CN106119361A - The test kit detected for the NDRG4 gene methylation of early gastric caacer diagnosis and prognosis evaluation and application thereof - Google Patents
The test kit detected for the NDRG4 gene methylation of early gastric caacer diagnosis and prognosis evaluation and application thereof Download PDFInfo
- Publication number
- CN106119361A CN106119361A CN201610510535.2A CN201610510535A CN106119361A CN 106119361 A CN106119361 A CN 106119361A CN 201610510535 A CN201610510535 A CN 201610510535A CN 106119361 A CN106119361 A CN 106119361A
- Authority
- CN
- China
- Prior art keywords
- methylation
- gene
- ndrg4
- test kit
- ndrg4 gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the test kit of a kind of NDRG4 gene methylation detection for early gastric caacer diagnosis and prognosis evaluation, feature is to include a pair NDRG4 gene promoter zone methylation specificity amplification primer and fluorescent quantitation probe, and concrete nucleotide sequence is as follows: forward primer: 5'TGGGATGGGGATGTTTTTGT 3'；Downstream primer: 5'CCTCCAAACCCCCTATAACC 3'；Fluorescent quantitation probe: 5'6 FAM AAAACGACGCTACCGTAATCTTTA BHQ1 3', advantage is easy and simple to handle, and the cycle is short, highly sensitive, and specificity is good and Detection accuracy high.
Description
Technical field
The present invention relates to disease be correlated with DNA detection technical field, more particularly relate to early gastric caacer diagnosis and prognosis
The test kit of the NDRG4 gene methylation detection of assessment and application thereof.
Background technology
Gastric cancer is one of modal malignant tumor of serious harm human health, and sickness rate occupies all malignant tumor
Second, mortality rate arranges the 3rd of all malignant tumor.Radical surgery remains the primary treatment regimen of gastric cancer at present, also
It is the means being uniquely hopeful to cure gastric cancer.But the most still having Most patients has been middle and advanced stage when making a definite diagnosis, and surgical effect is not
Good, directly affect prognosis.Therefore the molecular mechanism that further investigation gastric cancer occurs, develops, can be that early gastric caacer diagnosis provides foundation,
The most also provide effective target treatment for clinical treatment, there is important clinical meaning.The cause of disease of gastric cancer is considered as environment
Factor and the coefficient result of inherited genetic factors.With regard to stomach cancer development from the point of view of the research of genomics aspect, gastric cancer is base more than
Because of abnormal change, experience multi-step Multi stage development process and the disease that causes, different genes dysfunction is at stomach cancer development not
Not same-action is played with the stage.Recent study finds, except hereditism changes, epigenetics change also take part in sending out of gastric cancer
Raw evolution.Epigenetics modifies the base sequence change referring to be not related to genome, but can cause the table of hereditability
Form variation, mainly include DNA methylation modification, histone modification, chromosome reinvent, RNA interference etc..It has now been found that: base
Because the extensive hypomethylation of group is universals of tumor cell；The hyper-methylation in tumor suppressor gene promoter district can be led
Cause antioncogene silence, inactivation causes expression product and reduces or lose.Between DNA methylation and gastric cancer in close relations, research find
The existence of gene methylation, even precancerous stage can be detected also can find in each stage of gastric cancer.Therefore, DNA
Methylating can be that early gastric caacer diagnosis, judging prognosis and targeted therapy provide new thinking.
N-myc Downstream regulatory gene 4(N-Myc downstream regulated gene 4, NDRG4) belong to and press down cancer base
Because of NDRG gene family member.This gene family is high expressed in human body other normal structures multiple, in some tumor tissues
Not expressing or low expression, low expression then may be relevant to promoter hyper-methylation.Therefore, NDRG4 and the research of cancer-related
Attention.There are some researches show, the expression of NDRG4 reduces along with the rising of malignant grade of gliomas, and NDRG4 expresses
Level is proportionate with patients with gliomas prognosis, and the cancer effect that presses down of prompting NDRG4 gene has tumor cell source specificity.Mesh
Before, at present, the most do not disclose any about the detection NDRG4 gene promoter zone methylation ill wind of scale evaluation gastric cancer
The correlational study report of the test kit of dangerous and overall prognosis.
Summary of the invention
The technical problem to be solved is to provide easy and simple to handle, and the cycle is short, highly sensitive, and specificity is good and examines
Survey test kit and the application thereof of the high NDRG4 gene methylation detection for early gastric caacer diagnosis and prognosis evaluation of accuracy rate.
The present invention solves the technical scheme that above-mentioned technical problem used and comments for early gastric caacer diagnosis and prognosis for a kind of
The test kit of the NDRG4 gene methylation detection estimated, including a pair NDRG4 gene promoter zone methylation specificity amplification primer
And fluorescent quantitation probe, concrete nucleotide sequence is as follows:
Forward primer: 5'-TGGGATGGGGATGTTTTTGT-3'；
Downstream primer: 5'-CCTCCAAACCCCCTATAACC-3'；
Fluorescent quantitation probe: 5'-6-FAM-AAAACGACGCTACCGTAATCTTTA-BHQ1-3'.
