CN105063078A - Construction method of recombinant bacillus subtilis for integration and expression of foreign protein by virtue of Tn7 transposable element - Google Patents
Construction method of recombinant bacillus subtilis for integration and expression of foreign protein by virtue of Tn7 transposable element Download PDFInfo
- Publication number
- CN105063078A CN105063078A CN201510467499.1A CN201510467499A CN105063078A CN 105063078 A CN105063078 A CN 105063078A CN 201510467499 A CN201510467499 A CN 201510467499A CN 105063078 A CN105063078 A CN 105063078A
- Authority
- CN
- China
- Prior art keywords
- subtilis
- gene
- foreign protein
- integration
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a construction method of recombinant bacillus subtilis for integration and expression of foreign protein by virtue of a Tn7 transposable element; specifically, the construction method comprises the following steps: constructing a transposable integration and expression plasmid containing an antibiotics resistance gene, transposable Tn7 left and right arm boxes, a multiple cloning site and Tn7 transposase TnsABCD segments as well as an escherichia coli replicon pBRe322 ori and a bacillus subtilis temperature-sensitive replicon; interpolating a bacillus subtilis promoter, signal peptide, foreign protein gene and like expression elements into the transposable integration and expression plasmid, and converting to a bacillus subtilis host, so that the foreign protein gene is integrated and expressed on an attTn7 site at downstream 3' end of bacillus subtilis glms gene; and implementing fluctuation temperature culture so that the temperature-sensitive replicon on the plasmid becomes ineffective, thus obtaining recombinant bacillus subtilis that an integration plasmid containing the antibiotics resistance gene and the Tn7 transposase is not reserved anymore. The construction method disclosed by the invention has the advantages that stable foreign gene transposable integration is obtained, and the recombinant bacterium is free from an antibiotics resistance gene and is consistent with food safety requirements.
Description
Technical field
The present invention relates to biological technical field, specifically a kind of recombined bacillus subtilis construction process utilizing Tn7 transposable element integrative gene expression foreign protein.
Background technology
In the production of food and medicine active protein, genetic engineering technique is adopted to carry out to activated protein plasmagene the effective ways that heterogenous expression has been proved to be to improve output and purity.As conventional genetically engineered Host Strains, rapidly, cultivate simple, fermentation costs is lower, and also do not have complicated proteolytic enzyme system, recombinant protein is more stable, thus becomes the good host of Restruction protein in Escherichia coli Growth breeding.But still there are some defects for the production of foodstuffs industry enzyme in intestinal bacteria, mainly contains: 1. intestinal bacteria are not generally recognized as safe bacterial strains; 2., in the high density fermentation of recombination bacillus coli, expression plasmid is often easy to due to structural instability and segregational instability lose.In order to keep the genetic stability of expression of recombinant e. coli plasmid, often need to apply selective pressure, selective pressure the most frequently used at present adds microbiotic.Add the metabolic burden that antibiotic selective pressure can increase thalline undoubtedly, increase production cost, cause antibiotic remains in finished product, cause resistant gene diffusion in the environment.For food and medicine recombinant protein, in product, residual antibiotic is forbidden by countries in the world gradually.
Generally recognized as safe microorganism mainly contains milk-acid bacteria and subtilis etc. in aspergillus tubigensis in fungi and yeast, bacterium, the applicating history that wherein natural subtilis is existing long in the food industry, the understanding of people to its genetic background and physiological property is only second to intestinal bacteria; The recombined bacillus subtilis speed of growth is faster compared with fungi, zymoprotein can be secreted into extracellular, and without the need to cytoclasis, separation purifying technique is easy, and expression product is solvable, correctly can fold, and have biological activity; Therefore subtilis integrative gene expression food activated protein plasmagene is adopted to be good selection.The foreign gene integrated copies with subtilis chromosomal DNA and copies, in most of the cases quite stable, recombinant bacterium not to use under antibiotic selective pressure and continuous passage can cultivate and do not lose expression casette, can solve microbiotic problem from source, this is very meaningful to production food active protein product.
Exogenous origin gene integrator to karyomit(e) will can adopt the method for homologous recombination and swivel base restructuring, the frequency that traditional RecA and λ Red homologous recombination system restructuring occurs is lower, complex operation, but also can build the integrative gene expression subtilis of single copy and the integrative gene expression subtilis (Li Xiaoming etc. of more multiple copied, with the method for integrated recombined bacillus subtilis for bacterial classification production a-acetolactate decarboxylase, patent No. ZL201010271749.1; Li Xiaoming etc., a kind of in subtilis with the method for the recombinant expressed beta-amylase of integrated mode, patent No. ZL201010563646.2; Two or more exogenous gene expression unit are incorporated into the method for the same integration site of subtilis karyomit(e), patent No. ZL201010563647.7 by Liao Dongqing etc.).It is still need to retain antibiotic resistance gene in integrated DNA fragmentation that homologous recombination integrates the shortcoming existed, to filter out the recon of Homo~logous exchange generation.And compared with homologous recombination method, swivel base restructuring does not need antibiotics resistance gene to be incorporated into subtilis karyomit(e), and the integrated plasmid containing resistant gene and transposase can be driven away and Host Strains, obtain the exogenous origin gene integrator expression of inheritance stability.
Summary of the invention
The object of this invention is to provide a kind of recombined bacillus subtilis construction process utilizing Tn7 transposable element integrative gene expression foreign protein, integrate to solve homologous recombination the problem still needing to retain antibiotic resistance gene in integration fragment.
The technical scheme that the present invention achieves the above object is as follows:
1. one kind utilizes the recombined bacillus subtilis construction process of Tn7 transposable element integrative gene expression foreign protein to be a kind of for the transposition integration plasmid subtilis by building, insert Transforming B. subtilis after foreign protein genes and Expression element thereof, Tn7 transposase TnsABCD is produced, by the attTn7 site that foreign protein genes and Expression element transposition integration thereof are held to subtilis karyomit(e) glms downstream of gene 3 ' by induction; Then Fluctuation temperature culture is passed through, culture temperature is brought up to 33 ~ 37 DEG C from 26 ~ 30 DEG C, make the temperature-sensitive replicon that turns on integrative gene expression plasmid ineffective, no longer retained the recombined bacillus subtilis of the transposition integration plasmid containing antibiotics resistance gene and Tn7 transposase.Forwarded to by bacterium colony and do not cultivate containing in antibiotic liquid nutrient media, the bacterial strain that can give expression to active protein is the recombined bacillus subtilis that required transposition integration expresses foreign protein genes.
Above-mentioned nutritional medium is conventional Nutrious fermented substratum, comprises peptone or protolysate 1 ~ 50g/L, yeast extract 1 ~ 25g/L, sodium-chlor 1 ~ 15g/L.
2. utilize Tn7 transposable element by foreign protein genes and Expression element transposition integration thereof to subtilis, steps of the method are: build a kind of transposition integration plasmid for subtilis, insert Transforming B. subtilis after foreign protein genes and Expression element thereof, Tn7 transposase TnsABCD is produced, by the attTn7 site that foreign protein genes and Expression element transposition integration thereof are held to subtilis karyomit(e) glms downstream of gene 3 ' by induction.
The above-mentioned transposition integration plasmid for subtilis, include following component: can in intestinal bacteria plasmid replication replicon and can in subtilis the temperature sensitive replicon of plasmid replication, containing antibiotics resistance gene, Tn7 transposon left and right arms box, multiple clone site, Tn7 transposase TnsABCD fragment and abduction delivering element thereof.
The above-mentioned replicon that can be used for plasmid replication in escherichia coli host can be pBR322ori, or colE1ori; Can be used for the temperature sensitive replicon of plasmid replication in subtilis is pWV01ori/ts, is characterized in can exercising copy function at about 28 DEG C, but loses replication about 35 DEG C time.
The above-mentioned antibiotics resistance gene that can use in subtilis can be chloramphenicol resistance gene, neomycin resistance gene, erythromycin resistance gene or spectinomycin resistance gene etc.This antibiotics resistance gene is cloned in outside Tn7 left arm and right arm, can not by transposition integration on subtilis karyomit(e) when swivel base is recombinated.
Tn7 transposase TnsABCD is used to identify and shear Tn7 swivel base fragment, identify attTn7 swivel base site and impel Tn7 swivel base fragment to be inserted into this site.Above-mentioned Tn7 transposase TnsABCD can use arabinose operon, and comprise and suppress sub-araC and promotor Pbad to carry out abduction delivering, or with lactose operon, comprise repressor gene lacI, operator gene lacO and promotor lacP carrys out abduction delivering.
The above-mentioned foreign protein genes of expressing for subtilis transposition integration can be enzyme, antibacterial peptide isoreactivity protein gene.The Expression element of above-mentioned foreign protein genes, comprises following component: can in subtilis the promotor of efficient transcription as P43 promotor, or Pamy promotor; The signal peptide fragment of efficient secretion is as sacB signal peptide fragment, or amyQ signal peptide fragment.Above-mentioned foreign protein genes and Expression element thereof are cloned in the multiple clone site between Tn7 left arm and right arm.
The above-mentioned subtilis host for transposition integration is that subtilis 168 derivative strain is as 1A751, WB600, WB800 etc.
Advantage of the present invention is:
The present invention utilizes the high integration efficiency of Tn7 transposable element, easily obtains the site-directed integration restructuring of foreign protein genes on subtilis karyomit(e); Utilize the effect of temperature sensitive replicon simultaneously, integrated plasmid containing antibiotics resistance gene can be driven away by Fluctuation temperature culture, obtain the transposition integration recombinant bacterium of the inheritance stability not containing antibiotics resistance gene and transposase, do not need to add microbiotic when this recombinant bacterium that ferments produces active protein, meet the requirement of food safety yet.
Embodiment
Below by way of specific embodiment, technical scheme of the present invention is further described, but these embodiments are not appreciated that limitation of the present invention.
Embodiment 1
The present embodiment illustrates the recombined bacillus subtilis construction process utilizing Tn7 transposable element transposition integration to express beta-glucanase gene.
The beta-glucanase gene of the present embodiment is the beta-glucanase gene from Bacillussubtilis.The structure that beta-glucanase gene transposition integrates recombined bacillus subtilis expression strain is specific as follows:
1, will containing araC (suppression in arabinose operon), Pbad (araBAD promotor), the plasmid of intestinal bacteria replicon pBR322ori and bla (ammonia benzyl resistant gene), size as Invitrogen is the plasmid pBAD/His-A of 4.1kb, pBAD/His-A is cut with BspHI enzyme, remove the bla fragment of about 1kb, reclaim 3.1kb fragment.
2, with containing the temperature sensitive replicon pWV01ori/ts of subtilis, the plasmid of chloramphenicol resistance gene cat, plasmid pAW016 as the preservation of Nanning Xin Jian biotechnology limited liability company is template, use primer AflIII-CmFOR:gcACATGTttataaaagccagtcattag, with primer AflIII-wv01tsRE:gaACATGTgatcattttgtttattgcaattg, pcr amplification is about the cat+pWV01ori/ts fragment of 3kb, and PCR primer is run glue, reclaims.
3, the PCR primer of PCR step 2 is cut with AflIII enzyme, purifying; Be connected with the 3.1kbBspHI fragment of the pBAD/His-A of step 1, be transformed into E. coli DH5alpha.
4, with NcoI digestion verification transformant, select the transformant obtaining 2.9kb and 3.2kb two band, namely build and obtain intestinal bacteria and B. subtilis shuttle vector pBAD-pWV01ori.
5, with containing Tn7 transposon left and right arms box Tn7L-MCS-Tn7R, araC, the plasmid of Pbad and the Tn7 transposase TnsABCD under it, if plasmid pGRG36 is template, use primer SbfI-Tn7LFOR:aaCCTGCAGGctttcagcctgtgggc, and primer BstBI-TnsDRE:ccTTCGAAtcactcttccccataaacc, pcr amplification is about the Tn7L-MCS-Tn7R-araC-Pbad-TnsABCD fragment of 8kb, template is digested, this PCR primer of purifying with DpnI.
6, by the PCR primer of SbfI and BstBI double digestion step 5, purifying.
7, with the plasmid pBAD-pWV01ori of NsiI and BstBI double digestion step 4, the NsiI-pBR322ori-cat-pWV01ori/ts-BstBI fragment of 3.8kb is reclaimed.
8, the DNA fragmentation of step 6 is connected with the DNA fragmentation of step 7, transformation of E. coli E.coliDH5alpha.Transformant is containing the temperature sensitive replicon pWV01ori of subtilis, chloramphenicol resistance gene, Tn7 transposon left and right arms box, the transposition integration plasmid of multiple clone site and Tn7 transposase TnsABCD fragment, called after pNKTN701.
9, P43 promotor is cloned, sacB signal peptide and beta-glucanase gene also insert pNKTN701: with the plasmid with sacB signal peptide, plasmid pWB980 as the preservation of Nanning Xin Jian biotechnology limited liability company is template, use primer BglII-sacBSPFOR:gAAgATCTATGAACATCAAAAAGTTTGC, with primer SalI-sacBSPRE:TACGCGTCGACGGCAAACGCTTGAGT, pcr amplification sacB signal peptide fragment, runs PCR primer about glue, reclaims the fragment of about 100bP; PCR primer is cut, purifying with BglII and SalI enzyme; Be connected with the pHY-P43 plasmid 5.1kbBglII-SalI fragment containing P43 promotor, be transformed into E. coli DH5alpha.With BglII and SalI double digestion checking transformant, select to obtain the transformant of 5.1kb and 0.1kb two band, sequence verification, namely build and obtain containing P43 promotor and sacB signal peptide intestinal bacteria and B. subtilis shuttle vector pHY-P43sacBSP; From plasmid pNKglu SalI and the BamHI double digestion recovery 0.7kb beta-glucanase gene of the preservation of Nanning Xin Jian biotechnology limited liability company, be connected with pHY-P43sacBSP plasmid 5.2kbSalI-BamHI fragment, be transformed into E. coli DH5alpha.With SalI and BamHI double digestion checking transformant, select the transformant obtaining 5.2kb and 0.7kb two band, namely build the intestinal bacteria obtained containing P43 promotor-sacB signal peptide-beta-glucanase gene and B. subtilis shuttle vector pHY-P43sacBSPglu; PHY-P43sacBSPglu BglII-BamHI double digestion is filled and led up two ends with Klenow, reclaims P43 promotor-sacB signal peptide-beta-glucanase gene fragment afterwards; Integrated plasmid pNKTN701 is carried out Sma I single endonuclease digestion and dephosphorylation, is connected to P43 promotor-sacB signal peptide-beta-glucanase gene fragment; Connect product conversion to E.coliDH5alpha, obtain exact connect ion product through fast cermet of inspection;
10, by the connection product conversion of step 9 to subtilis host WB800,28 DEG C containing overnight incubation on paraxin LB flat board, obtain chloramphenicol resistant strain, by this bacterial strain 28 DEG C of overnight incubation in not containing paraxin, LB liquid nutrient medium containing 0.1% pectinose, the attTn7 site that induction P43 promotor-sacB signal peptide-beta-glucanase gene fragment fixed point transposition integration is held to subtilis glms downstream of gene 3 '.
11, by the overnight culture dilution spread of step 10 not containing paraxin, the LB containing 0.1% glucose is dull and stereotyped, forwards 35 DEG C to and is cultured to and grows single bacterium colony.
12, the recombined bacillus subtilis list bacterium colony of picking step 11, be inoculated into not containing in the LB liquid nutrient medium of paraxin, 37 DEG C, 220r/min cultivates 36 hours, centrifugal 5 minutes of 10000r/min, gets supernatant liquor and measures activity of beta-glucanase.The mensuration of activity of beta-glucanase is carried out by the following method: draw the enzyme liquid of 1.0ml through suitably dilution (with 0.1mol/L acetic acid-sodium acetate buffer solution (pH6.0) dilution, through 60 DEG C of balances), join in scale test tube, add 9.0ml beta-glucan (0.2% again, through 60 DEG C of balances), electromagnetic oscillation 3s, 60 DEG C of insulation reaction 10min, be placed in ice-water bath 2min termination reaction, mixing, draw 1.0ml reaction soln to 10ml tool plug test tube, add 1.0mlDNS reagent (first liquid: take the NaOH solution that 6.9g crystalline phenol is dissolved in 15.2ml10%, with distilled water diluting to 69ml, add 6.9g sodium bisulfite again, second liquid: take the NaOH solution that 255g Seignette salt is dissolved in 300ml10%, then 3, the 5-dinitrosalicylic acid solutions adding 880ml1%, first liquid and second liquid are mixed to get yellow agents and store in brown bottle, under room temperature, lucifuge makes typical curve (again will make typical curve after each preparation) after placing 7 days), electromagnetic oscillation 3s, boiling water bath heating 5min, room temperature is cooled to tap water, add water and be settled to 10.0ml, electromagnetic oscillation 3s.Replace sample solution for blank with the sample solution after deactivation, measure absorbancy at 540nm place.Enzyme activity is defined as: 60 DEG C, under pH6.0 condition, per minute is hydrolyzed the enzyme amount that 0.2% beta-glucan liquid generates 1 μm of ol glucose, is 1 enzyme activity unit (U).It is the transposition integration recombined bacillus subtilis expression strain that the bacterium colony of 5.4-28.8U/ml is acquisition that this batch measures activity of beta-glucanase.
Embodiment 2
The present embodiment illustrates the recombined bacillus subtilis construction process utilizing Tn7 transposable element transposition integration expressed xylanase gene.
The xylanase gene of the present embodiment is the xylanase gene from Bacillusstearothermophilus.The structure of xylanase gene transposition integration recombined bacillus subtilis expression strain is specific as follows:
1, will containing araC (suppression in arabinose operon), Pbad (araBAD promotor), the plasmid of intestinal bacteria replicon pBR322ori and bla (ammonia benzyl resistant gene), size as Invitrogen is the plasmid pBAD/His-A of 4.1kb, pBAD/His-A is cut with BspHI enzyme, remove the bla fragment of about 1kb, reclaim 3.1kb fragment.
2, with containing the temperature sensitive replicon pWV01ori/ts of subtilis, the plasmid of chloramphenicol resistance gene cat, plasmid pAW016 as the preservation of Nanning Xin Jian biotechnology limited liability company is template, use primer AflIII-CmFOR:gcACATGTttataaaagccagtcattag, with primer AflIII-wv01tsRE:gaACATGTgatcattttgtttattgcaattg, pcr amplification is about the cat+pWV01ori/ts fragment of 3kb, and PCR primer is run glue, reclaims.
3, the PCR primer of PCR step 2 is cut with AflIII enzyme, purifying; Be connected with the 3.1kbBspHI fragment of the pBAD/His-A of step 1, be transformed into E. coli DH5alpha.
4, with NcoI digestion verification transformant, select the transformant obtaining 2.9kb and 3.2kb two band, namely build and obtain intestinal bacteria and B. subtilis shuttle vector pBAD-pWV01ori.
5, with containing Tn7 transposon left and right arms box Tn7L-MCS-Tn7R, araC, the plasmid of Pbad and the Tn7 transposase TnsABCD under it, if plasmid pGRG36 is template, use primer SbfI-Tn7LFOR:aaCCTGCAGGctttcagcctgtgggc, and primer BstBI-TnsDRE:ccTTCGAAtcactcttccccataaacc, pcr amplification is about the Tn7L-MCS-Tn7R-araC-Pbad-TnsABCD fragment of 8kb, template is digested, this PCR primer of purifying with DpnI.
6, by the PCR primer of SbfI and BstBI double digestion step 5, purifying.
7, with the plasmid pBAD-pWV01ori of NsiI and BstBI double digestion step 4, the NsiI-pBR322ori-cat-pWV01ori/ts-BstBI fragment of 3.8kb is reclaimed.
8, the DNA fragmentation of step 6 is connected with the DNA fragmentation of step 7, transformation of E. coli E.coliDH5alpha.Transformant is containing the temperature sensitive replicon pWV01ori of subtilis, chloramphenicol resistance gene, Tn7 transposon left and right arms box, the transposition integration plasmid of multiple clone site and Tn7 transposase TnsABCD fragment, called after pNKTN701.
9, P43 promotor is cloned, amyQ signal peptide and xylanase gene also insert pNKTN701: with the bacterial strain containing amyQ signal peptide, bacterial strain Bacillusamyloliquefaciens as the preservation of Nanning Xin Jian biotechnology limited liability company is template, use primer BglII-amyQSPFOR:gAAgATCTATGATTCAAAAACGAAAGCGGAC, with primer SalI-amyQSPRE:TACGCGTCGACTACGGCTGATGTTTTTGTAATCG, pcr amplification amyQ signal peptide fragment, PCR primer is run glue, reclaims the fragment of about 100bP; PCR primer is cut, purifying with BglII and SalI enzyme; Be connected with the pHY-P43 plasmid 5.1kbBglII-SalI fragment containing P43 promotor, be transformed into E. coli DH5alpha; With BglII and SalI double digestion checking transformant, select to obtain the transformant of 5.1kb and 0.1kb two band, namely build and obtain containing P43 promotor and amyQ signal peptide intestinal bacteria and B. subtilis shuttle vector pHY-P43amyQSP; From plasmid pNKxyl SalI and the BamHI double digestion recovery 1kb xylanase gene of the preservation of Nanning Xin Jian biotechnology limited liability company, be connected with pHY-P43amyQSP plasmid 5.2kbSalI-BamHI fragment, be transformed into E. coli DH5alpha; With SalI and BamHI double digestion checking transformant, select the transformant obtaining 5.2kb and 1kb two band, namely build the intestinal bacteria obtained containing P43 promotor-amyQ signal peptide-xylanase gene and B. subtilis shuttle vector pHY-P43amyQSPxyl; PHY-P43amyQSPxyl BglII-BamHI double digestion is filled and led up two ends with Klenow, reclaims P43 promotor-amyQ signal peptide-xylanase gene fragment afterwards; Integrated plasmid pNKTN701 is carried out Sma I single endonuclease digestion and dephosphorylation, is connected to P43 promotor-amyQ signal peptide-xylanase gene fragment; Connect product conversion to E.coliDH5alpha, obtain exact connect ion product through fast cermet of inspection;
10, by the connection product conversion of step 9 to subtilis host WB800,28 DEG C containing overnight incubation on paraxin LB flat board, obtain chloramphenicol resistant strain, by this bacterial strain 28 DEG C of overnight incubation in not containing paraxin, LB liquid nutrient medium containing 0.1% pectinose, the attTn7 site that induction P43 promotor-sacB signal peptide-beta-glucanase gene fragment fixed point transposition integration is held to subtilis glms downstream of gene 3 '.
11, by the overnight culture dilution spread of step 10 not containing paraxin, the LB containing 0.1% glucose is dull and stereotyped, forwards 35 DEG C to and is cultured to and grows single bacterium colony.
12, the recombined bacillus subtilis list bacterium colony of picking step 11, be inoculated into not containing in the LB liquid nutrient medium of paraxin, 37 DEG C, 220r/min cultivates 36 hours, centrifugal 5 minutes of 10000r/min, gets supernatant liquor and measures Xylanase activity.The mensuration of Xylanase activity is carried out by the following method: draw 1.0ml and (do suitably dilution with distilled water through the enzyme liquid of suitably dilution, through 85 DEG C of balances), join in scale test tube, add 3.0ml xylan (3% again, through 85 DEG C of balances) and 6.0mlTris damping fluid (0.1mol/L, pH8.0), electromagnetic oscillation 3s, 85 DEG C of insulation reaction 10min, put ice-water bath 2min termination reaction, mixing, draw 1.0ml solution to 10ml tool plug test tube, add 1.0mlDNS reagent (first liquid: take the NaOH solution that 6.9g crystalline phenol is dissolved in 15.2ml10%, with distilled water diluting to 69ml, add 6.9g sodium bisulfite again, second liquid: take the NaOH solution that 255g Seignette salt is dissolved in 300ml10%, then 3, the 5-dinitrosalicylic acid solutions adding 880ml1%, first liquid and second liquid are mixed to get yellow agents and store in brown bottle, under room temperature, lucifuge makes typical curve (again will make typical curve after each preparation) after placing 7 days), electromagnetic oscillation 3s, boiling water bath heating 5min, room temperature is cooled to tap water, add water and be settled to 10.0ml, electromagnetic oscillation 3s.Replace sample solution for blank with the sample solution after deactivation, measure absorbancy at 540nm place.Xylanase activity is defined as: at 85 DEG C, and under pH value 8.0 condition, it is an enzyme activity unit (U) that per minute is hydrolyzed the enzyme amount that 3% xylan generates 1 μm of ol wood sugar.It is the transposition integration recombined bacillus subtilis expression strain that the bacterium colony of 3.2-18.0U/ml is acquisition that this batch measures Xylanase activity.
Claims (2)
1. one kind utilizes the recombined bacillus subtilis construction process of Tn7 transposable element integrative gene expression foreign protein, it is characterized in that: be a kind of for the transposition integration plasmid subtilis by building, insert Transforming B. subtilis after foreign protein genes and Expression element thereof, Tn7 transposase TnsABCD is produced, by the attTn7 site that foreign protein genes and Expression element transposition integration thereof are held to subtilis karyomit(e) glms downstream of gene 3 ' by induction; Pass through Fluctuation temperature culture, culture temperature is brought up to 33-37 DEG C from 26-30 DEG C, make the temperature-sensitive replicon that turns on integrative gene expression plasmid ineffective, no longer retained the recombined bacillus subtilis of the transposition integration plasmid containing antibiotics resistance gene and Tn7 transposase; Bacterium colony is forwarded to and does not cultivate containing in antibiotic liquid nutrient media, the bacterial strain that can give expression to active protein is the recombined bacillus subtilis that required transposition integration expresses foreign protein genes, described nutritional medium is conventional Nutrious fermented substratum, comprise peptone or protolysate 1 ~ 50g/L, yeast extract 1 ~ 25g/L, sodium-chlor 1 ~ 15g/L.
2. a kind of recombined bacillus subtilis construction process utilizing Tn7 transposable element integrative gene expression foreign protein according to claim 1, it is characterized in that: utilize Tn7 transposable element by foreign protein genes and Expression element transposition integration thereof to subtilis, steps of the method are: build a kind of transposition integration plasmid for subtilis, insert Transforming B. subtilis after foreign protein genes and Expression element thereof, Tn7 transposase TnsABCD is produced by induction, by the attTn7 site that foreign protein genes and Expression element transposition integration thereof are held to subtilis karyomit(e) glms downstream of gene 3 ', described Tn7 transposase TnsABCD is used to identify and shear Tn7 swivel base fragment, identify attTn7 swivel base site and impel Tn7 swivel base fragment to be inserted into this site.Above-mentioned Tn7 transposase TnsABCD can use arabinose operon, and comprise and suppress sub-araC and promotor Pbad to carry out abduction delivering, or with lactose operon, comprise repressor gene lacI, operator gene lacO and promotor lacP carrys out abduction delivering;
The described transposition integration plasmid for subtilis, include following component: can in intestinal bacteria plasmid replication replicon and can in subtilis the temperature sensitive replicon of plasmid replication, containing antibiotics resistance gene, Tn7 transposon left and right arms box, multiple clone site, Tn7 transposase TnsABCD fragment and abduction delivering element thereof;
Described can the replicon of plasmid replication be pBR322ori in intestinal bacteria, or colE1ori; Described to can be used for the temperature sensitive replicon of plasmid replication in subtilis be pWV01ori/ts, is characterized in can exercising copy function at about 28 DEG C, but loses replication about 35 DEG C time;
The described antibiotics resistance gene that can use in subtilis is chloramphenicol resistance gene, neomycin resistance gene, erythromycin resistance gene or spectinomycin resistance gene, this antibiotics resistance gene is cloned in outside Tn7 left arm and right arm, can not by transposition integration on subtilis karyomit(e) when swivel base is recombinated;
The described foreign protein genes of expressing for subtilis transposition integration is enzyme, antibacterial peptide activated protein plasmagene; The Expression element of described foreign protein genes, comprises following component: can in subtilis the promotor of efficient transcription as P43 promotor, or Pamy promotor; The signal peptide fragment of efficient secretion is as sacB signal peptide fragment, or amyQ signal peptide fragment; Described foreign protein genes and Expression element thereof are cloned in the multiple clone site between Tn7 left arm and right arm;
The described subtilis host for transposition integration is that subtilis 168 derivative strain is as 1A751, WB600, WB800.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510467499.1A CN105063078A (en) | 2015-08-03 | 2015-08-03 | Construction method of recombinant bacillus subtilis for integration and expression of foreign protein by virtue of Tn7 transposable element |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510467499.1A CN105063078A (en) | 2015-08-03 | 2015-08-03 | Construction method of recombinant bacillus subtilis for integration and expression of foreign protein by virtue of Tn7 transposable element |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105063078A true CN105063078A (en) | 2015-11-18 |
Family
ID=54492588
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510467499.1A Pending CN105063078A (en) | 2015-08-03 | 2015-08-03 | Construction method of recombinant bacillus subtilis for integration and expression of foreign protein by virtue of Tn7 transposable element |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105063078A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108728477A (en) * | 2017-04-24 | 2018-11-02 | 华东理工大学 | A kind of efficient Transpositional mutation system and construction method |
| CN109609425A (en) * | 2018-12-29 | 2019-04-12 | 广西壮族自治区农业科学院农产品加工研究所 | A method of integrative recombinant is screened using the activation recovering of the enzyme of bacillus subtilis integration site |
| CN110257375A (en) * | 2019-06-25 | 2019-09-20 | 南宁新科健生物技术有限公司 | A kind of expression system and its preparation method and application |
| CN113025641A (en) * | 2021-04-01 | 2021-06-25 | 南京农业大学 | Method for randomly inserting DNA fragment into bacillus subtilis chromosome and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101372685A (en) * | 2008-07-16 | 2009-02-25 | 南阳师范学院 | Zero background constructing method for recombinant baculovirus |
| CN102127529A (en) * | 2010-11-29 | 2011-07-20 | 南宁邦尔克生物技术有限责任公司 | Method for recombinant expression of beta-amylase in bacillus subtillis in integrated mode |
-
2015
- 2015-08-03 CN CN201510467499.1A patent/CN105063078A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101372685A (en) * | 2008-07-16 | 2009-02-25 | 南阳师范学院 | Zero background constructing method for recombinant baculovirus |
| CN102127529A (en) * | 2010-11-29 | 2011-07-20 | 南宁邦尔克生物技术有限责任公司 | Method for recombinant expression of beta-amylase in bacillus subtillis in integrated mode |
Non-Patent Citations (6)
| Title |
|---|
| ANTON V. BRYKSIN, ET AL.: "Rational Design of a Plasmid Origin That Replicates Efficiently in Both Gram-Positive and Gram-Negative Bacteria", 《PLOS ONE》 * |
| ERIC D. LOVULLO, ET AL.: "Single-copy chromosomal integration systems for Francisella tularensis", 《MICROBIOLOGY》 * |
| GREGORY J MCKENZIE, ET AL.: "Fast, easy and efficient: site-specific insertion of transgenes into Enterobacterial chromosomes using Tn7 without need for selection of the insertion event", 《BMC MICROBIOLOGY》 * |
| JOSEPH E. PETERS, ET AL.: "Tn7: SMARTER THAN WE THOUGHT", 《MOLECULAR CELL BIOLOGY》 * |
| KYOUNG-HEE CHOI, ET AL.: "A Tn7-based broad-range bacterial cloning and expression system", 《NATURE METHODS》 * |
| KYOUNG-HEE CHOI, ET AL.: "mini-Tn7 insertion in bacteria with single attTn7 sites: example Pseudomonas aeruginosa", 《NATURE PROTOCOLS》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108728477A (en) * | 2017-04-24 | 2018-11-02 | 华东理工大学 | A kind of efficient Transpositional mutation system and construction method |
| CN108728477B (en) * | 2017-04-24 | 2022-02-22 | 华东理工大学 | Efficient transposition mutation system and construction method |
| CN109609425A (en) * | 2018-12-29 | 2019-04-12 | 广西壮族自治区农业科学院农产品加工研究所 | A method of integrative recombinant is screened using the activation recovering of the enzyme of bacillus subtilis integration site |
| CN110257375A (en) * | 2019-06-25 | 2019-09-20 | 南宁新科健生物技术有限公司 | A kind of expression system and its preparation method and application |
| CN113025641A (en) * | 2021-04-01 | 2021-06-25 | 南京农业大学 | Method for randomly inserting DNA fragment into bacillus subtilis chromosome and application thereof |
| CN113025641B (en) * | 2021-04-01 | 2023-05-23 | 南京农业大学 | Method for randomly inserting DNA fragments into bacillus subtilis chromosome and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107400677B (en) | Bacillus licheniformis genome editing vector based on CRISPR-Cas9 system and preparation method thereof | |
| CN104212830B (en) | A kind of bacillus subtilis Self-controlled expression system and construction method thereof and application | |
| JPH06505875A (en) | Ethanol production with recombinant hosts | |
| CN105063078A (en) | Construction method of recombinant bacillus subtilis for integration and expression of foreign protein by virtue of Tn7 transposable element | |
| CN110093367B (en) | Bacillus subtilis oscillatory type gene expression system and construction method and application thereof | |
| CN107574173B (en) | Recombinant plasmid and method for constructing monascus pigment high-yield strain by using same | |
| CN108034667B (en) | Monascus ruber alpha-amylase gene, and preparation method and application thereof | |
| Álvarez-Cao et al. | Bioconversion of beet molasses to alpha-galactosidase and ethanol | |
| CN112522125B (en) | Hyaluronidase engineering bacterium and construction method and application thereof | |
| CN112513249B (en) | Mutant strain of trichoderma filamentous fungus and method for producing protein | |
| CN104073458A (en) | Bacillus subtilis strain capable of efficiently expressing exogenous secretory proteinase | |
| CN109402152A (en) | A kind of method of high efficient expression preparation UDP-glucose -4- epimerase | |
| CN104388368A (en) | Low-endotoxin escherichia coli prokaryotic expression engineering bacterial mutant strain and construction method | |
| US20240093247A1 (en) | Genetically engineered strain of zymomonas mobilis and uses thereof | |
| Zhou et al. | Engineering endoglucanase-secreting strains of ethanologenic Klebsiella oxytoca P2 | |
| CN100439506C (en) | Escherichia coli self-cracking method and its dedicated carrier and application | |
| CN107384989A (en) | A kind of branching enzyme and its application in resistant dextrin preparation | |
| He et al. | Direct production of ethanol from raw sweet potato starch using genetically engineered Zymomonas mobilis | |
| CN101550605A (en) | Method for establishing saccharomyces integrated gene mutation library based on in vivo homologous recombination | |
| CN116144571B (en) | Bacillus pumilus independent of antibiotics and capable of stabilizing high-yield alpha-amylase, and construction method and application thereof | |
| US20140120592A1 (en) | Recombinant caldicellulosiruptor bescii and methods of use | |
| CN112805366A (en) | Mutant strain of trichoderma reesei and method for producing protein | |
| CN107236680B (en) | Pichia pastoris recombinant bacterium for expressing Streptomyces sp.FA1-derived xylanase | |
| CN115948265A (en) | Kluyveromyces marxianus haploid yeast and construction method and application thereof | |
| AU2020204574B2 (en) | B.licheniformis engineering bacteria for inhibiting bacterial autolysis, construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20151118 |
|
| WD01 | Invention patent application deemed withdrawn after publication |