WO2021062886A1

WO2021062886A1 - Preparation and transformation methods for bacillus subtilis competent cell

Info

Publication number: WO2021062886A1
Application number: PCT/CN2019/111571
Authority: WO
Inventors: 周辉
Original assignee: 广东普洛宇飞生物科技有限公司
Priority date: 2019-09-30
Filing date: 2019-10-17
Publication date: 2021-04-08
Also published as: CN110484480A; CN110484480B

Abstract

A cell wall weakening agent for preparing a bacillus subtilis competent cell, comprising the following components: glycine, serine, and dithiothreitol. The provided cell wall weakening agent can improve the transformation efficiency of bacillus subtilis. Also provided is a transformation method for a bacillus subtilis competent cell by electroporation.

Description

Preparation and transformation method of Bacillus subtilis competent cell

Technical field

The present invention belongs to the field of biotechnology, and particularly relates to a method for preparing Bacillus subtilis competence and its transformation.

Background technique

Bacillus subtilis (Bacillus subtilis) is a kind of gram-positive rod-shaped bacteria that is widely distributed in the soil, mesophilic, aerobic and spore-producing. It has strong resistance to stress, and can secrete a large number of enzymes and produce Antibacterial substances, on the one hand, are widely used in the fields of feed, biological control, and environmental protection as live bacteria, and on the other hand, they play an important role in the production of exogenous proteins and metabolites as an expression system. The Gram-positive bacteria expression system possessed by Bacillus subtilis has the ability to express different proteins that many Gram-negative bacteria such as E. coli do not possess. Compared with our commonly used E. coli expression system, the Bacillus subtilis expression system has The following advantages: 1) It has a strong secretion and expression ability, and can directly secrete the expressed foreign protein outside the cell to avoid the aggregation of the protein in the cell. The recovery of the purified protein is relatively simple, which is conducive to downstream operations; 2) Belongs The GRAS strain can be safely used for the production of food and pharmaceutical proteins; 3) There is no obvious codon preference, which avoids codon optimization.

The introduction of foreign genes is an important step in the application of Bacillus subtilis as an expression system. However, the transformation efficiency of Bacillus subtilis is far lower than that of Escherichia coli, which limits its use in protein engineering (such as directed evolution, protein mutant library, etc.) and Application of metabolic transformation. As early as 1958, studies have found that Bacillus subtilis strains have the ability to form natural competence, and the formation of competence is the result of highly ordered genetic regulation in the later stage of growth, but the proportion of Bacillus subtilis that naturally form competent cells Smaller, and the duration is shorter. The currently reported methods to improve the transformation efficiency of Bacillus subtilis mainly include polymer method, electroporation method and protoplasm method. However, the polymer method requires the construction of polymer plasmids. The protoplast method is fragile, which makes the preparation of Bacillus subtilis protoplasts. The body is difficult and very cumbersome. The electroporation transformation method is a commonly used method for Bacillus subtilis. Its operation is simple, the experiment is easy to control, and the reproducibility is good. However, the electrotransformation conditions have a great impact on the transformation of competent cells. The current electroporation transformation efficiency is generally not high. Can not meet the needs of the experiment, so it is necessary to establish a method for efficient transformation of Bacillus subtilis.

Summary of the invention

The first object of the present invention is to provide a cell wall weakening agent for preparing Bacillus subtilis competent cells, the cell wall weakening agent comprising the following components: glycine, serine and dithiothreitol (DTT). The inventor's research shows that after adding the cell wall weakening agent of the present invention to the Bacillus subtilis culture and culturing for a period of time, the obtained Bacillus subtilis competent cells can improve the transformation efficiency.

Preferably, the concentration of the glycine, serine and dithiothreitol in the cell wall weakening agent is 0.5-1% (W/V) for glycine and 0.5-1% (W/V) for serine , Dithiothreitol is 1-10mM.

Preferably, the concentration of the glycine, serine and dithiothreitol in the cell wall weakening agent is: glycine is 0.6-0.8% (W/V), serine is 0.7-0.9% (W/V) , Dithiothreitol is 5-7mM.