Described test kit also includes fluorescent quantitation methylation status of PTEN promoter reaction system, consisting of: the fluorescence of 20 μ l
Consisting of of quantitative methylation status of PTEN promoter reaction system: 2 × HotTaq Mater Mix 10.0 ul；The upstream and downstream of 5 μMs
The each 1.0 μ l of primer；The probe 1.0 μ l of 2 μMs；H2O 5.0 μ l, DNA sample template 2.0 μ l；Fluorescent quantitation methylation specific
Property PCR reaction condition is as follows: (1) 95 DEG C of denaturation 10min；(2) 95 DEG C of degeneration 15s, 60 DEG C of annealing 45s, totally 45 circulations,
Period continuous acquisition fluorescence signal；(3) 40 DEG C maintain 10min, and every example specimen sets three multiple holes, Qiagen EpiTect
Methylated DNA as positive control and Qiagen EpiTect unmethylated DNA as negative control, water is
Blank.
Described test kit also include detect reference gene ACTB methylation Methylation-specific primer to and probe,
Concrete nucleotide sequence is as follows:
Forward primer: 5'-TGGTGATGGAGGAGGTTTAGTAAGT-3'；
Downstream primer: 5'-AACCAATAAAACCTACTCCTCCCTTAA-3'；
Fluorescent quantitation probe:
5'-6-FAM-ACCACCACCCAACACACAATAACAAACACA-BHQ1-3' 。
The purposes of the test kit of the above-mentioned NDRG4 gene methylation detection for early gastric caacer diagnosis and prognosis evaluation, can
For preparing early gastric caacer diagnosis and the reagent of prognosis evaluation or test kit.
Compared with prior art, it is an advantage of the current invention that: the present invention is for early gastric caacer diagnosis and prognosis evaluation
The test kit of NDRG4 gene methylation detection, for early diagnosis and the prognosis evaluation of gastric cancer, design obtains one group and is positioned at tune
The primer of the NDRG4 gene promoter zone methylation in control functional transcription region and probe, amplification region is positioned at genetic transcription and initiates
Upstream-the 377bp in site to-260bp, and successfully set up into test kit, for the inspection of NDRG4 gene promoter zone methylation
Survey, there is higher sensitivity and specificity, it is possible to auxiliary diagnosis early gastric cancer, and there is the prediction postoperative overall life of patients with gastric cancer
Depositing the application prospect of situation, concrete advantage is as follows:
1) present invention combines biometric database and finds NDRG4 gene and have the particular sequence of regulation and control downstream transcription function, and passes through
The Dual-Luciferase experimental verification biological function of this sequence, is favorably improved the detection of NDRG4 gene promoter zone methylation
Sensitivity and specificity；
2) by detecting same gastric cancer DNA sample content, this test kit is than prior art (application number: 201610048731.2)
There is higher sensitivity, specificity and accuracy；
3) this test kit is except auxiliary early gastric caacer diagnosis, it is also possible to the overall survival situation that prediction patients with gastric cancer is postoperative, clinical
The NDRG4 promoter zone methylation level that doctor can carry according to patient, adjusts the therapeutic scheme of patient, in time to carrying height
Methylated NDRG4 gene patient, doctor should give closer clinical follow, thus instruct the personalization of clinical patients with gastric cancer
Treatment；
In sum, the present invention can for the test kit of the NDRG4 gene methylation detection of early gastric caacer diagnosis and prognosis evaluation
Solve that DNA content is few, Loss Rate is high in sample, with defects such as carcinogenic contaminants, relatively conventional gastric cancer detection technique has to be sent out
Early now, highly sensitive, the cycle is short, simple to operation, and detection efficiency is high, and with strong points, specificity is good, and testing result accurately may be used
Lean on, the quickest and the advantage of economy, beneficially gastric cancer early discovery is treated with timely.
