WO2012126265A1

WO2012126265A1 - Recombinant endospore with human serum albumin presented on surface for oral administration and preparation method therefor

Info

Publication number: WO2012126265A1
Application number: PCT/CN2011/084333
Authority: WO
Inventors: 陈克平; 毛浪勇; 宁德刚; 姜姗彤; 李国辉; 姚勤; 袁弋
Original assignee: 江苏大学
Priority date: 2011-03-21
Filing date: 2011-12-21
Publication date: 2012-09-27
Also published as: CN102181469A

Abstract

A method for preparing Bacillus subtilis endospore with human serum albumin fusion protein presented on the surface and an oral product thereof. Capsid protein gene cotC of Bacillus subtilis endospore, as a molecular vector, is recombined with human serum albumin gene hsa, to construct an integrated recombinant plasmid that is expressed as a fusion, the recombinant plasmid that expresses human serum albumin HSA as a fusion is transformed into Bacillus subtilis, an exogenous gene is integrated to an amylase gene amyE at a specific site on the chromosome through homologous recombination, the recombinant strain has no amylase activity due to insertional inactivation of the amylase gene, a recombinant Bacillus subtilis strain that expresses CotC-HAS as a fusion is screened, and the recombinant strain is induced to produce endospore with human serum albumin presented on the surface. The endospore produced by the recombinant strain can be directly orally administered to animals.

Description

Description of the surface for displaying oral serum albumin recombinant spores and preparation method thereof

The invention relates to a preparation method and a product for displaying a recombinant spore of a foreign protein on the surface, and specifically relates to a recombinant spore showing a human serum albumin HSA on the surface of a Bacillus subtilis spore, belonging to the technical field of recombinant fusion protein medicine.

Background technique

Ouman serum albumin (HSA) is a single-chain aglycosylated protein consisting of 585 amino acids with a molecular mass of approximately 66.5 kD (Mingetti, et al. 1986. J. Biol. Chem. 261, 6757) The isoelectric point is between 4.7 and 4.9. HSA is the most abundant protein in human plasma, accounting for about 60% of total protein in blood. Human serum albumin can transport fatty acids, bile pigments, amino acids, steroid hormones, metal ions and many therapeutic molecules in body fluids while maintaining the osmotic pressure of blood at an appropriate level. As the most important carrier of blood and plasma protein components, HSA plays an important physiological role in the body, so it has a wide range of uses in clinical medicine practice, and is widely used to treat various shocks, burns, war wounds, Patients with blood volume reduction caused by various causes such as surgery and work accidents, as well as patients with chronic nephritis, hepatitis, cirrhosis and advanced malignant tumors, malnutrition edema, hypoalbuminemia and patients without albuminemia. HSA has a high nutritional value for cells. HSA is composed of more essential amino acids and is a balanced and complete source of amino acids. About 1/3 of the proteins that nourish cells are derived from HSA synthesized by the liver. The daily synthesis of HSA in the liver is almost completely consumed by various tissue cells. The HSA leaves the blood system, reaches the cell membrane, enters the cell, and hydrolyzes to synthesize various proteins. Because of the high indications and high doses of HSA (the amount of HSA used per patient per day is nearly 10g), HSA has a huge market demand. At present, HSA's global market demand is about 600t, of which China's annual demand for HSA is about 70t. Clinically, HSA is mainly obtained by collecting human blood by fractional filtration. However, human plasma has limited source, high price, and complicated source, which is easy to cause blood-borne pollution, such as hepatitis virus and HIV. At present, recombinant human serum albumin has been produced by yeast fermentation by genetic engineering, but to achieve large-scale production of drug-grade recombinant human serum albumin, the fermentation method still has many shortcomings and shortcomings, because recombinant human serum albumin The purity requirements of the product are extremely high, and the purity requirement is above 99.999999%. Any trace of miscellaneous protein may cause a serious immune reaction. This makes the separation and purification methods and steps for producing recombinant human serum albumin by fermentation method complicated, and the production cost is high.

Bacillus subtilis is an environmentally friendly bacterium. When nutrients are deficient, it can form spores in metabolic dormancy. Under suitable conditions, spores can germinate into vegetative cells with reproductive ability. The spores are easy to culture, are relatively easy to separate, and do not require complicated separation and purification operations. Spore is the most stress-resistant structure in the life world. It has good stability, resistance to oxidation, high temperature resistance, long-term resistance to 6 (TC high temperature, 20 minutes of survival at 120 ° C, and resistance to chemistry It is also very prominent in medicine and anti-radiation, and can survive in harsh environments for several years to several decades. Spores can remain active in acidic gastric environment, can resist saliva and bile attack, can pass through the animal digestive tract, can be used as A vector for heterologous proteins or biologically active molecules in extreme environments (eg gastrointestinal tract) (Oggioni MR, et al. 2003. Vaccine. 21: 96-101). Bacillus subtilis Description

After entering the digestive tract, the sub-state is rapidly revived from dormancy, and in a short period of time, it is propagated into a dominant population with high bacteria content, consumes a large amount of oxygen in the intestinal tract, and can produce hydrogen peroxide and bacteriocin, establish a micro-ecological balance, and promote beneficial. The growth of anaerobic microorganisms inhibits the growth of harmful bacteria (E. coli, Salmonella), and thus prevents gastrointestinal diseases such as diarrhea and diarrhea. At present, there are oral Bacillus subtilis live capsule products on the market, Beijing Zizhu Pharmaceutical Co., Ltd., Sinopharm S20030018 (hitp://vv .777aaa .oxn/htm[/vao/20079i82340271196: 569029.htm), indicating the grass Bacillus spores can be used orally to produce pharmacodynamic effects.

The purpose of the invention is to utilize the unique stress resistance of spores, and use the probiotic Bacillus subtilis spore coat protein as a carrier to display human serum albumin on the spore surface by spore surface display technology, so that human serum albumin can be rapidly expressed in large quantities. At the same time, it has good resistance to stress and is suitable for rapid and large-volume preparation of pharmacologically active recombinant human serum albumin oral nutrition. The product has the pharmacodynamic and nutritional functions of human serum albumin while maintaining the physiological characteristics of Bacillus subtilis spores. So far, no similar reports and invention patents have been found.

SUMMARY OF THE INVENTION In order to solve the problems of the prior art, the present invention provides a method and a product for preparing a recombinant spore of a surface displaying human serum albumin HSA. The invention uses Bacillus subtilis spore coat protein CotC as a carrier to display human serum albumin on the surface of spores of Bacillus subtilis by spore surface display technology, and can be used for direct oral administration of animals, and becomes a novel human serum albumin drug nutrition. A product or animal nutrition that has similar efficacy to human HSA in terms of safety, tolerability, pharmacodynamics, and pharmacokinetics. Compared with other injectable human serum albumin products, the preparation method and separation process of the surface display human serum albumin of the invention are simple and rapid, and have wider application value. The invention of this product overcomes the limitation of the current human serum albumin derived from blood products, and overcomes the shortcomings of the separation and purification process of human serum albumin produced by recombinant yeast fermentation, and has a good application prospect in the pharmaceutical field.

The technical solution adopted by the present invention is:

Method for preparing recombinant spore of surface displaying human serum albumin HSA and product thereof, using Bacillus subtilis spore coat protein gene as molecular carrier, and recombining with human serum albumin gene to construct fusion expression integrated recombinant plasmid, and Transformation of Bacillus subtilis to obtain a recombinant strain of Bacillus subtilis, inducing a recombinant strain to produce spores, and displaying human serum albumin on the surface of the spore.

A specific operation of the present invention is: a cDNA of human serum albumin HSA is amplified from a cDNA library of human liver tissue by RT/PCR, and the obtained gene is inserted into a cloning vector pMD18-T for storage. Then, the human serum albumin gene hsa was inserted between the Κρηί and E _CO m restriction sites of the fusion-expressing plasmid pJS700 to construct the integrated recombinant plasmid pJS700-HSA, and the plasmid was used to transform Bacillus subtilis, and the depletion method was used. The host strain was induced to produce spores, and the fusion protein CotC-HSA was displayed on the surface of the spore. DESCRIPTION OF THE INVENTION The present invention selects a Bacillus subtilis strain which has good transforming ability and can produce spores as a transformed strain of a recombinant plasmid, such as Bacillus subtilis 168 and a series of strains thereof (Bacillus Genetic Stock Center, Department of Biochemistry, The Ohio State University) , West 12th Avenue, Columbus, Ohio, 43210 USA); The spore-capsid protein gene coiC (Gene Bank SEQ ID NO: NP-389653) was selected as the molecular carrier of the surface display protein, and the human serum albumin gene fefl was selected as the recombinant gene. Bacillus subtilis is an environmentally friendly bacterium that differentiates into dormant spores in the absence of nutrients. Spores are highly resistant to stress, are resistant to acids and alkalis, have a high ability to survive, and are relatively large in size and easy to separate and purify. The cultivation method of Bacillus subtilis is simple and convenient, the growth is rapid, the nutrition requirement is simple, and it is easy to carry out industrial scale-up culture. The human serum albumin is displayed on the surface of the spore of Bacillus subtilis, and the human serum albumin is rapidly expressed in a large amount, and has good stress resistance and stability, and is simple and quick to separate and purify.

The invention relates to a recombinant plasmid constructed by recombining the selected spore capsid protein gene coiC and the Ζι^ gene coding sequence of the invention, wherein the recombinant plasmid contains a promoter of the spore capsid protein gene, a coding sequence containing no stop codon and The recombination gene of the h gene encodes a gene that expresses CotC-HSA when Bacillus subtilis differentiates to form spores. By constructing an integrated recombinant plasmid, the fusion gene cWC-Zira is integrated into a specific site on the B. subtilis chromosome and stably inherited, thereby avoiding the disadvantage that the plasmid is easily lost in Bacillus subtilis cells.

An expression vector carrying the fusion expression CotC-HSA can be transformed into a host cell by heat bombardment or electroporation. Successfully transformed cells can be identified by methods well known in the art by further screening for cells carrying the fusion gene constructed by the present invention, such as collecting cells, extracting DNA after lysis, and then performing PCR identification, etc., after induction of expression. Western blot was performed using the HSA antibody.

The invention also relates to a recombinant strain obtained by screening a recombinant integrative plasmid expressing the CotC-HSA, which is constructed by the invention, and transformed into a Bacillus subtilis strain, and the recombinant strain induces the surface of the spore to display recombinant human serum albumin, and can be passed through Western blot. The recombinant protein HSA displayed on the surface of the spore was examined.

The present invention relates to a primer sequence for cloning a gene hsa coding sequence fragment:

hsa-F: ATGGTACCATGAAGTGGGTAACCTTT ( SEQ ID NO. l )

hsa-R: GCGAATTCTTATAAGCCTAAGGCAGCT ( SEQ ID 0.2 )

The present invention relates to a primer sequence amplified by a fragment of the B. subtilis amylase gene amy £ (Gene Bank SEQ ID NO: NP-388186):

amyE-F : ATTGCTCGGGCTGTATGACTGG ( SEQ ID 0.3 )

amyE-R: GTTACACCATCACTGTTCGTTCCTT ( SEQ ID N0.4 )

The outstanding advantages of the present invention are as follows: The present invention displays human serum albumin HSA on the surface of Bacillus subtilis, and utilizes the unique resistance of spores to make human serum albumin smoothly pass through the animal body digestion barrier. Surface constructed by the present invention The manual displays the recombinant spore of Bacillus subtilis of human serum albumin HSA, which can be used for direct oral administration to animals, and becomes a novel human serum albumin nutrient or animal nutrition, compared with other injection type human serum albumin samples, preparation methods and The separation process is simple and fast, and has better stability and wider application value. The invention of this product overcomes the limitation of the current human serum albumin derived from blood products, and also overcomes the disadvantages of the complicated process of separation and purification of human serum albumin produced by recombinant yeast fermentation.

BRIEF DESCRIPTION OF THE DRAWINGS:

Figure 1 The human serum albumin gene coding sequence cloned by the inventors searched for alignment results in Gene Bank.

Fig. 2 is a construction method and a structural map of the fusion expression recombinant plasmid pJS700-HSA expressing CotC-HSA. amyE 5 '-end and amyE 3 '-end respectively represent the 5' and 3' ends of the amylase gene coding sequence, and are integrated into the amylase gene of Bacillus subtilis 168 by homologous recombination. Amp ^r ' E«/ represents the ampicillin resistance gene and the erythromycin resistance gene, respectively, and is used as a selection marker in Escherichia coli and BaciU subtilis 168 (rp-). cotC-hsa is a gene fragment that expresses a recombinant protein of CotC-HSA in a spore of Bacillus subtilis 168, which contains a promoter sequence of the cotC gene, a CotC coding sequence which does not contain a cwC stop codon, and the entire coding sequence of HSA. oriC is an E. coli replicon fragment.

Figure 3 recombinant strain

Amylase activity analysis of 168 (rp-)/pJS700-HSA. A: wild type strain Bacillus subtilis 168 ( rp — ) and recombinant strain ScdZ subtilis 168 ( rp /pJS700-HSA was cultured on starch plates; B : iodine staining of wild type strains and recombinant strains on starch plates.

Figure 4 is a schematic representation of the integration of the Em ^r -cotC-hsa gene fragment in the Bacillus subtilis 168 chromosome.

Figure 5 PCR detection of the Em ^r -cotC-hsa fragment in recombinant strains. M: 250bp DNA Ladder Marker; using Bacillus subtilis 168 (ΐψ') (Wild-type, WT) and Bcicillus subtilis 168 (ir^)")/pJS700-HSA (Transgenic, TG) chromosomes as templates, with amyE -F/amyE-R, hsa-F/hsa-R hsa-F/ amyE-R and amyE-F/hsa-R are four sets of primer pairs (see Figure 4 for the position of the primer pair in the chromosome). Identification of recombinant genes.

Figure 6. Surface display of transgenic recombinant strains Western blot analysis of recombinant spores of HSA. M is a prestained protein MW marker, 1 is the wild type strain Bacillus subtilis 168 (ίφ_) after 48 hours of culture as a control, 2 and 3 are the recombinant strain Bacillus subtilis 168 (irp") / pJS700-HSA culture for 8h and 48h respectively. Extract.

Figure 7 Effect of oral recombinant spores on serum albumin levels in mice. The control group was given normal saline to the mice; the wild type group was given wild type spores at a dose of 2 mg/(gd); the low dose group and the high dose group were given recombinant spores at a dose of 1 mg respectively. /(g'd) and 2 mg/(gd).

Figure 8 Effect of oral spores on body weight in mice. The four curves represent the changes in body weight of the control group, the wild-type spore-treated group, and the recombinant spore small-dose and high-dose treatment groups for 30 days. Detailed description of the specification

Experimental Materials:

Various restriction enzymes, T ₄ DNA ligase, LA Taq, Γ _βί? enzyme, pMD18-T vector were purchased from Bao Bioengineering (Dalian) Co., Ltd., and PCR primers were synthesized by Shanghai Jierui Bioengineering Co., Ltd. Completed by Biomics Biotechnology Co., Ltd., all DNA fragments used in the present invention were isolated and purified using Omega Bio-Tek Gel Extraction Ktt, E. coli strain DH5ct (China General Microbial Depository Management Center CGMCC, Beijing No. 1 Courtyard of Beichen West Road, Chaoyang District, Institute of Microbiology, Chinese Academy of Sciences, 100101) Preserved for the laboratory, other reagents are domestically analyzed.

The terms used in the present invention, unless otherwise specified, are generally understood by those of ordinary skill in the art. The experimental procedures not specifically described in the following examples were carried out in accordance with the Guide to Molecular Cloning (Edited by Sambrook et al., Science Press, 1992), kit instructions, and product specifications. The following examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way. In the following examples, some of the processes and methods not described in detail are conventional methods that are familiar and understood by those skilled in the art. The source and trade name of the reagents used are indicated on the first occurrence, and the same reagents used thereafter are the same as those indicated for the first time unless otherwise specified. The biological materials preserved by the inventors involved in the embodiments of the present invention can be provided to the public for 20 years.

Example 1 : Cloning, sequencing and identification of human serum albumin fe« gene

Human liver tissue samples were provided by Dr. Liu Jibing from Nantong University School of Medicine. Human liver tissue was taken and placed in a mortar precooled with liquid nitrogen, and liquid nitrogen was added for grinding. The signal R A (mRNA) was separated by an R A extraction kit, and the cDNA sequence of the human serum albumin gene was obtained by RT/PCR.

The PCR amplification primer for the human serum albumin gene fragment is - hsa-F: ATGGTACCATGAAGTGGGTAACCTTT

hsa-R: GCGAATTCTTATAAGCCTAAGGCAGCT

The PCR reaction system is strictly carried out according to the LA 3⁄4g instruction manual. The 20 μL reaction system contains 73⁄4 R« LA Taq 0.2 L, 10 X LA PCR Buffer II (Mg ²⁺ Plus) 2 μL, dNTP Mixture (2.5 mM each) 3.2 μ L, template DNA lOOng, upstream and downstream primers (20 μ Μ) 0.4 y L each, and finally add sterile ultrapure water to 20 μL. The PCR conditions were: denaturation at 94 °C for 5 min, 94 °C for lmin, 56 °C for 40 s, 72 °C for 2 min, 30 cycles. The PCR product was 1845 bp in size and included the coding sequence for the human serum albumin gene. In order to facilitate cloning, the upstream primer hsa-F was added with a «1 restriction site, and the downstream primer hsa-R was added (^1 site. The amplified fragment was TaKaRa pMD18-T Simple Vector ( TaKaRa, treasure bio Engineering (Dalian) Co., Ltd.) method, cloned into pMD18-T vector, transformed into E. coli DH5a, screened the cloned strain, extracted the plasmid, and digested with 1^1 and ^3⁄4^1 and £/?1, agar Positive clones were identified by glycophore electrophoresis, and the recombinant plasmid was sequenced, and sequencing of the cloned fragment was performed by Biomics Biotechnology Co., Ltd. The recombinant plasmid of the specification was named pMD18-T-HSA, and the recombinant strain was named DH5o/pMD18-T-HSA. The positive recombinant strain was stored in LB medium containing 15% glycerol and frozen at -80 °C.

The sequencing results were searched in GenBank in ittp://blast.ncbi.nlm.nih.gov/Blast.cgi) and the results are shown in Figure 1. Example 2: Preparation and application of HSA-producing Bacillus subtilis recombinant spores using CotC as a carrier surface

1. Construction of recombinant integrated plasmid pJS700-HSA

Plasmid pJS700 (Li Qian. Study on recombinant spores of Bacillus subtilis expressing WSSV envelope proteins Vp l 9 and Vp28 on the surface of molecular carrier with CotX [D]. Zhenjiang, Jiangsu: Jiangsu University, 2010:36-38) Environment of Jiangsu University Associate Professor Ning Degang, the gene, the size of the plasmid is about 5.5kb. In the pJS700 plasmid, amyE 5 '-end and amyE 3 '-end represent the 5' and 3' ends of the amylase gene amyE (Gene Bank SEQ ID NO: NP-388186), respectively, and are integrated in Bacillus by homologous recombination. Subtilis 168 (^) chromosome in the amylase gene. The ampicillin resistance gene and the erythromycin resistance gene were respectively indicated as selection markers in Escherichia coli and Bad iw 168 (ίφ-). cotC is the Bacillus subtilis spore capsid protein CotC gene, which contains the promoter sequence of the cotC gene (Gene Bank SEQ ID NO: NP-389653) and the CotC coding sequence which does not contain the cotC stop codon. oriC is an E. coli replicon fragment. The hsa fragment and pJS700 were recovered by agarose gel recovery kit with the plasmids pMD 18-T-HSA and pJS700, respectively, and the two fragments were digested with T ₄ DNA ligase, and the ligated product was transformed into Escherichia coli. DH5 (X competent cells, transformants were plated in LB plates containing 50 μg/mL ampicillin overnight at 37 ° C, and the next day selected positive monoclonal strains were cultured in LB liquid containing 50 μg/mL ampicillin The medium was cultured at 37 °C for 12 to 16 hours. The plasmid was extracted and identified by PCR and ^«1 and ^0^1. The positive clones were identified by agarose gel electrophoresis. After the identification, the recombinant integrated plasmid was named pJS700- HSA, the positive recombinant strain was named DH5a/pJS700-HSA. The recombinant integrated plasmid PJS700-HSA contained the recombinant gene cotC-hm, and the construction process and its map are shown in Fig. 2.

2. Screening and identification of Bacillus subtilis strains expressing recombinant spores

The integrated recombinant plasmid PJS700-HSA was transformed into βα«7Ζί« subtilis 168 (trp ) (Bacillus Genetic Stock Center, Department of Biochemistry, The Ohio State University, West 12th Avenue, Columbus, Ohio, 43210, USA) with 0.4 μ The LB plate of g/mL erythromycin (purchased from SIGMA) was used to screen the recombinants. Single colonies were selected from the plates and inoculated into LB plates containing 1% starch. The cells were cultured overnight at 37 ° C, and the next day was treated with iodine-potassium iodide solution. Starch plate staining was used to identify recombinant strains. Preparation method of 1% starch plate: 0.1 g of soluble starch was added to lOOmL LB solid medium, and the plate was inverted after autoclaving. Preparation of iodine-potassium iodide solution: 2 g of potassium iodide, lg of iodine, 300 mL of distilled water, first dissolve potassium iodide in a small amount of deionized water, add iodine after all dissolved, dilute to 300 mL by shaking, and store in a brown glass bottle protected from light. It can be diluted 2~10 times when used. Appropriate amount of iodine-potassium iodide solution was dropped on the starch plate. A transparent circle around the colony indicated that the recombinant gene was not inserted into the amylase gene a yZ?, and the color of the colony and its surrounding blue turned out to indicate the recombinant gene. The book was successfully inserted into the amylase gene am on the T to subtilis 168 (rp-) chromosome, thus causing the amylase gene to be inactive, see Figure 3.

In order to further prove that the inactivation of the amylase gene in the recombinant strain is due to the insertion of « - _CO iC-fe«, respectively, amyE-F/amyE-R, hsa-F/hsa-R, hsa-F/amyE- R, amyE-F/hsa-R is a primer pair, and the chromosome of Bacillus subtilis is used as a template to identify whether the recombinant strain contains the « _-CO C-fe« gene fragment by PCR amplification. A schematic diagram of the integration of the EwZ-coiC-/^ fragment in the Bacillus subtilis 168 Op-) chromosome is shown in Figure 4. The PCR reaction system was subjected to the TaKaRa ΙΛ instruction manual. The 20 μL reaction system contained LA Taq 0.2 μL, 10 X LA PCR Buffer II (Mg ²⁺ Plus) 2 L, dNTP Mixture (2.5 mM each) 3.2 L, template DNA 100ng, upstream and downstream primers (20 μ M) each 0.4 μL, and finally added sterile ultrapure water to 20 L. The PCR reaction conditions were set separately according to the characteristics of each primer pair. Approximately 5.0 kb, 1.8 kb, 4.3 kb, and 2.3 kb amplified fragments were detected in the recombinant strains, whereas only about 1.1 kp of the amylase gene was detected in the wild-type strain, and the results are shown in Fig. 5. This indicates that the recombinant strain contains the Emf-co C-foa recombinant gene on the chromosome, and the 7- _CO C-/ira recombinant fragment was successfully inserted into the amylase gene. The identified recombinant strain was named Bacillus subtilis 168 rp )/pJS700-HSA.

The method for extracting the chromosome of Bacillus subtilis is as follows: The single colony is cultured in a medium supplemented with LB and the corresponding antibiotic, and cultured in a shaker at 37 ° C to an OD ₆₀₀ of 1.0 2.0. Take 1.5 mL of the bacterial solution in Eppendor f, centrifuge at 8000 rpm for 10 min, discard the supernatant, wash the pellet with 10 ml of ^1^118.0 (1011^13⁄48-1^1, ImMEDTA), and centrifuge to remove the supernatant. Add 100 LTE suspension precipitation; add 3 (^L lOOmg/ml lysozyme solution to the suspension, do not shake, put lh in 37 °C incubator, force 50 L 10% SDS and 20 L20mg/mL proteinase K Continue to culture for 1 h at 37 °C; add TE to 300 μL, add 150 PL phenol and chloroform, centrifuge at 12000 rpm for 10 min, and take the supernatant; add 300 μM chloroform, centrifuge at 12000 rpm for 5 min, take the supernatant, force 1/ 4 volumes of 5M NaCl, 2 volumes of absolute ethanol, precipitated DNA for 2h at room temperature, centrifuged at 12000rpm for 10min, collected the precipitate, washed with 500 L 70% ethanol, and after evaporation, add 10 L of TE buffer to dissolve the precipitate. Take l L and measure the DNA concentration by agarose gel electrophoresis. The rest can be stored at -20 °C for later use.

3. Surface display and induction of recombinant spores of human serum albumin

168 (irp- )/pJS700-HSA forms spores. The formulation of the DSM medium is: 0.8% nutrient broth (Difo), 0.1% CL 0.025% MgS0 ₄ - 7H ₂ 0, l.OmM Ca(N0 ₃ ) ₂ ·4Η ₂ 0, 10μΜ MnCl ₂ , l. (^MFeS0 ₄ . The wild type strain fiadZfe ^Mfc 168 ) and the recombinant strain were inoculated separately in DSM medium, the recombinant strains were treated with 8h and 48h cultures respectively, and the wild type strains were treated for 48 hours. Method for treatment of spore protein: The cells were collected by centrifugation at 12000 rpm for 10 min, resuspended in the same volume of GTEBuffer (50 mM glucose, 20 mM pH 7.5 Tris-HCl, 10 mM EDTA, 2 mg/mL lysozyme), and treated at 37 ° C for 30 minutes for destruction. Nutrient cells, 12000 rpm X 10 min precipitated spores, washed 3 times with PBS pH 7.4, resuspended in the same volume of SDS-DTT buffer (O.lmM pH 7.4 PBS, 50 mM DTT, 1.5% SDS), 65 ° C water bath The book was treated for 10 min, subjected to SDS-PAGE electrophoresis, transferred to a PVDF membrane, and rabbit anti-HSA serum was used as a primary antibody. The spore protein of the recombinant strain and the wild-type strain was detected by Western blot. The results showed that no HSA was detected in the culture of wild type strain 48h and recombinant strain 8h, but after 48h of culture, the cells differentiated into spores due to nutrient depletion. In the process of sporulation, HSA followed with spore coat The shell protein CotC-is expressed as such, and thus HSA can be detected, see Figure 6. This indicates that human serum albumin HSA in recombinant spores was displayed on the surface of recombinant spores by the capsid protein vector CotC.

4. Oral recombinant spore assay in mice to analyze the physiological functions of recombinant spores

The mouse gavage experiment was carried out at the Experimental Animal Center of Jiangsu University. The experiment was approved by the Animal Experimental Ethics Committee of Jiangsu University, and the experimental procedure was carried out in full accordance with the requirements of the Experimental Animal Center. Male SPF-grade ICR mice (5 weeks old, 18-22 g) were acclimated for two weeks in the experimental environment prior to the experiment. One cage per 10 mice, culture conditions are: Maintain room temperature 20 ± 2 ° C, free of diet and drinking water. After adaptation, we first performed an acute toxicological analysis of the recombinant spores. Twenty ICR mice (half male and female) were taken and the mice were intragastrically administered with recombinant spores at a dose of 5 m _g /fe^. The experimental mice were then observed for two weeks, and no adverse reactions occurred in the experimental mice. Then, 40 mice were randomly divided into 4 groups: a blank control group (administered saline to mice), and a wild-type treatment group (wild-type spores were administered to mice at a dose of 2 mg/(gd). ), two recombinant spore treatment groups (a low-dose group at a dose of 1 mg/Cg_d), a large dose group at a dose of 2 mg/(gd)) o Collected spores were vacuum-dried and weighed and resuspended in physiology In salt water, it is used separately. The mice were intragastrically administered with spores resuspended in physiological saline, and the mice were observed and weighed daily during the intragastric administration. After 30 days, the eyeballs of the mice were dug, blood was taken, serum was separated, and biochemical parameters were detected. The biochemical detection of mouse serum was performed by the Affiliated Hospital of Jiangsu University (Jiangbin Hospital). The experimental data is expressed as the mean standard deviation. Statistical analysis was performed using a t-test of independent samples. PO.05 indicates that the experimental results are statistically significant. The experimental results showed that albumin in the serum of mice with large doses of recombinant spores was significantly higher than other groups, P <0.01, see Figure 7. This indicates that oral recombinant spores can increase the albumin content in the serum of animals. There was no significant difference in the body weight of the mice, as shown in Figure 8, which indicates that oral spores did not cause discomfort in the gastrointestinal tract of mice.

Claims

Claim

A method for preparing a surface-displaying human serum albumin recombinant spore, which comprises: using a Bacillus subtilis spore coat protein gene as a molecular vector, and recombining with a human serum albumin gene to construct an integrated recombinant plasmid for fusion expression, And transforming Bacillus subtilis to obtain a recombinant strain of Bacillus subtilis, and inducing a recombinant spore of the surface of the spore produced by the recombinant strain to display human serum albumin.

The method for producing a surface-displayed human serum albumin recombinant spore according to claim 1, wherein the Bacillus subtilis spore coat protein gene is cotC.

The method according to claim 2, wherein the fusion-expressing integrated recombinant plasmid is a Bacillus subtilis spore coat protein gene cotC and human serum. A plasmid constructed by recombinant albumin gene.

The method according to claim 3, wherein the recombinant strain of Bacillus licheniformis is a bacterium obtained by transforming an integrated recombinant plasmid into a bacterium of the genus Bacillus sp. The chromosome of the strain contains a selection marker gene suitable for Bacillus subtilis, and a gene recombined with the coding sequence of the sporo-capsid protein gene and the human serum albumin gene, which are inserted into the amylase gene to cause the amylase of the recombinant strain. The gene is inactivated.

The recombinant spore of the human serum albumin surface according to claim 4, wherein the recombinant spore is a spore of Bacillus subtilis induced by a recombinant strain of Bacillus subtilis, and the surface of the spore exhibits human serum albumin HSA.

A surface-displaying human serum albumin recombinant spore, which is characterized by: preparing by using the Bacillus subtilis spore coat protein gene as a molecular vector, and recombining with human serum albumin to construct a fusion expression fusion The recombinant plasmid is transformed into Bacillus subtilis to obtain a recombinant strain of Bacillus subtilis, and the recombinant spore of the human serum albumin is displayed on the surface of the spore produced by the recombinant strain.

7. The recombinant spore of human serum albumin surface according to claim 6, wherein the human serum albumin is displayed on the surface of the spore by a recombinant technique using Bacillus subtilis, and the recombinant spore can be used for oral administration to a human or an animal.