Preferably, the concentration of the glycine, serine and dithiothreitol in the cell wall weakening agent is: glycine is 0.6% (W/V), serine is 0.9% (W/V), dithiothreon Sugar alcohol is 6mM.

The inventors studied the effects of different concentrations of glycine, threonine, and DTT on the transformation rate of Bacillus subtilis competent cells. The results show that when the concentration of glycine is 0.6-0.8%, the concentration of serine is 0.7-0.9%. The conversion rate of Bacillus subtilis competent cells is higher when the concentration of dithiothreitol is in the range of 5-7 mM; the conversion efficiency is highest when glycine is 0.6%, serine is 0.9%, and dithiothreitol is 6 mM.

The second object of the present invention is to provide a method for electric shock transformation of Bacillus subtilis competent cells, which includes two steps of preparing competent cells and electric shock transformation, wherein the preparing competent cells sequentially includes the following steps:

(1) Inoculate Bacillus subtilis into LB basic medium for overnight cultivation, and then inoculate it into GM growth medium for cultivation;

(2) Add the cell wall weakening agent of the present invention to the culture in step (1) and continue to culture until the OD600 value reaches 0.9;

(3) Centrifuge the culture obtained in step (2) in an ice bath to collect Bacillus subtilis cells;

(4) Wash the cells with pre-cooled WB shock buffer, then resuspend the obtained cells in WB shock buffer, quickly freeze in liquid nitrogen, and store at -80°C;

The components of GM growth medium are: tryptone 1% (W/V), yeast extract 0.5% (W/V), NaCl 0.5% (W/V), hydrolyzed casein 0.2% (W/V), 500 mM sorbitol, 500 mM glucose, 50 mM K ₂ HPO ₄ , 50 mM KH ₂ PO ₄ .

The components of the WB shock buffer are: 500 mM trehalose, 500 mM sorbitol, 500 mM mannitol, 0.5 mM K ₂ HPO ₄ , 0.5 mM KH ₂ PO ₄ , 15 mM MgCl ₂ , 85 mM CaCl ₂ , pH 7.2.

The electric shock conversion includes the following steps:

The plasmid to be transformed and the competent cell are mixed and bathed in ice, and subjected to electric shock. After electric shock transformation, heat shock at 30° C. for 5 min; to obtain the recombinant Bacillus subtilis which is introduced into the transformation treatment.

Preferably, the amount of inoculation in the GM medium in the step (1) is 1:100, and the inoculum is cultivated in the GM medium to OD600=0.6.

The electric shock parameters are: voltage 20kv/cm, capacitance 25μF, resistance 200Ω, electric shock 1 time, duration 5ms.

Preferably, the step of electroporation transformation further includes adding the recombinant Bacillus subtilis transformed by electroporation to RM resuscitation medium, culturing at 37°C for 3-6 hours, and then coating the LB plate;

The components of the RM recovery medium are tryptone 1% (W/V), yeast extract 0.5% (W/V), NaCl 0.5% (W/V), sorbitol 500 mM, 350 mM mannitol.

Preferably, the Bacillus subtilis is one of Bacillus subtilis ZK, Bacillus subtilis DB104 or Bacillus subtilis WB600.

Preferably, the plasmid is a shuttle plasmid PHT01 or PHT304.

The beneficial effects of the present invention: on the basis of the prior art, the present invention improves the preparation and transformation method of Bacillus subtilis electro-transformed competent cells. After the conventional LB basic medium is cultivated, the growth medium GM is used for cultivation, and The cell wall weakening agent with optimized concentration was added during the preparation process, and the resuscitation medium RM was used for resuscitation culture after electric shock transformation. The prepared competent cells of Bacillus subtilis had a great transformation efficiency compared with the traditional method of preparing competent cells. The improvement of the preparation process is simple, the experiment is easy to control, and the repeatability is good.

Description of the drawings

Figure 1 shows the electrophoresis diagram of PHT01 plasmid transformation.

Figure 2 is the electrophoresis diagram of PHT304 plasmid transformation.

Figure 3 is a schematic diagram of the effect of adding different concentrations of glycine, threonine, and DTT on the transformation efficiency of Bacillus subtilis.

Figure 4 is a schematic diagram showing the effect of different ratios of glycine, threonine, and DDT combination on the transformation efficiency of Bacillus subtilis.

Detailed ways

In order to show the technical solutions, objectives and advantages of the present invention more concisely and clearly, the present invention will be further described in detail below in conjunction with specific embodiments and the accompanying drawings.

Example 1 Transformation of Bacillus subtilis high-temperature-resistant α-amylase

1. Construction of the vector

According to the Bacillus subtilis thermostable alpha-amylase gene sequence published by NCBI, primers were designed to amplify the Bacillus subtilis strain as a template. The primer sequences were P1: CGGGATCCACATTGAAAGGGGAGGAGAAT, P2: GCTCTAGACGTCCTCTCTGCTCTTCTATC, The 5 ends were introduced with BamHI and XbaI restriction sites, and the gel was recovered for use after amplification. The PHT01 plasmid was double digested with BamHI and XbaI endonuclease and recovered after digestion. The Bacillus subtilis selected in this embodiment is Bacillus subtilis ZK.

The restriction conditions are as follows:

Put the digestion system into a 37°C tank, and water bath for 3h

The connection conditions are as follows:

Put the connection system in a 16°C water bath and connect overnight. The ligated product was transformed into Escherichia coli DH-5a, and the amp-resistant LB plate was used for screening, a single clone was picked and sequenced to confirm the successful construction of the vector.

2. Preparation of reagents

LB medium preparation: 1% (W/V) tryptone, 0.5% (W/V) yeast extract, 1% (W/V) sodium chloride, sterilized at 121°C for 15 min.

GM medium (growth medium) preparation: tryptone 1% (W/V), yeast extract 0.5% (W/V), NaCl 0.5% (W/V), hydrolyzed casein 0.2% (W/V) ), 500mM sorbitol, 500mM glucose, 50mM K ₂ HPO ₄ , 50 mM KH ₂ PO ₄ , sterilized at 115°C for 15 min.

Cell wall weakening agent (WA solution preparation 10×): 5% (W/V) glycine, 10% (W/V) serine, 5 mmol DTT. Glycine and serine are sterilized by filtration with a 0.22um filter membrane and sterilized by DTT at 121°C for 15 minutes.

Preparation of WB buffer (shock buffer): 500mM trehalose, 500mM sorbitol, 500mM mannitol, 15mM MgCl ₂ , 0.5mM K ₂ HPO ₄ , 0.5mM KH ₂ PO ₄ , 10% glycerol, adjust pH Sterilize at 121°C for 15 minutes to 7.2.

Preparation of RM medium (resuscitation medium): tryptone 1% (W/V), yeast extract 0.5% (W/V), NaCl 0.5% (W/V), sorbitol 500 mM, 350 mM mannitol , Sterilize at 121℃ for 15min.

3. Preparation of Bacillus subtilis competent cells

(1) Pick out a single clone of Bacillus subtilis and culture it overnight in 2ml LB medium for 12-14 hours at a temperature of 32°C and a rotation speed of 200rpm;

(2) Take 400ul of the culture of the above step (1) and inoculate it in 40ml GM medium, cultivate at 32°C and 200rpm to OD600=0.6;

(3) Add a cell wall weakening agent, where the final concentrations of glycine, serine, and DTT are 0.5% (W/V), 1% (W/V), 0.5 mmol, 37°C, 200 rpm, and continue to culture until the OD600 value reaches 0.9 ；

(4) Ice bath for 10 minutes, collect Bacillus subtilis cells by centrifugation (10000g, 4℃), wash 3 times with pre-cooled WB buffer, and finally resuspend in 100ul of WB buffer, and put it in liquid nitrogen for quick freezing, -80 Store at ℃;

4. Electric shock conversion

(1) Take the Bacillus subtilis strain stored at -80°C and melt it naturally on ice, add 100ng of the plasmid to be transformed after melting, and perform electric shock after ice bath for 5 minutes;

(2) Transfer the system of step (1) to an electric shock cup (1mm) pre-cooled at 0℃, and perform an electric shock with an electric transfer instrument (voltage 20kv/cm, capacitance 25μF, resistance 200Ω, electric shock 1 time, duration 5ms) ；

(3) Heat shock at 30℃ for 5min after electric shock conversion;

(4) Add 1ml of RM medium and incubate at 37°C for 3-6 hours, then spread it on an LB plate containing corresponding antibiotics.

(5) Count the colonies and calculate the transformation rate. The transformation rate is the number of transformants produced per μg of plasmid DNA.

The calculation formula of conversion efficiency is:

Transformation efficiency = total number of transformants/addition of plasmid DNA

Total number of transformants=number of colonies×dilution times×total volume of transformation reaction stock solution/volume of plate-coated bacteria solution.

The conversion rate calculated according to the above formula is 7.8×10 ⁷ cfu/μg. According to the results of agarose gel electrophoresis, the DNA bands are clear as shown in

lanes

1, 2 and 3 in Figure 1.

Example 2

The only difference between this embodiment and embodiment 1 is that the shuttle plasmid used in this embodiment is PHT304, and the selected Bacillus subtilis is Bacillus subtilis DB104.

The conversion rate calculated according to the above formula is 5.9×10 ⁷ cfu/μg. According to the results of agarose gel electrophoresis, the DNA bands are clear as shown in

lanes

1, 2, and 3 in Figure 2.

Example 3

In this example, the influence of the three components in the WA solution on the transformation rate of Bacillus subtilis was studied by separately adding glycine, threonine and DTT at different final concentrations. The shuttle plasmid selected in this example was PHT01, and the selected Bacillus subtilis was subtilis. Bacillus WB600. details as follows:

1. Preparation of Bacillus subtilis competent cells:

(2) Inoculate 400ul of the above-mentioned culture in 40ml GM medium, cultivate at 32°C and 200rpm to OD600=0.6;

(3) Separately add different concentrations of glycine, threonine, and DTT (dithiothreitol) to make the final concentrations: glycine (0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%) , Serine (0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%), DTT (1mM, 2mM, 3mM, 4mM, 5mM, 6mM, 7mM, 8mM, 9mM, 10mM) solution, 37℃, 200rpm Continue to cultivate until the value of OD600 reaches 0.9;

The LB medium, GM medium, WB buffer, and RM medium of this example are the same as those in Example 1.

2. Electric shock conversion

(3) Heat shock at 30℃ for 5min after electric shock conversion;

Separate addition of different concentrations of glycine, threonine, and DTT affect the transformation rate of Bacillus subtilis, and the results are shown in Figure 3. It can be seen from Figure 3 that when the final concentration of glycine is in the range of 0.6-0.8%, the final concentration of threonine is in the range of 0.7-0.9%, and the final concentration of DTT is in the range of 5-7mM, the conversion efficiency is better.

Example 4

After screening the final concentration range of glycine, threonine and DTT with better conversion efficiency, combine them to further screen out the best ratio of the three components. The specific ratio is shown in Table 1 below, and the remaining operations The conditions are the same as in Example 1.

Table 1. Different concentrations of glycine, threonine, and DDT combination grouping

The results are shown in Figure 4.

Groups

3, 6, 10-18 all have higher conversion rates. Moreover, the conversion efficiency does not increase with the increase of the component concentration. The conversion efficiency is not simply positively correlated with the concentration of glycine, threonine, and DTT, and the three have a certain synergistic effect through compounding. Therefore, through the above experimental screening, the transformation effect of group 12 is the best, that is, the final concentrations of glycine, threonine, and DTT are 0.6% (W/V), 0.9% (W/V), and Bacillus subtilis when the final concentration is 6 mmol. The conversion effect is good, which is the best solution of the present invention.

The above-mentioned embodiments only express several embodiments of the present invention, and the descriptions are relatively specific and detailed, but they should not be understood as limiting the scope of the invention patent. It should be pointed out that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention should be subject to the appended claims.

Claims

A cell wall weakening agent for preparing Bacillus subtilis competent cells is characterized in that the cell wall weakening agent comprises the following components: glycine, serine and dithiothreitol.
The cell wall weakening agent for preparing Bacillus subtilis competent cells according to claim 1, wherein the final concentration of the glycine, serine and dithiothreitol in the cell wall weakening agent is: glycine is 0.5-1% (W/V), serine 0.5-1% (W/V), dithiothreitol 1-10 mmol.
The cell wall weakening agent for preparing Bacillus subtilis competent cells according to claim 2, wherein the concentration of the glycine, serine and dithiothreitol in the cell wall weakening agent is: glycine is 0.6 ~0.8%(W/V), serine is 0.7~0.9%(W/V), dithiothreitol is 5~7mmol.
The cell wall weakening agent for preparing Bacillus subtilis competent cells according to claim 3, wherein the concentration of the glycine, serine and dithiothreitol in the cell wall weakening agent is: glycine is 0.6 %(W/V), serine is 0.9%(W/V), dithiothreitol is 6mmol.
A method for electric shock transformation of Bacillus subtilis competent cells is characterized in that it comprises two steps of preparing competent cells and electric shock transformation, wherein the preparing competent cells sequentially includes the following steps:

(1) Inoculate Bacillus subtilis into LB medium for overnight cultivation, and then inoculate it into GM medium for cultivation;

(2) In step (1), the cell wall weakening agent according to claim 1 is added to the culture to continue the culture until the value of OD600 reaches 0.9;

(3) Centrifuge the culture obtained in step (2) in an ice bath to collect Bacillus subtilis cells;

(4) Wash the cells with pre-cooled WB buffer, then resuspend the obtained cells in WB buffer, and put them in liquid nitrogen for quick freezing and storage;

The components of GM medium are: tryptone 1% (W/V), yeast extract 0.5% (W/V), NaCl 0.5% (W/V), hydrolyzed casein 0.2% (W/V), 500mM Sorbitol, 500mM glucose, 50mM K 2 HPO 4 , 50mM KH 2 PO 4 .

The components of the WB buffer are: 500 mM trehalose, 500 mM sorbitol, 500 mM mannitol, 0.5 mM K 2 HPO 4 , 0.5 mM KH 2 PO 4 , 15 mM MgCl 2 , 85 mM CaCl 2 , pH 7.2.

The electric shock conversion includes the following steps:

The plasmid to be transformed and the competent cell are mixed and bathed in ice, and subjected to electric shock. After electric shock transformation, heat shock at 30° C. for 5 min; to obtain the recombinant Bacillus subtilis which is introduced into the transformation treatment.
The method for electroporation transformation of Bacillus subtilis competent cells according to claim 5, wherein the inoculation amount of the GM medium in the step (1) is 1:100, and the GM medium is cultured to OD600= 0.6.
The method for electric shock transformation of Bacillus subtilis competent cells according to claim 5, wherein the electric shock parameters are: voltage 20 kv/cm, capacitance 25 μF, resistance 200 Ω, electric shock 1 time, duration 5 ms.
The method for electric shock transformation of Bacillus subtilis competent cells according to claim 5, wherein the step of electric shock transformation further comprises adding the recombinant Bacillus subtilis transformed by electric shock to RM medium and culturing at 37°C for 3-6 hours. Coated LB plate;

The components of the RM medium are tryptone 1% (W/V), yeast extract 0.5% (W/V), NaCl 0.5% (W/V), sorbitol 500 mM, 350 mM mannitol.
The method for electroporation transformation of Bacillus subtilis competent cells according to claim 5, wherein the Bacillus subtilis is one of Bacillus subtilis ZK, Bacillus subtilis DB104 or Bacillus subtilis WB600.
The method for electroporation transformation of Bacillus subtilis competent cells according to claim 5, wherein the plasmid is a shuttle plasmid PHT01 or PHT304.