Accompanying drawing explanation
Fig. 1 is that NDRG4 gene promoter area is detected sequence region (particular location is Chr 16:58,497,172-
58,497,289)；
Fig. 2 is NDRG4 gene amplification fragment luciferase reporter gene Activity determination；
For the purpose of Fig. 3, the amplification of gene NDRG4 gene and reference gene ACTB gene by fluorescence quantitative methylation status of PTEN promoter is bent
Line；
Fig. 4 is the comparison at cancerous tissue Yu cancer beside organism of the NDRG4 gene promoter zone methylation level；
Fig. 5 is the NDRG4 gene promoter zone methylation method of the present invention ROC curve when diagnosis of gastric cancer；
Fig. 6 is the existing NDRG4 gene promoter zone methylation method ROC curve when diagnosis of gastric cancer；
Fig. 7 be NDRG4 gene promoter zone methylation level stomach cancer cell (MKN-74, SGC-7901, AGS, BGC-823,
HGC-27, MKN-45, MGC-803) and the comparison of people's Gastric Mucosal Cells (GES-1)；
Fig. 8 is patients with gastric cancer NDRG4 gene hyper-methylation with hypomethylated Kapla-Meier survival curve (over time
Increasing, this curve is the most on a declining curve, and what decrease speed was slow show as on figure, and the gradient is little, curve is mild, it is meant that relatively
High survival rate)；
Fig. 9 is to be grouped with the height of NDRG4 gene methylation level for covariant in Cox risk ratio regression model, adjusts simultaneously
In whole single factor analysis, (P < 0.05 including patient age, tumor size, differentiation, lymph node is the most important covariant
No transfer, TNM by stages and palindromia) the survival curve figure that does, thus illustrate that NDRG4 gene methylation level can be as gastric cancer
The independentpredictor of overall patient's prognosis.
Detailed description of the invention
Below in conjunction with accompanying drawing embodiment, the present invention is described in further detail.
1, object of study and the collection of sample
Collect Hangzhou, Zhejiang province city hospital in December, 2007 to the stomach organization of in February, 2010 general surgery excision and phase
Each 110 examples of Carcinoma side normal tissue that should match, wherein cancerous tissue takes from the center of tumor tissues, cancer beside organism's distance cancer group
Knit more than 5cm and for non-cancer tissue, the most non-row radiation and chemotherapy confirming through histopathologic examination before all ODP in operation.Suffer from
21 ~ 83 years old person's age, wherein male 76 example, women 34 example；There are smoking history 30 example, non-smoking history 80 example；There are history of drinking history 28 example, nothing
History of drinking history 82 example；Tumor size:>=6cm 43 example,<6cm 67 example.According to american cancer joint committee (AJCC) gastric cancer TNM
By stages: I and II phase 17 example, the phase III and IV phase 93；Without lymphatic metastasis 16 example, there is lymphatic metastasis 94 example；Histo-differentiation journey
Degree: differentiated or middle differentiation 47 example, low differentiation or without breaking up 63 examples.Transport in liquid nitrogen container immediately, then after institute's label taking is the most in vitro
It is present in-80 DEG C of refrigerators.
Inclusive criteria: the patients with gastric cancer 1. just controlled；2. Gastric Diseases by Spraying is all through proved by pathology；3. stomach focus requires as primary
Focus, rather than metastatic lesion；The most preoperative non-row chemicotherapy；5. without other malignant tumor medical histories.
Exclusion standard: 1. cannot obtain the Gastric Diseases by Spraying of proved by pathology；2. there are serious unsteered internal disease or urgency
Property the infected；3. gestation or women breast-feeding their children.
Presetting the longest follow up time 5 years, dead as endpoints with patients with gastric cancer, life span was counted from art day.
All enter group objects all inform and sign Informed Consent Form.
2, cell is cultivated
DMEM culture medium culturing stomach cancer cell line (MKN-74, SGC-7901, AGS, BGC-823, HGC-containing 10% hyclone
27, MKN-45, MGC-803) and people's Gastric Mucosal Cells (GES-1), in 37 DEG C, 5% CO2In saturated humidity constant-temperature incubation case.
3, tissue samples and the extraction of cell strain complete genome DNA
Use QIAamp DNA Mini Kit(Qiagen, Hilden, Germany) DNA extraction kit extraction tissue full genome
Group DNA, then detected by NanoDrop2000 ultramicrospectrophotometer (Thermo Fisher Scientific, the U.S.)
The concentration of gained DNA, for the detection of NDRG4 gene promoter zone methylation level.
4, methylate modification
Use EZ DNA Methylation GoldTMKit methylates conversion reagent box (Zymo research, the U.S.), sternly
According to test kit, lattice illustrate that step operates.Through this walk after, in DNA sequence unmethylated cytosine (C) be changed into urine phonetic
Pyridine (U).
5, TCGA data base 450K methylates and the correlation analysis of mRNA sequencing data
Download 372 patients with gastric cancer cancerous tissue Illumina Human Methylation 450K in TCGA data base to methylate
Chip data and IlluminaHiSeq_RNA-SeqV2 gene expression data.Extract all CpG position, NDRG4 gene promoter area
Point methylate data and gene expression data does correlation analysis, it is seen that with the CpG position of gene expression high negative correlation in table 1
Put and be positioned at upstream 5 ' end chr16:58,497,231-chr16:58,497,240, point out the regulation and control downstream that this region is potential to turn
The particular sequence of recording function.Therefore, inventor for this region design Methylation-specific primer to and probe, use fluorescent quantitation
Methylation status of PTEN promoter carries out methylation level detection.Detected full-length genome position, sequence place is as shown in Figure 1.
