CN104046680B - Methylate DNA detection method - Google Patents
Methylate DNA detection method Download PDFInfo
- Publication number
- CN104046680B CN104046680B CN201310077102.9A CN201310077102A CN104046680B CN 104046680 B CN104046680 B CN 104046680B CN 201310077102 A CN201310077102 A CN 201310077102A CN 104046680 B CN104046680 B CN 104046680B
- Authority
- CN
- China
- Prior art keywords
- dna
- sequence
- detection
- methylate dna
- methylate
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6804—Nucleic acid analysis using immunogens
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Pathology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kind of methyl DNA detection method, the method comprises the following steps: processing sample, synthesising probing needle, hybridization, add monoclonal antibody, add conjugated monoclonal antibodies, add detection reagent, mensuration, judgement.The present invention have detection specificity high, be not easy the advantages such as disturbed, false positive rate is low, tumour early detection, tumour personalized treatment, the tumour state of an illness to be judged and detection in recurrence monitoring etc. and the exploitation of detection reagent are having great significance.
Description
Technical field
The present invention relates to field of biological detection, be specifically related to a kind of detection method of methylate DNA.
Background technology
The 5' carbon that DNA methylation refers to cytosine(Cyt) (C) residue in CpG site on DNA chain has been modified a methyl.DNA methylation is one of DNA modification be found the earliest, is the important component part of epigenetics.DNA methylation occurs on the cytosine residues of the CG dinucleotides on DNA chain characteristically, and this is common in gene 5 ' end expression regulation sequence.DNA methylation has vital role in the regulation and control of genetic expression, take part in the processes such as Embryonic Development in Animal, Genomic Imprinting and x chromosome inactivation.Research shows, the change of DNA methylation can cause the change of chromatin Structure, DNA conformation, DNA stability and protein interaction mode, thus controlling gene is expressed.
The change of methylation state of DNA is the important factor causing tumour.The exception of local, CpG island methylation level raises, and can cause not expressing of genomic instability and cancer suppressor gene.If activated allelic inactivation in cancer suppressor gene, then the probability that cancer occurs will improve, so the application of DNA methylation in tumour early detection is very noticeable.Research shows, the change of epigenetic, with the generation of tumour and development, thus detects DNA methylation and changes the early discovery that can contribute to tumour.The research of current tumor methylation mainly concentrates on cancer suppressor gene, this is because it is found that and the generation of tumour may methylate with the CpG island of cancer suppressor gene promoter region to cause cancer suppressor gene to close relevant.Local height due to CpG island methylates early than the neoplasm of cell, and therefore the detection of DNA methylation may be used for tumorigenic early prediction.
The methylated detection method in CpG island is numerous, and its principle is respectively based on the digestion with restriction enzyme method of methyl-sensitive and the PCR detection method based on S-WAT modifying DNA.Methylation sensitive restriction enzyme/Southern method (methylation-sensitiverestrictionEndonuclease/Southern, MSRE-Southern) is more traditional method, and sensitivity is low, and sample requirement is large.Methylate DNA specific PCR methodology (MethylationSpecificPCR, MSP) and derivative methylate DNA detection method thereof are the common methods detecting DNA methylation at present, its sensitivity is higher, but be easily disturbed, poor specificity, thus cause the false positive rate of detection also very high.
Summary of the invention
The invention provides a kind of methylate DNA detection method, effectively can get rid of the impact of non-methylate DNA, solve the shortcomings such as detection specificity in prior art is low, easily disturbed, false positive is high well.
For achieving the above object, technical scheme of the present invention is, a kind of methylate DNA detection method, and described methylate DNA detection method comprises the steps:
Step 1, adopts sulfiting testing sample DNA, and the non-methylate DNA of known standard and known standard methylation DNA;
Step 2, determines the surveyed area of testing gene, and select target detects sequence, designs and synthesizes detection probes sequence according to gene order;
Step 3, the standard methylation DNA crossed with sulfiting and the non-methylate DNA of standard, as the positive criteria contrast detected and negative standards's contrast, make gradient dilution in proportion; Hybridization is carried out respectively with the standard methylation DNA sample of described detection probes and gradient dilution and the non-methylate DNA sample of standard; Simultaneously with described detection probes with carry out hybridization with the testing sample DNA that sulfiting is crossed;
Step 4, adds the reactant of step 3 gained on the reaction carriers with avidin bag quilt, catches the probe be labeled that have passed through hybridization, and washs;
Step 5, adds anti-methylated cytosine monoclonal antibody and reacts, and wash;
Step 6, adds HRP conjugated monoclonal antibodies and reacts, and wash;
Step 7, adds HRP detection reagent and reacts, measure after termination reaction, and calculates concentration and the amount of methylate DNA;
Step 8, judges whether to there is methylate DNA.
Preferably, sulphite used in described step 1 is S-WAT, and concentration is 5M, pH5.0.
Preferably, the temperature of reaction of described step 1 is 60 degree, and the reaction times is 4 hours.
Preferably, the surveyed area of testing gene and target detection sequence is determined and design and synthesis probe in described step 2, refer to selection one section of sequence A in testing gene, this sequence A is made to contain CpG site as much as possible, sequence length is 18-120 base, detection probes design is carried out as target detection sequence, using the complementary sequence of sequence A as detection probes sequence 1 using the methylation state of sequence A after sulfiting; In testing gene group DNA sequence A downstream area another chain on, select one section of sequence B, sequence B is made to be rich in CpG site and not overlap with sequence A, sequence length is 18-120 base, detection probes design is carried out as target detection sequence using the methylation state of sequence B after sulfiting, using the complementary sequence of sequence B as detection probes sequence 2, synthesis detection probes, and mark at 5 ' end of the probe of synthesis.
Preferably, the described probe to synthesis marks, and refers to mark with vitamin H or the material with detectability matter.
Preferably, the standard methylation DNA in described step 3 and the non-methylate DNA of standard are the pure mankind's methylate DNA through determining and non-methylate DNA; Described hybridization carries out under the temperature of reaction condition being 8.0,60 DEG C in the salt concn of 2xSSC, pH value.
Preferably, the reaction carriers of described step 4 is enzyme plate with avidin bag quilt or glass microsphere.
Preferably, the monoclonal antibody added in described step 5 is little mouse-anti methylated cytosine monoclonal antibody, the reaction of described step 5 be the salt concn of 1xPBST, pH8.0,0.5% skim-milk as encapsulant, the temperature of reaction condition of 25 DEG C under carry out.
Preferably, the coupled antibody added in described step 6 is the sheep anti-Mouse monoclonal antibody of HRP coupling, the reaction of described step 6 be the salt concn of 1xPBST, pH8.0,0.5% skim-milk as encapsulant, the temperature of reaction condition of 25 DEG C under carry out.
Preferably, the HRP detection reagent in described step 7 is HRP substrate: TMB, TMB.
Preferably, described testing sample is the sample of the mankind normal and cancer cells DNA, tumor tissues genomic dna, hemocyte DNA, serum CRP, body fluid DNA or movement DNA.
Preferably, described cancer cells is lung carcinoma cell, stomach cancer cell, colon cell, rectal cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell; Described tumor tissues is cancerous lung tissue, stomach organization, colon, rectal tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or Pancreatic Adenocarcinoma; Described body fluid comprises blood, celiolymph, gastric juice and Digestive system, seminal fluid, saliva, tear, sweat, urine, vaginal secretion.
Preferably, in described step 8, judge whether to there is methylate DNA, be contrast the corresponding characteristic curve of methylate DNA detected with standard substance, judge whether there is methylate DNA in testing sample.
So that in the DNA to be measured of bisulfite process, because non-methylated cytosine(Cyt) (C) is converted into uridylic (U), methylated cytosine(Cyt) (C) remains unchanged, thus GC content overall on DNA chain is reduced, be conducive to the specific hybrid of detection probes and target dna.After carrying out hybrid capture by specific detection probes, effectively eliminate the impact of DNA methylation of overall importance (GlobalDNAmethylation), make only have the methylate DNA of object detection area to be preserved, thus the methylate DNA of the denier existed in sample can be detected.
Compared to prior art, the present invention effectively can get rid of the impact of non-methylate DNA, the methylate DNA in sample is made to be able to enrichment, therefore the present invention have detection specificity high, be not easy the advantages such as disturbed, false positive rate is low, also have that the scope of application is large simultaneously, method be simple, need sample size little, be suitable for the benefits such as mixing sample, judge in tumour early detection, personalized treatment, the state of an illness and have great significance in recurrence monitoring etc.
Accompanying drawing explanation
Fig. 1 is methylate DNA detection method schema of the present invention.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read content of the present invention, these equivalent form of values fall within equally the application the scope that limits of attached claims.
Embodiment 1,
Step 1, with the non-methylate DNA of known standard and methylate DNA as detection sample; Employing concentration is the sodium sulfite solution process testing sample DNA of 5M, and temperature of reaction is 60 degree, and the treatment time is 4 hours;
Step 2, determines the surveyed area of testing gene, designs and synthesizes the sequence of the methylated DNA sequence complementary pairing can crossed with sulfiting as the probe sequence detected according to gene order; On two chains that genome sequence is corresponding, each design probe sequence, makes this section of long 18-120 base of sequence, and the sequence of two probes is not overlapped; To designed and synthesis probe 5 ' end carry out biotin labeling;
Step 3, the standard methylation DNA crossed with sulfiting of gradient dilution step 1 gained by 1/2 and non-methylate DNA, with the standard DNA sample of gradient dilution carry out hybridization under the temperature of reaction condition being 8.0,60 DEG C in the salt concn of 2xSSC, pH value by the detection probes of step 2 gained;
Step 4, adds the enzyme plate with avidin bag quilt respectively by the reactant of step 3, catches the biotin labeled probe through carrying out hybridization, and washs;
Step 5, adds little mouse-anti methylated cytosine (Anti-5-Methylcytosine) monoclonal antibody, the salt concn of 1xPBST, pH8.0,0.5% skim-milk as encapsulant, the temperature of reaction condition of 25 DEG C under react, and to wash;
Step 6, add the sheep anti-Mouse monoclonal antibody (GoatAnti-MouseIgG (H+L)-HRPpAb) of HRP coupling, the salt concn of 1xPBST, pH8.0,0.5% skim-milk as encapsulant, the temperature of reaction condition of 25 DEG C under react, and to wash;
Step 7, adds HRP detection reagent (HRP substrate: TMB, TMB) and reacts, then termination reaction measuring by microplate reader, and calculates concentration and the amount of methylate DNA;
Step 8, judges whether to there is methylate DNA, determination methods for: by the data calculated in step 7, contrast the corresponding characteristic curve of methylate DNA detected with standard substance, judge whether there is methylate DNA in testing sample.
Embodiment 2,
Get normal people and turned out to be 5 grams, colon cancer patient ight soil, add 5 times of volume 1xTE and fully mixing, with equal-volume chloroform once, with the isopropanol precipitating acquisition STb gene of 0.6 times.With this DNA for testing sample, under the same conditions as example 1, practicality of the present invention is checked.
Wherein identical with embodiment 1 condition, the DNA referred to divided by actual clinical sample extraction is outside testing sample, and all operations is identical with embodiment 1.
DNA sample to be measured in embodiment two, for the mankind are normal and the sample of cancer cells DNA, tumor tissues genomic dna, hemocyte DNA, serum CRP, various body fluid DNA or various movement DNA.
Described cancer cells is lung carcinoma cell, stomach cancer cell, colon cell, rectal cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell; Described tumor tissues is cancerous lung tissue, stomach organization, colon, rectal tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or Pancreatic Adenocarcinoma; Described various body fluid comprises blood, celiolymph, gastric juice and various Digestive system, seminal fluid, saliva, tear, sweat, urine, vaginal secretion etc.
Step 1, be detect sample by above-mentioned DNA sample to be measured, the non-methylate DNA of known standard and methylate DNA are as negative control and positive control; Employing concentration is that the sodium sulfite solution of 5M processes testing sample DNA and negative control, positive control respectively, and temperature of reaction is 60 degree, and the treatment time is 4 hours;
Step 2, determine the surveyed area of testing gene and target detection sequence and design and synthesis probe: in testing gene, select one section of sequence A, this sequence A is made to contain CpG site as much as possible, sequence length is 18-120 base, detection probes design is carried out as target detection sequence, using the complementary sequence of sequence A as detection probes sequence 1 using the methylation state of sequence A after sulfiting; In testing gene group DNA sequence A downstream area another chain on, select one section of sequence B, sequence B is made to be rich in CpG site and not overlap with sequence A, sequence length is 18-120 base, detection probes design is carried out as target detection sequence using the methylation state of sequence B after sulfiting, using the complementary sequence of sequence B as detection probes sequence 2, synthesis detection probes, and mark at 5 ' end of the probe of synthesis;
Step 3, the standard methylation DNA crossed with sulfiting of gradient dilution step 1 gained by 1/2 and non-methylate DNA, with the standard DNA sample of the testing sample DNA that with sulfiting cross, gradient dilution respectively carry out hybridization under the temperature of reaction condition being 8.0,60 DEG C in the salt concn of 2xSSC, pH value by the detection probes of step 2 gained;
Step 4, adds the enzyme plate with avidin bag quilt respectively by the reactant of step 3, catches the biotin labeled probe through carrying out hybridization, and washs;
Step 5, adds little mouse-anti methylated cytosine (Anti-5-Methylcytosine) monoclonal antibody, the salt concn of 1xPBST, pH8.0,0.5% skim-milk as encapsulant, the temperature of reaction condition of 25 DEG C under react, and to wash;
Step 6, add the sheep anti-Mouse monoclonal antibody (GoatAnti-MouseIgG (H+L)-HRPpAb) of HRP coupling, the salt concn of 1xPBST, pH8.0,0.5% skim-milk as encapsulant, the temperature of reaction condition of 25 DEG C under react, and to wash;
Step 7, adds HRP detection reagent (HRP substrate: TMB, TMB) and reacts, then termination reaction measuring by microplate reader, and calculates concentration and the amount of methylate DNA;
Step 8, judges whether to there is methylate DNA, determination methods for: by the data of testing sample DNA calculated in step 7, contrast the corresponding characteristic curve of methylate DNA detected with standard substance, judge whether there is methylate DNA in testing sample.
Embodiment 3,
The design of detection probes
Methylating of P16 genetic transcription promoter region is the feature that the kinds cancer cells such as lung cancer have.The sequence of P16 genetic transcription promoter region is as follows, has the part of underscore for selected surveyed area.
Homosapiensp16protein(CDKN2A)gene,CpGislandandpartialcds，DQ325544.1
Genomic dna normal chain (sensestrand):
5’-CGGACCGCGTGCGCTCGGCGGCTGCGGAGAGGGGGAGAGCAGGCAGCGGGCGGCGGGGAGCAGCATGGAGCGGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGCTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGGCGCTGCCCAACGCACCGAATAGTTACGGTCGGAGGCCG-3’
The secondary chain (anti-sensestrand) of genomic dna:
3’-GCCTGGCGCACGCGAGCCGCCGACGCCTCTCCCCCTCTCGTCCGTCGCCCGCCGCCCCTCGTCGTACCTCGCCCGCCGCCCCTCGTCGTACCTCGGAAGCCGACTGACCGACCGGTGCCGGCGCCGGGCCCGAGCCCATCTCCTCCACGCCCGCGACGACCTCCGCCCCCGCGACGGGTTGCGTGGCTTATCAATGCCAGCCTCCGGC-5’
Positive chain DNA is in the sequence (underscore part is designed probe location) after sulfiting:
5’-
CGGATCGCGTGCGTTCGGCGGTTGCGGAGAGGGGGAGAGTAGGTAGCGGGCGGCGGGGAGTAGTATGGAGCGGGCGGCGGGGAGTAGTATGGAGTTTTCGGTTGATTGGTTGGTTACGGTCGCGGTTCGGGTTCGGGTAGAGGAGGTGCGGGCGTTGTTGGAGGCGGGGGCGTTGTTTAACGTATCGAATAGTTACGGTCGGAGGTCG-3’
Secondary chain DNA is in the sequence (underscore part is designed probe location) after sulfiting:
3’-GCTTGGCGCATGCGAGCTGCTGATGCTTTTTTTTTTTTTGTTTGTTGCTTGCTGCTTTTTGTTGTATTTTGCTTGCTGCTTTTTGTTGTATTTTGGAAGCTGATTGATTGATTGGTGCTGGCGCTGGGCTTGAGCTTATTTTTTTTAT
GCTTGCGATGATTTTTGCTTTTGCGATGGGTTGCGTGGCTTATTAATGCTAGCTTTTGGC-5’
The upstream probe of design:
5’-biotin-CCCGCCGCCCGCTACCTACTCTCCCCCTCTCCGCAACCGCCGAACGCACGCGATCCG-3’
The downstream probe of design:
5’-biotin-CGAACGCTACTAAAAACGAAAACGCTACCCAACGCACCGAATAATTACGATCGAAAACCG-3’
Foregoing is exemplifying of specific embodiments of the invention, for the reagent, equipment, working method etc. of wherein not detailed description, should be understood to take this area existing common and conventional reagent, equipment, working method etc. to be implemented.
Be more than the description to the embodiment of the present invention, by the above-mentioned explanation to the disclosed embodiments, professional and technical personnel in the field realized or uses the present invention.To be apparent for those skilled in the art to the multiple amendment of these embodiments, General Principle as defined herein can without departing from the spirit or scope of the present invention, realize in other embodiments.Therefore, the present invention can not be restricted to these embodiments shown in this article, but will meet the widest scope consistent with principle disclosed herein and features of novelty.
Claims (10)
1. for a methylate DNA detection method for non-diagnostic object, it is characterized in that, described methylate DNA detection method comprises the steps:
Step 1, adopts sulfiting testing sample DNA, and the non-methylate DNA of known standard and known standard methylation DNA;
Step 2, determines the surveyed area of testing gene, and select target detects sequence, designs and synthesizes detection probes sequence according to gene order;
Step 3, the standard methylation DNA crossed with sulfiting and the non-methylate DNA of standard, as the positive criteria contrast detected and negative standards's contrast, make gradient dilution in proportion; Hybridization is carried out respectively with the standard methylation DNA sample of described detection probes and gradient dilution and the non-methylate DNA sample of standard; Simultaneously with described detection probes with carry out hybridization with the testing sample DNA that sulfiting is crossed;
Step 4, joins in reaction carriers respectively by the reactant of step 3 gained, catches the probe be labeled that have passed through hybridization, and washs;
Step 5, adds anti-methylated cytosine monoclonal antibody and reacts, and wash;
Step 6, adds HRP conjugated monoclonal antibodies and reacts, and wash;
Step 7, adds HRP detection reagent and reacts, measure after termination reaction, and calculates concentration and the amount of methylate DNA;
Step 8, judges whether to there is methylate DNA.
2. the methylate DNA detection method for non-diagnostic object according to claim 1, is characterized in that, sulphite used in described step 1 is S-WAT, concentration is 5M, pH5.0, the temperature of reaction of described step 1 is 60 degree, and the reaction times is 4 hours.
3. the methylate DNA detection method for non-diagnostic object according to claim 1, it is characterized in that, the surveyed area of testing gene and target detection sequence is determined and design and synthesis probe in described step 2, refer to selection one section of sequence A in testing gene, this sequence A is made to contain CpG site as much as possible, sequence length is 18-120 base, detection probes design is carried out as target detection sequence, using the complementary sequence of sequence A as detection probes sequence 1 using the methylation state of sequence A after sulfiting; In testing gene group DNA sequence A downstream area another chain on, select one section of sequence B, sequence B is made to be rich in CpG site and not overlap with sequence A, sequence length is 18-120 base, detection probes design is carried out as target detection sequence using the methylation state of sequence B after sulfiting, using the complementary sequence of sequence B as detection probes sequence 2, synthesis detection probes, and mark at 5 ' end of the probe of synthesis.
4. the methylate DNA detection method for non-diagnostic object according to claim 3, is characterized in that, the described probe to synthesis marks, and refers to mark with vitamin H or the material with detectability matter.
5. the methylate DNA detection method for non-diagnostic object according to claim 1, is characterized in that, the standard methylation DNA in described step 3 and the non-methylate DNA of standard, is the pure mankind's methylate DNA through determining and non-methylate DNA; Described hybridization carries out under the temperature of reaction condition being 8.0,60 DEG C in the salt concn of 2xSSC, pH value.
6. the methylate DNA detection method for non-diagnostic object according to claim 1, it is characterized in that, the monoclonal antibody added in described step 5 is little mouse-anti methylated cytosine monoclonal antibody, the reaction of described step 5 be the salt concn of 1xPBST, pH8.0,0.5% skim-milk as encapsulant, the temperature of reaction condition of 25 DEG C under carry out.
7. the methylate DNA detection method for non-diagnostic object according to claim 1, it is characterized in that, the coupled antibody added in described step 6 is the sheep anti-Mouse monoclonal antibody of HRP coupling, the reaction of described step 6 be the salt concn of 1xPBST, pH8.0,0.5% skim-milk as encapsulant, the temperature of reaction condition of 25 DEG C under carry out.
8. the methylate DNA detection method for non-diagnostic object according to claim 1, is characterized in that, the HRP detection reagent in described step 7 is HRP substrate: TMB, TMB.
9. the methylate DNA detection method for non-diagnostic object according to claim 1, it is characterized in that, described testing sample is the sample of the mankind normal and cancer cells DNA, tumor tissues genomic dna, hemocyte DNA, serum CRP, body fluid DNA or movement DNA.
10. the methylate DNA detection method for non-diagnostic object according to claim 9, it is characterized in that, described cancer cells is lung carcinoma cell, stomach cancer cell, colon cell, rectal cell, liver cancer cell, breast cancer cell, lymphocytic cancer cell, transitional cell bladder carcinoma cell line, ovarian cancer cell, kidney cancer cell or pancreatic cancer cell; Described tumor tissues is cancerous lung tissue, stomach organization, colon, rectal tissue, liver cancer tissue, breast cancer tissue, lymphatic cancer tissue, Bladder Cancer, ovarian cancer tissue, renal carcinoma tissue or Pancreatic Adenocarcinoma; Described body fluid comprises blood, celiolymph, gastric juice and Digestive system, seminal fluid, saliva, tear, sweat, urine, vaginal secretion.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310077102.9A CN104046680B (en) | 2013-03-11 | 2013-03-11 | Methylate DNA detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310077102.9A CN104046680B (en) | 2013-03-11 | 2013-03-11 | Methylate DNA detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104046680A CN104046680A (en) | 2014-09-17 |
| CN104046680B true CN104046680B (en) | 2016-04-06 |
Family
ID=51500076
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310077102.9A Active CN104046680B (en) | 2013-03-11 | 2013-03-11 | Methylate DNA detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104046680B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2319943A1 (en) * | 2009-11-05 | 2011-05-11 | Epigenomics AG | Methods of predicting therapeutic efficacy of cancer therapy |
| CN102399865A (en) * | 2010-09-16 | 2012-04-04 | 上海迦美生物科技有限公司 | Endonuclease digestion based quantitative detection method for methylated DNA |
| EP2479283A1 (en) * | 2006-04-17 | 2012-07-25 | Epigenomics AG | Methods and nucleic acids for the detection of colorectal cell proliferative disorders |
| WO2012167145A2 (en) * | 2011-06-01 | 2012-12-06 | University Of Southern California | Genome-scale analysis of aberrant dna methylation in colorectal cancer |
| CN102888461A (en) * | 2012-10-15 | 2013-01-23 | 辽宁大学 | PCR (polymerase chain reaction) method for quickly and efficiently detecting DNA (deoxyribonucleic acid) methylation modification after sulfite treatment |
-
2013
- 2013-03-11 CN CN201310077102.9A patent/CN104046680B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2479283A1 (en) * | 2006-04-17 | 2012-07-25 | Epigenomics AG | Methods and nucleic acids for the detection of colorectal cell proliferative disorders |
| EP2319943A1 (en) * | 2009-11-05 | 2011-05-11 | Epigenomics AG | Methods of predicting therapeutic efficacy of cancer therapy |
| CN102399865A (en) * | 2010-09-16 | 2012-04-04 | 上海迦美生物科技有限公司 | Endonuclease digestion based quantitative detection method for methylated DNA |
| WO2012167145A2 (en) * | 2011-06-01 | 2012-12-06 | University Of Southern California | Genome-scale analysis of aberrant dna methylation in colorectal cancer |
| CN102888461A (en) * | 2012-10-15 | 2013-01-23 | 辽宁大学 | PCR (polymerase chain reaction) method for quickly and efficiently detecting DNA (deoxyribonucleic acid) methylation modification after sulfite treatment |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104046680A (en) | 2014-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wei et al. | Monitoring tumor burden in response to FOLFIRINOX chemotherapy via profiling circulating cell-free DNA in pancreatic cancer | |
| He et al. | Development of a multiplex MethyLight assay for the detection of multigene methylation in human colorectal cancer | |
| CN106399518B (en) | Probe, kit and its detection method for Human epidermal growth factor receptor detection in Gene Mutation | |
| Tanić et al. | Epigenome-wide association studies for cancer biomarker discovery in circulating cell-free DNA: technical advances and challenges | |
| Campuzano et al. | Electrochemical biosensing to move forward in cancer epigenetics and metastasis: A review | |
| CN104164474A (en) | Fluorescent quantitative PCR method for detecting expression quantities of PCA3 gene and PSA gene in urine and diagnosis kit thereof | |
| CN108559776A (en) | A kind of biomarker and its application for sudden weak smart auxiliary diagnosis | |
| CN108103198A (en) | A kind of and the relevant blood plasma miRNA marker of cancer of pancreas auxiliary diagnosis and its application | |
| CN102399861B (en) | Methylate DNA detection method based on endonuclease digestion | |
| CN108531586A (en) | A kind of relevant cycle miRNA marker and its application on X chromosome of and Computer-aided Diagnosis of Breast Cancer | |
| CN107630093A (en) | For the reagent of diagnosing liver cancer, kit, detection method and purposes | |
| CN109609634A (en) | One kind circulation miRNA marker relevant to carcinoma of endometrium auxiliary diagnosis and its application | |
| Wang et al. | Methylation-powered engineering of a dual-color light-up RNA nanosensor for label-free and ultrasensitive sensing of multiple DNA methyltransferases | |
| CN104046680B (en) | Methylate DNA detection method | |
| CN107641649B (en) | Primer pair, kit and method for detecting stability of NR27 locus of microsatellite | |
| CN103074438B (en) | Multi-gene detection kit for guiding administration of warfarin and detection method of multi-gene detection kit | |
| CN104611430A (en) | Detection method and primers for TMPRSS2-ERG gene in human urine | |
| CN102159728A (en) | Breast cancer metastasis determination method and blood serum evaluation method | |
| CN108103199A (en) | A kind of Xun Huan miRNA marker relevant with oophoroma auxiliary diagnosis and its application | |
| CN106636306A (en) | Method for detecting methylation of relevant gene promoters in colorectal cancer | |
| Yu et al. | Significance of combined detection of LunX mRNA and tumor markers in diagnosis of lung carcinoma | |
| CN106119361A (en) | The test kit detected for the NDRG4 gene methylation of early gastric caacer diagnosis and prognosis evaluation and application thereof | |
| CN105385760A (en) | Kit capable of being used for detecting SHISA3 gene promotor region methylation level related to laryngocarcinoma and application thereof | |
| CN102399865A (en) | Endonuclease digestion based quantitative detection method for methylated DNA | |
| CN103487580A (en) | Application of DKK1 as diagnostic marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200806 Address after: 225300 west side of the second floor of G59, building 0004, east side of Lujia Road, west side of taikou Road, China Pharmaceutical City, Taizhou City, Jiangsu Province Patentee after: Jiangsu Yuanhen Biotechnology Co.,Ltd. Address before: 215200 science and Technology Pioneer Park, Wujiang economic and Technological Development Zone, Suzhou, Jiangsu Patentee before: SUZHOU CHENGMEI BIOTECHNOLOGY Co.,Ltd. |
|
| TR01 | Transfer of patent right |