CN109609425B - Method for screening integrated recombinants by recovering activity of enzyme of bacillus subtilis integration site - Google Patents

Abstract

The invention particularly relates to a method for screening integrated recombinants by utilizing activity recovery of enzymes of bacillus subtilis integrated sites. The method comprises the following steps: 1) constructing resistance gene integration plasmid, transforming bacillus subtilis, and screening the inactivated bacillus subtilis with deletion of 3' end of the gene of the enzyme of the integration site; 2) constructing exogenous gene integration plasmid; 3) transforming the bacillus subtilis obtained in the step 1) by the exogenous gene integration plasmid, taking an agar solid culture medium of a substance which can be utilized by enzymatic hydrolysis of enzyme at an integration site as a screening culture medium, and screening recombinant engineering bacteria of which the exogenous gene integration plasmid is integrated into the bacillus subtilis through homologous double exchange by inactivating antibiotic resistance and enzyme activity of the integration site. The invention has the advantages that: antibiotic resistance genes are not needed to be used as a screening marker of the recombinant bacillus subtilis; the obtained recombinant Bacillus subtilis maintains the enzyme activity of the integration site.

Description

Method for screening integrated recombinants by recovering activity of enzyme of bacillus subtilis integration site

[ technical field ] A method for producing a semiconductor device

The invention belongs to the technical field of biology, and relates to a method for screening an integration recon by recovering the activity of an enzyme of a bacillus subtilis integration site.

[ background of the invention ]

Bacillus subtilis is nonpathogenic, produces no toxin and heat-sensitizing protein, is a food-Safe strain (GRAS: Generally Recognized as Safe), and is classified as a food-grade microorganism. And the bacillus subtilis is used as an expression system and has the following advantages: 1. the method has strong protein secretion function, does not need to crush cells to extract protein, can obtain pure target protein by simply treating fermentation supernatant, and realizes secretion expression of various exogenous proteins in bacillus subtilis at present. 2. There is no obvious codon preference, and the expressed product is not easy to form inclusion body. 3. The fermentation conditions are simple. The development and utilization of Bacillus subtilis as an expression system have profound significance.

According to the type of the adopted vector, the expression mode of the bacillus subtilis can be divided into replicable plasmid expression and chromosome integration expression. Both expression patterns typically require antibiotic resistance genes for screening. In addition, replicating plasmids are generally not very stable in B.subtilis, and generally require the use of antibiotics during production, and antibacterial activity is an important test requirement for enzyme preparations for food use. In addition, researchers have found that antibiotic resistance genes present in genetically engineered foods can be transferred to bacteria in human intestinal microorganisms. In order to avoid such gene contamination, some national governments have now made clear regulations that prohibit the production and sale of genetically engineered foods for any antibiotic resistance gene.

In the currently used integrative plasmids, the resistance gene is mostly used as a selection marker, and if the integration is carried out into the Bacillus subtilis chromosomal genome by homologous double crossover, the enzyme at the integration site is inactivated. For example, plasmids pDG364, pMLK83, pDG1661, pDG1662, pDG1728, pDG1730, pDL, pDK, pSG1154, pSG1192, pSG1193, pSG1729, pSG1190 and pSG1191 which integrate into the chromosome genome of Bacillus subtilis by homologous double crossover, and recombinant bacteria need to be screened by antibiotics such as chloramphenicol, neomycin or spectinomycin, and the obtained recombinant bacteria of Bacillus subtilis have inactivated alpha-amylase; plasmids pDG1663, pDG1664, pDG1729 and pDG1731 with thrC genes as integration sites are homozygously integrated into a bacillus subtilis chromosome genome, erythromycin or spectinomycin is required to be used for screening out recombinant bacteria, and thrC enzyme of the obtained bacillus subtilis recombinant bacteria is inactivated; and plasmids pAX01 and pA-spac homologous double-exchange integration of which integration sites are beta-galactosidase genes are integrated into a bacillus subtilis chromosome genome, a recombinant bacterium needs to be screened by erythromycin antibiotic, and the beta-galactosidase of the obtained bacillus subtilis recombinant bacterium is inactivated.

[ summary of the invention ]

The invention aims to provide a method for screening integration recombinants by utilizing the activity recovery of enzymes of a bacillus subtilis integration site. Relates to a method for screening integrated recombinants by recovering the activity of an enzyme of a bacillus subtilis integration site. The method comprises the following steps: 1) constructing resistance gene integration plasmid, transforming bacillus subtilis, and screening the inactivated bacillus subtilis with deletion of 3' end of the gene of the enzyme of the integration site; 2) constructing exogenous gene integration plasmid; 3) transforming the bacillus subtilis obtained in the step 1) by the exogenous gene integration plasmid, taking an agar solid culture medium of a substance which can be utilized by enzymatic hydrolysis of enzyme at an integration site as a screening culture medium, and screening recombinant engineering bacteria of which the exogenous gene integration plasmid is integrated into the bacillus subtilis through homologous double exchange by inactivating antibiotic resistance and enzyme activity of the integration site.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

a method for screening integrated recombinants by utilizing the activity recovery of enzymes of Bacillus subtilis integrated sites comprises the following specific steps:

(1) constructing resistance gene integration plasmid, transforming bacillus subtilis, and screening the inactivated bacillus subtilis with the deletion of the 3' end of the gene of the enzyme of the obtained integration site as a host bacterium, wherein the specific operation is as follows:

s1, constructing a resistance gene integration plasmid which enables the 3' end of the enzyme gene of the integration site to be deleted and inactivated, wherein the homologous double-exchange DNA sequence of the integration plasmid is A-ARG-C;

wherein A represents an upstream homology arm which is a DNA sequence of the 5' end of the enzyme gene of the Bacillus subtilis integration site;

c represents a downstream homology arm, which is a DNA sequence after the termination codon of the enzyme gene of the integration site;

antibiotic resistance gene ARG is arranged between homologous arms;

s2, screening the inactivated Bacillus subtilis with the deletion of the 3' end of the gene of the enzyme of the integration site: transforming the bacillus subtilis by the linearized resistance gene integration plasmid, culturing and screening the bacillus subtilis on a solid culture medium containing antibiotics, and obtaining the bacillus subtilis inactivated by deletion of the 3' end of the gene of the enzyme of the integration site through antibiotic resistance and enzyme inactivation of the integration site;

(2) constructing exogenous gene integration plasmid, wherein the homologous double-exchange DNA sequence is AB-EGEU-C;

wherein AB is the complete sequence of the enzyme gene of the Bacillus subtilis integration site;

c represents a downstream homology arm which is a DNA sequence after an enzyme gene stop codon of an integration site;

an exogenous gene expression unit EGEU is arranged between the homologous arms;

(3) screening the bacillus subtilis with the exogenous gene integrated into the bacillus subtilis integration site: the method comprises the steps of transforming the linearized exogenous gene integration plasmid into the bacillus subtilis inactivated by deleting the 3' end of the gene of the enzyme of the integration site, taking an agar solid culture medium of a substance which can be utilized by enzymolysis of the enzyme of the integration site as a screening culture medium, and screening recombinant engineering bacteria of which the exogenous gene integration plasmid is integrated into the bacillus subtilis through homologous double exchange by inactivating antibiotic resistance and the enzyme activity of the integration site.

Further preferably, the bacillus subtilis is a bacillus subtilis 168 derivative strain, and comprises 1a751, WB600 and WB 800.

In the present invention, further explained are:

firstly, the enzyme of the integration site is bacillus subtilis alpha-amylase;

the DNA sequence AB is the complete sequence of the bacillus subtilis alpha-amylase gene and is obtained by amplification of an AmyS/AmyA primer;

the DNA sequence A is a DNA sequence at the 5' end of the bacillus subtilis alpha-amylase gene, and the plasmid fragment containing the DNA sequence A is obtained by carrying out enzyme digestion and purification on a plasmid pUC1ABC containing the complete sequence of the bacillus subtilis alpha-amylase gene by Pst I;

the DNA sequence C is a DNA sequence behind a stop codon of the bacillus subtilis alpha-amylase gene and is obtained by amplifying an AEndS/AEndA primer;

the antibiotic resistance gene ARG is one of a neomycin resistance gene, a spectinomycin resistance gene, a chloramphenicol resistance gene and an erythromycin resistance gene;

in step S2, the antibiotic-containing solid culture medium is an LB solid culture medium containing 20ug/mL of neomycin, or an LB solid culture medium containing 100ug/mL of spectinomycin, or an LB solid culture medium containing 5ug/mL of chloramphenicol, or an LB solid culture medium containing 0.5ug/mL of erythromycin;

the agar solid medium for the enzymatically utilizable substance in step (3) is an agar solid medium containing only soluble starch.

Further, the primer sequences of AmyS, AmyA, AEndS and AEndA are as follows:

AmyS:5′-TTCGACGTCTCAAATAAGGAGTGTCA-3′；

AmyA:5′-TAGGAGCTCCCTCAATGGGGAAGAGA-3′；

AEndS:5′-AGGAAGCTTGGGACTTACCGAAAGAA-3′；

AEndA:5′-AATCAGCTGCTGCTTCCAACAAAACC-3′。

secondly, the enzyme of the integration site is bacillus subtilis sucrase;

the DNA sequence AB is the complete sequence of a sucrase gene of the bacillus subtilis and is obtained by amplifying InvS/InvA primers;

the DNA sequence A is a DNA sequence at the 5' end of a sucrase gene of bacillus subtilis and is obtained by InvS/InvP primer amplification;

the DNA sequence C is a DNA sequence behind a stop codon of a sucrase gene of the bacillus subtilis and is obtained by amplifying an IEnds/IEndA primer;

the antibiotic resistance gene ARG is one of a neomycin resistance gene, a spectinomycin resistance gene, a chloramphenicol resistance gene and an erythromycin resistance gene;

in step S2, the antibiotic-containing solid culture medium is an LB solid culture medium containing 20ug/mL of neomycin, or an LB solid culture medium containing 100ug/mL of spectinomycin, or an LB solid culture medium containing 5ug/mL of chloramphenicol, or an LB solid culture medium containing 0.5ug/mL of erythromycin;

the agar solid medium for the enzymatically utilizable substance in step (3) is an agar solid medium containing only sucrose.

Further, the InvS, InvA, InvP, IEndS and IEndA primer sequences are as follows:

InvS:5′-GAGGACGTCATGACAGCACATGACCAGGA-3′；

InvA:5′-TAGGAGCTCTTTCTACATAAGTGTCCAAATTCC-3′；

InvP:5′-CAACTGCAGCCCGCTTCCAATTCACA-3′；

IEndS:5′-CCTCTGCAGTTCTTATGTGAAATCTGAGC-3′；

IEndA:5′-AATAAGCTTTTGCAGATTTCCTCAAA-3′。

in summary, due to the adoption of the technical scheme, the invention has the beneficial effects that:

(1) antibiotic resistance genes are not needed to be used as a screening marker of the recombinant bacillus subtilis;

(2) the obtained recombinant Bacillus subtilis maintains the enzyme activity of the integration site and is used as a screening marker.

[ description of the drawings ]

Fig. 1 is a technical route chart specifically constructed in the present embodiment;

FIG. 2 is an electrophoretogram of plasmid digested with AatII/SacI,

wherein M is Marker D2000 molecular weight standard, and the bands are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom in sequence; the number 1 is an AatII/SacI enzyme digestion electrophoresis picture of the plasmid;

FIG. 3 is a diagram of the plasmid electrophoretogram using Hind III/PvuII,

wherein M is Marker III molecular weight standard, and the bands are 4500bp, 3000bp, 2000bp, 1200bp, 800bp, 500bp and 200bp from top to bottom; the number 1 is a HindIII/PvuII enzyme cutting electrophoresis picture of the plasmid;

FIG. 4 is an electrophoretogram of plasmid digested with Pst I,

wherein M is Marker III molecular weight standard, and the bands are 4500bp, 3000bp, 2000bp, 1200bp, 800bp, 500bp and 200bp from top to bottom; the number 1 is a plasmid cutting electrophoresis picture by Pst I;

FIG. 5 shows the electrophoresis of the plasmid digested with Hind III/Kpn I,

wherein M is Marker III molecular weight standard, and the bands are 4500bp, 3000bp, 2000bp, 1200bp, 800bp, 500bp and 200bp from top to bottom; the number 1 is a restriction electrophoresis picture of the plasmid by Hind III/Kpn I;

FIG. 6 is a diagram of plasmid double restriction with Pst I/Hind III,

wherein M is Marker III molecular weight standard, and the bands are 4500bp, 3000bp, 2000bp, 1200bp, 800bp, 500bp and 200bp from top to bottom; number 1 is a plasmid PstI/HindIII double-restriction enzyme electrophoretogram;

FIG. 7 is a diagram of the plasmid double-restriction with AatII/PstI electrophoresis,

wherein M is Marker D2000 molecular weight standard, and the bands are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom in sequence; the number 1 is an AatII/Pst I double-enzyme digestion electrophoretogram for the plasmid;

FIG. 8 is an electrophoretogram of plasmid digested with Pst I,

wherein M is Marker D2000 molecular weight standard, and the bands are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom in sequence; the number 1 is a plasmid cutting electrophoresis picture by Pst I;

FIG. 9 is a diagram of plasmid double-restriction electrophoresis using AatII/SacI,

wherein M is Marker III molecular weight standard, and the bands are 4500bp, 3000bp, 2000bp, 1200bp, 800bp, 500bp and 200bp from top to bottom; number 1 is the plasmid Aat II/SacI double enzyme cutting electrophoresis picture;

FIG. 10 shows a double-restriction electrophoresis of a plasmid with SalI/KpnI,

wherein M is Marker III molecular weight standard, and the bands are 4500bp, 3000bp, 2000bp, 1200bp, 800bp, 500bp and 200bp from top to bottom; the code 1 shows the plasmid electrophorogram cut with SalI/KpnI double enzyme.

[ detailed description ] embodiments

The present invention will be described in further detail with reference to specific examples. It will be understood that these examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.

Example 1: method for recovering and screening recon integrating mango ethylene receptor gene ETRlb into bacillus subtilis by utilizing activity of alpha-amylase as enzyme of bacillus subtilis integration site

1. Construction of integration plasmid

Synthesizing a primer:

AmyS:TTCGACGTCTCAAATAAGGAGTGTCA (Aat II restriction site underlined)

AmyA:TAGGAGCTCCCTCAATGGGGAAGAGA (SacI restriction site underlined)

AEndS:AGGAAGCTTGGGACTTACCGAAAGAA (HindIII restriction site underlined)

AEndA:AATCAGCTGCTGCTTCCAACAAAACC (PvuII restriction sites underlined)

Wherein AmyS/AmyA amplified is a bacillus subtilis alpha-amylase gene sequence, and AEndS/AEndA amplified is a DNA sequence behind a stop codon of the bacillus subtilis alpha-amylase gene. Extracting the genome DNA of the bacillus subtilis WB600 by using a bacterial genome DNA extraction kit (TIANGEN) and using the genome DNA as a template, and respectively amplifying by using primers AmyS/AmyA, AEnds/AEndA and DNA Polymerase PrimeSTAR HS DNA Polymerase (TAKARA), wherein the reaction system and conditions are as follows:

the reaction system was designed to be 100uL total system, specifically 5 XPCR Buffer (Buffer) 20uL, dNTPmix (deoxyribonucleoside triphosphate mixture) 5uL with concentration of 2.5mM, upstream and downstream primers each 2uL with concentration of 10mM, PrimeSTAR HS DNA Polymerase (TAKARA)2uL with concentration of 2.5U/uL, and DNA template 2uL (about 20ng), and the 100uL system was made up with sterilized water.

The reaction conditions are as follows: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s in a cycle, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1.5min, and 30 cycles; after the PCR reaction is cycled, the extension is continued for 10min at 72 ℃ and then the PCR product is stored at 16 ℃.

The amplified products are respectively recovered and purified by agarose gel with a DNA purification recovery kit (TIANGEN), the target fragment recovered by AmyS/AmyA is about 2.0kb, is a bacillus subtilis alpha-amylase gene sequence and is named as AB (in addition, A is used as an upstream homologous arm of the integrated plasmid, and the plasmid fragment containing the DNA sequence A in the embodiment is obtained by enzyme digestion of the plasmid containing AB); the desired fragment recovered from AENDS/AENDA was about 0.2kb, a DNA sequence after the stop codon of the Bacillus subtilis alpha-amylase gene, and was designated C (C as the downstream homology arm of the integrated plasmid).

Plasmid pUC19, plasmid pUC19 and DNA fragment AB were extracted with a plasmid Mini kit (TIANGEN) and digested simultaneously with AatII/SacI, respectively, and after digestion, agarose gel recovery and purification were carried out with a DNA purification recovery kit (TIANGEN), wherein a fragment of about 2.2kb was recovered from pUC19 and a fragment of about 2.0kb was recovered from DNA fragment AB, these fragments were ligated and transformed into E.coli DH 5. alpha. which was applied to LB screening plates containing 100ug/mL Amp, to which 40mL of X-gal stock and 4. mu.L of IPTG stock were added, and cultured overnight at 37 ℃. When the single colony on the screening plate grows to a proper size, the plate is placed at 4 ℃ for several hours to complete the color development. White single colonies were picked and cultured, the plasmids were purified and digested with AatII/SacI to give bands of about 2.0kb and about 2.2kb, which were in agreement with the theoretical size (FIG. 2), and the plasmid was pUC1 AB.

Plasmid pUC1AB and DNA fragment C were digested simultaneously with HindIII/PvuII, and after digestion, they were purified by agarose gel recovery using DNA purification recovery kit (TIANGEN), in which about 4.0kb fragment was recovered from pUC1AB and about 0.2kb fragment was recovered from DNA fragment C, and these two fragments were ligated and transformed into E.coli DH 5. alpha. and spread on LB screening plate containing 100ug/mL Amp and cultured overnight at 37 ℃. When the single colony on the screening plate grows to a proper size, selecting the single colony for culturing, carrying out enzyme digestion by Hind III/Pvu II to obtain bands with the sizes of about 4.0kb and about 0.2kb, wherein the bands are consistent with the theoretical size (figure 3), and the improved particle is named as pUC1ABC after sequencing verification.

Plasmid pUC1ABC and plasmid pVK73 were digested with Pst I, and the digested products were recovered and purified by agarose gel using DNA purification recovery kit (TIANGEN). Wherein pUC1ABC recovers an about 3.0kb fragment which retains a sequence at the 5' -end of the Bacillus subtilis alpha-amylase gene; pVK73 recovered an approximately 1.4kb fragment, which was the antibiotic Resistance gene ARG (antibiotic Resistance genes), specifically the neomycin Resistance gene. These two fragments were ligated and transformed into E.coli DH 5. alpha. and screened on LB solid plate containing 50ug/mL kanamycin, and single colonies were picked up, and the plasmid was digested with Pst I to obtain bands of about 2.9kb and about 1.4kb, which were identical to the theoretical size (FIG. 4), and the plasmid was pUC1 AC-NEO.

In this example, the exogenous gene was the mango ethylene receptor gene ETRlb deposited in this laboratory. Plasmid pUC1ABC and cloned plasmid pUC19-ETRlb of mango ethylene receptor gene ETRlb preserved in the laboratory are respectively cut by Hind III/Kpn I, and are recovered and purified by agarose gel using DNA purification recovery kit (TIANGEN) after enzyme cutting, wherein, pUC1ABC recovers about 4.2kb fragment, pUC19-ETRlb recovers about 2.3kb fragment, the two fragments are connected and transformed into Escherichia coli DH5 alpha, and the two fragments are coated on LB screening plate containing 100ug/mL Amp and cultured overnight at 37 ℃. When the single colony on the screening plate grows to a proper size, the single colony is picked up, the plasmid is subjected to quality improvement, and enzyme digestion is carried out by Hind III/Kpn I, so that bands with the sizes of about 4.2kb and about 2.3kb are obtained, and the bands are consistent with the theoretical size (figure 5), and the extracted plasmid is pUC1 ABC-ETRlb.

2. Construction of alpha-amylase inactivated Bacillus subtilis

After plasmid pUC1AC-NEO is linearized by restriction endonuclease Aat II, purified by a DNA product purification kit (TIANGEN), transformed into Bacillus subtilis WB600, coated on an LB plate containing 20ug/mL neomycin for screening, a grown single colony is spotted on two LB plates containing 1% (w/v) soluble starch in parallel, after overnight culture at 37 ℃, one of the plates is taken out and developed by gram iodine solution, and then screened by an anhydrous hydrolysis loop after being developed by the gram iodine solution, thus obtaining a transformant.

The following primers were synthesized: aam 1: GGTCTGATCGATGGGATGTC, respectively; aam 2: TCATCATCGCTCATCCATGT are provided. After the transformant was cultured overnight in LB medium, total DNA was extracted. PCR was then performed with primer pairs aam1/aam2 and aam1/AEndA, respectively. The PCR conditions were as follows:

aam1/aam 2: 20ul of PCR reaction system: DNA template (transformant total DNA)1ul (about 20ng), 10 XTaq Buffer2ul, 10pmol/ul dNTP 0.4ul, 10pmol/ul forward and reverse primers 0.5ul, 2.5U/ul Taq DNA polymerase 1ul, ddH2O to 20ul was added. PCR reaction procedure: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 10min at 72 ℃; storing at 4 deg.C;

aam 1/AEndA: 20ul of PCR reaction system: DNA template (transformant total DNA)1ul (about 20ng), 10 XTaq Buffer2ul, 10pmol/ul dNTP 0.4ul, 10pmol/ul forward and reverse primers 0.5ul, 2.5U/ul Taq DNA polymerase 1ul, ddH was added₂O to 20 ul. PCR reaction procedure: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 70 s; 10min at 72 ℃; storing at 4 deg.C;

if a transformant obtained about 1.8kb by PCR using the primer pair aam1/aam2 and about 470bp in the primer pair aam1/AEndA, the transformant was Bacillus subtilis WB600Amy in which the foreign gene was integrated into the chromosomal genome in a homologous double crossover manner^-Neo⁺。

3. Integration of exogenous genes into the Bacillus subtilis chromosomal genome

After plasmid pUC1ABC-ETRlb is linearized by restriction enzyme Aat II, the plasmid is purified by a DNA product purification kit (TIANGEN), and bacillus subtilis WB600Amy is transformed^-Neo⁺The DNA is spread on a screening plate containing 1% (w/v) soluble starch and 1.5% (w/v) agar, cultured overnight at 37 ℃, single colonies with larger growth are picked up and are respectively parallel spotted on an LB plate, an LB plate containing 1% (w/v) soluble starch and an LB plate containing 20ug/mL neomycin, after the overnight culture at 37 ℃, the LB plate containing 1% (w/v) soluble starch is developed by gram iodine solution, a hydrolysis ring is picked up after the development of the iodine solution of the LB plate containing 1% (w/v) soluble starch, a single colony which does not grow on the LB plate containing 20ug/mL neomycin is picked up to obtain a transformant, and the gram DNA is extracted after the overnight culture of the single colony in a culture medium. PCR was then performed with primer pair AmyS/AEndA. The PCR conditions were as follows:

20ul of PCR reaction system: DNA template (transformant total DNA)1ul (about 20ng), 10 XTaq Buffer2ul, 10pmol/ul dNTP 0.4ul, 10pmol/ul forward and reverse primers 0.5ul, 2.5U/ul Taq DNA polymerase 1ul, ddH was added₂O to 20 ul. PCR reaction procedure: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 10min at 72 ℃; storing at 4 deg.C;

if a transformant was PCR-transfected with the AmyS/AEndA primer pair to give a product of about 4.5kb (theoretically, the unsuccessfully integrated transformant could be PCR-transfected to give a product of about 2.3 kb), the transformant was Bacillus subtilis WB600Amy in which the foreign gene was integrated into the chromosomal genome in a homologous double crossover manner⁺[ETRlb]. (the technical route of construction of this example 1 is shown in FIG. 1).

Example 2: method for recovering and screening recombinant of mango ethylene receptor gene ETRlb integrated into bacillus subtilis by using activity of enzyme-sucrase of bacillus subtilis integration site

1. Construction of integration plasmid

Synthesizing a primer:

InvS:GAGGACGTCATGACAGCACATGACCAGGA (Aat II restriction site underlined)

InvA:TAGGAGCTCTTTCTACATAAGTGTCCAAATTCC (SacI restriction site underlined)

InvP:CAACTGCAGCCCGCTTCCAATTCACA (Pst I restriction site underlined)

IEndS:CCTCTGCAGTTCTTATGTGAAATCTGAGC (Pst I restriction site underlined)

IEndA:AATAAGCTTTTGCAGATTTCCTCAAA (HindIII restriction site underlined)

Wherein InvS/InvA amplified is a sequence of a sucrase gene of Bacillus subtilis, InvS/InvP amplified is a DNA sequence at the 5' end of the sucrase gene of Bacillus subtilis, and IEnds/IEndA amplified is a DNA sequence behind a stop codon of the sucrase gene of Bacillus subtilis. The genomic DNA of Bacillus subtilis WB600 was extracted with a bacterial genomic DNA extraction kit (TIANGEN) and used as a template, and amplified with primers InvS/InvA, InvS/InvP, IEnds/IEndA and DNA Polymerase PrimeSTAR HS DNA Polymerase (TAKARA), respectively, in the following reaction system and conditions:

the reaction system was designed to be 100uL total system, specifically 5 XPCR Buffer (Buffer) 20uL, dNTPmix (deoxyribonucleoside triphosphate mixture) 5uL with concentration of 2.5mM, upstream and downstream primers each 2uL with concentration of 10mM, PrimeSTAR HS DNA Polymerase (TAKARA)2uL with concentration of 2.5U/uL, and DNA template 2uL (about 20ng), and the 100uL system was made up with sterilized water.

The reaction conditions are as follows: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s in a cycle, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1.5min, and 30 cycles; after the PCR reaction is cycled, the extension is continued for 10min at 72 ℃ and then the PCR product is stored at 16 ℃.

Respectively carrying out agarose gel recovery and purification on the amplification products by using a DNA purification recovery kit (TIANGEN), wherein the target fragment recovered by InvS/InvA is about 1.4kb which is a sucrase gene sequence of bacillus subtilis and is named as AB; the target fragment recovered by InvS/InvP is about 0.3kb, is a DNA sequence of the 5' end of the sucrase gene of Bacillus subtilis, and is named A (A is used as the upstream homology arm of the integration plasmid); the target fragment recovered from IEnds/IEndA was about 0.3kb, a DNA sequence after the stop codon of the sucrase gene from Bacillus subtilis, and was designated C (C as the downstream homology arm of the integrated plasmid).

Plasmid pUC19, plasmid pUC19 and DNA fragment C were each double digested with Pst I/Hind III using a plasmid miniprep kit (TIANGEN), and after digestion, agarose gel recovery and purification using a DNA purification recovery kit (TIANGEN) were performed, in which a fragment of about 2.7kb was recovered from pUC19 and a fragment of about 0.3kb was recovered from DNA fragment C, and these two fragments were ligated and transformed into E.coli DH 5. alpha. and spread on LB screening plates containing 100ug/mL Amp, to which 40mL of X-gal stock and 4. mu.L of IPTG stock were added, and cultured overnight at 37 ℃. When the single colony on the screening plate grows to a proper size, the plate is placed at 4 ℃ for several hours to complete the color development. White single colonies were picked and cultured, the plasmids were removed and digested simultaneously with Pst I/Hind III to give bands of about 2.7kb and about 0.3kb, corresponding to the theoretical size (FIG. 6), the plasmid named pUC 2C.

Plasmid pUC2C and DNA fragment A were each digested simultaneously with AatII/Pst I, and after digestion, they were purified by agarose gel recovery using DNA purification recovery kit (TIANGEN), in which about 2.5kb fragment was recovered from pUC2C and about 0.3kb fragment was recovered from DNA fragment A, and these two fragments were ligated and transformed into E.coli DH 5. alpha. and spread on LB screening plate containing 100ug/mL Amp and cultured overnight at 37 ℃. When the single colony on the screening plate grows to a proper size, the single colony is picked, the quality-improved particle is subjected to double enzyme digestion by AatII/PstI, bands with the sizes of about 2.5kb and about 0.3kb are obtained, the bands are consistent with the theoretical size (figure 7), and the extracted plasmid is pUC2 AC.

Plasmid pUC2AC and plasmid pVK73 were digested with Pst I, and the digested products were purified by agarose gel recovery using a DNA purification recovery kit (TIANGEN). Wherein pUC2AC recovered an approximately 2.7kb fragment; pVK73 recovered an approximately 1.4kb fragment, which was the antibiotic Resistance gene ARG (antibiotic Resistance genes), specifically the neomycin Resistance gene. These two fragments were ligated, transformed into E.coli DH 5. alpha. and spread on LB screening plates containing 50ug/mL kanamycin and cultured overnight at 37 ℃. When the single colony on the screening plate grows to a proper size, the single colony is picked, the plasmid is subjected to quality improvement, enzyme digestion is carried out by Pst I, bands with the sizes of about 2.7kb and about 1.4kb are obtained, the bands are consistent with the theoretical size (figure 8), and the extracted plasmid is pUC2 AC-NEO.

Plasmid pUC2C and DNA fragment AB were each digested simultaneously with AatII/SacI, and after digestion, they were purified by agarose gel recovery using a DNA purification recovery kit (TIANGEN), in which about 2.5kb fragment was recovered from pUC2C and about 1.4kb fragment was recovered from DNA fragment AB, and these two fragments were ligated and transformed into E.coli DH 5. alpha. and spread on LB screening plate containing 100ug/mL Amp and cultured overnight at 37 ℃. When the single colony on the screening plate grows to a proper size, the single colony is picked, the quality-improved particle is subjected to double enzyme digestion by AatII/SacI, bands with the sizes of about 2.5kb and about 1.4kb are obtained and are consistent with the theoretical size (figure 9), and the quality-improved particle is named as pUC2ABC after sequencing verification.

In this example, the exogenous gene was the mango ethylene receptor gene ETRlb deposited in this laboratory. Plasmid pUC2ABC and cloned plasmid pUC19-ETRlb of mango ethylene receptor gene ETRlb preserved in the laboratory are respectively cut by SalI/Kpn I, and are recovered and purified by agarose gel using DNA purification recovery kit (TIANGEN) after being cut by enzyme, wherein, pUC2ABC recovers about 3.9kb fragment, pUC19-ETRlb recovers about 2.2kb fragment, the two fragments are connected and transformed into Escherichia coli DH5 alpha, and the Escherichia coli DH5 alpha is coated on LB screening plate containing 100ug/mL Amp and cultured overnight at 37 ℃. When the single colony on the screening plate grows to a proper size, the single colony is picked, the plasmid is subjected to quality improvement, double digestion is carried out by SalI/KpnI, bands with the sizes of about 3.9kb and about 2.2kb are obtained, the bands are consistent with the theoretical size (figure 10), and the extracted plasmid is pUC2 ABC-ETRlb.

2. Construction of sucrase-inactivated Bacillus subtilis

After plasmid pUC2AC-NEO was linearized with restriction enzyme AatII, it was purified with DNA product purification kit (TIANGEN), transformed into Bacillus subtilis WB600, and spread on LB plate containing 20ug/mL neomycin to obtain transformants.

The following primers were synthesized: InvN: CGCTGGCTCCGAGTGAT are provided. After the transformant was cultured overnight in LB medium, total DNA was extracted. PCR was then performed with primer pairs InvN/IENDA and InvS/IENDA, respectively. The PCR conditions were as follows:

InvN/IEndA: 20ul of PCR reaction system: DNA template (transformant total DNA)1ul (about 20ng), 10 XTaq Buffer2ul, 10pmol/ul dNTP 0.4ul, 10pmol/ul forward and reverse primers 0.5ul, 2.5U/ul Taq DNA polymerase 1ul, ddH2O to 20ul was added. PCR reaction procedure: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 10min at 72 ℃; storing at 4 deg.C;

InvS/IEndA: 20ul of PCR reaction system: DNA template (transformant total DNA)1ul (about 20ng), 10 XTaq Buffer2ul, 10pmol/ul dNTP 0.4ul, 10pmol/ul forward and reverse primers each 0.5ul, 2.5U/ul Taq DNA polymerase 1ul, ddH was added₂O to 20 ul. PCR reaction procedure: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 70 s; 10min at 72 ℃; storing at 4 deg.C;

if a transformant does not produce a product of about 1.5kb by PCR using the InvN/IEndA primer set, but produces a product of about 1.9kb by PCR using the InvS/IEndA primer set, the transformant is a strain of Bacillus subtilis WB600Ine in which a foreign gene is integrated into the chromosomal genome in a homologously double crossover manner^-Neo⁺。

3. Integration of exogenous genes into the Bacillus subtilis chromosomal genome

After plasmid pUC2ABC-ETRlb is linearized by restriction enzyme Aat II, the plasmid is purified by a DNA product purification kit (TIANGEN), and transformed into bacillus subtilis WB600Ine^-neo⁺The single colony is spread on a plate containing 1% (w/v) sucrose and 1.5% (w/v) agar, cultured at 37 ℃ overnight, the single colony growing to be larger is selected, the single colony is respectively spotted on an LB plate and an LB plate containing 20ug/mL neomycin in parallel, after the overnight culture at 37 ℃, the single colony growing on the LB plate containing 20ug/mL neomycin is selected to obtain a transformant, and the single colony is cultured in an LB culture medium overnight to extract total DNA. PCR was then performed with primer pair InvS/IENDA. The PCR conditions were as follows:

20ul of PCR reaction system: DNA template (transformant total DNA)1ul (about 20ng), 10 XTaq Buffer2ul, 10pmol/ul dNTP 0.4ul, 10pmol/ul forward and reverse primers 0.5ul, 2.5U/ul Taq DNA polymerase 1ul, ddH was added₂O to 20 ul. PCR reaction procedure: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 10min at 72 ℃; storing at 4 deg.C;

if a transformant was PCR-transfected with the InvS/IEndA primer pair to give a product of about 4.0kb (theoretically, the unsuccessfully integrated transformant could be PCR-transfected to give a product of about 1.9 kb), then this transformant was a strain having the foreign gene integrated into the chromosomal genome by homologous double crossoverBacillus WB600Ine⁺[ETRlb](the technical route of construction of this example 2 is shown in FIG. 1).

The above examples are merely illustrative of several embodiments of the present invention, and the description thereof is more specific and detailed, but not to be construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present invention should be subject to the appended claims.

Sequence listing

<110> institute for agricultural product processing of Guangxi Zhuang nationality academy of agricultural sciences

<120> a method for screening integrated recombinants by recovering the activity of an enzyme of an integration site of Bacillus subtilis

<141> 2018-12-29

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213> Artificial sequence (Artificial sequence Latin)

<400> 1

ttcgacgtct caaataagga gtgtca 26

<210> 2

<211> 26

<212> DNA

<213> Artificial sequence (Artificial sequence Latin)

<400> 2

taggagctcc ctcaatgggg aagaga 26

<210> 3

<211> 26

<212> DNA

<213> Artificial sequence (Artificial sequence Latin)

<400> 3

aggaagcttg ggacttaccg aaagaa 26

<210> 4

<211> 26

<212> DNA

<213> Artificial sequence (Artificial sequence Latin)

<400> 4

aatcagctgc tgcttccaac aaaacc 26

<210> 5

<211> 29

<212> DNA

<213> Artificial sequence (Artificial sequence Latin)

<400> 5

gaggacgtca tgacagcaca tgaccagga 29

<210> 6

<211> 33

<212> DNA

<213> Artificial sequence (Artificial sequence Latin)

<400> 6

taggagctct ttctacataa gtgtccaaat tcc 33

<210> 10

<211> 26

<212> DNA

<213> Artificial sequence (2 Ambystoma latex x Ambystoma jeffersonia)

<400> 10

caactgcagc ccgcttccaa ttcaca 26

<210> 8

<211> 29

<212> DNA

<213> Artificial sequence (Artificial sequence Latin)

<400> 8

cctctgcagt tcttatgtga aatctgagc 29

<210> 9

<211> 26

<212> DNA

<213> Artificial sequence (Artificial sequence Latin)

<400> 9

aataagcttt tgcagatttc ctcaaa 26

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence Latin)

<400> 10

ggtctgatcg atgggatgtc 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence Latin)

<400> 11

tcatcatcgc tcatccatgt 20

<210> 12

<211> 17

<212> DNA

<213> Artificial sequence (Artificial sequence Latin)

<400> 12

cgctggctcc gagtgat 17

Claims (4)

1. A method for screening integrated recombinants by utilizing the activity recovery of enzymes of Bacillus subtilis integrated sites is characterized by comprising the following specific steps:

(1) constructing resistance gene integration plasmid, transforming bacillus subtilis, and screening the inactivated bacillus subtilis with the deletion of the 3' end of the gene of the enzyme of the obtained integration site as a host bacterium, wherein the specific operation is as follows:

s1, constructing a resistance gene integration plasmid which enables the 3' end of the enzyme gene of the integration site to be deleted and inactivated, wherein the homologous double-exchange DNA sequence of the integration plasmid is A-ARG-C;

wherein A represents an upstream homology arm which is a DNA sequence of the 5' end of the enzyme gene of the Bacillus subtilis integration site;

c represents a downstream homology arm, which is a DNA sequence after the termination codon of the enzyme gene of the integration site;

the ARG between the homologous arms is an antibiotic resistance gene;

s2, screening the inactivated Bacillus subtilis with the deletion of the 3' end of the gene of the enzyme of the integration site: transforming the bacillus subtilis by the linearized resistance gene integration plasmid, culturing and screening the bacillus subtilis on a solid culture medium containing antibiotics, and obtaining the bacillus subtilis inactivated by deletion of the 3' end of the gene of the enzyme of the integration site through antibiotic resistance and enzyme inactivation of the integration site;

(2) constructing exogenous gene integration plasmid, wherein the homologous double-exchange DNA sequence is AB-EGEU-C;

wherein AB is the complete sequence of the enzyme gene of the Bacillus subtilis integration site;

c represents a downstream homology arm which is a DNA sequence after an enzyme gene stop codon of an integration site;

the EGEU between homologous arms is an exogenous gene expression unit;

(3) screening the bacillus subtilis with the exogenous gene integrated into the bacillus subtilis integration site: the method comprises the steps of transforming the linearized exogenous gene integration plasmid into the bacillus subtilis inactivated by deleting the 3' end of the gene of the enzyme of the integration site, taking an agar solid culture medium of a substance which can be utilized by enzymolysis of the enzyme of the integration site as a screening culture medium, and screening recombinant engineering bacteria of which the exogenous gene integration plasmid is integrated into the bacillus subtilis through homologous double exchange by inactivating antibiotic resistance and the enzyme activity of the integration site.

2. The method for screening integration recombinants by recovering activity of enzyme using integration site of Bacillus subtilis according to claim 1, wherein the Bacillus subtilis is Bacillus subtilis 168-derived strain, and the Bacillus subtilis 168-derived strain is 1A751, WB600 and WB 800.

3. The method of screening for integration recombinants using recovery of activity of an enzyme of Bacillus subtilis integration site according to claim 1,

the enzyme of the integration site is bacillus subtilis alpha-amylase;

the DNA sequence AB is the complete sequence of the bacillus subtilis alpha-amylase gene and is obtained by amplification of an AmyS/AmyA primer; the sequence of the AmyS primer is as follows: 5'-TTCGACGTCTCAAATAAGGAGTGTCA-3', respectively; the sequence of the AmyA primer is as follows: 5'-TAGGAGCTCCCTCAATGGGGAAGAGA-3', respectively;

the DNA sequence A is a DNA sequence at the 5' end of the bacillus subtilis alpha-amylase gene, and the plasmid fragment containing the DNA sequence A is obtained by carrying out enzyme digestion and purification on a plasmid pUC1ABC containing the complete sequence of the bacillus subtilis alpha-amylase gene by Pst I;

the DNA sequence C is a DNA sequence behind a stop codon of the bacillus subtilis alpha-amylase gene and is obtained by amplifying an AEndS/AEndA primer; the sequence of the AEnds primer is as follows: 5'-AGGAAGCTTGGGACTTACCGAAAGAA-3', respectively; the sequence of the AEndA primer is as follows: 5'-AATCAGCTGCTGCTTCCAACAAAACC-3', respectively;

the antibiotic resistance gene ARG is one of a neomycin resistance gene, a spectinomycin resistance gene, a chloramphenicol resistance gene and an erythromycin resistance gene;

in step S2, the antibiotic-containing solid culture medium is an LB solid culture medium containing 20ug/mL of neomycin, or an LB solid culture medium containing 100ug/mL of spectinomycin, or an LB solid culture medium containing 5ug/mL of chloramphenicol, or an LB solid culture medium containing 0.5ug/mL of erythromycin;

the agar solid medium for the enzymatically utilizable substance in step (3) is an agar solid medium containing only soluble starch.

4. The method of screening for integration recombinants using recovery of activity of an enzyme of Bacillus subtilis integration site according to claim 1,

the enzyme of the integration site is bacillus subtilis sucrase;

the DNA sequence AB is the complete sequence of a sucrase gene of the bacillus subtilis and is obtained by amplifying InvS/InvA primers; the InvS primer has the sequence as follows: 5'-GAGGACGTCATGACAGCACATGACCAGGA-3', respectively; the InvA primer has the sequence as follows: 5'-TAGGAGCTCTTTCTACATAAGTGTCCAAATTCC-3', respectively;

the DNA sequence A is a DNA sequence at the 5' end of a sucrase gene of bacillus subtilis and is obtained by InvS/InvP primer amplification; the InvS primer has the sequence as follows: 5'-GAGGACGTCATGACAGCACATGACCAGGA-3', respectively; the InvP primer has the sequence as follows: 5'-CAACTGCAGCCCGCTTCCAATTCACA-3', respectively;

the DNA sequence C is a DNA sequence behind a stop codon of a sucrase gene of the bacillus subtilis and is obtained by amplifying an IEnds/IEndA primer; the IEnds primer has the sequence as follows: 5'-CCTCTGCAGTTCTTATGTGAAATCTGAGC-3', respectively; the IEndA primer has the sequence as follows: 5'-AATAAGCTTTTGCAGATTTCCTCAAA-3', respectively;

the antibiotic resistance gene ARG is one of a neomycin resistance gene, a spectinomycin resistance gene, a chloramphenicol resistance gene and an erythromycin resistance gene;

in step S2, the antibiotic-containing solid culture medium is an LB solid culture medium containing 20ug/mL of neomycin, or an LB solid culture medium containing 100ug/mL of spectinomycin, or an LB solid culture medium containing 5ug/mL of chloramphenicol, or an LB solid culture medium containing 0.5ug/mL of erythromycin;

the agar solid medium for the enzymatically utilizable substance in step (3) is an agar solid medium containing only sucrose.

Images