Table 1 Illumina 450K methylates NDRG4 gene promoter zone methylation site and gene expression in chip
Dependency
| Sequence number | Methylation sites | Genomic locations | Correlation coefficient | P value |
| 1 | cg04190807 | chr16:58,497,231 | -0.407 | 2.79E-17 |
| 2 | cg00687686 | chr16:58,497,237 | -0.399 | 2.65E-16 |
| 3 | cg04942472 | chr16:58,497,240 | -0.378 | 1.72E-16 |
| 4 | cg01466678 | chr16:58,497,395 | -0.341 | 6.56E-13 |
| 5 | cg11306587 | chr16:58,497,714 | -0.384 | 2.10E-14 |
| 6 | cg13031432 | chr16:58,497,767 | -0.395 | 2.81E-16 |
| 7 | cg00984694 | chr16:58,498,152 | -0.405 | 8.31E-18 |
| 8 | cg04797985 | chr16:58,498,190 | -0.365 | 1.24E-13 |
| 9 | cg05469759 | chr16:58,498,456 | -0.335 | 2.51E-12 |
| 10 | cg08384171 | chr16:58,498,535 | -0.371 | 2.51E-12 |
| 11 | cg00262031 | chr16:58,498,575 | -0.359 | 1.35E-15 |
| 12 | cg06650115 | chr16:58,498,586 | -0.385 | 1.23E-15 |
It is said that in general, gene promoter is positioned at the region of 2000 bases in upstream of gene transcription start site.?
In the patent of application (application number: 201610048731.2), the methylated amplification sequence of NDRG4 gene is positioned at genetic transcription and initiates
Upstream-the 154bp in site to-83bp, its methylation level compared with normal colon in intestinal cancer tissue is significantly raised.According to table
1 it can be seen that in gastric cancer the dependency of the methylation level of NDRG4 gene promoter area different loci and gene expression is not the most
With, and the methylation level held the closer to gene order upstream 5 ' to the ability of regulation and control of gene expression, the strongest (i.e. correlation coefficient is exhausted
The biggest to value), it follows that the phase of the methylation level of NDRG4 gene promoter area different loci and gene expression in intestinal cancer
Closing property also differs.Therefore, find and there is the particular sequence of controlling gene expressional function be favorably improved NDRG4 gene methylation
The sensitivity of detection and specificity.On the other hand, although gastric cancer and colorectal cancer belong to malignant tumor of digestive tract, but it is being sent out
The aspects such as pathogenesis system, prognosis of disease, therapeutic strategy all differ, similarly, and the biology that NDRG4 gene methylation plays wherein
Effect is the most different.
6, luciferase reporter gene Activity determination
Containing the two kinds of luciferase genes can expressed in same cell simultaneously in luciferase reporter gene carrier, one
Being LUC Photinus pyralis LUC Photinus pyralis FL reporter gene, another is Renilla luciferase reporter gene.LUC Photinus pyralis LUC Photinus pyralis FL reporter gene
For flagship report gene, promoter region purpose fragment is cloned on carrier.If purpose fragment has Binding site for transcription factor,
Then making LUC Photinus pyralis LUC Photinus pyralis FL transcribe, activate LUC Photinus pyralis LUC Photinus pyralis FL protein translation, Lampyridea fluorescent value rises, and as standard
The expression of the renilla luciferase changing internal reference is unaffected, now LUC Photinus pyralis LUC Photinus pyralis FL activity/renilla luciferase activity
Value rises, so that it is determined that whether purpose fragment has gene expression regulation effect.
During detection uciferase activity, operation room temperature is set as 22 DEG C, lucifuge.Dual-luciferase reporter system is examined
Survey step is as follows:
1. cell lysis: discard old cell culture fluid, every hole adds 100 μ l reporter gene cell pyrolysis liquids, abundant cell lysis.
2. after cell completes cracking, every porocyte is transferred to EP centrifuge tube, centrifugal mix homogeneously.
The most slowly melt LUC Photinus pyralis LUC Photinus pyralis FL detectable and renilla luciferase detection buffer to room temperature, sea pansy is glimmering
It is standby that light element enzyme detection substrate (100 ×) is placed in ice bath.
4. according to 1:100 ratio, renilla luciferase detection substrate (100 is added to renilla luciferase detection buffer
×), it is configured to renilla luciferase detection working solution.
5. opening GLO-MAX 20/20 fluorescence detector, arrange detection parameter, the assay intervals time is 2s, detects the time
For 10s.
6., during detection LUC Photinus pyralis LUC Photinus pyralis FL activity value F (Firely Lueiferase), each cell sample adds 100 μ
L LUC Photinus pyralis LUC Photinus pyralis FL detectable, is immediately placed in GLO-MAX 20/20 fluorescence detector by EP centrifuge tube after mixing, calculate F
Value.
7. add 100 μ l renilla luciferase detection working solutions, after mixing, be immediately placed in GLO-MAX 20/20 fluoroscopic examination
Instrument, calculates renilla luciferase activity value R (Renilla Luciferase).
8., after completing all samples mensuration, relative luciferase activity is the ratio of F and R.
By arranging positive control and blank, find the relative luciferase activity ratio of NDRG4 gene amplification fragment
It is worth higher than empty plasmid (P < 0.01), illustrates that this fragment has promoter activity, scalable gene expression (Fig. 2).
7, fluorescent quantitation methylation status of PTEN promoter
Consisting of of the quantitative fluorescent PCR reaction system of 20 μ l: 2 × HotTaq Mater Mix 10.0 μ l；Upstream and downstream are drawn
Thing each 1.0 μ l(5 μM)；Probe 1.0 μ l(2 μM)；H2O 5.0 μ l, sample form 2.0 μ l.Fluorescent quantitation methylates spy
Opposite sex PCR reaction condition is as follows: (1) 95 DEG C of denaturation 10min；(2) 95 DEG C of degeneration 15s, 60 DEG C of renaturation 45s, totally 45 are followed
Ring, period continuous acquisition fluorescence signal；(3) 40 DEG C maintain 10min.Every example specimen sets three multiple holes, Qiagen EpiTect
Methylated DNA as positive control and Qiagen EpiTect unmethylated DNA as negative control, water is
Blank.
Primer and probe sequence that the detection of NDRG4 gene promoter zone methylation uses are as follows:
Forward primer: 5'-TGGGATGGGGATGTTTTTGT-3'；
Downstream primer: 5'-CCTCCAAACCCCCTATAACC-3'；
Fluorescent quantitation probe: 5'-6-FAM-AAAACGACGCTACCGTAATCTTTA-BHQ1-3'；
Primer and probe sequence that reference gene ACTB DNA methylation assay uses are as follows:
Forward primer: 5'-TGGTGATGGAGGAGGTTTAGTAAGT-3'；
Downstream primer: 5'-AACCAATAAAACCTACTCCTCCCTTAA-3'；
Fluorescent quantitation probe: 5'-6-FAM-ACCACCACCCAACACACAATAACAAACACA-BHQ1-3'.
8, the data that methylate calculate
By the result of Roche LightCycler 480 quantitative real time PCR Instrument detection, Roche LightCycler 480 is glimmering
The calculating process of Fluorescent Quantitative PCR instrument is, first passes through ACTB reference gene and genes of interest is carried out relative quantification, use
Laboratory sample value is made normalized by the relative quantification of positive control dna further, obtains methylating hundred by following conversion
Proportion by subtraction parameter (PMR):
PMR = (GENEsample/REFsample)/(GENEpositive/REFpositive) × 100%
Wherein, gene for the purpose of GENE, REF is reference gene, and sample is experiment sample, and positive is methylation positive pair
According to DNA.It is corresponding A CTB gene and the amplification of NDRG4 gene promoter area fluorescent quantitation methylation status of PTEN promoter shown in Fig. 3
Curve.Fluorescent quantitation methylation status of PTEN promoter is by each circulation products fluorescence in methylation status of PTEN promoter amplified reaction
Detecting in real time thus the realization quantitative analysis to starting template of signal.In real-time fluorescence quantitative PCR reacts, introduce a kind of glimmering
Photochemistry material, along with PCR product constantly adds up, fluorescence signal intensity also equal proportion increases.Often through a circulation, receive
Collect a fluorescence intensity signals, such that it is able to by the change of fluorescence intensity change monitoring product amount, obtain an amplified fluorescence
Curve.The period (Ct value) that the abscissa of Fig. 3 is experienced when reaching, by the fluorescence signal in each reaction tube, the threshold value set,
Vertical coordinate is fluorescent value.Ct value is the least, shows that the concentration of target sequence is the highest, and the PMR value representing methylation level can be direct
LightCycler480 software draws.
9, interpretation of result
This experiment uses SPSS 18.0 that data are carried out finishing analysis.Inventor is to NDRG4 gene promoter zone methylation water
Put down and carry out paired t-test, find: in cancerous tissue, NDRG4 gene methylation level is higher than cancer beside organism, and difference has statistics to anticipate
Justice (P value is less than 0.001, sees Fig. 4).In order to reflect the accuracy size of NDRG4 gene methylation diagnosis of gastric cancer risk quantitatively,
Inventor analyzes its Receiver operating curve (ROC curve) further.Fig. 5 shows, NDRG4 gene methylation Diagnosis of Gastric
Under the ROC curve of cancer risk, area (AUC) is 0.730, difference statistically significant (P < 0.001) compared with 0.5, prompting
Methylating of NDRG4 this promoter region sequence of gene is higher for the accuracy of early gastric caacer diagnosis.Typically can will just make a definite diagnosis
The maximum separation of severed finger number be defined as in excellent diagnostics separation, i.e. Fig. 5 near the upper left point of coordinate diagram be sensitivity
The marginal value the highest with specificity, the vertical coordinate that this point is corresponding is sensitivity, and abscissa is (1-specificity).Therefore, fluorescence
Quantitatively methylation status of PTEN promoter detection NDRG4 gene methylation is 65.5% for the sensitivity of diagnosis of gastric cancer, and specificity is
77.3%.Fig. 6 is for using the NDRG4 gene methylation method Diagnosis of Gastric in prior art (application number: 201610048731.2)
The ROC curve of cancer risk, its area under curve is 0.654, and sensitivity is 62.2%, and specificity is 67.3%, and its accuracy is sensitive
Degree and specificity are below the present invention.
Report according to most literature, PMR value 4%, represent hyper-methylation；PMR value < 4%, represent hypomethylation, therefore invent
Methylation level, with cancerous tissue PMR value 4% as marginal value, is divided into hyper-methylation and hypomethylation by people, finds: NDRG4 gene opens
The danger that the crowd of mover district hyper-methylation gets a cancer of the stomach be hypomethylated 4.609 times of NDRG4 gene promoter area (P=
6.32E-6, is shown in Table 2).
The comparison between cancerous tissue and cancer beside organism of the table 2 NDRG4 gene promoter zone methylation level
Note: P value is less than 0.05, has statistical significance.
Additionally, this test kit have also been made further checking at cellular level.Inventor is NDRG4 at cell-based assay
Gene promoter zone methylation level, finds: stomach cancer cell line (MKN-74, SGC-7901, AGS, the BGC-of different differentiation degrees
823, HGC-27, MKN-45, MGC-803) NDRG4 gene promoter zone methylation water average specific people Gastric Mucosal Cells (GES-
1) height (all P values are less than 0.05, see Fig. 7).The methylation differential that finds organizationally of this result verification.
By analyzing the relation of NDRG4 gene promoter zone methylation level and gastric cancer prognosis, inventor is to 110 cancers
Tissue samples carries out Kapla-Meier survival analysis, and result shows, the patients with gastric cancer of NDRG4 promoter region hyper-methylation is postoperative
Overall survival substantially shortens (P=0.002 is shown in Table 3, Fig. 8).It addition, by variable (P the most important in single factor analysis
< 0.05) include in multiplicity, it is seen that and NDRG4 gene promoter zone methylation level can be as patients with gastric cancer prognosis evaluation
Independent factor, and difference have statistical significance (Hazard ratio is 1.887,95%CI=1.107-3.218, P=0.020,
It is shown in Table 3, Fig. 9).
Table 3 NDRG4 gene promoter zone methylation level and the relation of gastric cancer overall survival phase
Note: P value is less than 0.05, has statistical significance.NA represents that these data cannot calculate.
Present invention have an advantage that 1, the present invention combines biometric database and finds NDRG4 gene and have regulation and control downstream transcription
The particular sequence of function, and the biological function of this sequence is demonstrated by luciferase reporter gene Activity determination, help
In the sensitivity and the specificity that improve the detection of NDRG4 gene methylation.2, by this test kit and prior art (application number:
201610048731.2) comparing, by detecting the gastric cancer DNA sample content of equivalent, this test kit has higher sensitivity, faces
Contribute on bed reducing the probability that patient fails to pinpoint a disease in diagnosis, be suitable for early screening.3, this test kit is except auxiliary early gastric caacer diagnosis, also may be used
With the overall survival situation that prediction patients with gastric cancer is postoperative, reach the personalized treatment of clinical patients with gastric cancer.Additionally, this test kit profit
By NDRG4 gene methylation degree in fluorescent quantitation specific PCR methodology detection patients with gastric cancer tissue samples, there is following notable spy
Point: 1, easy and simple to handle, the cycle is short.This test kit can measure 190 samples simultaneously, is greatly shortened the detection time, be suitable for hospital or
Institute large-scale promotion application.2, stability.This test kit can preserve 12 months at a temperature of-20 DEG C, its sensitivity and spy
Different degree does not the most decline.Plan of the present invention uses analyzes the postoperative cancerous tissue of patients with gastric cancer and the NDRG4 gene in cancer beside organism DNA
Methylation, in conjunction with modern biology information technology and Principle of Statistics, it is provided that easy and simple to handle, highly sensitive, the cycle is short, inspection
Surveying the methylated quantitative detection method that result is reliable and stable, follow up and prognosis evaluation for patient provide science to depend on simultaneously
According to.
In the present invention, described DNA sample can derive from any biological sample；It is highly preferred that described DNA to be measured is selected from
Tissue (including paraffin-embedded tissue), cell, blood, serum, blood plasma, saliva, seminal fluid, urine, feces and other secretions.
Described above not limitation of the present invention, the present invention is also not limited to the example above.The art common
Technical staff, in the essential scope of the present invention, the change made, retrofits, adds or replaces, and also should belong to the protection of the present invention
Scope, protection scope of the present invention is as the criterion with claims.
Claims (4)
1. the test kit for the NDRG4 gene methylation detection of early gastric caacer diagnosis and prognosis evaluation, it is characterised in that:
Including a pair NDRG4 gene promoter zone methylation specificity amplification primer and fluorescent quantitation probe, concrete nucleotide sequence is such as
Under:
Forward primer: 5'-TGGGATGGGGATGTTTTTGT-3'；
Downstream primer: 5'-CCTCCAAACCCCCTATAACC-3'；
Fluorescent quantitation probe: 5'-6-FAM-AAAACGACGCTACCGTAATCTTTA-BHQ1-3'.
The examination of the NDRG4 gene methylation detection for early gastric caacer diagnosis and prognosis evaluation the most according to claim 1
Agent box, it is characterised in that include fluorescent quantitation methylation status of PTEN promoter reaction system, consisting of: the fluorescent quantitation of 20 μ l
Consisting of of methylation status of PTEN promoter reaction system: 2 × HotTaq Mater Mix 10.0 ul；The upstream and downstream primer of 5 μMs
Each 1.0 μ l；The probe 1.0 μ l of 2 μMs；H2O 5.0 μ l, DNA sample template 2.0 μ l；Fluorescent quantitation methylation-specific
PCR reaction condition is as follows: (1) 95 DEG C of denaturation 10min；(2) 95 DEG C of degeneration 15s, 60 DEG C of annealing 45s, totally 45 circulations, phases
Between continuous acquisition fluorescence signal；(3) 40 DEG C maintain 10min, and every example specimen sets three multiple holes, Qiagen EpiTect
Methylated DNA as positive control and Qiagen EpiTect unmethylated DNA as negative control, water is
Blank.
The examination of the NDRG4 gene methylation detection for early gastric caacer diagnosis and prognosis evaluation the most according to claim 1
Agent box, it is characterised in that described test kit also includes the Methylation-specific primer pair detecting reference gene ACTB methylation
And probe, concrete nucleotide sequence is as follows:
Forward primer: 5'-TGGTGATGGAGGAGGTTTAGTAAGT-3'；
Downstream primer: 5'-AACCAATAAAACCTACTCCTCCCTTAA-3'；
Fluorescent quantitation probe:
5'-6-FAM-ACCACCACCCAACACACAATAACAAACACA-BHQ1-3' 。
4. according to the NDRG4 gene methylation detection for early gastric caacer diagnosis and prognosis evaluation described in claim 1-3
The purposes of test kit, it is characterised in that: can be used for preparing early gastric caacer diagnosis and the reagent of prognosis evaluation or test kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610510535.2A CN106119361B (en) | 2016-06-28 | 2016-06-28 | Kit for NDRG4 gene methylation detection for early diagnosis and prognosis evaluation of gastric cancer and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610510535.2A CN106119361B (en) | 2016-06-28 | 2016-06-28 | Kit for NDRG4 gene methylation detection for early diagnosis and prognosis evaluation of gastric cancer and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106119361A true CN106119361A (en) | 2016-11-16 |
| CN106119361B CN106119361B (en) | 2020-01-07 |
Family
ID=57468765
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610510535.2A Active CN106119361B (en) | 2016-06-28 | 2016-06-28 | Kit for NDRG4 gene methylation detection for early diagnosis and prognosis evaluation of gastric cancer and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106119361B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106893777A (en) * | 2017-03-02 | 2017-06-27 | 武汉艾米森生命科技有限公司 | For detecting many site methylating reagent boxes of colorectal cancer related gene and application |
| CN111549129A (en) * | 2020-03-30 | 2020-08-18 | 宁波美康盛德医学检验所有限公司 | Kit for detecting gastric cancer and application thereof |
| CN115466793A (en) * | 2022-09-26 | 2022-12-13 | 山东大学 | Application of detection reagent of ACOT9 gene in preparation of gastric cancer detection kit and gastric cancer detection kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101680025A (en) * | 2007-01-09 | 2010-03-24 | 癌甲基化组科学公司 | Epigenetic change in selected genes and cancer |
| CN105543378A (en) * | 2016-01-23 | 2016-05-04 | 广州市康立明生物科技有限责任公司 | NDRG4 gene methylation detection primers, probe and kit for early diagnosis of intestinal cancer |
-
2016
- 2016-06-28 CN CN201610510535.2A patent/CN106119361B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101680025A (en) * | 2007-01-09 | 2010-03-24 | 癌甲基化组科学公司 | Epigenetic change in selected genes and cancer |
| CN105543378A (en) * | 2016-01-23 | 2016-05-04 | 广州市康立明生物科技有限责任公司 | NDRG4 gene methylation detection primers, probe and kit for early diagnosis of intestinal cancer |
Non-Patent Citations (3)
| Title |
|---|
| HONGNA LU等: ""DNA methylation analysis of SFRP2, GATA4/5, NDRG4 and VIM for the detection of colorectal cancer in fecal DNA"", 《ONCOLOGY LETTERS》 * |
| WENHUA XIAO等: ""Quantitative detection of methylated NDRG4 gene as a candidate biomarker for diagnosis of colorectal cancer"", 《ONCOLOGY LETTERS》 * |
| 赵慧霞等: ""NDRG4基因甲基化检测在结直肠癌早期诊断中的应用研究"", 《中国医药导报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106893777A (en) * | 2017-03-02 | 2017-06-27 | 武汉艾米森生命科技有限公司 | For detecting many site methylating reagent boxes of colorectal cancer related gene and application |
| CN111549129A (en) * | 2020-03-30 | 2020-08-18 | 宁波美康盛德医学检验所有限公司 | Kit for detecting gastric cancer and application thereof |
| CN111549129B (en) * | 2020-03-30 | 2023-08-29 | 宁波美康盛德医学检验所有限公司 | Kit for detecting gastric cancer and application thereof |
| CN115466793A (en) * | 2022-09-26 | 2022-12-13 | 山东大学 | Application of detection reagent of ACOT9 gene in preparation of gastric cancer detection kit and gastric cancer detection kit |
| CN115466793B (en) * | 2022-09-26 | 2023-09-01 | 山东大学 | Application of ACOT9 gene detection reagent in preparation of gastric cancer detection kit and gastric cancer detection kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106119361B (en) | 2020-01-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ozawa et al. | A microRNA signature associated with metastasis of T1 colorectal cancers to lymph nodes | |
| Springer et al. | A combination of molecular markers and clinical features improve the classification of pancreatic cysts | |
| CN106459961B (en) | Pancreatic cancer detection kit or device and detection method | |
| Li et al. | High expression of long noncoding RNA MALAT1 indicates a poor prognosis and promotes clinical progression and metastasis in bladder cancer | |
| Shi et al. | Serum miR-626 and miR-5100 are promising prognosis predictors for oral squamous cell carcinoma | |
| Salazar et al. | Gene expression signature to improve prognosis prediction of stage II and III colorectal cancer | |
| Arantes et al. | Validation of methylation markers for diagnosis of oral cavity cancer | |
| JP2015128442A (en) | Plasma micrornas for detecting early colorectal cancer | |
| BRPI0709397A2 (en) | primary cell propagation | |
| CN104745575A (en) | Gene composition used for detecting cell proliferative abnormality or grading disease degree and application thereof | |
| Liu et al. | rs11614913 polymorphism in miRNA-196a2 and cancer risk: an updated meta-analysis | |
| JP2018504906A (en) | Use of the methylated site of the Y chromosome as a diagnostic marker for prostate cancer | |
| JP2009106191A (en) | Gene associated with liver cancer, and method for determination of risk of acquiring liver cancer | |
| Barbosa et al. | Potential clinical applications of circulating cell-free DNA in ovarian cancer patients | |
| CN106119361A (en) | The test kit detected for the NDRG4 gene methylation of early gastric caacer diagnosis and prognosis evaluation and application thereof | |
| JP2022523366A (en) | Biomarker panel for cancer diagnosis and prognosis | |
| CN106676183A (en) | ZFHX4 as biomarker for prognosis of esophagus cancer | |
| CN107574248A (en) | A kind of the non-small cell lung cancer auxiliary diagnosis based on GALNT2 genes, prognostic evaluation kit and its application method | |
| Byun et al. | Expression of hsv1-miR-H18 and hsv2-miR-H9 as a field defect marker for detecting prostate cancer | |
| KR101803108B1 (en) | Method for the urinary detection of bladder cancer | |
| WO2023105296A2 (en) | Urine mirna marker for prostate cancer diagnosis, diagnostic reagent and kit | |
| CN105779635B (en) | A kind of kit being used for colorectal cancer Index for diagnosis based on OLFM1 gene | |
| Antoniewicz et al. | Lack of evidence for increased level of circulating urothelial cells in the peripheral blood after transurethral resection of bladder tumors | |
| Zhao et al. | Off the fog to find the optimal choice: Research advances in biomarkers for early diagnosis and recurrence monitoring of bladder cancer | |
| CN107475430A (en) | A kind of the glioblastoma auxiliary diagnosis based on IFI30 genes, prognostic evaluation kit and its application method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |