CN105400865B - The DNA methylation detection of the gene promoter areas TMEM176A - Google Patents
The DNA methylation detection of the gene promoter areas TMEM176A Download PDFInfo
- Publication number
- CN105400865B CN105400865B CN201510390230.8A CN201510390230A CN105400865B CN 105400865 B CN105400865 B CN 105400865B CN 201510390230 A CN201510390230 A CN 201510390230A CN 105400865 B CN105400865 B CN 105400865B
- Authority
- CN
- China
- Prior art keywords
- tmem176a
- primer
- gene promoter
- cancer
- pair
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Abstract
Inventor selects TMEM176A genes as target gene for the first time, proves that promoter region is in hyper-methylation state in the cancer of the esophagus, colon cancer cell, is had initiative by MSP technologies.The present invention is provided to detect the primer and kit of cell TMEM176A gene promoter zone methylation states, primer is a pair of of methylated primers or is a pair of of methylated primers and a pair of non-methylated primers.The specificity that the cancer of the esophagus is detected using primer of the present invention and kit is good, wherein be 61.2% in the cancer of the esophagus, colorectal cancer 53.13%；High sensitivity reaches 0.5%, is i.e. has 5 cancer cells that can be detected in 1000 cells.The powerful measure that the gene promoter areas TMEM176A hyper-methylation state can be used as digestive system carcinoma diagnosis, observation of curative effect, Index for diagnosis, minimal residual disease detection etc. is detected using kit of the present invention, and, it is easy to operate, stability is good, have far-reaching clinical meaning and generalization.
Description
Technical field
The present invention relates to DNA methylation assay technologies, relate in particular to the gene promoter areas TMEM176A DNA methylation
Detection, especially a kind of methylated primers pair for detecting TMEM176A gene promoter zone methylation states further wrap
Include non-methylated primers pair.Meanwhile the invention further relates to the kits containing the primer pair.
Background technology
The cancer of the esophagus is one of highest malignant tumour of lethality in worldwide, and position is ranked eighth in kinds of tumor,
It ranked fourth position in tumor in digestive tract.Although as making constant progress for Clinical Oncology, the cancer of the esophagus is still that cancer is mutually shut
Die one of most important reason of rate.The cancer of the esophagus includes mainly two kinds of esophageal squamous cell carcinoma and adenocarcinoma of esophagus, and incidence has very
Mainly there are African south and east, Central Asia and east in big regional disparity, area occurred frequently, from Iranian the north to Central Asia republicanism
State extends to NORTH CHINA and middle part is referred to as " cancer of the esophagus band ", men and women's morbidity indifference.According to statistics, just have within only 2012
456000 new hair patient with esophageal carcinoma, there is 400000 patient with esophageal carcinoma death.China is the hotspot of the cancer of the esophagus, morbidity
Rate and the death rate are respectively 22.4/100000 and 16.77/100000, and 90% is esophageal squamous cell carcinoma, mainly with smoking, drink
Wine, nutrition condition be poor, vegetables and fruit intake are few and it is related to feed boiling hot food.Adenocarcinoma of esophagus is mainly in west prosperity
It is national more typically, mainly less and helicobacter pylori with gastroesophageal reflux disease, Barrett esophagus, smoking, obesity, fruits and vegetables intake
It is related to infect history.The whole prognosis of the cancer of the esophagus is poor, and survival rate is no more than 20% within 5 years.The early stage cancer of the esophagus is usually asymptomatic,
But continuously improving with endoscopic diagnosis technology so that the gastroscope recall rate of the early stage cancer of the esophagus improves.During dysphagia is
The most common symptom of late esophagus cancer, can be with weight loss.Although gastrocopy can more intuitively observe mucous membrane of esophagus disease
Become, but finally makes a definite diagnosis the pathological diagnosis for being also to rely on the pathological biopsy and Operated Specimens of gastric tissue under gastroscope.The cancer of the esophagus is current
Treatment mainly include simple surgical operation, surgical operation combined chemotherapy, radiotherapy or chemicotherapy, survival rate is followed successively by within 5 years
16%-52%, 23%-36%, 18.6%-41.3%, 39%；For the unresectable cancer of the esophagus, based on simple chemicotherapy,
But to maintaining remission rate, the effect of improvement long-term survival rate very limited, therefore, the prognosis mala of the cancer of the esophagus.
Colorectal cancer is the big malignant tumour in third place in the world, is number four in world's malignant tumour associated death cause of disease.Often
Year, about 1,200,000 new cases were diagnosed as colorectal cancer, and 600,000 cases die of colorectal cancer.In male patient's kinds of tumor
In, colorectal cancer occupies third position, and second is occupied in female patient.According to American Cancer Society (American Cancer
Society, ACS) 2014 AUTHORITATIVE DATAs announced show that colorectal cancer is the total the third-largest most common cancer of American male and women
Disease and the third-largest cancer mortality reason, the incidence of colorectal cancer and the death rate are in be decreased obviously trend in the past 20 years.And China
The latest data announced shows the morbidity and mortality of male's colorectal cancer in lung cancer, gastric cancer, liver cancer and the cancer of the esophagus within 2014
Later, the 5th is ranked.It is the 3rd after the morbidity and mortality of women colorectal cancer occupy breast cancer, lung cancer.National tumour is stepped on
National registration office tumour registration material was collected at note center at 2011 and 2013, analyzed 2003-2007 and 2009 year whole nation
Tumour registers morbidity and the Death Level of covering area cancer, as a result shows that 2003~2007 years Chinese colorectal cancer incidence rates are
28.08/10 ten thousand；Mortality of carcinoma is 13.41/10 ten thousand.Chinese colorectal cancer incidence rate is 29.44/10 ten thousand within 2009；Mortality of carcinoma
It is 14.23/10 ten thousand.It can be seen that the morbidity and mortality of China's colorectal cancer rise year by year, the comprehensive of colorectal cancer should be reinforced
Close preventing and controlling, improve colorectal cancer early diagnosis early harness the river it is flat.
In view of the diagnosing and treating means for being applied to the clinical cancer of the esophagus and colorectal cancer at present, especially to the morning of tumour
The detection method of phase diagnosis, residual and recurrence is still extremely limited, is current problem in the urgent need to address.Therefore, it sends out
The effective ways of the early diagnosis and therapy of the existing cancer of the esophagus and colorectal cancer have a very important significance.
With the arrival of genome times afterwards comprehensively, before epigenetics (Epigenetics) has become the research of life science
Edge.Epigenetics refers to that heritable gene expression that researching DNA sequence does not change becomes for science of heredity
The science of change, it can explain the inexplicable problem of some classical genetics institute, such as：The brother of monozygotic twin has complete
Identical genotype, and grow up under same environment, but only wherein a people gets a cancer of the stomach, and an other human body is healthy, therefore
Epigenetic information provides the instruction when, where gone in which way using hereditary information.In digestive system carcinoma field,
Epigenetics research is mainly concentrated on DNA methylation and acetylation of histone.DNA methylation modification is genome epigenetic
Main mode in regulation and control, generation, the development of human tumor are related with the exception of DNA methylation, and the gene promoter area islands CpG are high
Expression of tumor suppressor gene silence can be led to and then lead to tumour by methylating.DNA methylation refers to the work in methylated transferase
Under, using s- adenosylmethionines as methyl donor, methyl is transferred on No. 5 carbon atoms of CG dinucleotides cytimidines, shape
At 5 methylcysteins.DNA methylation is early stage extremely in cell carcinogenesis, take place frequently event, therefore specific gene methylates
It can be used as the molecular marker, therapy target and judging prognosis means of early diagnosis of cancer.With advances in technology, methyl is detected
The means of change are also enriched, not only the distribution that methylates of certain detectable segment DNA sequence, and can also big flux understanding it is entire
The methylation of genome.Main method has two classes at present：When sodium bisulfite method (Sodium Bisulfite), including
The gene sequencing method of sodium bisulfite method dependence, sodium hydrogensulfite joint restriction endonuclease analysis (COBRA), methylate spy
Anisotropic PCR (MS-PCR), methyl-sensitive mononucleotide amplification (Ms-SNuE) etc.；Another kind of is the limit of methyl-sensitive
Property inscribe enzyme process processed includes restriction map (MSRF), the restriction labeling genome scanning of Southern methods, methyl-sensitive
Technology (RLGS), otherness methylation hybridization analysis (DMH), methylated CpG island amplicon analysis (MCA) etc..It is worth mentioning
It is MS-PCR, from after Herman in 1996 has invented technique, enormously simplifies the detection method of DNA methylation so that table
It sees genetics research more rapidly to advance, the advantage protruded is high specific, high sensitivity, easy to operate, expense
With and take less, unrestricted restriction endonuclease limitation, at present MS-PCR have become to study gene methylation state
The method being most widely used, the research particularly with large quantities of clinical samples methylation states is even more prefered method.MS-
The basic principle of PCR is：DNA does not have in the CG dinucleotides to methylate after sulphite phosphorothioate on the islands CpG
Cytimidine translate into uracil, be finally translated into thymidine, and the cytimidine to methylate then remains unchanged, therefore
Methylated primers and non-methylated primers are separately designed for above-mentioned difference, carry out PCR amplification, amplified production row gel electricity respectively
Swimming photograph observation is as a result, obtain whether be the conclusion to methylate.
Transmembrane protein 176 (transmembrane protein 176, TMEM176) is and transmembrane protein 4A families
(membrane-spanning 4A family of protein, MS4A) relevant albumen, is present in mammal and bone fish
Class, including two kinds of hypotypes of TMEM176A and 176B.Zuccolo etc. is found that a large amount of highly conserved in zebra fish
TMEM176 genes.TMEM176A is found into the cell in the renal proximal tubules of mouse earliest, is located at No. 6 chromosomes.And people
Class TMEM176A genes are located at 7q36.1, and there are four transmembrane domains, are that tumor associated antigen is screened in hepatocellular carcinoma earliest
It was found that.Gehrau etc. has found that the mRNA transcriptional levels of TMEM176A are apparent when liver-transplantation patients recur hepatitis C infection
Increase.The researchs such as Condamine find that TMEM176A and 176B is interaction, and the two is maintaining mouse naivety dendron shape thin
It plays an important role in the crudity of born of the same parents, inflammatory stimulus makes TMEM176A and 176B express downward.The discoveries such as Cuajungco
TMEM176A and 176B has apparent expression in the mankind much organize, in lymthoma and lung cancer, the albumen of TMEM176A
Horizontal expression obviously increases.Strelnikov etc. reports the DNA methylation and breast of the islands the CpG exception of the mankind TMEM176A and 176B
Gland cancer is related.In conclusion to the functional study of TMEM176A, there is also many deficiencies at present, in the apparent something lost of the cancer of the esophagus
Passing change, there is not been reported with functional study.
Invention content
The object of the present invention is to provide the primers of detection cell TMEM176A gene promoter zone methylation states, that is, are used for
The primer of TMEM176A gene promoter zone methylation states is detected, meanwhile, another object of the present invention is to provide a kind of containing
State the kit of primer.It is yet another object of the invention to provide a kind of detection TMEM176A gene promoter zone methylation states
Method is come to carry out risk assessment to the cancer of the esophagus, colorectal cancer with this.
By experiment and deliberation repeatedly, the present inventor selects a pair of of specificity methylated primers pair and non-methyl well
Change primer pair, and establish a stable reaction system, ideal reaction condition is found out, using susceptibility higher third
The detection means of acrylamide gel electrophoresis technology as a result, therefore obtain reliable experimental result, the results showed that：TMEM176A
The hyper-methylation state of gene promoter area has higher specificity in the cancer of the esophagus and colorectal cancer.Utilize the primer pair
And the high sensitivity of kit detection TMEM176A gene methylation states, solve above-mentioned recall rate is low, result is difficult to analyze,
The series of technical such as genetics exception substantially are only capable of displaying, therefore, primer of the present invention and kit can be used for
Early diagnosis, efficacy determination of the cancer of the esophagus and colorectal cancer etc..
Technical solution provided by the invention is：For detecting drawing for cell TMEM176A gene promoter zone methylation states
Object pair is methylated primers, and upstream primer nucleotide sequences are as described in Primer-MF, i.e.,：5'
GAAGAAAGACGTTTTGTGGATAGGAC 3', downstream primer nucleotide sequence is as described in Primer-MR, i.e.,：5'
CTAATATCCGCTCTACTCGACCGCG 3'.Using the methylated primers pair, carried out by template of the DNA after phosphorothioate
MS-PCR is expanded.It methylates if the gene promoter areas TMEM176A exist, the segment of 156bp sizes can be obtained；If
TMEM176A genes do not methylate normally, then do not generate amplified production.Based on this, which is known as methylating by the application
Primer.The methylated primers pair, the Tm 59.17 of sense primer, G/C content 42%, the Tm 63.86 of downstream primer, GC contains
Amount 56%.
The invention further relates to following non-methylated primers pair, upstream primer nucleotide sequences as described in Primer-UF,
I.e.：5'GGAAGAAAGATGTTTTGTGGATAGGAT 3', downstream primer nucleotide sequence is as described in Primer-UR, i.e.,：5'
CAACTAATATCCACTCTACTCAACCACA 3'.Using the non-methylated primers pair, using the DNA after phosphorothioate as template
MS-PCR amplifications are carried out, if TMEM176A genes do not methylate normally, the segment of 160bp sizes can be obtained.Based on this,
The primer pair is known as non-methylated primers by the application.The non-methylated primers pair, the Tm 57.86 of sense primer, GC contains
Amount 37%, the Tm 59.58 of downstream primer, G/C content 39%.
The present invention also provides a kind of methods of detection TMEM176A gene promoter zone methylation states, are come to oesophagus with this
Cancer, colorectal cancer early diagnosed, efficacy determination etc., is included the following steps：First, using methylated primers pair, with vulcanization
DNA after modification is that template carries out MS-PCR amplifications；Then, methylation state is judged according to amplified production.Preferred embodiment is, together
Shi Liyong methylated primers pair and non-methylated primers pair carry out MS-PCR amplifications by template of the DNA after phosphorothioate；According to
The amplified production of methylated primers and non-methylated primers, judges methylation state.It is expanded with methylated primers, there is expansion
Increase production object, and expanded with non-methylated primers, no amplified production is exhaustive methylation；With methylating and non-methylate is drawn
Object is expanded, and has amplified production, is partial methylation；It is expanded with non-methylated primers, there is amplified production, use methyl
Change primer to be expanded, no amplified production methylates for nothing.Partial methylation and exhaustive methylation are judged to methylating.
Further, the method for carrying out MS-PCR using the primer pair of the present invention, ideal reaction condition are as follows：95℃
Lower pre-degeneration 5min, subsequently enters cycle, and 30s is denaturalized at 95 DEG C, and anneal 30s at 60 DEG C, extends 40s at 72 DEG C, altogether
35 cycles, later, continuation extends 5min at 72 DEG C.
Further, the MS-PCR reaction systems that digestive system carcinoma cell is detected using the primer pair of the present invention, with totality
25ul is counted comprising：
(1) template：2ul；
(2) methylated primers pair of a concentration of 50pmol/ul or non-methylated primers pair, wherein sense primer with
Downstream primer is respectively 0.5ul；
(3) 10 × MSP buffer buffer solutions：2.5ul；
(4)20mMdNTP：1.25ul；
(5) hot start taq enzymes：0.5ul；
(6) deionized water：17.75ul；
Wherein, the template is the TMEM176A gene promoters after the cell DNA or phosphorothioate to be measured after phosphorothioate
Sub-district is the gene promoter areas TMEM176A after 100% cancer of the esophagus, colorectal cancer cell DNA or the phosphorothioate to methylate
For the 100% non-normal esophageal to methylate, Colon and rectum cell DNA.
The present invention provides a kind of kit for detecting digestive system tumor cell, which includes above-mentioned methyl
Change primer pair.Preferred embodiment is that kit of the present invention also includes above-mentioned non-methylated primers pair.
Further, kit of the invention also includes that methylation positive compares pcr template, and the template is after phosphorothioate
The gene promoter areas TMEM176A be 100% cell DNA to methylate.
Further, kit of the invention also includes that non-methylation positive compares pcr template, which is phosphorothioate
The gene promoter areas TMEM176A afterwards are the 100% non-normal tissue cell DNA to methylate.
Further, kit of the invention also includes the following ingredients needed for MS-PCR reactions：10 × MSP buffer are slow
Fliud flushing, 20mMdNTP, hot start taq enzymes, deionized water.
The method of first passage MSP of the present invention is successfully authenticated the height of TMEM176A promoter regions in digestive system tumor
It methylates.It is inferred that the promoter region hyper-methylation state of the gene may be a new digestive system tumor molecular labeling
Object, TMEM176A genes may be a new digestive system tumor correlation suppression cancer candidate gene.As it is solid it is theoretical according to
According to the present inventor is detected digestive system tumor and normal specimen using the method for MS-PCR, with its clear TMEM176A
Gene promoter zone methylation state.
The invention has the advantages that：Utilize primer of the present invention and kit detection oesophagus and Colon and rectum mucomembranous cell
Biopsy cells, in tumour cell the gene promoter areas TMEM176A be in hyper-methylation state, methyl rate is in oesophagus
It respectively may be about 61.2%, 53.13% in cancer, colorectal cancer, and in normal tissue cell, the gene promoter areas TMEM176A are in
Non- methylation state shows that the methylation state of the gene promoter area has specificity for digestive system tumor cell；Together
Shi Yingyong primers of the present invention and kit, reaction system and reaction condition can make the sensitive of detection digestive system tumor cell
Degree reaches 0.5%, i.e. has 5 cancer cells that can be detected in 1000 cells, this illustrates TMEM176A gene promoters
Zone methylation state can be used as a new molecular marker of digestive system tumor.This kit selects TMEM176A genes for the first time
As target gene, have initiative.Therefore, the gene promoter areas TMEM176A are detected using primer of the present invention and kit
Hyper-methylation state can be used as diagnosis, observation of curative effect, Index for diagnosis of the digestive system tumor such as cancer of the esophagus and colorectal cancer etc.
Powerful measure, moreover, it is easy to operate, stability is good, have far-reaching clinical meaning and promotional value.
Description of the drawings
Fig. 1 is the figure for indicating electrophoresis result；
Fig. 2 is the figure for indicating electrophoresis result；Wherein
With the normal esophageal after phosphorothioate, Colon and rectum cell DNA, the cancer of the esophagus, colorectal cancer cell after phosphorothioate
DNA, deionized water (system control) are template, carry out MS-PCR, amplification production with methylated primers and non-methylated primers respectively
Object Gel electrophoresis results difference is as depicted in figs. 1 and 2, and wherein：
EC1, EC2, EC3, EC4, EC5, EC6, EC7, EC8 represent human esophageal carcinoma sample, CRC1, CRC2, CRC3,
CRC4, CRC5, CRC6, CRC7, CRC8 represent Colorectal Carcinoma sample；EN1, EN2, EN3 and EN4 are normal esophageal tissue sample
This 4, CN1, CN2, CN3, CN4, CN5, CN6, CN7, CN8 represent 8, normal colorectal carcinoma sample；
ddH2O is that double-negative system compares, and whether there is the pollution of PCR product, such as ddH to evaluation system2O is detected
Result be double-negative (M be feminine gender with U), then system credible result；
IVD labels are methylation positive control；NL is the human peripheral lymphocytes of the U positives, is used as the moon herein
Property control；
U represents the non-result that methylates；M represents the result that methylates；Marker is DL2000marker (molecular weight standard), on
Lower two bands respectively represent 200bp and 100bp；This system amplified production size, U bands are 160bp, and M bands are 156bp.
Fig. 3 be indicate by esophageal carcinoma cell line K410DNA (gene promoter areas TMEM176A 100% methylate) with it is normal
Esophageal tissue's cell DNA (gene promoter areas TMEM176A 100% are non-to methylate) mixes in proportion, carries out phosphorothioate, this
It is expanded afterwards with methylated primers, the figure of amplified production electrophoresis result, wherein：
1st group：100% esophageal carcinoma cell line K410DNA+0% normal esophageal histocytes DNA；
2nd group：50% esophageal carcinoma cell line K410DNA+50% normal esophageal histocytes DNA；
3rd group：5% esophageal carcinoma cell line K410DNA+95% normal esophageal histocytes DNA；
4th group：1% esophageal carcinoma cell line K410DNA+99% normal esophageal histocytes DNA；
Specific implementation mode
5th group：0.5% esophageal carcinoma cell line K410DNA+99.5% normal esophageal histocytes DNA；
6th group：0% esophageal carcinoma cell line K410DNA+100% normal esophageal histocytes DNA.
To understand the present invention in more detail, the invention will be further elaborated by the following examples.
Embodiment 1
1, the preparation (extraction of genomic DNA and phosphorothioate process) of template
The preparation of DNA：Obtain the cancer of the esophagus, colorectal cancer sample and normal above-mentioned tissue specimen.Knot food in the present embodiment
Pipe cancer 8 (EC1-EC8), colorectal cancer 8 (CRC1-CRC8), 4 normal esophageals (EN1-EN4), 8 normal Colon and rectums
(CN1-CN8), genomic DNA is extracted respectively using the method that phenol-chloroform extracts, UV detector measures absorbance (A)
Value determines its content and purity.
Sulphite is modified：With reference to herman (J.G.Herman, J.R.Graff, S.Myohanen, B.D.Nelkin
and S.B.Baylin,Methylation-specific PCR:a novel PCR assay for methylation
Status of CpG islands, Proc.Natl.Acad.Sci.USA 93 (1996), 9821-9826.) side of reports such as
Method.The genomic DNA for taking above-mentioned preparation, accurately takes 2ugDNA after dilution, adds deionized water to final volume 50ul, is added fresh
The NaOH 5ul, 37 DEG C of incubation 25min of the 3M of preparation.Quinhydrones 30ul and the 3M bisulfite of the 10mM of Fresh is added later
Sodium 520ul is uniformly mixed and (NaOH of the 3M of Fresh, computational methods has been added in it：It is added in 10ml 3M sodium hydrogensulfites
The NaOH 740ul of 3M), hereafter 50 DEG C of incubation 16h apply DNA purification kits (Promega is public, takes charge of product) to purify and recycle
DNA NaOH of 5ul 3M is added into it to terminate phosphorothioate using 50ul deionized water eluted dnas, with 3 times of volumes
Absolute ethyl alcohol precipitates DNA, and the DNA after final phosphorothioate is re-dissolved in 20ul deionized waters, obtains DNA profiling, immediately
Using or -20 DEG C save backup.
2, MS-PCR is expanded
The PCR reaction systems expanded with methylated primers, in terms of total volume 25ul, including：
Template (DNA after phosphorothioate)：2ul；
Methylated primers (50pmol/ul)：
Sense primer (5'GAAGAAAGACGTTTTGTGGATAGGAC 3')：0.5ul,
Downstream primer (5'CTAATATCCGCTCTACTCGACCGCG 3')：0.5ul；
10 × MSP buffer (buffer solution) 2.5ul；
20mMdNTP：1.25ul；
Hot start taq enzymes：0.15ul；
Deionized water：18.1ul
The PCR reaction systems expanded with non-methylated primers, in terms of total volume 25ul, including：
The PCR reaction systems that are expanded with methylated primers except that：Primer is different, is non-first in the system
Base primer (50pmol/ul)：
Sense primer (5'GGAAGAAAGATGTTTTGTGGATAGGAT 3')：0.5ul,
Downstream primer (5'CAACTAATATCCACTCTACTCAACCACA 3')：0.5ul；
It is identical in remaining PCR reaction system expanded with methylated primers.
Using above-mentioned MSP reaction systems to prepared DNA profiling (8 cancer of the esophagus cancerous tissue sample EC1~EC8,8
Colorectal Carcinoma sample CRC1~CRC8,4 normal esophageal tissue samples EN1~EN4,8 normal colorectal carcinoma samples
CN1~CN8) it is expanded respectively, and with ddH2O is as negative control, amplification program：95 DEG C of pre-degeneration 5min, then into
Enter cycle, 30s is denaturalized at 95 DEG C, anneal 30s at 60 DEG C, extends 40s at 72 DEG C, totally 35 cycles, later, continues
Extend 7min at 72 DEG C.
The detection of 3.PCR reaction products
PCR product carries out 2% agarose gel electrophoresis, and ultraviolet transmission analyzer is detected and taken a picture.
4. result
As a result interpretation method is as follows：
(1) it is expanded using methylated primers (being indicated with M in figure), has amplified production, and draw using non-methylate
Object (being indicated with U in figure) is expanded, and then interpretation is exhaustive methylation result to the sample of no amplified production；
(2) methylated primers and non-methylated primers are applied to be expanded, it is part to have the sample interpretation of amplified production
Methylate result；
(3) it is expanded using non-methylated primers, has amplified production, and expanded with methylated primers, no expansion
Then interpretation is the non-result that methylates to the sample of volume increase object.
(4) the sample standard deviation interpretation of partial methylation and exhaustive methylation is the result that methylates.
As shown in Figure 1, in human esophageal carcinoma, EC2 and EC7 are non-methylate as a result, EC1, EC3, EC4, EC5, EC6, EC8
For the result that methylates；In Colorectal Carcinoma, CRC3, CRC5, CRC6, CRC7, CRC8 be it is non-methylate as a result, CRC1, CRC2,
CRC4 is the result that methylates.As shown in Fig. 2, normal esophageal tissue (EN1, EN2, EN3 and EN4), normal colorectal carcinoma (CN1,
CN2, CN3, CN4, CN5, CN6, CN7, CN8) it is the non-result that methylates.Control systems reaction is normal, credible result.
2 clinical samples of embodiment detect
Take cancer of the esophagus clinical samples 103, colorectal cancer clinical samples 96, normal esophageal tissue specimen 4, normal knot
Rectal tissue sample 8.Carry out MS-PCR amplifications, it is prepared by template, PCR amplification system and condition, amplified production detection with
Identical in implementation one, testing result is see following table：
| Classification | Number of cases | M (methylates) number of cases | U (without methylating) number of cases | Methylation positive rate |
| The cancer of the esophagus | 103 | 63 | 40 | 61.2% |
| Normal esophageal tissue | 4 | 0 | 4 | 0 |
| Colorectal cancer | 96 | 51 | 45 | 53.13% |
| Normal colorectal carcinoma | 8 | 0 | 8 | 0 |
3 susceptibility of embodiment is tested
By the DNA (gene promoter areas TMEM176A 100% methylate) of esophageal carcinoma cell line K410 and normal esophageal group
The DNA (gene promoter areas TMEM176A 100% are non-to methylate) for knitting cell is mixed in proportion, and carrying out phosphorothioate, (method is same
Embodiment one), then carry out MS-PCR.PCR product carries out 2% agarose gel electrophoresis, and ultraviolet transmission analysis-e/or determining is simultaneously taken a picture.
Grouping：1st group：100% esophageal carcinoma cell line K410DNA+0% normal esophageal histocytes DNA
2nd group：50% esophageal carcinoma cell line K410DNA+50% normal esophageal histocytes DNA
3rd group：5% esophageal carcinoma cell line K410DNA+95% normal esophageal histocytes DNA
4th group：1% esophageal carcinoma cell line K410DNA+99% normal esophageal histocytes DNA
5th group：0.5% esophageal carcinoma cell line K410DNA+99.5% normal esophageal histocytes DNA
6th group：0% esophageal carcinoma cell line K410DNA+100% normal esophageal histocytes DNA
As a result see Fig. 3：There are 5 cancer cells that can be detected in 1000 normal cells, that is, uses in the present invention
TMEM176A gene specifics primer pair and reaction system, condition detection esophageal cancer cell TMEM176A gene promoter areas
Methylation state its sensitivity can reach 0.5%, sensitivity is higher, can be used to monitor early carcinomatous change.
Embodiment 4 detects the kit forms of digestive system carcinoma cell
Detect digestive system carcinoma cell kit include following component, wherein carry out 1 MS-PCR dosage be：
1, the methylated primers of a concentration of 50pmol/ul：Sense primer nucleotides sequence is classified as Primer-MF, downstream primer
Nucleotides sequence is classified as Primer-MR, is respectively 0.5ul.
2, the non-methylated primers of a concentration of 50pmol/ul：Sense primer nucleotides sequence is classified as Primer-UF, and downstream is drawn
Object nucleotides sequence is classified as Primer-UR, is respectively 0.5ul.
3,2 parts of reaction solution, are respectively cooperating with methylated primers and non-methylated primers are on probation, and every part of reaction system includes：
(1) 10xMSP buffer (buffer solution) 2.5ul；
(2)20mM dNTP：1.25ul；
(3) Hot start taq enzymes：0.15ul；
(4)ddH2O：18.1ul.
One kit may include the dosage that above-mentioned each ingredient carries out multiple MS-PCR, such as 25 times, 50 times, it is 100 inferior,
The Specific amounts of each ingredient depending on the circumstances or the needs of the situation depending on.
To prevent the false positive and false negative of MS-PCR amplified productions, kit preferably further includes：
(1) positive control pcr template：The gene promoter areas TMEM176A after phosphorothioate are 100% food to methylate
Pipe cancerous cell line K410 system DNA, the dosage for carrying out 1 MSP are：2ul.
(2) negative control pcr template：Gene promoter areas TMEM176A after phosphorothioate are 100% non-to methylate
Normal peripheral blood lymphocyte DNA, the dosage for carrying out 1 MSP are：2ul.
(3) double-negative system control：DdH2O whether there is the pollution of PCR product to evaluation system, as ddH2O is examined
The result of survey is double-negative (M be feminine gender with U), then system credible result.
Claims (7)
1. a kind of primer pair for detecting cell TMEM176A gene promoter zone methylation states is methylated primers,
Its upstream primer nucleotide sequences is as described in Primer-MF, i.e.,：5'GAAGAAAGACGTTTTGTGGATAGGAC 3', downstream is drawn
Object nucleotide sequence is as described in Primer-MR, i.e.,：5'CTAATATCCGCTCTACTCGACCGCG 3'.
2. a kind of primer pair for detecting cell TMEM176A gene promoter zone methylation states, including methylated primers pair
With non-methylated primers pair, the methylated primers are to being used to detect cell TMEM176A gene promoters as described in claim 1
The primer pair of sub-district methylation state, the sense primer nucleotide sequence of the non-methylated primers pair as described in Primer-UF,
I.e.：5'GGAAGAAAGATGTTTTGTGGATAGGAT 3', downstream primer nucleotide sequence is as described in Primer-UR, i.e.,：5'
CAACTAATATCCACTCTACTCAACCACA 3'。
3. a kind of kit of detection cell TMEM176A gene promoter zone methylation states, it is characterised in that：Including right
It is required that the primer pair described in 1 or 2.
4. kit according to claim 3, it is characterised in that：Also include that methylation positive compares pcr template, the template
The cancer of the esophagus that methylates for the gene promoter areas TMEM176A 100% after phosphorothioate, colorectal cancer cell DNA.
5. kit according to claim 4, it is characterised in that：Also include that non-methylation positive compares pcr template, the mould
Plate is the non-normal esophageal to methylate in the gene promoter areas TMEM176A 100% after phosphorothioate, Colon and rectum cell DNA.
6. according to claim 3 to 5 any one of them kit, it is characterised in that：Also include under MS-PCR reactions are required
Row ingredient：10 × MSP buffer buffer solutions, 20mMdNTP, hotstar taq enzymes, deionized water.
7. a kind of MS-PCR reaction systems for detecting cell TMEM176A gene promoter zone methylation states, with total volume
25ul is counted comprising：
(1) template：2ul；
(2) a concentration of 50pmol/ul's is described in claim 1 for detecting cell TMEM176A gene promoter zone methylations
It is used to detect cell TMEM176A gene promoter zone methylation shapes described in the methylated primers pair and claim 2 of state
Non- methylated primers pair in the primer pair of state, wherein sense primer is respectively 0.5ul with downstream primer；
(3) 10 × MSP buffer buffer solutions：2.5ul；
(4)20mMdNTP：1.25ul；
(5) hot start taq enzymes：0.5ul；
(6) deionized water：17.75ul；
Wherein, the template is the gene promoter areas TMEM176A after the cell DNA or phosphorothioate to be measured after phosphorothioate
The gene promoter areas TMEM176A after the cancer of the esophagus, colorectal cancer cell DNA or the phosphorothioate that methylate for 100% are
The 100% non-normal esophageal to methylate, Colon and rectum cell DNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510390230.8A CN105400865B (en) | 2015-07-06 | 2015-07-06 | The DNA methylation detection of the gene promoter areas TMEM176A |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510390230.8A CN105400865B (en) | 2015-07-06 | 2015-07-06 | The DNA methylation detection of the gene promoter areas TMEM176A |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105400865A CN105400865A (en) | 2016-03-16 |
| CN105400865B true CN105400865B (en) | 2018-10-23 |
Family
ID=55466621
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510390230.8A Active CN105400865B (en) | 2015-07-06 | 2015-07-06 | The DNA methylation detection of the gene promoter areas TMEM176A |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105400865B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106676168B (en) * | 2016-11-08 | 2021-03-23 | 北京交通大学 | ATP4B gene body DNA-based apparent modification detection primer pair and kit |
| CN107245519A (en) * | 2017-06-06 | 2017-10-13 | 俞晓敏 | A kind of PWS and AS quick determination method |
| CN112646881A (en) * | 2019-10-11 | 2021-04-13 | 中国人民解放军总医院 | Primer probe, PCR method and kit for detecting methylation state of CCL28 gene promoter region of cell |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009105533A2 (en) * | 2008-02-19 | 2009-08-27 | The Johns Hopkins University | Methods for predicting esophageal adenocarcinoma (eac) |
| WO2010042228A2 (en) * | 2008-10-10 | 2010-04-15 | Cornell University | Methods for predicting disease outcome in patients with colon cancer |
| CN102311953A (en) * | 2011-09-23 | 2012-01-11 | 上海市肿瘤研究所 | Method and kit for diagnosing bladder cancer with urine |
| CN102373286A (en) * | 2011-11-28 | 2012-03-14 | 中国科学院化学研究所 | Primer capable of detecting methylation of promoter of gene related to colonic adenocarcinoma |
| WO2012167145A2 (en) * | 2011-06-01 | 2012-12-06 | University Of Southern California | Genome-scale analysis of aberrant dna methylation in colorectal cancer |
| CN103417983A (en) * | 2012-05-18 | 2013-12-04 | 北京大学 | Novel apoptosis-related molecule TMEM106A and applications thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120004127A1 (en) * | 2010-05-12 | 2012-01-05 | Christopher Sears | Gene expression markers for colorectal cancer prognosis |
-
2015
- 2015-07-06 CN CN201510390230.8A patent/CN105400865B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009105533A2 (en) * | 2008-02-19 | 2009-08-27 | The Johns Hopkins University | Methods for predicting esophageal adenocarcinoma (eac) |
| WO2010042228A2 (en) * | 2008-10-10 | 2010-04-15 | Cornell University | Methods for predicting disease outcome in patients with colon cancer |
| WO2012167145A2 (en) * | 2011-06-01 | 2012-12-06 | University Of Southern California | Genome-scale analysis of aberrant dna methylation in colorectal cancer |
| CN102311953A (en) * | 2011-09-23 | 2012-01-11 | 上海市肿瘤研究所 | Method and kit for diagnosing bladder cancer with urine |
| CN102373286A (en) * | 2011-11-28 | 2012-03-14 | 中国科学院化学研究所 | Primer capable of detecting methylation of promoter of gene related to colonic adenocarcinoma |
| CN103417983A (en) * | 2012-05-18 | 2013-12-04 | 北京大学 | Novel apoptosis-related molecule TMEM106A and applications thereof |
Non-Patent Citations (5)
| Title |
|---|
| Abnormal accumulation of human transmembrane (TMEM)-176A and 176B proteins is associated with cancer pathology;Math P. Cuajungco等;《Acta Histochemica》;20121231;第114卷;705-712 * |
| Identification of novel targets for antiangiogenic therapy by comparing the gene expressions of tumor and normal endothelial cells;Tsuguteru Otsubo等;《Cancer Sci.》;20140531;第105卷(第5期);560-567 * |
| Neonatal DNA methylation patterns associate with gestational age;James W. Schroeder等;《Epigenetics》;20111201;第6卷(第12期);1498-1504 * |
| NON-MICROARRAY DNA DIFFERENTIAL METHYLATION SCREENING IN BREAST CANCER;Vladimir Strelnikov等;《Cancer Genetics and Cytogenetics》;20101231;第203卷;93 * |
| TMEM176A基因启动子区在食管癌中的异常甲基化改变;张游;《中国博士学位论文全文数据库 医药卫生科技辑》;20151015(第10期);E072-35 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105400865A (en) | 2016-03-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5512521B2 (en) | Analysis method of ovarian cancer disease | |
| ES2715226T3 (en) | Epigenetic markers of colorectal cancers and diagnostic methods that use them | |
| WO2016109782A2 (en) | Methods and compositions for detecting colorectal neoplasias | |
| CN104846092A (en) | New markers for cancer | |
| CN109929919B (en) | DNA methylation detection method and related application | |
| WO2010113529A1 (en) | Method for detection of colorectal tumor | |
| CN105400865B (en) | The DNA methylation detection of the gene promoter areas TMEM176A | |
| AU2012388616A1 (en) | Method for screening cancer | |
| CN108866191A (en) | Tumor marker STAMP-EP2 based on methylation modification | |
| JP2022552400A (en) | COMPOSITION FOR DIAGNOSING LIVER CANCER USING CPG METHYLATION CHANGE IN SPECIFIC GENE AND USE THEREOF | |
| Liu et al. | Quantitative assessment of gene promoter methylation in non‑small cell lung cancer using methylation‑sensitive high‑resolution melting | |
| TW202028473A (en) | Purpose of HOXA9 methylation detection reagent in preparation of lung cancer diagnosis reagent | |
| CN107868822A (en) | For detecting the composition and its kit and purposes of cancer of the esophagus | |
| Varkalaite et al. | Atrophic gastritis and gastric cancer tissue miRNome analysis reveals hsa-miR-129-1 and hsa-miR-196a as potential early diagnostic biomarkers | |
| WO2020221315A1 (en) | Methylation-based modified tumor marker stamp-ep8 and application thereof | |
| CN115315530A (en) | Composition for diagnosing bladder cancer using CPG methylation change in specific gene and use thereof | |
| CN102851354B (en) | Primer pair and kit for detecting methylation state of DNA at cell DACH1 gene promoter region | |
| TW202028464A (en) | Application of HOXA7 methylation detection reagent to preparation of lung cancer diagnosis reagent | |
| CN110029165A (en) | A kind of kit marked for detecting the susceptible correlated inheritance of carcinoma of endometrium | |
| CN115537464B (en) | Diagnostic or auxiliary diagnostic reagent, nucleic acid combination, kit and application of colorectal cancer or precancerous lesions | |
| CN115433778B (en) | Detection reagent and kit for detecting colorectal cancer or colorectal adenoma related gene methylation and application of detection reagent and kit | |
| CN114107498A (en) | Colorectal cancer blood detection marker and application thereof | |
| WO2020221316A1 (en) | Tumor marker stamp-ep9 based on methylation modification and application thereof | |
| WO2020221314A1 (en) | Tumor marker stamp-ep7 based on methylated modification and use thereof | |
| CN113430272A (en) | Reagent and kit for diagnosis or auxiliary diagnosis of esophageal cancer or precancerous lesion and application of reagent and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |