CN102127530B - Method for integrating two or more than two exogenous gene expression units onto the same integrated site of chromosome of Bacillus subtilis - Google Patents
Method for integrating two or more than two exogenous gene expression units onto the same integrated site of chromosome of Bacillus subtilis Download PDFInfo
- Publication number
- CN102127530B CN102127530B CN2010105636477A CN201010563647A CN102127530B CN 102127530 B CN102127530 B CN 102127530B CN 2010105636477 A CN2010105636477 A CN 2010105636477A CN 201010563647 A CN201010563647 A CN 201010563647A CN 102127530 B CN102127530 B CN 102127530B
- Authority
- CN
- China
- Prior art keywords
- plasmid
- subtilis
- selection markers
- resistant gene
- gene expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention discloses a method for integrating two or more than two exogenous gene expression units onto the same integrated site of chromosome of Bacillus subtilis, which comprises the following steps of: cloning the exogenous gene expression units into an integrating plasmid containing a resistant gene screening marker A, and integrating the exogenous gene expression units into the chromosome of Bacillus subtilis by using the integrating plasmid to obtain a recombinant strain 1; replacing the resistant gene screening marker A in the recombinant strain 1 by another resistant gene screening marker B by utilizing a plasmid for replacing resistant gene screening markers to obtain a recombinant strain 2; transforming the recombinant strain 2 by using the integrating plasmid, and screening by using the resistant gene screening marker A and the resistant gene screening marker B to obtain a recombinant strain containing two exogenous gene expression units; and repeatedly replacing resistant gene and integrating to obtain a recombinant strain that more than two same or different exogenous gene expression units are integrated into the chromosome of the Bacillus subtilis. The method has important application prospect for constructing integrated Bacillus subtilis expression strains.
Description
Technical field
The invention belongs to biological technical field, specifically is a kind of method that two or more exogenous gene expression unit is incorporated into the same integration site of subtilis karyomit(e).
Background technology
Subtilis (Bacillus subtilis) is nonpathogenic, and toxin producing and pyrogenicity allergic protein matter are not a kind of bacterial classifications of food safety, are classified as the food-grade microorganisms category.And subtilis is as expression system; Have the following advantages: 1. have very strong protein secreting function; Do not need smudge cells to extract protein; Only need to handle fermented supernatant fluid more simply and can obtain purer target protein, existing at present multiple foreign protein has been realized secreting, expressing in subtilis.2. do not have tangible codon-bias, expression product also is not easy to form inclusion body simultaneously.3. fermentation condition is simple.The development and use subtilis has profound significance as expression system.
Different based on the type of employing carrier, the bacillus subtilis expression pattern can be divided into that chromosomal integration is expressed and two kinds of reproducible plasmid expressions.Foreign gene can keep stability preferably in the host in chromosomal integration is expressed, and plasmid replication is unstable usually, needs added with antibiotic to keep.But microbiotic can not add in food and Additive Production thereof.Therefore, the expression of subtilis chromosomal integration is a trend of food, pharmaceutical production future development.A deficiency of integrative gene expression need to be the copy number of expressing gene low, thereby influences the expression amount of foreign protein.A kind of method that increases copy number is that foreign gene is incorporated into different sites respectively.This method need be with exogenous gene cloning to different integrative vectors, and foreign gene also maybe be different at the different integration site expression level of karyomit(e).Another kind method is through improving constantly antibiotic concentration, filtering out the recon of integrating the copy number increase.The quantitative character that this method utilizes antibiotic concentration to increase is screened recon; False positive is high; Multiple copied foreign gene in the integration bacterial strain that obtains is unstable, and the expression effect of foreign protein is also undesirable, often needs the antibiosis of high density usually to keep the copy number of foreign gene.
Summary of the invention
The purpose of this invention is to provide a kind of method, two or more exogenous gene expression unit are incorporated into the same integration site of subtilis karyomit(e).Express unitary copy number through improving, in the hope of obtaining higher exogenous gene expression amount.The present invention is incorporated into subtilis genome group with integrated plasmid; Utilize the resistant gene selection markers of integrated plasmid to filter out the reorganization bacterium; Replace the resistant gene selection markers with the plasmid of replacement resistant gene selection markers again; Integrated plasmid transforms the reorganization bacterium that obtains again, and the resistant gene selection markers screening through resistant gene selection markers on the integrated plasmid and replacement resistant gene selection markers plasmid obtains the reorganization bacterium again.Pass through some integration-replacement-integration again of taking turns, can obtain the reorganization bacterium that two or more exogenous gene expression unit are incorporated into subtilis genome group.
Integrated plasmid pDG364, pMLK83, pDG1661, pDG1662, pDG1663, pDG1664, pDG1728, pDG11729, pDG1730, pDG1731, pAX01, pAX-spac, pSG1154, pSG1192, pSG1193, pSG1729, pSG1190, pSG1191, pDL, pDK that the present invention uses; And replace resistant gene selection markers plasmid pVK71, pVK73, JM103 (pCm::Er), JM103 (pCm::Nm), JM103 (pCm::Sp), JM103 (pCm::Tc), JM103 (pEr::Cm), JM103 (pEr::Nm), JM103 (pEr::Pm), JM103 (pEr::Sp) all available from the Bacillus of Ohio State Univ-Columbus USA heredity preservation center (the Bacillus Genetic Stock Center; BGSC, http://www.bgsc.org).
The present invention realizes through following steps:
1) the exogenous gene expression unit is cloned into separately respectively on the subtilis integrated plasmid, each recombination and integration plasmid carries an exogenous gene expression unit;
2) the unitary integration of first exogenous gene expression is to utilize integrated plasmid that the exogenous gene expression unit is incorporated in the subtilis karyomit(e), selects through the resistant gene selection markers A that carries on the integrated plasmid to obtain the exogenous gene expression unit and be incorporated into the recombined bacillus subtilis 1 in the subtilis karyomit(e);
3) plasmid of usefulness replacement resistant gene selection markers replaces with resistant gene selection markers B with the resistant gene selection markers A of above-mentioned recombined bacillus subtilis 1; To replace successful reorganization bacterium through resistant gene selection markers B and pick out, obtain recombined bacillus subtilis 2 with resistant gene selection markers B;
4) second unitary integration of exogenous gene expression is to utilize to be connected with second unitary integrated plasmid of exogenous gene expression and with the homology single cross form of changing second exogenous gene expression unit to be incorporated on the recombined bacillus subtilis 2, screens with resistant gene selection markers B through resistant gene selection markers A and obtains containing two unitary recombined bacillus subtilis of exogenous gene expression;
5) repeat above-mentioned steps 3) and step 4); After resistant gene selection markers A replaced with other resistant gene selection markers; Be incorporated in the reorganization bacterium with the homology single cross form of changing with being connected with the unitary integrated plasmid of exogenous gene expression, can obtain expressing more than two the unit and be incorporated into the reorganization bacterium in the subtilis karyomit(e);
Described exogenous gene expression unit can be identical or different: like difference, obtain the reorganization bacterium that different exogenous gene expressions unit is incorporated into subtilis genome group; As identical, the exogenous gene expression unit that obtains two or more copies is incorporated into the reorganization bacterium of subtilis genome group;
Described exogenous gene expression unit can be a monocistron, also can be polycistron;
Described subtilis is subtilis 168 derivative strains, 1A751 for example, WB600, or WB800.
Different according to the integrative vector that uses, the concrete steps of method of the present invention are following:
1. utilize integrated plasmid pMLK83 and derive plasmid or pDK and the plasmid of deriving thereof (describe for convenient, two kinds of plasmids are referred to as H.During concrete the application, each one of them plasmid of only using.Integrate down together).
1) with two exogenous gene expression unit A with B is cloned into subtilis integrative plasmid pMLK83 respectively and derive plasmid or pDK and the plasmid of deriving thereof, construction recombination plasmid H-A and H-B.
2) transform the host subtilis with recombinant plasmid H-A,, pick out the exchange of foreign gene homology and be incorporated into bacterial strain [A] Neo in the subtilis karyomit(e) through neomycin resistance
+
3) plasmid pVK71 transforms subtilis [A] Neo as replacement resistant gene selection markers plasmid
+, pick out the Togoplus resistance, the bacterial strain of neomycin resistance inactivation [A] Neo
-Spe
+
4) transform subtilis [A] Neo with recombinant plasmid H-B
-Spe
+, pick out bacterial strain [AB] Neo of Togoplus resistance and neomycin resistance
+Spe
+Thereby, two foreign gene A, B are expressed the unit and are incorporated in the subtilis genome group.
2. utilize integrated plasmid pDG364 and derive plasmid or pDL and the plasmid of deriving (being referred to as K) thereof are integrated.
1) exogenous gene expression unit A, B, C, D and E are cloned into subtilis integrative plasmid pDG364 respectively and derive plasmid or pDL and the plasmid of deriving thereof, construction recombination plasmid K-A, K-B, K-C, K-D and K-E.
2) transform the host subtilis with recombinant plasmid K-A,, pick out the exchange of foreign gene homology and be incorporated into bacterial strain [A] Cat in the subtilis karyomit(e) through chlorampenicol resistant
+
3) plasmid JM103 (pCm::Er) transforms subtilis [A] Cat as replacement resistant gene selection markers plasmid
+, pick out the Oxacyclotetradecane,erythromycin deriv resistance, the bacterial strain of chlorampenicol resistant inactivation [A] Cat
-Erm
+
4) transform subtilis [A] Cat with recombinant plasmid K-B
-Erm
+, pick out bacterial strain [AB] Cat of chlorampenicol resistant and Oxacyclotetradecane,erythromycin deriv resistance
+Erm
+Thereby, two foreign gene A, B are expressed the unit and are incorporated in the subtilis genome group.
5) respectively with recombinant plasmid K-C, K-D and K-E as integrated plasmid; Plasmid JM103 (pCm::Nm), JM103 (pCm::Sp), JM103 (pCm::Tc) are as replacement resistant gene selection markers plasmid; Repeating step 3 and 4 obtains containing five reorganization bacterium [ABCDE] Cat that copy foreign genes at last
+Erm
+Neo
+Spe
+Tec
+
3. utilize integrated plasmid pDG1661 and derive plasmid or pDG1662 and the plasmid of deriving (being referred to as M) thereof are integrated.
1) exogenous gene expression unit A, B, C and D are cloned into subtilis integrative plasmid pDG1661 respectively and derive plasmid or pDG1662 and the plasmid of deriving thereof, construction recombination plasmid M-A, M-B, M-C and M-D.
2) transform the host subtilis with recombinant plasmid M-A,, pick out the exchange of foreign gene homology and be incorporated into bacterial strain [A] Cat in the subtilis karyomit(e) through chlorampenicol resistant
+
3) plasmid JM103 (pEr::Cm) transforms subtilis [A] Cat as replacement resistant gene selection markers plasmid
+, pick out the Oxacyclotetradecane,erythromycin deriv resistance, the bacterial strain of chlorampenicol resistant inactivation [A] Cat
-Erm
+
4) transform subtilis [A] Cat with recombinant plasmid M-B
-Erm
+, pick out bacterial strain [AB] Erm of chlorampenicol resistant and Oxacyclotetradecane,erythromycin deriv resistance
+Cat
+Thereby, two foreign gene A, B are expressed the unit and are incorporated in the subtilis genome group.
5) respectively with recombinant plasmid M-C and M-D as integrated plasmid; With plasmid JM103 (pEr::Nm), JM103 (pEr::Pm) as replacement resistant gene selection markers plasmid; Repeating step 3 and 4 obtains containing four reorganization bacterium [ABCD] Cat that copy foreign genes at last
+Erm
+Neo
+Phm
+
4. utilize integrated plasmid pDG1663 and derive plasmid or pDG1664 and the plasmid of deriving (being referred to as N) thereof are integrated.
1) exogenous gene expression unit A, B, C and D are cloned into subtilis integrative plasmid pDG1663 respectively and derive plasmid or pDG1664 and the plasmid of deriving thereof, construction recombination plasmid N-A, N-B, N-C and N-D.
2) transform the host subtilis with recombinant plasmid N-A,, pick out the exchange of foreign gene homology and be incorporated into bacterial strain [A] Erm in the subtilis karyomit(e) through the Oxacyclotetradecane,erythromycin deriv resistance
+
3) plasmid JM103 (pEr::Cm) transforms subtilis [A] Erm as replacement resistant gene selection markers plasmid
+, pick out chlorampenicol resistant, bacterial strain [A] Erm of Oxacyclotetradecane,erythromycin deriv resistance inactivation
-Cat
+
4) transform subtilis [A] Erm with recombinant plasmid N-B
-Cat
+, pick out bacterial strain [AB] Erm of Oxacyclotetradecane,erythromycin deriv resistance and chlorampenicol resistant
+Cat
+Thereby, two foreign gene A, B are expressed the unit and are incorporated in the subtilis genome group.
5) respectively with recombinant plasmid N-C and N-D as integrated plasmid; With plasmid JM103 (pEr::Nm), JM103 (pEr::Pm) as replacement resistant gene selection markers plasmid; Repeating step 3 and 4 obtains containing four reorganization bacterium [ABCD] Erm that copy foreign genes at last
+Cat
+Neo
+Phm
+
5. utilize the integrated plasmid pSG1154 and the plasmid of deriving thereof, pSG1190 and the plasmid of deriving thereof, pSG1191 and the plasmid of deriving thereof, pSG1192 and the plasmid of deriving thereof, pSG1193 and derive plasmid or pSG1729 and the plasmid of deriving (being referred to as R) thereof are integrated.
1) two exogenous gene expression unit A and B are cloned into subtilis integrative plasmid pSG1154 and the plasmid of deriving, pSG1192 and the plasmid of deriving thereof, pSG1193 and the plasmid of deriving thereof, pSG1729 and the plasmid of deriving thereof, pSG1190 and derive plasmid or pSG191 and the plasmid of deriving thereof, construction recombination plasmid R-A and R-B respectively.
2) transform the host subtilis with recombinant plasmid R-A,, pick out the exchange of foreign gene homology and be incorporated into bacterial strain [A] Spe in the subtilis karyomit(e) through the Togoplus resistance
+
3) plasmid pVK73 transforms subtilis [A] Spe as replacement resistant gene selection markers plasmid
+, pick out neomycin resistance, bacterial strain [A] Spe of Togoplus resistance inactivation
-Neo
+
4) transform subtilis [A] Spe with recombinant plasmid R-B
-Neo
+, pick out bacterial strain [AB] Neo of Togoplus resistance and neomycin resistance
+Spe
+Thereby, two foreign gene A, B are expressed the unit and are incorporated in the subtilis genome group.
6. utilize the integrated plasmid pDG1728 and the plasmid of deriving thereof, pDG1729 and the plasmid of deriving thereof, pDG1730 and derive plasmid or pDG1731 and the plasmid of deriving (being referred to as X) thereof are integrated.
1) two exogenous gene expression unit A and B are cloned into subtilis integrative plasmid pDG1728 and the plasmid of deriving, pDG1729 and the plasmid of deriving thereof, pDG1730 and derive plasmid or pDG1731 and the plasmid of deriving thereof, construction recombination plasmid X-A and X-B respectively.
2) transform the host subtilis with recombinant plasmid X-A,, pick out the exchange of foreign gene homology and be incorporated into bacterial strain [A] Spe in the subtilis karyomit(e) through the Togoplus resistance
+
3) plasmid pVK73 transforms subtilis [A] Spe as replacement resistant gene selection markers plasmid
+, pick out neomycin resistance, bacterial strain [A] Neo of Togoplus resistance inactivation
+Spe
-
4) transform subtilis [A] Neo with recombinant plasmid X-B
+Spe
-, pick out bacterial strain [AB] Neo of neomycin resistance and Togoplus resistance
+Spe
+Thereby, two foreign gene A, B are expressed the unit and are incorporated in the subtilis genome group.
7. utilize integrated plasmid pAX01 and derive plasmid or pA-spac and the plasmid of deriving (being referred to as V) thereof are integrated.
1) exogenous gene expression unit A, B, C, D and E are cloned into subtilis integrative plasmid pAX01 respectively and derive plasmid or pAX-spac and the plasmid of deriving thereof, construction recombination plasmid V-A, V-B, V-C, V-D and V-E.
2) transform the host subtilis with recombinant plasmid V-A,, pick out the exchange of foreign gene homology and be incorporated into bacterial strain [A] Erm in the subtilis karyomit(e) through the Oxacyclotetradecane,erythromycin deriv resistance
+
3) plasmid JM103 (pEr::Cm) transforms subtilis [A] Erm as replacement resistant gene selection markers plasmid
+, pick out chlorampenicol resistant, bacterial strain [A] Erm of Oxacyclotetradecane,erythromycin deriv resistance inactivation
-Cat
+
4) transform subtilis [A] Erm with recombinant plasmid V-B
-Cat
+, pick out bacterial strain [AB] Erm of Oxacyclotetradecane,erythromycin deriv resistance and chlorampenicol resistant
+Cat
+Thereby, two foreign gene A, B are expressed the unit and are incorporated in the subtilis genome group.
5) respectively with recombinant plasmid V-C, V-D and V-E as integrated plasmid; With plasmid JM103 (pEr::Nm), JM103 (pEr::Pm), JM103 (pEr::Sp) as replacement resistant gene selection markers plasmid; Repeating step 3 and 4 obtains containing five reorganization bacterium [ABCDE] Erm that copy foreign genes at last
+Cat
+Neo
+Phm
+Spe
+
Advantage of the present invention is to utilize the reorganization bacterium that has or not this qualitative character to select to obtain a gene multiple copied of antibiotics resistance, or a plurality of gene integration is to the reorganization bacterium of same integration site, and method is simply effective.
Embodiment
Below in conjunction with concrete embodiment, the present invention is described in further detail.Should be understood that these embodiment just in order to demonstrate the invention, but not limit scope of the present invention by any way.
1: two copy of embodiment beta-amylase is expressed the unit and is incorporated into subtilis 1A751.
1. the structure pMLK83-P43-CTBA of integrated plasmid
According to the promotor P43 sequence of note among the Genbank, the design upstream primer is that 5 ' attgctggacgcttatggac 3 ' is 5 ' cgggatccattcctctcttacctataat 3 ' with downstream primer.PCR reaction system 100ul:DNA template (the total DNA of subtilis 1A751) 1ul (about 20ng); 5 * PrimeSTAR Buffer 20ul, 10pmol/ul dNTP 2ul, the forward and reverse primer of 10pmol/ul respectively are 2u1; 2.5U/ul PrimeSTAR HS archaeal dna polymerase 1ul adds ddH
2O to 100ul.PCR response procedures: 94 ℃ of 5min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 1min, 30 circulations; 72 ℃ of 10min; 4 ℃ of preservations.The PCR fragment carries out respectively being connected with the T4 ligase enzyme behind the double digestion with restriction enzyme BamH I, Hind III with plasmid pMLK83, is transformed in the escherichia coli DH5a, obtains recombinant plasmid pMLK83-P43 through Screening and Identification.
Synthesize following dna segment (the beta-amylase gene is called for short CTBA) with full gene synthetic mode:
1 GGATCCATGA?AAAAAAATAT?CATCACTTCT?ATCACATCTC?TGGCTCTGGT
51 TGCCGGGCTG?TCTTTGACTG?CTTTTGCAGC?TACAACGGCT?AGCATAGCAC
101 CAAATTTCAA?AGTTTTTGTA?ATGGGTCCAT?TAGAAAAAGT?CACAGATTTT
151 AATGCATTCA?AAGATCAATT?GATAACTTTA?AAGAATAATG?GTGTTTATGG
201 TATAACAACA?GATATTTGGT?GGGGCTATGT?TGAAAATGCA?GGTGAAAATC
251 AATTTGACTG?GAGTTATTAT?AAGACATATG?CTGATACCGT?ACGCGCTGCG
301 GGATTGAAGT?GGGTTCCAAT?AATGTCAACG?CATGCCTGTG?GAGGTAATGT
351 TGGTGATACA?GTAAATATAC?CTATTCCGTC?ATGGGTATGG?ACAAAAGATA
401 CCCAAGATAA?TATGCAGTAT?AAGGATGAAG?CCGGAAATTG?GGATAATGAA
451 GCAGTAAGTC?CATGGTATTC?TGGCTTAACC?CAACTCTATA?ATGAATTTTA
501 TTCATCTTTT?GCATCAAATT?TTAGCAGCTA?TAAAGATATA?ATTACTAAAA
551 TATATATATC?TGGAGGCCCT?TCTGGAGAAT?TAAGATATCC?TTCATATAAT
601 CCTTCGCATG?GATGGACATA?TCCTGGACGT?GGCTCGCTGC?AGTGCTATAG
651 TAAAGCGGCT?ATAACAAGTT?TTCAAAATGC?TATGAAGTCT?AAATATGGAA
701 CTATAGCAGC?AGTTAATAGT?GCATGGGGTA?CAAGCCTAAC?TGATTTTTCT
751 CAAATTAGTC?CACCTACAGA?TGGTGATAAT?TTCTTTACAA?ATGGTTATAA
801 AACTACTTAT?GGTAATGACT?TTTTGACATG?GTATCAAAGT?GTTTTGACTA
851 ATGAGTTAGC?CAATATTGCT?TCTGTAGCTC?ATAGCTGCTT?TGATCCAGTA
901 TTTAATGTTC?CAATAGGAGC?AAAAATAGCT?GGAGTGCATT?GGCTATATAA
951 TAGTCCGACA?ATGCCACATG?CTGCAGAATA?TTGTGCCGGT?TATTATAATT
1001 ATAGCACGCT?ACTCGATCAA?TTTAAGGCAT?CTAATCTTGC?TATGACATTT
1051 ACATGTCTTG?AAATGGATGA?TTCTAATGCA?TATGTAAGTC?CATATTATTC
1101 TGCACCTATG?ACGTTAGTCC?ATTATGTAGC?TAATCTTGCT?AATAATAAAG
1151 GTATAGTCCA?CAATGGAGAA?AATGCTTTGG?CTATATCCAA?CAACAATCAA
1201 GCTTATGTGA?ATTGTGCAAA?TGAATTAACA?GGATATAATT?TTTCTGGATT
1251 TACACTTTTA?AGACTTTCGA?ATATTGTAAA?TAGTGATGGA?TCTGTGACAT
1301 CAGAGATGGC?TCCTTTTGTA?ATTAATATAG?TTACACTAAC?GCCTAACGGT
1351 ACGATACCAG?TTACATTTAC?AATAAACAAT?GCGACAACTT?ATTATGGACA
1401 AAATGTATAT?ATTGTTGGTA?GTACATCTGA?TCTTGGAAAT?TGGAATACAA
1451 CCTATGCCCG?TGGTCCTGCA?TCATGCCCTA?ATTATCCTAC?TTGGACAATA
1501 ACGCTTAATC?TATTACCTGG?TGAGCAGATA?CAGTTTAAAG?CTGTAAAAAT
1551 TGATAGTTCA?GGAAATGTAA?CTTGGGAAGG?TGGCTCGAAT?CATACTTATA
1601 CTGTGCCGAC?ATCTGGGACT?GGTAGTGTCA?CCATTACATG?GCAAAATTAA
1651 TCAATAAAAT?GTTACACATA?GAACAAATTG?TAAACACTGG?AATATATTCC
1701 GGTGTTTTTT?TGTATATTAT?GGGCGTTTAA?TCCGCGG
With synthetic beta-amylase gene DNA fragment and plasmid pMLK83-P43 with restriction enzyme BamH I be connected with the T4 ligase enzyme after Sac II carries out double digestion; Be transformed in the bacillus coli DH 5 alpha competent cell, obtain recombinant plasmid pMLK83-P43-CTBA through Screening and Identification.
2. the double exchange of plasmid pMLK83-P43-CTBA homology is incorporated into subtilis 1A751 genome group
Getting one completely encircles subtilis 1A751 glycerol stock and draws the LB flat board, 37 ℃ of incubator overnight cultures.Transform and choose single bacterium colony to 3ml LB substratum night previous day; 37 ℃; The 250rpm overnight cultures, the next morning gets 160 μ l nutrient solutions and is forwarded to that (the SPI substratum: it is 50% (W/V) glucose solution and 1% (V/V) volume, 100 * CAYE solution that SP salt adds 1% volumetric concentration in the 8ml SPI substratum; SP salts solution: contain 1.96g/L (NH
2)
2SO
4, 13.72g/L K
2HPO
4, 5.88g/L KH
2PO
4, 0.196g/LMgSO
47H
2O (sterilization separately) and 0.98g/L Trisodium Citrate; 100 * CAYE solution: contain 20g/L casamino acids and 100g/L yeast extract.), 37 ℃, 250rpm is cultured to logarithmic growth latter stage (about 4～5 hours); Get 0.2ml and grow to logarithm nutrient solution (SPII substratum: SPI substratum adding 1% (V/V, down together) volume 50mmol/L CaCl to 2ml SPII substratum in latter stage
2Solution, 1% volume 250mmol/L MgCl
2Solution), 37 ℃, 100rpm cultivated 90 minutes; In the thalline of above-mentioned SPII substratum, add 20ul 10mmol/L EGTA, again in 37 ℃, 100rpm cultivated 10 minutes; Bacterium liquid after the above-mentioned processing is subtilis 1A751 competent cell.The 1A751 competent cell is distributed into the every pipe of 0.5ml, adds 5ul plasmid pMLK83-P43-CTBA (50ng/ul), again in 37 ℃, 250rpm cultivated 90 minutes, and it is dull and stereotyped to get bacterium liquid coating Xin Meisu (20ug/ml) LB.Promptly obtain bacillus subtilis genetic engineering bacterial strain 1A751 [CTBA] Neo with the ruined transformant of PCR method screening alpha-amylase gene
+The PCR method of the ruined transformant of screening alpha-amylase gene is following:
Synthetic following primer: aam1:5 ' ggtctgatcgatgggatgtc 3 '; Aam2:5 ' tcatcatcgctcatccatgt3 '; W2p:5 ' actgacgattaccttgcg 3 '; Baci-p1:5 ' cttccaatcacccgctctt 3 '. transformant after the incubated overnight, is extracted total DNA. and with primer aam1/aam2 and w2p/baci-p1 carried out the PCR.PCR reaction conditions respectively as follows respectively then in the LB substratum:
Aam1/aam2:PCR reaction system 20ul:DNA template (the total DNA of transformant) 1ul (about 20ng); 10 * Taq Buffer 2ul, 10pmol/ul dNTP 0.4ul, the forward and reverse primer of 10pmol/ul respectively are 0.5ul; 2.5U/ul Taq archaeal dna polymerase 1ul adds ddH
2O to 20ul.PCR response procedures: 94 ℃ of 5min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, 30 circulations; 72 ℃ of 10min; 4 ℃ of preservations;
W2p/baci-p1:PCR reaction system 20ul:DNA template (the total DNA of transformant) 1ul (about 20ng); 10 * Taq Buffer 2ul, 10pmol/ul dNTP 0.4ul, the forward and reverse primer of 10pmol/ul respectively are 0.5ul; 2.5U/ul Taq archaeal dna polymerase 1ul adds ddH
2O to 20ul.PCR response procedures: 94 ℃ of 5min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 70s, 30 circulations; 72 ℃ of 10min; 4 ℃ of preservations;
If a certain transformant with the w2p/baci-p1 primer to doing the product that PCR obtains about 1.1kb, and with the aam1/aam2 primer to doing the product that PCR can not get about 450bp, then this transformant is the transformant of AMS disappearance.
3. the replacement of neomycin resistance gene
Plasmid pVK71 mixes with subtilis 1A751 [CTBA] the Neo+ competent cell for preparing; 220rpm; 37 ℃ of shaking tables are cultivated 90min; Be applied in the LB solid medium that contains spectinomycin 60ug/ml, the bacterium colony that grows inoculates the LB solid medium checking that contains Xin Meisu 20ug/ml, filters out banded miromycin resistance and bacterial strain 1A751 [CTBA] Neo of neomycin resistance inactivation
-Spe+.
4. the single cross of plasmid pMLK83-P43-CTBA homology is changed and is incorporated into subtilis 1A751 [CTBA] Neo
-Spe+ genome group.
Plasmid pMLK83-P43-CTBA and subtilis 1A751 [CTBA] Neo for preparing
-The Spe+ competent cell mixes; 220rpm; 37 ℃ of shaking tables are cultivated 90min; Be applied to and contain Xin Meisu 20ug/ml, the LB solid medium incubated overnight of spectinomycin 60ug/ml can be screened and obtained two copy beta-amylases and express bacterial strain 1A751 [CTBA2] Neo+Spe+ that unit are incorporated into subtilis genome group.
5. the expression of subtilis beta-amylase
Subtilis 1A751 [CTBA] Neo+ is containing activation on the LB flat board of Xin Meisu 20ug/ml; Subtilis 1A751 [CTBA2] Neo+Spe+ is in the dull and stereotyped activation of the LB that contains Xin Meisu 20ug/ml, Togoplus 60ug/ml; Be inoculated into LB liquid nutrient medium overnight cultures respectively; Centrifugal, supernatant is the beta-amylase crude enzyme liquid.
6. subtilis 1A751 [CTBA] Neo+ and subtilis 1A751 [CTBA2] Neo+Spe+ enzyme comparison alive
Draw 9ml 1% starch solution behind 70 ℃ ± 0.5 ℃ water bath with thermostatic control preheating 5min, add 1.0ml beta-amylase crude enzyme liquid mixing, place 70 ℃ ± 0.5 ℃ water bath with thermostatic control accurate response 30min; Place ice-water bath 2min termination reaction; Mixing is drawn 1.0ml solution to 10ml tool plug test tube, adds 1.0ml DNS reagent (first liquid: take by weighing the NaOH solution that the 6.9g crystalline phenol is dissolved in 15.2ml 10%; To 69ml, add the 6.9g sodium sulfite anhy 96 with distilled water diluting again.Second liquid: take by weighing the NaOH solution that the 255g Seignette salt is dissolved in 300ml 10%, add 3 of 880ml 1% again, 5-dinitrosalicylic acid solution.First liquid and second liquid mix to such an extent that yellow reagent is stored in the brown bottle, and lucifuge is placed after 7 days and made typical curve under the room temperature), put and heat 5min in the boiling water bath; Flowing water is cooled to room temperature; To 10ml, mixing returns to zero with blank with distilled water diluting; Under the 540nm wavelength, carry out colorimetric with spectrophotometer, the record absorbancy.The sample solution of blank after by deactivation replaces sample solution.Enzyme work is defined as: 1ml enzyme liquid is under 70 ℃, pH6.0 condition, and hydrolysis 1% starch fluid generated 1mg SANMALT-S in 1 hour, was 1 enzyme activity unit, represented with U/ml.
After measured; The crude enzyme liquid enzyme of bacillus subtilis 1A751 [CTBA] Neo+ is lived to about 400U/ml; It is about 700U/ml that the crude enzyme liquid enzyme of bacillus subtilis 1A751 [CTBA2] Neo+Spe+ is lived, and the beta amylase enzyme work of two copies expression unit integration bacterial strains is 1.5-2 times of single copy.
2: four copies of embodiment beta-amylase is expressed the unit and is incorporated into subtilis 1A751.
1. the structure pDG364-P43-CTBA of integrated plasmid
According to the promotor P43 sequence of note among the Genbank, the design upstream primer is that 5 ' cgggatccagcttcgtgcatgcag 3 ' is 5 ' cccaagcttattcctctcttacctataat 3 ' with downstream primer.PCR reaction system 100ul:DNA template (the total DNA of subtilis 1A751) 1ul (about 20ng); 5 * PrimeSTAR Buffer 20ul, 10pmol/ul dNTP 2ul, the forward and reverse primer of 10pmol/ul respectively are 2ul; 2.5U/ul PrimeSTAR HS archaeal dna polymerase 1ul adds ddH
2O to 100ul.PCR response procedures: 94 ℃ of 5min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 1min, 30 circulations; 72 ℃ of 10min; 4 ℃ of preservations.The PCR fragment carries out respectively being connected with the T4 ligase enzyme behind the double digestion with restriction enzyme BamH I, Hind III with plasmid pDG364, is transformed in the escherichia coli DH5a, obtains recombinant plasmid pDG364-P43 through Screening and Identification.
Synthesize following dna segment (the beta-amylase gene is called for short CTBA) with full gene synthetic mode:
1 AAGCTTTAATGA?AAAAAAATAT?CATCACTTCT?ATCACATCTC?TGGCTCTGGT
51 TGCCGGGCTG?TCTTTGACTG?CTTTTGCAGC?TACAACGGCT?AGCATAGCAC
101 CAAATTTCAA?AGTTTTTGTA?ATGGGTCCAT?TAGAAAAAGT?CACAGATTTT
151 AATGCATTCA?AAGATCAATT?GATAACTTTA?AAGAATAATG?GTGTTTATGG
201 TATAACAACA?GATATTTGGT?GGGGCTATGT?TGAAAATGCA?GGTGAAAATC
251 AATTTGACTG?GAGTTATTAT?AAGACATATG?CTGATACCGT?ACGCGCTGCG
301 GGATTGAAGT?GGGTTCCAAT?AATGTCAACG?CATGCCTGTG?GAGGTAATGT
351 TGGTGATACA?GTAAATATAC?CTATTCCGTC?ATGGGTATGG?ACAAAAGATA
401 CCCAAGATAA?TATGCAGTAT?AAGGATGAAG?CCGGAAATTG?GGATAATGAA
451 GCAGTAAGTC?CATGGTATTC?TGGCTTAACC?CAACTCTATA?ATGAATTTTA
501 TTCATCTTTT?GCATCAAATT?TTAGCAGCTA?TAAAGATATA?ATTACTAAAA
551 TATATATATC?TGGAGGCCCT?TCTGGAGAAT?TAAGATATCC?TTCATATAAT
601 CCTTCGCATG?GATGGACATA?TCCTGGACGT?GGCTCGCTGC?AGTGCTATAG
651 TAAAGCGGCT?ATAACAAGTT?TTCAAAATGC?TATGAAGTCT?AAATATGGAA
701 CTATAGCAGC?AGTTAATAGT?GCATGGGGTA?CAAGCCTAAC?TGATTTTTCT
751 CAAATTAGTC?CACCTACAGA?TGGTGATAAT?TTCTTTACAA?ATGGTTATAA
801 AACTACTTAT?GGTAATGACT?TTTTGACATG?GTATCAAAGT?GTTTTGACTA
851 ATGAGTTAGC?CAATATTGCT?TCTGTAGCTC?ATAGCTGCTT?TGATCCAGTA
901 TTTAATGTTC?CAATAGGAGC?AAAAATAGCT?GGAGTGCATT?GGCTATATAA
951 TAGTCCGACA?ATGCCACATG?CTGCAGAATA?TTGTGCCGGT?TATTATAATT
1001 ATAGCACGCT?ACTCGATCAA?TTTAAGGCAT?CTAATCTTGC?TATGACATTT
1051 ACATGTCTTG?AAATGGATGA?TTCTAATGCA?TATGTAAGTC?CATATTATTC
1101 TGCACCTATG?ACGTTAGTCC?ATTATGTAGC?TAATCTTGCT?AATAATAAAG
1151 GTATAGTCCA?CAATGGAGAA?AATGCTTTGG?CTATATCCAA?CAACAATCAG
1201 GCTTATGTGA?ATTGTGCAAA?TGAATTAACA?GGATATAATT?TTTCTGGATT
1251 TACACTTTTA?AGACTTTCGA?ATATTGTAAA?TAGTGATGGA?TCTGTGACAT
1301?CAGAGATGGC?TCCTTTTGTA?ATTAATATAG?TTACACTAAC?GCCTAACGGT
1351?ACGATACCAG?TTACATTTAC?AATAAACAAT?GCGACAACTT?ATTATGGACA
1401?AAATGTATAT?ATTGTTGGTA?GTACATCTGA?TCTTGGAAAT?TGGAATACAA
1451?CCTATGCCCG?TGGTCCTGCA?TCATGCCCTA?ATTATCCTAC?TTGGACAATA
1501?ACGCTTAATC?TATTACCTGG?TGAGCAGATA?CAGTTTAAAG?CTGTAAAAAT
1551?TGATAGTTCA?GGAAATGTAA?CTTGGGAAGG?TGGCTCGAAT?CATACTTATA
1601?CTGTGCCGAC?ATCTGGGACT?GGTAGTGTCA?CCATTACATG?GCAAAATTAA
1651?TCAATAAAAT?GTTACACATA?GAACAAATTG?TAAACACTGG?AATATATTCC
1701?GGTGTTTTTT?TGTATATTAT?GGGCGTTTAA?TGAATTC
With synthetic beta-amylase gene DNA fragment and plasmid pDG364-P43 with restriction enzyme HindIII be connected with the T4 ligase enzyme after EcoR I carries out double digestion; Be transformed in the bacillus coli DH 5 alpha competent cell, obtain recombinant plasmid pDG364-P43-CTBA through Screening and Identification.
2. the double exchange of plasmid pDG364-P43-CTBA homology is incorporated into subtilis 1A751 genome group
Method like embodiment 1 prepares subtilis 1A751 competent cell.The 1A751 competent cell is distributed into the every pipe of 0.5ml, adds 5ul plasmid pDG364-P43-CTBA (50ng/ul), again in 37 ℃, 250rpm cultivated 90 minutes, and it is dull and stereotyped to get bacterium liquid coating paraxin (5ug/ml) LB.Promptly obtain bacillus subtilis genetic engineering bacterial strain 1A751 [CTBA] Cat with the ruined transformant of PCR method screening alpha-amylase gene
+The PCR method of the ruined transformant of screening alpha-amylase gene is following:
Synthetic following primer: aam1:5 ' ggtctgatcgatgggatgtc 3 '; Aam2:5 ' tcatcatcgctcatccatgt3 '; W2p:5 ' actgacgattaccttgcg 3 '; Baci-p1:5 ' cttccaatcacccgctctt 3 '. transformant after the incubated overnight, is extracted total DNA. and with primer aam1/aam2 and w2p/baci-p1 carried out the PCR.PCR reaction conditions respectively as follows respectively then in the LB substratum:
Aam1/aam2:PCR reaction system 20ul:DNA template (the total DNA of transformant) 1ul (about 20ng); 10 * Taq Buffer 2ul, 10pmol/ul dNTP 0.4ul, the forward and reverse primer of 10pmol/ul respectively are 0.5ul; 2.5U/ul Taq archaeal dna polymerase 1ul adds ddH
2O to 20ul.PCR response procedures: 94 ℃ of 5min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, 30 circulations; 72 ℃ of 10min; 4 ℃ of preservations;
W2p/baci-p1:PCR reaction system 20ul:DNA template (the total DNA of transformant) 1ul (about 20ng); 10 * Taq Buffer 2ul, 10pmol/ul dNTP 0.4ul, the forward and reverse primer of 10pmol/ul respectively are 0.5ul; 2.5U/ul Taq archaeal dna polymerase 1ul adds ddH
2O to 20ul.PCR response procedures: 94 ℃ of 5min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 70s, 30 circulations; 72 ℃ of 10min; 4 ℃ of preservations;
If a certain transformant with the w2p/baci-p1 primer to doing the product that PCR obtains about 1.1kb, and with the aam1/aam2 primer to doing the product that PCR can not get about 450bp, then this transformant is transformant 1A751 [CTBA] Cat of AMS disappearance
+
3. with plasmid JM103 (pCm::Er) replacement chloramphenicol resistance gene
Plasmid JM103 (pCm::Er) and subtilis 1A751 [CTBA] Cat for preparing
+Competent cell mixes; 220rpm; 37 ℃ of shaking tables are cultivated 90min; Be applied in the LB solid medium that contains Oxacyclotetradecane,erythromycin deriv 1ug/ml, the bacterium colony that grows inoculates the LB solid medium checking that contains paraxin 5ug/ml, filters out the Oxacyclotetradecane,erythromycin deriv resistance and bacterial strain 1A751 [CTBA] Cat-Erm of chlorampenicol resistant inactivation
+
4. the single cross of plasmid pDG364-P43-CTBA homology is changed and is incorporated into subtilis 1A751 [CTBA] Cat
-Erm
+The genome group
Plasmid pDG364-P43-CTBA transforms subtilis 1A751 [CTBA] Cat for preparing
-Erm
+Competent cell is containing paraxin 5ug/ml, and the LB solid medium of Oxacyclotetradecane,erythromycin deriv 1ug/ml is selected the reorganization bacterium, can screen to obtain bacterial strain 1A751 [CTBA2] Cat that two copy beta-amylases expression unit are incorporated into subtilis genome group
+Erm
+
5. with plasmid JM103 (pCm::Nm) replacement chloramphenicol resistance gene
Plasmid JM103 (pCm::Nm) transforms subtilis 1A751 [CTBA2] Cat for preparing
+Erm
+Competent cell; Containing Xin Meisu 20ug/ml; Select the reorganization bacterium in the LB solid medium of Oxacyclotetradecane,erythromycin deriv 1ug/ml, the bacterium colony that grows inoculates the LB solid medium checking that contains paraxin 5ug/ml, filters out neomycin resistance and bacterial strain 1A751 [CTBA2] Cat-Neo of chlorampenicol resistant inactivation
+Erm
+
6. the single cross of plasmid pDG364-P43-CTBA homology is changed and is incorporated into subtilis 1A751 [CTBA2] Cat
-Erm
+Neo
+The genome group
Plasmid pDG364-P43-CTBA transforms subtilis 1A751 [CTBA2] Cat for preparing
-Neo
+Erm
+Competent cell; In the LB solid medium that contains paraxin 5ug/ml, Oxacyclotetradecane,erythromycin deriv 1ug/ml and Xin Meisu 20ug/ml, select the reorganization bacterium, can screen and obtain bacterial strain 1A751 [CTBA3] Cat that three copy beta-amylases expression unit are incorporated into subtilis genome group
+Neo
+Erm
+
7. with plasmid JM103 (pCm::Sp) replacement chloramphenicol resistance gene
Plasmid JM103 (pCm::Sp) transforms subtilis 1A751 [CTBA3] Cat
+Neo
+Erm
+Containing Togoplus 60ug/ml; Select the reorganization bacterium in the LB solid medium of Oxacyclotetradecane,erythromycin deriv 1ug/ml and Xin Meisu 20ug/ml; The bacterium colony that grows inoculates the LB solid medium checking that contains paraxin 5ug/ml, filters out the Togoplus resistance and bacterial strain 1A751 [CTBA3] Cat of chlorampenicol resistant inactivation
-Spe
+Neo
+Erm
+
8. the single cross of plasmid pDG364-P43-CTBA homology is changed and is incorporated into subtilis 1A751 [CTBA3] Cat
-Spe
+Neo
+Erm
+The genome group
Plasmid pDG364-P43-CTBA transforms subtilis 1A751 [CTBA3] Cat
-Spe
+Neo
+Erm
+In the LB solid medium that contains paraxin 5ug/ml, Oxacyclotetradecane,erythromycin deriv 1ug/ml, Xin Meisu 20ug/ml and Togoplus 60ug/ml, select the reorganization bacterium, can screen and obtain bacterial strain 1A751 [CTBA4] Cat that four copy beta-amylases expression unit are incorporated into subtilis genome group
+Spe
+Neo
+Erm
+
9. the expression of subtilis beta-amylase
Subtilis 1A751 [CTBA4] Cat
+Spe
+Neo
+Erm
+Activation on the LB flat board that contains paraxin 5ug/ml, Oxacyclotetradecane,erythromycin deriv 1ug/ml, Xin Meisu 20ug/ml, Togoplus 60ug/ml is inoculated into LB liquid nutrient medium overnight cultures, and centrifugal, supernatant is the beta-amylase crude enzyme liquid.
10. the enzyme activity determination of the recombined bacillus subtilis beta-amylase of expressing
Measure the enzyme of the beta-amylase of recombined bacillus subtilis expression lives like the method for embodiment 1.Through measuring, single copy is expressed the unit and is integrated bacterial strain 1A751 [CTBA] Cat
+The crude enzyme liquid enzyme live to about 400U/ml, two copies are expressed the unit and are integrated bacterial strain 1A751 [CTBA2] Cat
+Erm
+The crude enzyme liquid enzyme live to about 700U/ml, three copies are expressed unit and are integrated bacterial strain 1A751 [CTBA3] Cat
+Neo
+Erm
+The crude enzyme liquid enzyme live to about 1000U/ml, four copies are expressed unit and are integrated bacterial strain 1A751 [CTBA4] Cat
+Spe
+Neo
+Erm
+The beta-amylase enzyme live to about 1200U/ml, four copies are expressed unit, and to integrate bacterial strains are about 3 times of single copy.
Claims (8)
1. two or more exogenous gene expression unit are incorporated into the method for the same integration site of subtilis karyomit(e); It is characterized in that; It is a kind of multiple resistant gene screening reorganization bacterium that utilizes; Two or more exogenous gene expression unit are incorporated into the method for the same integration site of subtilis karyomit(e), and concrete steps are:
1) the exogenous gene expression unit is cloned into separately respectively on the subtilis integrated plasmid, each recombination and integration plasmid carries an exogenous gene expression unit;
2) the unitary integration of first exogenous gene expression is to utilize integrated plasmid that the exogenous gene expression unit is incorporated in the subtilis karyomit(e), selects through the resistant gene selection markers A that carries on the integrated plasmid to obtain the exogenous gene expression unit and be incorporated into the recombined bacillus subtilis 1 in the subtilis karyomit(e);
3) plasmid of usefulness replacement resistant gene selection markers replaces with resistant gene selection markers B with the resistant gene selection markers A of above-mentioned recombined bacillus subtilis 1; To replace successful reorganization bacterium through resistant gene selection markers B and pick out, obtain recombined bacillus subtilis 2 with resistant gene selection markers B;
4) second unitary integration of exogenous gene expression is to utilize to be connected with second unitary integrated plasmid of exogenous gene expression and with the homology single cross form of changing second exogenous gene expression unit to be incorporated on the recombined bacillus subtilis 2, screens with resistant gene selection markers B through resistant gene selection markers A and obtains containing two unitary recombined bacillus subtilis of exogenous gene expression;
5) repeat above-mentioned steps 3) and step 4); After resistant gene selection markers A replaced with other resistant gene selection markers; Be incorporated in the reorganization bacterium with the homology single cross form of changing with being connected with the unitary integrated plasmid of exogenous gene expression, obtain expressing more than two the unit and be incorporated into the reorganization bacterium in the subtilis karyomit(e); Described exogenous gene expression unit is identical or different: not simultaneously, obtain the reorganization bacterium that different exogenous gene expressions unit is incorporated into subtilis genome group; When identical, the exogenous gene expression unit that obtains two or more copies is incorporated into the reorganization bacterium of subtilis genome group;
Described exogenous gene expression unit is a monocistron, or polycistron;
Described subtilis is subtilis 168 derivative strains.
2. according to the said method that two or more exogenous gene expression unit is incorporated into the same integration site of subtilis karyomit(e) of claim 1; It is characterized in that, described subtilis integrated plasmid for can with plasmid pMLK83 and derive plasmid or pDK and the plasmid of deriving thereof of subtilis genome group generation homology exchange; Described resistant gene selection markers A is a Xin Meisu; The plasmid of described replacement resistant gene selection markers is pVK71; Described resistant gene selection markers B is a Togoplus.
3. according to the said method that two or more exogenous gene expression unit is incorporated into the same integration site of subtilis karyomit(e) of claim 1; It is characterized in that, described subtilis integrated plasmid for can with plasmid pDG364 and derive plasmid or pDL and the plasmid of deriving thereof of subtilis genome group generation homology exchange; Described resistant gene selection markers A is a paraxin; The plasmid of described replacement resistant gene selection markers is JM103 (pCm::Er), JM103 (pCm::Nm), JM103 (pCm::Sp), JM103 (pCm::Tc); Described resistant gene selection markers B is Oxacyclotetradecane,erythromycin deriv, Xin Meisu, Togoplus or tsiklomitsin.
4. according to the said method that two or more exogenous gene expression unit is incorporated into the same integration site of subtilis karyomit(e) of claim 1; It is characterized in that, described subtilis integrated plasmid for can with plasmid pDG1661 and derive plasmid or pDG1662 and the plasmid of deriving thereof of subtilis genome group generation homology exchange; Described resistant gene selection markers A is a paraxin; The plasmid of described replacement resistant gene selection markers is JM103 (pCm::Er), JM103 (pCm::Nm), JM103 (pCm::Tc); Described resistant gene selection markers B is Oxacyclotetradecane,erythromycin deriv, Xin Meisu or tsiklomitsin.
5. according to the said method that two or more exogenous gene expression unit is incorporated into the same integration site of subtilis karyomit(e) of claim 1; It is characterized in that, described subtilis integrated plasmid for can with plasmid pDG1663 and derive plasmid or pDG1664 and the plasmid of deriving thereof of subtilis genome group generation homology exchange; Described resistant gene selection markers A is an Oxacyclotetradecane,erythromycin deriv; The plasmid of described replacement resistant gene selection markers is JM103 (pEr::Cm), JM103 (pEr::Nm), JM103 (pEr::Pm); Described resistant gene selection markers B is paraxin, Xin Meisu or phleomycin.
6. according to the said method that two or more exogenous gene expression unit is incorporated into the same integration site of subtilis karyomit(e) of claim 1; It is characterized in that, described subtilis integrated plasmid for can with plasmid pSG1154, pSG1190, pSG1191, pSG1192, pSG1193 or pSG1729 and their corresponding plasmids of deriving of subtilis genome group generation homology exchange; Described resistant gene selection markers A is a Togoplus; The plasmid of described replacement resistant gene selection markers is pVK73; Described resistant gene selection markers B is a Xin Meisu.
7. according to the said method that two or more exogenous gene expression unit is incorporated into the same integration site of subtilis karyomit(e) of claim 1; It is characterized in that, described subtilis integrated plasmid for can with plasmid pDG1728, pDG1729, pDG1730 or pDG1731 and their corresponding plasmids of deriving of subtilis genome group generation homology exchange; Described resistant gene selection markers A is a Togoplus; The plasmid of described replacement resistant gene selection markers is pVK73; Described resistant gene selection markers B is a Xin Meisu.
8. according to the said method that two or more exogenous gene expression unit is incorporated into the same integration site of subtilis karyomit(e) of claim 1; It is characterized in that, described subtilis integrated plasmid for can with plasmid pAX01 and derive plasmid or pAX-spac and the plasmid of deriving thereof of subtilis karyomit(e) generation homology exchange; Described resistant gene selection markers A is an Oxacyclotetradecane,erythromycin deriv; The plasmid of described replacement resistant gene selection markers is JM103 (pEr::Cm), JM103 (pEr::Nm), JM103 (pEr::Pm) or JM103 (pEr::Sp); Described resistant gene selection markers B is paraxin, Xin Meisu, phleomycin or Togoplus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105636477A CN102127530B (en) | 2010-11-29 | 2010-11-29 | Method for integrating two or more than two exogenous gene expression units onto the same integrated site of chromosome of Bacillus subtilis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105636477A CN102127530B (en) | 2010-11-29 | 2010-11-29 | Method for integrating two or more than two exogenous gene expression units onto the same integrated site of chromosome of Bacillus subtilis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102127530A CN102127530A (en) | 2011-07-20 |
| CN102127530B true CN102127530B (en) | 2012-07-25 |
Family
ID=44265805
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105636477A Expired - Fee Related CN102127530B (en) | 2010-11-29 | 2010-11-29 | Method for integrating two or more than two exogenous gene expression units onto the same integrated site of chromosome of Bacillus subtilis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102127530B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609425B (en) * | 2018-12-29 | 2022-04-05 | 广西壮族自治区农业科学院农产品加工研究所 | Method for screening integrated recombinants by recovering activity of enzyme of bacillus subtilis integration site |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002000907A1 (en) * | 2000-06-23 | 2002-01-03 | Novozymes A/S | Method for stable chromosomal multi-copy integration of genes |
-
2010
- 2010-11-29 CN CN2010105636477A patent/CN102127530B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002000907A1 (en) * | 2000-06-23 | 2002-01-03 | Novozymes A/S | Method for stable chromosomal multi-copy integration of genes |
Non-Patent Citations (2)
| Title |
|---|
| 石爱琴等.青霉素酰化酶(PGA)在枯草芽孢杆菌基因组上的整合表达.《浙江理工大学学报》.2009,第26卷(第05期),776-781. * |
| 邹立扣等.枯草芽孢杆菌整合载体研究进展.《生物技术通讯》.2003,第14卷(第06期),525-527. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102127530A (en) | 2011-07-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Worthington et al. | Targeted disruption of the α-amylase gene in the hyperthermophilic archaeon Sulfolobus solfataricus | |
| Wu et al. | pHsh vectors, a novel expression system of Escherichia coli for the large-scale production of recombinant enzymes | |
| Suzuki et al. | Counterselection system for Geobacillus kaustophilus HTA426 through disruption of pyrF and pyrR | |
| Zhou et al. | Optimized expression and enhanced production of alkaline protease by genetically modified Bacillus licheniformis 2709 | |
| Suzuki et al. | Polysaccharide-degrading thermophiles generated by heterologous gene expression in Geobacillus kaustophilus HTA426 | |
| KR940014776A (en) | Fluolanas, microorganisms for producing the same, a method for producing the flulanase and its use | |
| Vargas et al. | [NiFe] hydrogenase from Alteromonas macleodii with unusual stability in the presence of oxygen and high temperature | |
| Jeon et al. | Genome-wide transcriptomic analysis of a flocculent strain of Zymomonas mobilis | |
| CN103224949B (en) | Bacillus subtilis for high-efficiency expression of recombination pullulanase and obtaining method thereof | |
| Sumi et al. | Light-inducible carotenoid production controlled by a MarR-type regulator in Corynebacterium glutamicum | |
| EP0057976B1 (en) | a process for cloning the gene coding for a thermostable alpha-amylase into escherichia coli and bacillus subtilis | |
| Zhang et al. | Development of an inducible transposon system for efficient random mutagenesis in Clostridium acetobutylicum | |
| Tan et al. | Role of Rbp1 in the acquired chill-light tolerance of cyanobacteria | |
| Oslowski et al. | Production of hydrogen from α-1, 4-and β-1, 4-linked saccharides by marine hyperthermophilic Archaea | |
| CN103834629A (en) | Recombinant high-temperature pullulanase and preparation method thereof | |
| CN106191090B (en) | The algae engineering bacteria system of antibiotic-free expression alien gene and its preparation and application | |
| CN102127530B (en) | Method for integrating two or more than two exogenous gene expression units onto the same integrated site of chromosome of Bacillus subtilis | |
| Ingle et al. | Polynucleotide phosphorylase and RNA helicase CshA cooperate in Bacillus subtilis mRNA decay | |
| Song et al. | Induction of a toxin-antitoxin gene cassette under high hydrostatic pressure enables markerless gene disruption in the hyperthermophilic archaeon Pyrococcus yayanosii | |
| CN102127529B (en) | Method for recombinant expression of beta-amylase in bacillus subtillis in integrated mode | |
| CN101691579A (en) | Marine low temperature alpha-amylase gene engineering bacteria, recombinant enzyme and application | |
| CN103773746B (en) | Lipase and mutant thereof | |
| CN113583931B (en) | Citrobacter williamsii ansB gene knockout mutant strain and application thereof | |
| CN109321618A (en) | A method of yield of erythrocin is improved by the red mould SACE_5717 gene of the more spores of sugar | |
| CN112226422B (en) | EstWY enzyme mutant with improved activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120725 Termination date: 20201129 |