplification with real-time quantitative PCR amplification appearance, detect amplified signal simultaneously; And with the non-methylate DNA of standard and standard methylation DNA as contrast;

Step 4 is analyzed the reaction result of pcr amplification appearance, and contrasts with the standard DNA sample result; In DNA sample to be measured, can detect the signal of pcr amplification product, then show to have methylate DNA in the sample; Otherwise,, then show not have methylate DNA in the sample if in DNA sample to be measured, can not detect the signal of pcr amplification product.

In the said step 1; Said sulphite is S-WAT; Use said S-WAT processing DNA sample method to be: with 0.3M NaOH sex change DNA to be measured, the pH value that adding is made up of 5M S-WAT, 0.5mM quinhydrones is 5.0 mixed solution, and 60 ℃ of lucifuge temperature were bathed 4 hours; Desulfurization and purify DNA.

In the said step 2, selected successive sequence should be greater than 8 bases.In this section successive sequence, should include at least one CpG site and CpG site at the middle part of this section sequence or near 3 'The position of end, but the C except that the CpG site does not appear.And to make said designed primer sequence length be 18 ~ 32 base length.

Wherein, the CpG phosphoric acid ester bond (p) that refers to cytosine(Cyt) (C), guanine (G) and be connected the two is formed the site.

In the said step 3, the used specific archaeal dna polymerase that uridylic is had susceptibility of pcr amplification reaction can be one or more in the archaeal dna polymerase in heat-resisting ancient pyrenomycetes source.Preferably, said methylate DNA sequence specific DNA polysaccharase can be the fpu archaeal dna polymerase.

According to above-mentioned methylate DNA detection method; Wherein, Said DNA to be measured is the human genome DNA, non-methylate DNA of said standard and standard methylation DNA for be complementary in DNA to be measured, the fixed pure non-human genome DNA of methylating and the fixed pure human genome DNA that methylates.As:

Said cancer cells is lung carcinoma cell, stomach cancer cell, colon cancer cell, rectum cancer cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell;

Said tumor tissues is cancerous lung tissue, stomach organization, colon cancer tissue, rectum cancer tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or carcinoma of the pancreas tissue;

Said body fluid is blood, csf, gastric juice, Digestive system, seminal fluid, saliva, tear, sweat, urine or vaginal secretion.

Sulfiting DNA make the non-cytosine(Cyt) that methylates (C) deaminizating on the DNA chain change uridylic (U) into, and the cytosine(Cyt) that methylates remains unchanged.The uridylic (U) of the archaeal dna polymerase in heat-resisting ancient pyrenomycetes such as pfu archaeal dna polymerase source on can not recognition template DNA chain, thereby when carrying out pcr amplification, have only methylate DNA to increase with the Pfu archaeal dna polymerase.When in sample, having methylate DNA,, and the curve of pcr amplification is arranged because of pcr amplification can normally carry out.When in sample, not having methylate DNA,, and there is not the curve of pcr amplification because of pcr amplification can carry out.

In sum, a kind of methylate DNA detection method of the present invention has that the scope of application is big, method is simple, need sample size little, be difficult for being disturbed, being suitable for advantages such as mixing sample.Have great significance at aspects such as tumour early detection, personalized treatment, state of an illness judgement and recurrence monitoring.

Description of drawings

Fig. 1 is a methylate DNA detection method schema of the present invention.

Embodiment

With reference to Fig. 1, introduce as follows methylate DNA detection method of the present invention is concrete:

Embodiment (one):

Step 1: adopt sulfiting and non-methylate DNA of the known standard of purifying and methylate DNA.The non-methylate DNA of standard with a certain amount of S-WAT was handled mixes with the standard methylation DNA that the S-WAT of gradient dilution was handled, as testing sample.

Wherein, said sulphite is specially S-WAT; The DNA to be measured of sulfiting can be specially the human genome gene.The treatment step of said sulfiting DNA to be measured does, with 0.3M NaOH sex change DNA to be measured, adds the pH value of being made up of 5M S-WAT, 0.5mM quinhydrones and be 5.0 mixed solution, 60 ℃ of lucifuge temperature baths 4 hours; Desulfurization and purify DNA.

Step 2: in the gene order that will detect, select one section sequence as the target detect sequence, make this section sequence contain a CpG site at least, and the middle part of this position, CpG site and this section sequence or near 3 'The position of end; C except that the CpG site does not appear in this section sequence simultaneously.With this section sequence or with this section sequence 5 'One section sequence of end is as the forward primer of PCR, with 3 of this section sequence 'The complementary sequence of one section sequence in end downstream is as the reverse primer of PCR; Preferably, selected successive sequence is greater than 8 bases, and making the inverse PCR primer that is designed is that 18 ~ 32 bases are long; In the position of " C " in the related CpG of reverse primer site, can mix with G/A and replace G; And make 3 of the reverse primer that designed 'Last base of end is not in the position of CpG " C ".

Step 3:PCR amplification; The operating process of PCR; By the DNA sample to be measured of step 1 gained as template (Template); By step 2 design and synthetic forward and inverse PCR primer (primer), pcr amplification damping fluid (Buffer), four kinds of triphosphate deoxyribose nucleotides (dNTPs), with archaeal dna polymerase to the uridylic sensitivity; Carry out pcr amplification with real-time quantitative PCR amplification appearance, detect amplified signal simultaneously; And with the non-methylate DNA of standard and standard methylation DNA as contrast;

Be that ancient pyrenomycetes belongs to one or more in the archaeal dna polymerase of originating wherein, be specially the pfu archaeal dna polymerase the responsive archaeal dna polymerase of uridylic.

Step 4: analyze the reaction result of pcr amplification appearance, and contrast with the standard DNA sample result; In the non-methylate DNA sample of standard, can not detect the signal of pcr amplification product; At the signal of standard methylation DNA sample detection to pcr amplification product; And in DNA sample to be measured, also can detect the signal of pcr amplification product, then show to have methylate DNA in the sample; Otherwise,, then show not have methylate DNA in the sample if in DNA sample to be measured, can not detect the signal of pcr amplification product.

A kind of methylate DNA detection method of the present invention is checked specificity of the present invention and sensitivity through above-mentioned steps.

Embodiment (two)

On embodiment (one's) basis, be testing sample with the DNA of actual clinical sample extraction, under the condition identical, check practicality of the present invention with above-mentioned embodiment ().

Wherein, in the identical condition of embodiment (), the DNA that refers to divided by the actual clinical sample extraction is outside the testing sample with above-mentioned, and all operations is with above-mentioned identical at embodiment ().

The DNA sample to be measured of said clinical extraction, the sample of and cancer cells DNA, tumor tissues genomic dna, hemocyte DNA, serum DNA, various body fluid DNA or various movement DNAs normal for the mankind.

Said cancer cells can be lung carcinoma cell, stomach cancer cell, colon cancer cell, rectum cancer cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell; Said tumor tissues can be cancerous lung tissue, stomach organization, colon cancer tissue, rectum cancer tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or carcinoma of the pancreas tissue; Said various body fluid can be blood, csf, gastric juice and various Digestive system, seminal fluid, saliva, tear, sweat, urine, vaginal secretion etc.

Embodiment (three)

On embodiment () and (twos') basis, be example with the sequence of P16 genetic transcription promoter region, concrete PCR design of primers is following:

Methylating of P16 genetic transcription promoter region is the characteristic that multiple cancer cell such as lung cancer have.The sequence of P16 genetic transcription promoter region is following, and the part that underscore is arranged is the selected zone that will detect.

Homo?sapiens?p16?protein（CDKN2A）gene，CpG?island?and?partial?cds，DQ325544.1

CGGACCGCGTGCGCTCGGCGGCTGCGGAGAGGGGGAGAGCAGGCAGCGGGCGGCGGGGAGCAGCATGGAGCGGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGCTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGGCGCTGCCCAACGCACCGAATAGTTACGGTCGGAGGCCG

Methylate DNA sequence, underscore partly are selected surveyed area, runic UFor non-methylated " C " handles the uridylic that changes into through S-WAT

UGGA UUGCGTGCGCT UGGCGGCTGCGGAGAGGGGGAGAGCAGGCAGCGGGCGGCGGGGAGCAGCATGGAGCGGGCGGCGGGGAGCAGCATGGAGC UTT UGGCTGA UTGGCTGGC UA UGGC UGCGGC UUGGGCT UGGGTAGAGGAGGTGCGG GCGCTGCTGGAGGCGGGGGCGCTGC UUAA UGCA UUGAATAGTTA UGGT UGG AGGC UG

Non-methylate DNA sequence, underscore partly are selected surveyed area, runic UFor non-methylated " C " handles the uridylic that changes into through S-WAT

UGGA UUG UGTG UG UT UGG UGG UTG UGGAGAGGGGGAGAG UAGG UAG UGGG UGG UGGGGAG UAG UATGGAG UGGG UGG UGGGGAG UAG UATGGAG UUTT UGG UTGA UTGG UTGG UUA UGG UUG UGG UUUGGG UT UGGGTAGAGGAGGTG UGG G UG UTG UTGGAGG UGGGGG UG UTG UUUAA UG UA UUGAATAGTTA UGGT UGG AGG UUG

The forward primer 5 of design '- GCGCTGCTGGAGGCGGGGGCGCTGC-3 '

The reverse primer (R=G/A) 5 of design '- CCAACCATAACTATTCAATRCATTAA-3 '

Then, according to the described method of embodiment (), detect.

Foregoing is giving an example of specific embodiment of the present invention, for the wherein not reagent of detailed description, equipment, working method etc., is to be understood that to taking the existing common and conventional reagent in this area, equipment, working method to wait and implement.

More than specific embodiment of the present invention is described in detail, but it is just as example, the present invention is not restricted to the specific embodiment of above description.To those skilled in the art, any equivalent modifications that the present invention is carried out with substitute also all among category of the present invention.Therefore, not breaking away from impartial conversion and the modification of being done under the spirit and scope of the present invention, all should contain within the scope of the invention.

Claims (9)

1. methylate DNA detection method based on the archaeal dna polymerase chain reaction is characterized in that step is following:

Step 1 is with sulfiting DNA to be measured, standard methylation DNA and the non-methylate DNA of standard;

Step 2 in the target area that will detect, is selected one section continuous sequence, makes this section continuous sequence include at least one and is in the middle part of this section sequence or near 3 'The position CpG site of end but the C except that the CpG site do not occur; With selected sequence or selected sequence 5 'The part of end is as forward primer, with selected sequence 3 'The complementary sequence of one section sequence in end downstream is as reverse primer;

Step 3; With step 2 synthetic PCR primer, the template so that the DNA sample of crossing with sulfiting to be measured reacts as PCR adds the specific archaeal dna polymerase that uridylic is had susceptibility; Carry out pcr amplification with real-time quantitative PCR amplification appearance, detect amplified signal simultaneously; And with the non-methylate DNA of standard and standard methylation DNA as contrast;

Step 4 is analyzed the reaction result of pcr amplification appearance, and contrasts with the standard DNA sample result; In DNA sample to be measured, can detect the signal of pcr amplification product, then show to have methylate DNA in the sample; Otherwise,, then show not have methylate DNA in the sample if in DNA sample to be measured, can not detect the signal of pcr amplification product.

2. detection method according to claim 1 is characterized in that, in the step 2, selected successive sequence is greater than 8 bases; And to make said designed primer sequence length be 18 ~ 32 base length.

3. detection method according to claim 1 is characterized in that, in the step 3, the used specific archaeal dna polymerase that uridylic is had susceptibility of pcr amplification reaction is one or more in the archaeal dna polymerase in heat-resisting ancient pyrenomycetes source.

4. detection method according to claim 3 is characterized in that, the said specific archaeal dna polymerase that uridylic is had susceptibility is the pfu archaeal dna polymerase.

5. detection method according to claim 1 is characterized in that, said sulphite is S-WAT.

6. detection method according to claim 5; It is characterized in that; Use said S-WAT processing DNA sample method to be: with 0.3M NaOH sex change DNA to be measured, the pH value that adding is made up of 5M S-WAT, 0.5mM quinhydrones is 5.0 mixed solution, and 60 ℃ of lucifuge temperature were bathed 4 hours; Desulfurization and purify DNA.

7. detection method according to claim 1; It is characterized in that; Said DNA to be measured is the human genome DNA, non-methylate DNA of said standard and standard methylation DNA for be complementary in DNA to be measured, the fixed pure non-human genome DNA of methylating and the fixed pure human genome DNA that methylates.

8. detection method according to claim 7 is characterized in that, said DNA sample to be measured is the sample of human normal cell DNA, cancer cells DNA, tumor tissues genomic dna, hemocyte DNA, serum DNA, body fluid DNA or movement DNA.

9. detection method according to claim 8 is characterized in that,

Said cancer cells is lung carcinoma cell, stomach cancer cell, colon cancer cell, rectum cancer cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell;

Said tumor tissues is cancerous lung tissue, stomach organization, colon cancer tissue, rectum cancer tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or carcinoma of the pancreas tissue;

Said body fluid comprises blood, csf, gastric juice and various Digestive system, seminal fluid, saliva, tear, sweat, urine, vaginal secretion.