WO2012107778A2 - Mutant pores - Google Patents
Mutant pores Download PDFInfo
- Publication number
- WO2012107778A2 WO2012107778A2 PCT/GB2012/050301 GB2012050301W WO2012107778A2 WO 2012107778 A2 WO2012107778 A2 WO 2012107778A2 GB 2012050301 W GB2012050301 W GB 2012050301W WO 2012107778 A2 WO2012107778 A2 WO 2012107778A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- pore
- mutant
- serine
- sequence
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/35—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycobacteriaceae (F)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/04—Mycobacterium, e.g. Mycobacterium tuberculosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2521/00—Reaction characterised by the enzymatic activity
- C12Q2521/10—Nucleotidyl transfering
- C12Q2521/101—DNA polymerase
Definitions
- the invention relates to mutant forms of Msp.
- the invention also relates to nucleic acid characterisation using Msp.
- Nanopore sensing is an approach to sensing that relies on the observation of individual binding events between analyte molecules and a receptor.
- Nanopore sensors can be created by placing a single pore of nanometer dimensions in an insulating membrane and measuring voltage-driven ionic transport through the pore in the presence of analyte molecules. The identity of an analyte is revealed through its distinctive current signature, notably the duration and extent of current block and the variance of current levels.
- nucleic acid e.g. DNA or RNA
- Existing technologies are slow and expensive mainly because they rely on amplification techniques to produce large volumes of nucleic acid and require a high quantity of specialist fluorescent chemicals for signal detection.
- Nanopore sensing has the potential to provide rapid and cheap nucleic acid sequencing by reducing the quantity of nucleotide and reagents required.
- nucleic acid (1) the control of nucleic acid movement through the pore and (2) the discrimination of nucleotides as the nucleic acid polymer is moved through the pore.
- nucleic acid has been passed through a mutant of hemolysin. This has provided current signatures that have been shown to be sequence dependent. It has also been shown that a large number of nucleotides contribute to the observed current, making a direct relationship between observed current and nucleic acid sequence challenging.
- MspA is a 157 kDa octameric porin from Mycobacterium smegmatis.
- the structure of MspA has been well documented by researchers (Gundlach, Proc Natl Acad Sci U S A. 2010 Sep 14; 107(37): 16060- 5. Epub 2010 Aug 26). Some key residues have been identified and modified to enhance the properties of the pore. These mutations have been performed to allow DNA to transition through the MspA pore.
- MspB, C and D are also known forms of Msp.
- novel mutants of Msp display improved properties for estimating the characteristics, such as the sequence of nucleic acids.
- the mutants surprisingly display improved nucleotide discrimination.
- the mutants surprisingly display an increased current range, which makes it easier to discriminate between different nucleotides, and a reduced variance of states, which increases the signal-to-noise ratio.
- the number of nucleotides contributing to the current as the nucleic acid moves through the pore is decreased. This makes it easier to identify a direct relationship between the observed current as the nucleic acid moves through the pore and the nucleic acid sequence.
- Msp shows improved sequencing properties when the movement of the nucleic acid through the pore is controlled by a Phi29 DNA polymerase.
- the coupling of Msp and Phi29 DNA polymerase results in three unexpected advantages.
- a decreased current variance is observed thereby increasing the signal-to- noise ratio.
- the invention provides a mutant Msp monomer comprising a variant of the sequence shown in SEQ ID NO: 2, wherein the variant comprises at least one of the following mutations:
- glutamine (Q) asparagine (N) or threonine (T) at position 75;
- glutamine (Q) asparagine (N) or threonine (T) at position 77;
- S serine
- T threonine
- tyrosine Y
- phenylalanine F
- valine V
- arginine R
- alanine A
- S serine
- glutamine Q
- leucine L
- methionine isoleucine
- I isoleucine
- A alanine
- V valine
- G glycine
- F tryptophan
- W tryptophan
- Y histidine
- H threonine
- T arginine
- R lysine
- asparagine N
- cysteine C
- S serine
- A alanine
- T threonine
- G glycine
- A alanine
- Q glutamine
- N asparagine
- G glycine
- T threonine
- tyrosine Y
- alanine A
- glutamine Q
- asparagine N
- threonine T
- phenylalanine F
- tryptophan W
- histidine H
- glycine G
- valine V
- arginine R
- lysine
- proline P
- cysteine C
- phenylalanine F
- isoleucine I
- valine V
- serine S
- proline P
- serine S
- the invention also provides:
- a construct comprising two or more covalently attached monomers derived from Msp; a polynucleotide which encodes a mutant of the invention or a construct of the invention; a homo-oligomeric pore derived from Msp comprising identical mutant monomers of the invention;
- hetero-oligomeric pore derived from Msp comprising at least one mutant monomer of the invention, wherein at least one of the eight monomers differs from the others;
- a method of characterising a target nucleic acid sequence comprising:
- kits for sequencing a target nucleic acid sequence comprising (a) a pore of the invention and (b) a nucleic acid handling enzyme;
- an apparatus for sequencing target nucleic acid sequences in a sample comprising (a) a plurality of pores of the invention and (b) a plurality of nucleic acid handling enzymes;
- a method of characterising a target nucleic acid sequence comprising:
- steps (b) and (b) are carried out with a voltage applied across the pore;
- kits for characterising a target nucleic acid sequence comprising (a) a pore derived from Msp and (b) a Phi29 DNA polymerase; and
- an apparatus for characterising target nucleic acid sequences in a sample comprising a plurality of pores derived from Msp and a plurality of Phi29 DNA polymerases.
- Fig. 1 shows the average dwell time of individual current levels as a single DNA strand translocates the nanopore.
- the data is collated from a number of single molecules and is split into quartiles by current levels.
- Fig. 2 shows current levels and variance obtained from using Phi29 in Unzipping mode to move a DNA strand (SEQ ID NO: 15) through the MS-(NNNRRK) 8 nanopore.
- Fig. 3 shows current levels and variance obtained from using Phi29 in Unzipping mode to move a DNA strand (SEQ ID NO: 15) through the HL-(mutant)7 nanopore.
- Fig. 4 shows the current levels for a single MspA channel recorded at a range of applied potentials (-200 mV to 200 mV).
- Fig. 5 shows the IV curve of open pore levels for the baseline MspA mutant, MS-(B1)8. Each line represents a single pore.
- Fig.6 shows the IV curve of open pore levels for the MspA mutant, MS-(B1-I105Y)8. Each line represents a single pore.
- Fig. 7 shows the IV curve of open pore levels for the MspA mutant, MS-(B1-I105N)8.
- Each line represents a single pore.
- Fig. 8 shows the change in current between a high conductance state (275 pA) and a low conductance state (150 pA) for the MS-(B1-I105A)8 pore at 180 mV.
- Fig. 9 shows the current levels produced when DNA is unzipped through the baseline MS-(B1) 8 pore. Current range for these events is ⁇ 30 pA.
- Fig. 10 shows the current levels produced when DNA is unzipped through the baseline MS-(B1-I10 A) 8 pore. Current range for these events is ⁇ 40 pA.
- Fig. 11 shows the DNA substrate design used in Examples 9 and 12 and 15.
- Fig. 12 shows the DNA substrate design used in Examples 10 and 11.
- Fig. 13 shows how the sequencing profile changes, for the same DNA sequence, when point mutations are made in the MspA monomer sequence. These plots show the average of the profile of the levels obtained from multiple polynucleotides.
- A) This graph shows the sequencing profile for the MS-(B1)8 pore.
- B) This graph shows the sequencing profile for the MS-(B1- D90Q-D93S-1105A)8 pore.
- C) shows the sequencing profile for the MS-(B 1 -D90Q- Q126R)8 pore.
- D) shows the sequencing profile for the MS-(B1-L88N-D90Q- D91M)8 pore.
- This graph shows the sequencing profile for the MS-(B1-L88N-D90Q-D91S)8 pore.
- Fig. 14 shows the DNA substrate design used in Example 13.
- Fig. 15 shows an example event trace for the controlled translocation of RNA, mediated by Phi29 DNA polymerase, through the MspA mutant pore MS-(B1)8.
- An expanded view, of the region highlighted in the upper trace, is shown below.
- Fig. 16 shows pore insertion into the lipid bilayer.
- A) Shows pore insertion of the MS- (Bl)8 oligomerised from the monomer.
- Fig. 17 shows an example event trace for the controlled translocation of DNA, mediated by a helicase, through the MS-(B1)8 mutant pore which was produced by oligomerisation of the monomer.
- An expanded view, of the region highlighted in the upper trace, is shown below.
- Fig. 18 shows an example event trace for the controlled translocation of DNA, mediated by a helicase, through the MS-(B1-B1)4 mutant pore which was produced by oligomerisation of the dimer.
- An expanded view, of the region highlighted in the upper trace, is shown below.
- Fig. 19 shows the DNA substrate design used in Example 16.
- Fig. 20 shows an example event trace for the controlled translocation of DNA containing both cytosine and 5-methylcytosine, mediated by a helicase, through the MS-(B1-L88N)8 mutant pore. An expanded view of the region highlighted in the upper trace is shown below.
- SEQ ID NO: 1 shows the polynucleotide sequence encoding the NNN-RR mutant MspA monomer.
- SEQ ID NO: 2 shows the amino acid sequence of the mature form of the NNN-RRK mutant of the MspA monomer.
- the mutant lacks the signal sequence and the amino terminal methionine (encoded by the start codon) and includes the following mutations: D90N, D91N, D93N, Dl 18R, D134R and E139K. These mutations allow DNA transition through the MspA pore.
- SEQ ID NO: 3 shows the polynucleotide sequence encoding the Phi29 DNA polymerase.
- SEQ ID NO: 4 shows the amino acid sequence of the Phi29 DNA polymerase.
- SEQ ID NO: 5 shows the codon optimised polynucleotide sequence derived from the sbcB gene from E. coli. It encodes the exonuclease I enzyme (EcoExo I) from E. coli.
- SEQ ID NO: 6 shows the amino acid sequence of exonuclease I enzyme (EcoExo I) from
- SEQ ID NO: 7 shows the codon optimised polynucleotide sequence derived from the xthA gene from E. coli. It encodes the exonuclease III enzyme from E. coli.
- SEQ ID NO: 8 shows the amino acid sequence of the exonuclease III enzyme from i. coli. This enzyme performs distributive digestion of 5' monophosphate nucleosides from one strand of double stranded DNA (dsDNA) in a 3 ' - 5 ' direction. Enzyme initiation on a strand requires a 5' overhang of approximately 4 nucleotides.
- SEQ ID NO: 9 shows the codon optimised polynucleotide sequence derived from the recJ gene from T. thermophilus. It encodes the RecJ enzyme from T. thermophilus (TthRecJ- cd).
- SEQ ID NO: 10 shows the amino acid sequence of the RecJ enzyme from T.
- thermophilus (TthRecJ-cd). This enzyme performs processive digestion of 5' monophosphate nucleosides from ssDNA in a 5 ' - 3 ' direction. Enzyme initiation on a strand requires at least 4 nucleotides.
- SEQ ID NO: 11 shows the codon optimised polynucleotide sequence derived from the bacteriophage lambda exo (redX) gene. It encodes the bacteriophage lambda exonuclease.
- SEQ ID NO: 12 shows the amino acid sequence of the bacteriophage lambda
- exonuclease The sequence is one of three identical subunits that assemble into a trimer.
- the enzyme performs highly processive digestion of nucleotides from one strand of dsDNA, in a 5'- 3'direction (http://www.neb.com/nebecomm/products/productM0262.asp). Enzyme initiation on a strand preferentially requires a 5 ' overhang of approximately 4 nucleotides with a 5 ' phosphate.
- SEQ ID Nos: 13 to 15 show the sequences used in Example 2.
- SEQ ID Nos: 16 to 18 show the amino acid sequences of the mature forms of the MspB, C and D mutants respectively. The mature forms lack the signal sequence.
- SEQ ID Nos: 19 and 20 show the sequences used in Examples 9, 12 and 15.
- SEQ ID Nos: 21 to 23 show the sequences used in Examples 10 and 11.
- SEQ ID Nos: 24 to 27 show the sequences used in Example 13.
- SEQ ID NO: 28 shows the DNA sequence of the dimer of the mature form of the NNN- RRK mutant of the MspA monomer used in Example 14.
- SEQ ID NO: 29 shows the protein sequence of the dimer of the mature form of the NNN- RRK mutant of the MspA monomer used in Example 14.
- SEQ ID NO: 30, 31 and 32 show the sequences used in Example 16.
- SEQ ID NO: 33 shows the linker sequence shown used in the construct shown in SEQ ID NO: 29.
- the present invention provides mutant Msp monomers.
- the mutant Msp monomers may be used to form the pores of the invention.
- a mutant Msp monomer is a monomer whose sequence varies from that of a wild-type Msp monomer and which retains the ability to form a pore. Methods for confirming the ability of mutant monomers to form pores are well-known in the art and are discussed in more detail below.
- the mutant monomers have improved nucleotide reading properties i.e. display improved nucleotide capture and discrimination.
- pores constructed from the mutant monomers capture nucleotides and nucleic acids more easily than the wild type.
- pores constructed from the mutant monomers display an increased current range, which makes it easier to discriminate between different nucleotides, and a reduced variance of states, which increases the signal-to-noise ratio.
- the number of nucleotides contributing to the current as the nucleic acid moves through pores constructed from the mutants is decreased. This makes it easier to identify a direct relationship between the observed current as the nucleic acid moves through the pore and the nucleic acid sequence.
- the improved nucleotide reading properties of the mutants are achieved via five main mechanisms, namely by changes in the: sterics (increasing or decreasing the size of amino acid residues); charge (e.g. introducing +ve charge to interact with the nucleic acid sequence); hydrogen bonding (e.g. introducing amino acids that can hydrogen bond to the base pairs);
- ⁇ pi stacking e,g, introducing amino acids that interact through delocalised electron pi systems
- alteration of the structure of the pore e.g. introducing amino acids that increase the size of the vestibule and/or constriction.
- a pore of the invention may display improved nucleotide reading properties as a result of altered sterics, altered hydrogen bonding and an altered structure.
- the introduction of bulky residues such as phenylalanine (F), tryptophan (W), tyrosine (Y) or histidine (H) increases the sterics of the pore.
- the introduction of aromatic residues such as phenylalanine (F), tryptophan (W), tyrosine (Y) or histidine (H), also increases the pi staking in the pore.
- the introduction of bulky or aromatic residues also alters the structure of the pore, for instance by opening up the pore and increasing the size of the vestibule and/or constriction. This is described in more detail below.
- a mutant monomer of the invention comprises a variant of the sequence shown in SEQ ID NO: 2.
- SEQ ID NO: 2 is the NNN-RRK mutant of the MspA monomer. It includes the following mutations: D90N, D91N, D93N, Dl 18R, D134R and E139K.
- a variant of SEQ ID NO: 2 is a polypeptide that has an amino acid sequence which varies from that of SEQ ID NO: 2 and which retains its ability to form a pore.
- the variant comprises at least one of the following mutations:
- N, S, Q or T at position 88 introduces into the inner constriction of the pore an amino acid that can hydrogen bond to the nucleotides in a nucleic acid.
- Residues 90 and 91 in each monomer also form part of the inner constriction of the pore.
- Residue 118 in each monomer is present within the vestibule of the pore.
- Residue 134 in each monomer is part of the entrance to the pore.
- S, Q or Y at position 90 introduces into the inner constriction of the pore an amino acid that can hydrogen bond to the nucleotides in a nucleic acid.
- the variant may include any number of mutations (a) to (kk), such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more of the mutations. Preferred combinations of mutations are discussed below.
- the amino acids introduced into the variant may be naturally-occuring or non-naturally occurring derivatives thereof.
- the amino acids introduced into the variant may be D-amino acids.
- cysteines may be introduced into the variant. Cysteines are preferably introduced at one or more, such as two or all of, positions 90, 91 and 103. These positions may be useful for chemical attachment of a molecular adaptor as discussed in more detail below. Any number of cysteines, such as 2, 3, 4, 5, 6 or more cysteines, may be introduced at positions 10 to 15, 51 to 60, 136 to 139 and 168 to 172. These positions are present in non-conserved loop regions of the pore and so are useful for chemically attaching a nucleic acid binding protein to the pore as discussed in more detail below.
- the variant comprises one or more of the substitutions shown in (A) to (Z) below. The variant may include any number of the substitutions in A to Z, such as 1, 2, 3, 4 or 5.
- (A) The introduction of one or more of (i) serine (S) at positon 75, (ii) serine (S) at position 77, (iii) asparagine (N) at position 88, (iv) glutamine (Q) at position 90 and (v) arginine (R) at position 126.
- the variant may include 1 , 2, 3, 4 or 5 of these substitutions.
- the advantages of homo-octameric pores including all four substitutions in each monomer are shown in Table 3 below.
- (H) The introduction of one or more of (i) threonine (T) at position 88 and (ii) serine (S) at position 90.
- the variant may include 1 or 2 of these substitutions.
- the advantages of homo-octameric pores including both substitutions in each monomer are shown in Table 2 below.
- (I) The introduction of one or more of (i) glutamine (Q) at position 87 and (ii) serine (S) at position 90.
- the variant may include 1 or 2 of these substitutions.
- the advantages of homo-octameric pores including both substitutions in each monomer are shown in Table 2 below.
- the variant may include 1 or 2 of these substitutions.
- the advantages of homo-octameric pores including both substitutions in each monomer are shown in Table 2 below.
- the variant may include 1 or 2 of these substitutions.
- the advantages of homo-octameric pores including both substitutions in each monomer are shown in Table 2 below.
- (Q) The introduction of one or more of (i) asparagine (N) at position 88 and (ii) arginine (R) at position 126.
- the variant may include 1 or 2 of these substitutions.
- the advantages of homo-octameric pores including both substitutions in each monomer are shown in Table 2 below.
- (R) The one or more of (i) asparagine (N) at position 88, (ii) glutamine (Q) at position 90 and (iii) arginine (R) at position 91.
- the variant may include 1, 2 or 3 of these substitutions.
- the advantages of homo-octameric pores including all three substitutions in each monomer are shown in Table 2 below.
- T The introduction of one or more of (i) asparagine (N) at position 88, (ii) glutamine (Q) at position 90 and (iii) valine (V) at position 105.
- the variant may include 1 , 2 or 3 of these substitutions.
- the advantages of homo-octameric pores including all three substitutions in each monomer are shown in Table 2 below.
- (V) The introduction of one or more of (i) phenylalanine (F), tryptophan (W), tyrosine (Y) or histidine (H) at position 90, (ii) phenylalanine (F), tryptophan (W), tyrosine (Y) or histidine (H) at position 91 and (iii) phenylalanine (F), tryptophan (W), tyrosine (Y) or histidine (H) at position 105.
- the variant may include 1, 2 or 3 of these substitutions.
- the introduction of these bulky, aromatic residues increases the sterics and pi stacking in the vestibule and/or constriction of the pore. They also increase the size of the vestibule and/or constriction (i.e. open up the pore).
- (W) The introduction of one or more of (i) serine (S), threonine (T), glycine (G), alanine (A) or valine (V) at position 90, (ii) serine (S), threonine (T), glycine (G), alanine (A) or valine (V) at position 91 and (iii) serine (S), threonine (T), glycine (G), alanine (A) or valine (V) at position 105.
- the variant may include 1, 2 or 3 of these substitutions.
- the introduction of smaller residues decreases the sterics in the vestibule and/or constriction of the pore.
- Preferred variants include, but are not limited to, those comprising at least one of the following substitution(s): L88N; L88S; L88Q; L88T; D90S; D90Q; D90Y; I105L; I105S;
- N90Q and N91Q R118N; N91C; N90C; N90W; N91W; N90K; N91K; N90R; N91R; N90S and
- a particularly preferred variant comprises I105N.
- Pores constructed from mutant monomers comprising I105N have a residual current that is increased by approximately 80%.
- the variant may include other mutations. Over the entire length of the amino acid sequence of SEQ ID NO: 2, a variant will preferably be at least 50% homologous to that sequence based on amino acid identity. More preferably, the variant may be at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% and more preferably at least 95%, 97% or 99% homologous based on amino acid identity to the amino acid sequence of SEQ ID NO: 2 over the entire sequence. There may be at least 80%, for example at least 85%, 90% or 95%, amino acid identity over a stretch of 100 or more, for example 125, 150, 175 or 200 or more, contiguous amino acids ("hard homology").
- Standard methods in the art may be used to determine homology.
- the UWGCG Package provides the BESTFIT program which can be used to calculate homology, for example used on its default settings (Devereux et al (1984) Nucleic Acids Research 12, p387- 395).
- the PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (such as identifying equivalent residues or corresponding sequences (typically on their default settings)), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S.F et al (1990) J Mol Biol 215:403-10.
- HSPs high scoring sequence pair
- T some positive- valued threshold score
- Altschul et al, supra these initial neighbourhood word hits act as seeds for initiating searches to find HSP's containing them.
- the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased.
- Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
- the BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment.
- the BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., arlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787.
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two amino acid sequences would occur by chance.
- P(N) the smallest sum probability
- a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1 , preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
- SEQ ID NO: 2 is the NNN-RRK mutant of the MspA monomer.
- the variant may comprise any of the mutations in the MspB, C or D monomers compared with MspA.
- the mature forms of MspB, C and D are show in SEQ ID NOs: 16 to 18.
- the variant may comprise the following substitution present in MspB: A138P.
- the variant may comprise one or more of the following substitutions present in MspC: A96G, N102E and A138P.
- the variant may comprise one or more of the following mutations present in MspD: Deletion of Gl, L2V, E5Q, L8V, D13G, W21A, D22E, K47T, I49H, I68V, D91G, A96Q, N102D, S103T, V104I, S136K and G141A.
- the variant may comprise combinations of one or more of the mutations and substitutions from Msp B, C and D.
- Amino acid substitutions may be made to the amino acid sequence of SEQ ID NO: 2 in addition to those discussed above, for example up to 1, 2, 3, 4, 5, 10, 20 or 30 substitutions.
- Conservative substitutions replace amino acids with other amino acids of similar chemical structure, similar chemical properties or similar side-chain volume.
- the amino acids introduced may have similar polarity, hydrophilicity, hydrophobicity, basicity, acidity, neutrality or charge to the amino acids they replace.
- the conservative substitution may introduce another amino acid that is aromatic or aliphatic in the place of a pre-existing aromatic or aliphatic amino acid.
- Conservative amino acid changes are well-known in the art and may be selected in accordance with the properties of the 20 main amino acids as defined in Table 4 below. Where amino acids have similar polarity, this can also be determined by reference to the hydropathy scale for amino acid side chains in Table 5.
- One or more amino acid residues of the amino acid sequence of SEQ ID NO: 2 may additionally be deleted from the polypeptides described above. Up to 1, 2, 3, 4, 5, 10, 20 or 30 residues may be deleted, or more.
- Variants may include fragments of SEQ ID NO: 2. Such fragments retain pore forming activity. Fragments may be at least 50, 100, 150 or 200 amino acids in length. Such fragments may be used to produce the pores of the invention. A fragment preferably comprises the pore forming domain of SEQ ID NO: 2. Fragments must include one of residues 88, 90, 91, 105, 118 and 134 of SEQ ID NO: 2. Typically, fragments include all of residues 88, 90, 91, 105, 118 and 134 of SEQ ID NO: 2.
- One or more amino acids may be alternatively or additionally added to the polypeptides described above.
- An extension may be provided at the amino terminal or carboxy terminal of the amino acid sequence of SEQ ID NO: 2 or polypeptide variant or fragment thereof.
- the extension may be quite short, for example from 1 to 10 amino acids in length. Alternatively, the extension may be longer, for example up to 50 or 100 amino acids.
- a carrier protein may be fused to an amino acid sequence according to the invention. Other fusion proteins are discussed in more detail below.
- a variant may have a methionine at the amino terminal of SEQ ID NO: 2.
- a variant is a polypeptide that has an amino acid sequence which varies from that of SEQ ID NO: 2 and which retains its ability to form a pore.
- a variant typically contains the regions of SEQ ID NO: 2 that are responsible for pore formation. The pore forming ability of Msp, which contains a ⁇ -barrel, is provided by ⁇ -sheets in each subunit.
- a variant of SEQ ID NO: 2 typically comprises the regions in SEQ ID NO: 2 that form ⁇ -sheets.
- One or more modifications can be made to the regions of SEQ ID NO: 2 that form ⁇ -sheets as long as the resulting variant retains its ability to form a pore.
- a variant of SEQ ID NO: 2 preferably includes one or more modifications, such as substitutions, additions or deletions, within its a-helices and/or loop regions.
- the mutant monomers may be modified to assist their identification or purification, for example by the addition of histidine residues (a his tag), aspartic acid residues (an asp tag), a streptavidin tag or a flag tag, or by the addition of a signal sequence to promote their secretion from a cell where the polypeptide does not naturally contain such a sequence.
- An alternative to introducing a genetic tag is to chemically react a tag onto a native or engineered position on the pore. An example of this would be to react a gel-shift reagent to a cysteine engineered on the outside of the pore. This has been demonstrated as a method for separating hemolysin hetero- oligomers (Chem Biol. 1997 Jul;4(7):497-505).
- the mutant monomer may be labelled with a revealing label.
- the revealing label may be any suitable label which allows the pore to be detected. Suitable labels include, but are not limited to, fluorescent molecules, radioisotopes, e.g. 125 1, 35 S, enzymes, antibodies, antigens, polynucleotides and ligands such as biotin.
- the mutant monomer may be made synthetically or by recombinant means.
- the pore may be synthesized by in vitro translation and transcription (IVTT).
- the amino acid sequence of the mutant monomer may be modified to include non-naturally occurring amino acids or to increase the stability of the monomer.
- the mutant monomer is produced by synthetic means, such amino acids may be introduced during production.
- the mutant monomer may also be altered following either synthetic or recombinant production.
- the mutant monomer may also be produced using D-amino acids.
- the mutant monomer may comprise a mixture of L-amino acids and D-amino acids. This is conventional in the art for producing such proteins or peptides.
- the mutant monomer contains one or more specific modifications to facilitate nucleotide discrimination.
- the mutant monomer may also contain other non-specific modifications as long as they do not interfere with pore formation.
- a number of non-specific side chain modifications are known in the art and may be made to the side chains of the mutant monomer. Such modifications include, for example, reductive alkylation of amino acids by reaction with an aldehyde followed by reduction with aBH 4 , amidination with methylacetimidate or acylation with acetic anhydride.
- the mutant monomer can be produced using standard methods known in the art.
- Polynucleotide sequences encoding a mutant monomer may be derived and replicated using standard methods in the art. Such sequences are discussed in more detail below. Polynucleotide sequences encoding a mutant monomer may be expressed in a bacterial host cell using standard techniques in the art. The mutant monomer may be produced in a cell by in situ expression of the polypeptide from a recombinant expression vector. The expression vector optionally carries an inducible promoter to control the expression of the polypeptide.
- a mutant monomer may be produced in large scale following purification by any protein liquid chromatography system from pore producing organisms or after recombinant expression as described below.
- Typical protein liquid chromatography systems include FPLC, AKTA systems, the Bio-Cad system, the Bio-Rad BioLogic system and the Gilson HPLC system.
- the mutant monomer may then be inserted into a naturally occurring or artificial membrane for use in accordance with the invention. Methods for inserting pore into membranes are discussed below.
- the mutant monomer is chemically modified.
- the mutant monomer can be chemically modified in any way and at any site.
- the mutant monomer is preferably chemically modified by attachment of a molecule to one or more cysteines (cysteine linkage), attachment of a molecule to one or more lysines, attachment of a molecule to one or more non-natural amino acids, enzyme modification of an epitope or modification of a terminus. Suitable methods for carrying out such modifications are well-known in the art.
- the mutant monomer may be chemically modified by the attachment of any molecule. For instance, the mutant monomer may be chemically modified by attachment of a dye or a fluorophore.
- the mutant monomer is chemically modified with a molecular adaptor that facilitates the interaction between a pore comprising the monomer and a target nucleotide or target nucleic acid sequence.
- the presence of the adaptor improves the host-guest chemistry of the pore and the nucleotide or nucleic acid sequence and thereby improves the sequencing ability of pores formed from the mutant monomer.
- the principles of host-guest chemistry are well-known in the art.
- the adaptor has an effect on the physical or chemical properties of the pore that improves its interaction with the nucleotide or nucleic acid sequence.
- the adaptor may alter the charge of the barrel or channel of the pore or specifically interact with or bind to the nucleotide or nucleic acid sequence thereby facilitating its interaction with the pore.
- the molecular adaptor is preferably a cyclic molecule, a cyclodextrin, a species that is capable of hybridization, a DNA binder or interchelator, a peptide or peptide analogue, a synthetic polymer, an aromatic planar molecule, a small positively-charged molecule or a small molecule capable of hydrogen-bonding.
- the adaptor may be cyclic.
- a cyclic adaptor preferably has the same symmetry as the pore.
- the adaptor preferably has eight-fold symmetry since Msp typically has eight subunits around a central axis. This is discussed in more detail below.
- the adaptor typically interacts with the nucleotide or nucleic acid sequence via host- guest chemistry.
- the adaptor is typically capable of interacting with the nucleotide or nucleic acid sequence.
- the adaptor comprises one or more chemical groups that are capable of interacting with the nucleotide or nucleic acid sequence.
- the one or more chemical groups preferably interact with the nucleotide or nucleic acid sequence by non-covalent interactions, such as hydrophobic interactions, hydrogen bonding, Van der Waal's forces, ⁇ -cation interactions and/or electrostatic forces.
- the one or more chemical groups that are capable of interacting with the nucleotide or nucleic acid sequence are preferably positively charged.
- the one or more chemical groups that are capable of interacting with the nucleotide or nucleic acid sequence more preferably comprise amino groups.
- the amino groups can be attached to primary, secondary or tertiary carbon atoms.
- the adaptor even more preferably comprises a ring of amino groups, such as a ring of 6, 7 or 8 amino groups.
- the adaptor most preferably comprises a ring of eight amino groups.
- a ring of protonated amino groups may interact with negatively charged phosphate groups in the nucleotide or nucleic acid sequence.
- the adaptor preferably comprises one or more chemical groups that are capable of interacting with one or more amino acids in the pore.
- the adaptor more preferably comprises one or more chemical groups that are capable of interacting with one or more amino acids in the pore via non-covalent interactions, such as hydrophobic interactions, hydrogen bonding, Van der Waal's forces, ⁇ - cation interactions and/or electrostatic forces.
- the chemical groups that are capable of interacting with one or more amino acids in the pore are typically hydroxyls or amines.
- the hydroxyl groups can be attached to primary, secondary or tertiary carbon atoms.
- the hydroxyl groups may form hydrogen bonds with uncharged amino acids in the pore.
- Any adaptor that that facilitates the interaction between the pore and the nucleotide or nucleic acid sequence can be used.
- Suitable adaptors include, but are not limited to, cyclodextrins, cyclic peptides and cucurbiturils.
- the adaptor is preferably a cyclodextrin or a derivative thereof.
- the cyclodextrin or derivative thereof may be any of those disclosed in Eliseev, A. V., and Schneider, H-J. (1994) J. Am. Chem. Soc. 116, 6081-6088.
- the adaptor is more preferably heptakis-6-amino-P- cyclodextrin (am 7 -pCD), 6-monodeoxy-6-monoamino- -cyclodextrin (ami- CD) or heptakis-(6- deoxy-6-guanidino)-cyclodextrin (gu 7 -pCD).
- the guanidino group in gu 7 -pCD has a much higher pKa than the primary amines in am 7 -pCD and so it more positively charged. This gu 7 -
- PCD adaptor may be used to increase the dwell time of the nucleotide in the pore, to increase the accuracy of the residual current measured, as well as to increase the base detection rate at high temperatures or low data acquisition rates.
- the adaptor is preferably heptakis(6-deoxy-6-amino)-6-N-mono(2- pyridyl)dithiopropanoyl- ⁇ -cyclodextrin (amsamPDP i -PCD) .
- More suitable adaptors include ⁇ -cyclodextrins, which comprise 8 sugar units (and therefore have eight-fold symmetry).
- the ⁇ -cyclodextrin may contain a linker molecule or may be modified to comprise all or more of the modified sugar units used in the ⁇ -cyclodextrin examples discussed above.
- the molecular adaptor is preferably covalently attached to the mutant monomer.
- the adaptor can be covalently attached to the pore using any method known in the art.
- the adaptor is typically attached via chemical linkage. If the molecular adaptor is attached via cysteine linkage, the one or more cysteines have preferably been introduced to the mutant by substitution.
- the mutant monomers of the invention can of course comprise a cysteine residue at one or more of positions 88, 90, 91, 103 and 105.
- the mutant monomer may be chemically modified by attachment of a molecular adaptor to one or more, such as 2, 3, 4 or 5, of these cysteines.
- the mutant monomer may be chemically modified by attachment of a molecule to one or more cysteines introduced at other positions.
- the molecular adaptor is preferably attached to one or more of positions 90, 91 and 103 of SEQ ID NO: 2.
- cysteine residues may be enhanced by modification of the adjacent residues. For instance, the basic groups of flanking arginine, histidine or lysine residues will change the pKa of the cysteines thiol group to that of the more reactive S " group.
- the reactivity of cysteine residues may be protected by thiol protective groups such as dTNB. These may be reacted with one or more cysteine residues of the mutant monomer before a linker is attached.
- the molecule may be attached directly to the mutant monomer. The molecule is preferably attached to the mutant monomer using a linker, such as a chemical crosslinker or a peptide linker.
- Suitable chemical crosslinkers are well-known in the art.
- Preferred crosslinkers include 2,5-dioxopyrrolidin- 1 -yl 3-(pyridin-2-yldisulfanyl)propanoate, 2,5-dioxopyrrolidin- 1 -yl 4- (pyridin-2-yldisulfanyl)butanoate and 2,5-dioxopyrrolidin- 1-yl 8-(pyridin-2- yldisulfanyl)octananoate.
- the most preferred crosslinker is succinimidyl 3-(2- pyridyldithio)propionate (SPDP).
- the molecule is covalently attached to the bifunctional crosslinker before the molecule/crosslinker complex is covalently attached to the mutant monomer but it is also possible to covalently attach the bifunctional crosslinker to the monomer before the bifunctional crosslinker/monomer complex is attached to the molecule.
- the linker is preferably resistant to dithiothreitol (DTT).
- Suitable linkers include, but are not limited to, iodoacetamide-based and Maleimide-based linkers.
- the monomer may be attached to a nucleic acid binding protein.
- the nucleic acid binding protein is preferably covalently attached to the mutant monomer.
- the protein can be covalently attached to the pore using any method known in the art.
- the monomer and protein may be chemically fused or genetically fused.
- the monomer and protein are genetically fused if the whole construct is expressed from a single polynucleotide sequence. Genetic fusion of a pore to a nucleic acid binding protein is discussed in International Application No. PCT/GB09/001679 (published as WO 2010/004265).
- the one or more cysteines have preferably been introduced to the mutant by substitution.
- the mutant monomers of the invention can of course comprise cysteine residues at one or more of positions 10 to 15, 51 to 60, 136 to 139 and 168 to 172. These positions are present in loop regions which have low conservation amongst homologues indicating that mutations or insertions may be tolerated. They are therefore suitable for attaching a nucleic acid binding protein.
- the reactivity of cysteine residues may be enhanced by modification as described above.
- the nucleic acid binding protein may be attached directly to the mutant monomer or via one or more linkers.
- the molecule may be attached to the mutant monomer using the hybridization linkers described in International Application No. PCT/GB 10/000132 (published as WO 2010/086602).
- peptide linkers may be used.
- Peptide linkers are amino acid sequences. The length, flexibility and hydrophilicity of the peptide linker are typically designed such that it does not to disturb the functions of the monomer and molecule.
- Preferred flexible peptide linkers are stretches of 2 to 20, such as 4, 6, 8, 10 or 16, serine and/or glycine amino acids.
- More preferred flexible linkers include (SG)i, (SG) 2 , (SG) 3 , (SG) ⁇ , (SG)s and (SG)s wherein S is serine and G is glycine.
- Preferred rigid linkers are stretches of 2 to 30, such as 4, 6, 8, 16 or 24, proline amino acids. More preferred rigid linkers include (P)i2 wherein P is proline.
- the mutant monomer may be chemically modified with a molecular adaptor and a nucleic acid binding protein.
- the invention also provides a construct comprising two or more covalently attached monomers derived from Msp.
- the construct of the invention retains its ability to form a pore.
- One or more constructs of the invention may be used to form pores for characterising, such as sequencing, nucleic acids sequences.
- the construct may comprise 2, 3, 4, 5, 6, 7, 8, 9 or 10 monomers.
- the two or more monomers may be the same or different.
- the monomers do not have to be mutant monomers of the invention.
- at least one monomer may comprise the sequence shown in SEQ ID NO: 2.
- at least one monomer may comprise a variant of SEQ ID NO: 2 which is at least 50% homologous to SEQ ID NO: 2 over its entire sequence based on amino acid identity, but does not include any of the specific mutations required by the mutant monomers of the invention.
- the variant may be at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% and more preferably at least 95%, 97% or 99% homologous based on amino acid identity to the amino acid sequence of SEQ ID NO: 2 over the entire sequence.
- At least one monomer in the construct is a mutant monomer of the invention. All of the monomers in the construct may be a mutant monomer of the invention. The mutant monomers may be the same or different. In a more preferred embodiment, the construct comprises two monomers and at least one of the monomers is a mutant monomer of the invention.
- the monomers are preferably genetically fused. Monomers are genetically fused if the whole construct is expressed from a single polynucleotide sequence.
- the coding sequences of the monomers may be combined in any way to form a single polynucleotide sequence encoding the construct.
- the monomers may be genetically fused in any configuration.
- the monomers may be fused via their terminal amino acids.
- the amino terminus of the one monomer may be fused to the carboxy terminus of another monomer.
- the construct is formed from the genetic fusion of two or more monomers each comprising the sequence shown in SEQ ID NO: 2 or a variant thereof, the second and subsequent monomers in the construct (in the amino to carboxy direction) may comprise a methionine at their amino terminal ends (each of which is fused to the carboxy terminus of the previous monomer).
- the construct may comprise the sequence M-mM, M- mM-mM or M-mM-mM-mM.
- the presences of these methionines typically results from the expression of the start codons (i.e. ATGs) at the 5' end of the polynucleotides encoding the second or subsequent monomers within the polynucleotide encoding entire construct.
- the first monomer in the construct (in the amino to carboxy direction) may also comprise a methionine (e.g. mM-mM, mM-mM-mM or mM-mM-mM-mM).
- the two or more monomers may be genetically fused directly together.
- the monomers are preferably genetically fused using a linker.
- the linker may be designed to constrain the mobility of the monomers.
- Preferred linkers are amino acid sequences (i.e. peptide linkers). Any of the peptide linkers discussed above may be used.
- the construct preferably comprises the sequence shown in SEQ ID NO: 29 or a variant thereof.
- Each monomer in SEQ ID NO: 29 comprises the sequence shown in SEQ ID NO: 2 or a variant thereof.
- the second monomer also comprises a methionine at its amino terminus as described above.
- the two monomers are linked by a peptide linker.
- a variant of SEQ ID NO: 29 may vary from SEQ ID NO: 29 in any of the ways discussed above with reference to variants of SEQ ID NO: 2.
- the linker may also be modified or replaced with a peptide linker discussed above.
- the monomers are chemically fused.
- a subunit is chemically fused to an enzyme if the two parts are chemically attached, for instance via a chemical crosslinker. Any of the chemical crosslinkers discussed above may be used.
- the linker may be attached to one or more cysteine residues introduced into a mutant monomer of the invention. Alternatively, the linker may be attached to a terminus of one of the monomers in the construct.
- a "lock and key" arrangement may be used in which two linkers are used. Only one end of each linker may react together to form a longer linker and the other ends of the linker each react with a different monomers.
- Such linkers are described in International Application No. PCT/GB 10/000132 (published as WO 2010/086602).
- the present invention also provides polynucleotide sequences which encode a mutant monomer of the invention.
- the mutant monomer may be any of those discussed above.
- the polynucleotide sequence preferably comprises a sequence at least 50%, 60%, 70%, 80%, 90% or 95% homologous based on nucleotide identity to the sequence of SEQ ID NO: 1 over the entire sequence. There may be at least 80%, for example at least 85%, 90% or 95% nucleotide identity over a stretch of 300 or more, for example 375, 450, 525 or 600 or more, contiguous nucleotides ("hard homology"). Homology may be calculated as described above.
- the polynucleotide sequence may comprise a sequence that differs from SEQ ID NO: 1 on the basis of the degeneracy of the genetic code.
- the present invention also provides polynucleotide sequences which encode any of the genetically fused constructs of the invention.
- the polynucleotide preferably comprises two or more sequences as shown in SEQ ID NO: 1 or a variant thereof as described above.
- the polynucleotide sequence preferably comprises the sequence of SEQ ID NO: 28 or a sequence at least 50%, 60%, 70%, 80%, 90% or 95% homologous based on nucleotide identity to the sequence of SEQ ID NO: 28 over the entire sequence.
- polynucleotide sequence may comprise a sequence that differs from SEQ ID NO: 28 on the basis of the degeneracy of the genetic code.
- Polynucleotide sequences may be derived and replicated using standard methods in the art. Chromosomal DNA encoding wild-type Msp may be extracted from a pore producing organism, such as Mycobacterium smegmatis. The gene encoding the pore subunit may be amplified using PCR involving specific primers. The amplified sequence may then undergo site- directed mutagenesis. Suitable methods of site-directed mutagenesis are known in the art and include, for example, combine chain reaction. Polynucleotides encoding a construct of the invention can be made using well-known techniques, such as those described in Sambrook, J. and Russell, D. (2001). Molecular Cloning: A Laboratory Manual, 3rd Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- the resulting polynucleotide sequence may then be incorporated into a recombinant replicable vector such as a cloning vector.
- a recombinant replicable vector such as a cloning vector.
- the vector may be used to replicate the
- polynucleotide in a compatible host cell may be made by introducing a polynucleotide into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector.
- the vector may be recovered from the host cell. Suitable host cells for cloning of
- polynucleotides are known in the art and described in more detail below.
- the polynucleotide sequence may be cloned into suitable expression vector.
- the polynucleotide sequence is typically operably linked to a control sequence which is capable of providing for the expression of the coding sequence by the host cell.
- Such expression vectors can be used to express a pore subunit.
- operably linked refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner.
- a control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences. Multiple copies of the same or different polynucleotide sequences may be introduced into the vector.
- the expression vector may then be introduced into a suitable host cell.
- a mutant monomer or construct of the invention can be produced by inserting a polynucleotide sequence into an expression vector, introducing the vector into a compatible bacterial host cell, and growing the host cell under conditions which bring about expression of the polynucleotide sequence.
- the recombinantly-expressed monomer or construct may self-assemble into a pore in the host cell membrane.
- the recombinant pore produced in this manner may be removed from the host cell and inserted into another membrane.
- the different subunits may be expressed separately in different host cells as described above, removed from the host cells and assembled into a pore in a separate membrane, such as a rabbit cell membrane.
- the vectors may be for example, plasmid, virus or phage vectors provided with an origin of replication, optionally a promoter for the expression of the said polynucleotide sequence and optionally a regulator of the promoter.
- the vectors may contain one or more selectable marker genes, for example a tetracycline resistance gene. Promoters and other expression regulation signals may be selected to be compatible with the host cell for which the expression vector is designed. A T7, trc, lac, ara or L promoter is typically used.
- the host cell typically expresses the pore subunit at a high level. Host cells transformed with a polynucleotide sequence will be chosen to be compatible with the expression vector used to transform the cell.
- the host cell is typically bacterial and preferably Escherichia coli. Any cell with a ⁇ DE3 lysogen, for example C41 (DE3), BL21 (DE3), JM109 (DE3), B834 (DE3), TUNER, Origami and Origami B, can express a vector comprising the T7 promoter.
- any of the methods cited in Proc Natl Acad Sci U S A. 2008 Dec 30;105(52):20647-52 may be used to express the Msp proteins.
- the invention also provides various pores.
- the pores of the invention are ideal for charcterising, such as sequencing, nucleic acid sequences because they can discriminate between different nucleotides with a high degree of sensitivity.
- the pores can surprisingly distinguish between the four nucleotides in DNA and RNA.
- the pores of the invention can even distinguish between methylated and unmethylated nucleotides.
- the base resolution of pores of the invention is surprisingly high.
- the pores show almost complete separation of all four DNA nucleotides.
- the pores further discriminate between deoxycytidine monophosphate (dCMP) and methyl- dCMP based on the dwell time in the pore and the current flowing through the pore.
- dCMP deoxycytidine monophosphate
- the pores of the invention can also discriminate between different nucleotides under a range of conditions.
- the pores will discriminate between nucleotides under conditions that are favourable to the characterising, such as sequencing, of nucleic acids.
- the extent to which the pores of the invention can discriminate between different nucleotides can be controlled by altering the applied potential, the salt concentration, the buffer, the temperature and the presence of additives, such as urea, betaine and DTT. This allows the function of the pores to be fine-tuned, particularly when sequencing. This is discussed in more detail below.
- the pores of the invention may also be used to identify nucleic acid polymers from the interaction with one or more monomers rather than on a nucleotide by nucleotide basis.
- a pore of the invention may be isolated, substantially isolated, purified or substantially purified.
- a pore of the invention is isolated or purified if it is completely free of any other components, such as lipids or other pores.
- a pore is substantially isolated if it is mixed with carriers or diluents which will not interfere with its intended use.
- a pore is substantially isolated or substantially purified if it present in a form that comprises less than 10%, less than 5%, less than 2% or less than 1% of other components, such as lipids or other pores.
- a pore of the invention may be present in a lipid bilayer.
- a pore of the invention may be present as an individual or single pore.
- a pore of the invention may be present in a homologous or heterologous population of two or more pores.
- the invention also provides a homo-oligomeric pore derived from Msp comprising identical mutant monomers of the invention.
- the homo-oligomeric pore preferably comprises one of the mutants shown in Tables 1, 2 and 3.
- the homo-oligomeric pore of the invention is ideal for characterising, such as sequencing, nucleic acids.
- the homo-oligomeric pore of the invention may have any of the advantages discussed above. The advantages of specific homo- oligomeric pores of the invention are indicated in Tables 1, 2 and 3.
- the homo-oligomeric pore may contain any number of mutant monomers.
- the pore typically comprises 7, 8, 9 or 10 identical mutant monomers.
- the pore preferably comprises eight identical mutant monomers.
- One or more, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10, of the mutant monomers is preferably chemically modified as discussed above.
- the invention also provides a hetero-oligomeric pore derived from Msp comprising at least one mutant monomer of the invention, wherein at least one of the eight monomers differs from the others.
- the hetero-oligomeric pore of the invention is ideal for characterising, such as sequencing, nucleic acids.
- Hetero-oligomeric pores can be made using methods known in the art (e.g. Protein Sci. 2002 Jul;l 1(7): 1813-24).
- the hetero-oligomeric pore contains sufficient monomers to form the pore.
- the monomers may be of any type.
- the pore typically comprises 7, 8, 9 or 10 monomers.
- the pore preferably comprises eight monomers.
- the pore may comprise at least one monomer comprising (a) the sequence shown in SEQ ID NO: 2 or (b) a variant thereof which does not have a mutation required by the mutant monomers of the invention. Suitable variants are discussed above. In this embodiment, the remaining monomers are preferably mutant monomers of the invention. Hence, the pore may comprise 9, 8, 7, 6, 5, 4, 3, 2 or 1 mutant monomers of the invention.
- the pore comprises (a) one mutant monomer and (b) seven identical monomers, wherein the mutant monomer in (a) is different from the identical monomers in (b).
- the identical monomers in (b) preferably comprise (i) the sequence shown in SEQ ID NO: 2 or (ii) a variant thereof which does not have a mutation present in the mutant monomers of the invention.
- Preferred pores include, but are not limited to, any of the following:
- all of the monomers are mutant monomers of the invention and at least one of them differs from the others.
- the pore comprises eight mutant monomers of the invention and at least one of them differs from the others.
- one or more, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10, of the mutant monomers is preferably chemically modified as discussed above.
- Preferred pores (a) to (c) above are preferably chemically modified by attachment of a molecule to one or more of the introduced cysteines.
- the invention also provides a pore comprising at least one construct of the invention.
- a construct of the invention comprises two or more covalently attached monomers derived from Msp. In other words, a construct must contain more than one monomer.
- the pore contains sufficient constructs and, if necessary, monomers to form the pore.
- an octameric pore may comprise (a) two constructs each comprising four monomers or (b) one construct comprising two monomers and six monomers that do not form part of a construct. At least two of the monomers in the pore are in the form of a construct of the invention.
- the monomers may be of any type.
- the pore typically comprises 7, 8, 9 or 10 monomers in total (at least two of which must be in a construct).
- the pore preferably comprises eight monomers (at least two of which must be in a construct).
- a pore typically contains (a) one construct comprising two monomers and (b) 5, 6, 7 or 8 monomers.
- the construct may be any of those discussed above.
- the monomers may be any of those discussed above, including mutant monomers of the invention.
- Another typical pore comprises more than one construct of the invention, such as two, three or four constructs of the invention. Such pores further comprise sufficient monomers to form the pore.
- the monomer may be any of those discussed above.
- a further pore of the invention comprises only constructs comprising 2 monomers, for example a pore may comprise 4, 5, 6, 7 or 8 constructs comprising 2 monomers.
- a specific pore according to the inventions comprises four constructs each comprising two monomers.
- the constructs may oligomerise into a pore with a structure such that only one monomer of a construct contributes to the barrel or vestibule of the pore.
- the other monomers of the construct will be on the outside of the barrel or vestibule of the pore.
- pores of the invention may comprise 5, 6, 7 or 8 constructs comprising 2 monomers where the barrel or vestibule comprises 8 monomers.
- Mutations can be introduced into the construct as described above.
- the mutations may be alternating, i.e. the mutations are different for each monomer within a two monomer construct and the constructs are assembled as a homo-oligomer resulting in alternating modifications.
- monomers comprising MutA and MutB are fused and assembled to form an A-B:A- B:A-B:A-B pore.
- the mutations may be neighbouring, i.e. identical mutations are introduced into two monomers in a construct and this is then oligomerised with different mutant monomers.
- monomers comprising MutA are fused follow by oligomerisation with MutB-containing monomers to form A-A:B:B:B:B:B:B.
- One or more of the monomers of the invention in a construct-containing pore may be chemically-modified as discussed above.
- the present invention also provides methods of characterising an individual nucleotide.
- the methods comprise contacting the nucleotide with a pore of the invention so that the nucleotide interacts with the pore and measuring the current passing through the pore during the interaction and thereby characterising the nucleotide.
- the invention therefore involves nanopore sensing of an individual nucleotide.
- the invention also provides methods of identifying an individual nucleotide comrpsining measuring the current passing through the pore during the interaction and thereby determining the identity of the nucleotide. Any of the pores of the invention can be used.
- the pore of the invention is preferably chemically modified with a molecular adaptor as discussed above.
- the nucleotide is present if the current flows through the pore in a manner specific for the nucleotide (i.e. if a distinctive current associated with the nucleotide is detected flowing through the pore).
- the nucleotide is absent if the current does not flow through the pore in a manner specific for the nucleotide.
- the invention can be used to differentiate nucleotides of similar structure on the basis of the different effects they have on the current passing through a pore. Individual nucleotides can be identified at the single molecule level from their current amplitude when they interact with the pore. The invention can also be used to determine whether or not a particular nucleotide is present in a sample. The invention can also be used to measure the concentration of a particular nucleotide in a sample.
- the methods may be carried out using any suitable membrane/pore system in which a pore of the invention is inserted into a membrane.
- the methods are typically carried out using (i) an artificial membrane comprising a pore of the invention, (ii) an isolated, naturally occurring membrane comprising a pore of the invention, or (iii) a cell expressing a pore that has been modified in accordance with the invention.
- the methods are preferably carried out using an artificial membrane.
- the membrane may comprise other transmembrane and/or intramembrane proteins as well as other molecules in addition to the pore of the invention.
- the membrane forms a barrier to the flow of ions, nucleotides and nucleic acids.
- Any membrane may be used in accordance with the invention. Suitable membranes are well-known in the art.
- the membrane is preferably an amphiphilic layer.
- An amphiphilic layer is a layer formed from amphiphilic molecules, such as phospholipids, which have both hydrophilic and lipophilic properties.
- the amphiphiles may be synthetic or naturally occurring.
- the amphiphilic layer may be a monolayer or a bilayer.
- Non-naturally occurring amphiphiles and amphiphiles which form a monolayer are known in the art and include, for example, block copolymers (Gonzalez-Perez et ah, Langmuir, 2009, 25, 10447-10450).
- the membrane may be a lipid bilayer.
- Lipid bilayers suitable for use in accordance with the invention can be made using methods known in the art.
- lipid bilayer membranes can be formed using the method of Montal and Mueller (1972).
- Lipid bilayers can also be formed using the method described in International Application No. PCT/GB08/000563.
- the method of the invention may be carried out using lipid bilayers formed from any membrane lipid including, but not limited to, phospholipids, glyco lipids, cholesterol, mycolic acid and mixtures thereof. Any of the lipids described in International Application No.
- the membrane is a solid state layer.
- a solid-state layer is not of biological origin.
- a solid state layer is not derived from or isolated from a biological environment such as an organism or cell, or a synthetically manufactured version of a biologically available structure.
- Solid state layers can be formed from both organic and inorganic materials including, but not limited to, microelectronic materials, insulating materials such as Si3N4, A1203, and SiO, organic and inorganic polymers such as polyamide, plastics such as Teflon® or elastomers such as two-component addition-cure silicone rubber, and glasses.
- the solid state layer may be formed from monatomic layers, such as graphene, or layers that are only a few atoms thick. Suitable graphene layers are disclosed in International Application No. PCT/US2008/010637 (published as WO 2009/035647). An amphiphilic layer may be formed across a solid state pore. This may be described in the art as hybrid pore formation (Hall et ah , Nat Nanotechnol., 2010, 5, 874-877).
- the pore may be suspended in a purified form in a solution containing a lipid bilayer such that it diffuses to the lipid bilayer and is inserted by binding to the lipid bilayer and assembling into a functional state.
- the pore may be directly inserted into the membrane using the "pick and place" method described in M.A. Holden, H. Bayley. J. Am. Chem. Soc. 2005, 127, 6502-6503 and International Application No. PCT/GB2006/001057 (published as WO 2006/100484).
- the methods of the invention are typically carried out in vitro.
- An individual nucleotide is a single nucleotide.
- An individual nucleotide is one which is not bound to another nucleotide or nucleic acid by a nucleotide bond.
- a nucleotide bond involves one of the phosphate groups of a nucleotide being bound to the sugar group of another nucleotide.
- An individual nucleotide is typically one which is not bound by a nucleotide bond to another nucleic acid sequence of at least 5, at least 10, at least 20, at least 50, at least 100, at least 200, at least 500, at least 1000 or at least 5000 nucleotides.
- the individual nucleotide has been digested from a target polynucleotide sequence, such as a DNA or RNA strand.
- the methods of the invention may be used to identify any nucleotide.
- the nucleotide can be naturally occurring or artificial.
- a nucleotide typically contains a nucleobase, a sugar and at least one phosphate group.
- the nucleobase is typically heterocyclic. Suitable nucleobases include purines and pyrimidines and more specifically adenine, guanine, thymine, uracil and cytosine.
- the sugar is typically a pentose sugar. Suitable sugars include, but are not limited to, ribose and deoxyribose.
- the nucleotide is typically a ribonucleotide or deoxyribonucleotide.
- the nucleotide typically contains a monophosphate, diphosphate or triphosphate.
- Suitable nucleotides include, but are not limited to, adenosine monophosphate (AMP), adenosine diphosphate (ADP), adenosine triphosphate (ATP), guanosine monophosphate (GMP), guanosine diphosphate (GDP), guanosine triphosphate (GTP), thymidine monophosphate (TMP), thymidine diphosphate (TDP), thymidine triphosphate (TTP), uridine monophosphate (UMP), uridine diphosphate (UDP), uridine triphosphate (UTP), cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP), cyclic adenosine monophosphate (cAMP), cyclic guanosine monophosphate (cGMP), deoxyadenosine monophosphate (dAMP), deoxyadenosine diphosphate (dADP), deoxyaden
- dCMP deoxycytidine diphosphate
- dCTP deoxycytidine triphosphate
- the nucleotide is preferably AMP, TMP, GMP, UMP, dAMP, dTMP, dGMP or dCMP.
- the nucleotide may be derived from the digestion of a nucleic acid sequence such as ribonucleic acid (R A) or deoxyribonucleic acid.
- Nucleic acid sequences can be digested using any method known in the art. Suitable methods include, but are not limited to, those using enzymes or catalysts. Catalytic digestion of nucleic acids is disclosed in Deck et al. , Inorg. Chem, 2002; 41 : 669-677.
- nucleotides from a single nucleic acid sequence may be contacted with the pore in a sequential manner in order to sequence the whole or part of the nucleic acid.
- the nucleotide is typically unmodified, such as when the nucleotide is derived from the digestion of a nucleic acid sequence. Alternatively, the nucleotide may be modified or damaged. The nucleotide is typically methylated or oxidised.
- the nucleotide may be labelled with a revealing label.
- the revealing label may be any suitable label which allows the nucleotide to be detected. Suitable labels include fluorescent molecules, radioisotopes, e.g. u 5 S, and linkers such as biotin.
- the nucleotide is typically present in any suitable biological sample. Suitable biological samples are discussed above. Interaction between the pore and nucleotide
- the nucleotide may be contacted with the pore on either side of the membrane.
- the nucleotide may be introduced to the pore on either side of the membrane.
- the nucleotide may be contacted with the side of the membrane that allows the nucleotide to pass through the pore to the other side of the membrane.
- the nucleotide is contacted with an end of the pore, which in its native environment allows the entry of ions or small molecules, such as nucleotides, into the barrel or channel of the pore such that the nucleotide may pass through the pore.
- the nucleotide interacts with the pore and/or adaptor as it passes across the membrane through the barrel or channel of the pore.
- the nucleotide may be contacted with the side of the membrane that allows the nucleotide to interact with the pore via or in conjunction with the adaptor, dissociate from the pore and remain on the same side of the membrane.
- the present invention provides pores in which the position of the adaptor is fixed.
- the nucleotide is preferably contacted with the end of the pore which allows the adaptor to interact with the nucleotide.
- the nucleotide may interact with the pore in any manner and at any site.
- the nucleotide preferably reversibly binds to the pore via or in conjunction with the adaptor.
- the nucleotide most preferably reversibly binds to the pore via or in conjunction with the adaptor as it passes through the pore across the membrane.
- the nucleotide can also reversibly bind to the barrel or channel of the pore via or in conjunction with the adaptor as it passes through the pore across the membrane.
- the nucleotide affects the current flowing through the pore in a manner specific for that nucleotide. For example, a particular nucleotide will reduce the current flowing through the pore for a particular mean time period and to a particular extent. In other words, the current flowing through the pore is distinctive for a particular nucleotide.
- Control experiments may be carried out to determine the effect a particular nucleotide has on the current flowing through the pore. Results from carrying out the method of the invention on a test sample can then be compared with those derived from such a control experiment in order to identify a particular nucleotide in the sample or determine whether a particular nucleotide is present in the sample.
- the frequency at which the current flowing through the pore is affected in a manner indicative of a particular nucleotide can be used to determine the concentration of that nucleotide in the sample.
- the ratio of different nucleotides within a sample can also be calculated. For instance, the ratio of dCMP to methyl- dCMP can be calculated.
- the methods may be carried out using any apparatus that is suitable for investigating a membrane/pore system in which a pore of the invention is inserted into a membrane.
- the method may be carried out using any apparatus that is suitable for nanopore sensing.
- the apparatus comprises a chamber comprising an aqueous solution and a barrier that separates the chamber into two sections.
- the barrier has an aperture in which the membrane containing the pore is formed.
- the nucleotide may be contacted with the pore by introducing the nucleotide into the chamber.
- the nucleotide may be introduced into either of the two sections of the chamber.
- the methods of the invention involve measuring the current passing through the pore during interaction with the nucleotide. Therefore the apparatus also comprises an electrical circuit capable of applying a potential and measuring an electrical signal across the membrane and pore.
- the methods may be carried out using a patch clamp or a voltage clamp.
- the methods preferably involve the use of a voltage clamp.
- the nucleotide is present in any suitable sample.
- the invention is typically carried out on a sample that is known to contain or suspected to contain the nucleotide.
- the invention may be carried out on a sample that contains one or more nucleotides whose identity is unknown.
- the invention may be carried out on a sample to confirm the identity of one or more nucleotides whose presence in the sample is known or expected.
- the sample may be a biological sample.
- the invention may be carried out in vitro on a sample obtained from or extracted from any organism or microorganism.
- the organism or microorganism is typically prokaryotic or eukaryotic and typically belongs to one the five kingdoms: plantae, animalia, fungi, monera and protista.
- the invention may be carried out in vitro on a sample obtained from or extracted from any virus.
- the sample is preferably a fluid sample.
- the sample typically comprises a body fluid of the patient.
- the sample may be urine, lymph, saliva, mucus or amniotic fluid but is preferably blood, plasma or serum.
- the sample is human in origin, but alternatively it may be from another mammal animal such as from commercially farmed animals such as horses, cattle, sheep or pigs or may alternatively be pets such as cats or dogs.
- a sample of plant origin is typically obtained from a commercial crop, such as a cereal, legume, fruit or vegetable, for example wheat, barley, oats, canola, maize, soya, rice, bananas, apples, tomatoes, potatoes, grapes, tobacco, beans, lentils, sugar cane, cocoa, cotton, tea, coffee.
- the sample may be a non-biological sample.
- the non-biological sample is preferably a fluid sample.
- Examples of a non-biological sample include surgical fluids, water such as drinking water, sea water or river water, and reagents for laboratory tests.
- the sample is typically processed prior to being assayed, for example by centrifugation or by passage through a membrane that filters out unwanted molecules or cells, such as red blood cells.
- the sample may be measured immediately upon being taken.
- the sample may also be typically stored prior to assay, preferably below -70°C.
- the methods of the invention involve the measuring of a current passing through the pore during interaction with the nucleotide. Suitable conditions for measuring ionic currents through transmembrane protein pores are known in the art and disclosed in the Example. The method is carried out with a voltage applied across the membrane and pore. The voltage used is typically from -400mV to +400mV.
- the voltage used is preferably in a range having a lower limit selected from -400 mV, -300mV, -200 mV, -150 mV, -100 mV, -50 mV, -20mV and 0 mV and an upper limit independently selected from +10 mV, + 20 mV, +50 mV, +100 mV, +150 mV, +200 mV, +300 mV and +400 mV.
- the voltage used is more preferably in the range lOOmV to 240mV and most preferably in the range of 160mV to 240mV. It is possible to increase discrimination between different nucleotides by a pore of the invention by using an increased applied potential.
- the methods are typically carried out in the presence of any alkali metal chloride salt.
- the salt is present in the aqueous solution in the chamber.
- Potassium chloride ( C1), sodium chloride (NaCl) or caesium chloride (CsCl) is typically used.
- KC1 is preferred.
- the salt concentration is typically from 0.1 to 2.5M, from 0.3 to 1.9M, from 0.5 to 1.8M, from 0.7 to 1.7M, from 0.9 to 1.6M or from 1M to 1.4M.
- the salt concentration is preferably from 1 0mM to 1M.
- High salt concentrations provide a high signal to noise ratio and allow for currents indicative of the presence of a nucleotide to be identified against the background of normal current fluctations.
- Lower salt concentrations may be used if nucleotide detection is carried out in the presence of an enzyme, such as when sequencing nucleic acids. This is discussed in more detail below.
- the methods are typically carried out in the presence of a buffer.
- the buffer is present in the aqueous solution in the chamber. Any buffer may be used in the method of the invention.
- One suitable buffer is Tris-HCl buffer.
- the methods are typically carried out at a pH of from 4.0 to 12.0, from 4.5 to 10.0, from 5.0 to 9.0, from 5.5 to 8.8, from 6.0 to 8.7 or from 7.0 to 8.8 or 7.5 to 8.5.
- the pH used is preferably about 7.5.
- the methods are typically carried out at from 0°C to 100°C, from 15°C to 95°C, from 16°C to 90°C, from 17°C to 85°C, from 18°C to 80°C, 19°C to 70°C, or from 20°C to 60°C.
- the methods may be carried out at room temperature.
- the methods are preferably carried out at a temperature that supports enzyme function, such as about 37°C.
- the present invention also provides methods of characterising a target nucleic acid sequence.
- One or more characteristics of the target nucleic acid sequence may be deteremined.
- the method may involve measuring two, three, four or five or more characteristics of the target nucleic acid sequence.
- the one or more characteristics are preferably selected from (i) the length of the target nucleic acid sequence, (ii) the identity of the target nucleic acid sequence, (iii) the sequence of the target nucleic acid sequence, (iv) the secondary structure of the target nucleic acid sequence and (v) whether or not the target nucleic acid sequence is modified. Any combination of (i) to (v) may be determined in accordance with the invention.
- the length of the nucleic acid sequence may be measured using the number of interactions between the target nucleic acid sequence and the pore.
- the identity of the nucleic acid sequence may be measured in a number of ways.
- the identity of the nucleic acid sequence may be measured in conjunction with measurement of the sequence of the target nucleic acid sequence or without measurement of the sequence of the target nucleic acid sequence.
- the former is straightforward; the nucleic acid is sequenced and thereby identified.
- the latter may be done in several ways. For instance, the presence of a particular motif in the nucleic acid sequence may be measured (without measuring the remaining sequence of the polynucleotide). Alternatively, the measurement of a particular electrical signal in the method may identify the target nucleic acid sequence as coming from a particular source.
- sequence of the nucleic acid sequence can be determined as described previously. Suitable sequencing methods, particularly those using electrical measurements, are described in Stoddart D et al., Proc Natl Acad Sci, 12;106(19):7702-7, Lieberman KR et al, J Am Chem Soc. 2010;132(50):17961-72, and International Application WO 2000/28312.
- the secondary structure may be measured in a variety of ways. For instance, the secondary structure may be measured using a change in dwell time or a change in current flowing through the pore.
- the invention also provides a method of estimating the sequenceof a target nucleic acid sequence.
- the invention further provides a method of sequencing a target nucleic acid sequence.
- a nucleic acid is a macromolecule comprising two or more nucleotides.
- the nucleotides may be any of those discussed above.
- the method comprises (a) contacting the target sequence with a pore of the invention and a nucleic acid binding protein so that protein controls the movement of the target sequence through the pore and a proportion of the nucleotides in the target sequence interacts with the pore and (b) measuring the current passing through the pore during each interaction and thereby charcterising, such as estimating the sequence of or sequencing, the target sequence.
- the method involves nanopore sensing of a proportion of the nucleotides in a target nucleic acid sequence as the nucleotides pass through the barrel or channel in order to characterising, such as sequencing, the target sequence.
- the method comprises (a) contacting the target sequence with a pore of the invention and an exonuclease such that the exonuclease digests an individual nucleotide from one end of the target sequence; (b) contacting the nucleotide with the pore so that the nucleotide interacts with the adaptor; (c) measuring the current passing through the pore during the interaction and thereby characterising the nucleotide; and (d) repeating steps (a) to (c) at the same end of the target sequence and thereby characterining of the target sequence.
- the method involves nanopore sensing of a proportion of the nucleotides in a target nucleic acid sequence in a successive manner in order to characterise the target sequence.
- the method concerns sequencing the target nucleic acid sequence and step (a) comprises determining the identity of the nucleotide. Individual nucleotides are described above.
- the pores of the invention are particularly suited to these methods because they display improved nucleotide discrimination. In particular, they display an increased current range, which makes it easier to discriminate between different nucleotides, and a reduced variance of states, which increases the signal-to-noise ratio. In addition, in relation to the former
- the number of nucleotides contributing to the current as the nucleic acid moves through the pore is decreased. This makes it easier to identify a direct relationship between the observed current as the nucleic acid moves through the pore and the nucleic acid sequence.
- the pores of the invention are preferably chemically modified with (1) a molecular adaptor and/or (2) the nucleic acid binding protein or exonuclease as discussed above.
- the whole or only part of the target nucleic acid sequence may be characterised, such as sequenced, using this method.
- the nucleic acid sequence can be any length.
- the nucleic acid sequence can be at least 10, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400 or at least 500 nucleotides in length.
- the nucleic acid sequence can be 1000 or more nucleotides or 5000 or more nucleotides in length.
- the nucleic acid sequence can be naturally occurring or artificial.
- the method may be used to verify the sequence of a manufactured oligonucleotide. The methods are typically carried out in vitro.
- the methods may be carried out using any suitable membrane/pore system in which a pore is inserted into a membrane.
- the methods are typically carried out using any of the systems, apparatus or conditions disclosed above.
- nucleotide discrimination can be achieved at low salt concentrations if the temperature is increased.
- One such strategy is to use the lipid bilayer to divide two different concentrations of salt solution, a low salt concentration of salt on the enzyme side and a higher concentration on the opposite side.
- One example of this approach is to use 200 mM of KC1 on the cis side of the membrane and 500 mM C1 in the trans chamber. At these conditions, the conductance through the pore is expected to be roughly equivalent to 400 mM C1 under normal conditions, and the enzyme only experiences 200 mM if placed on the cis side.
- Another possible benefit of using asymmetric salt conditions is the osmotic gradient induced across the pore. This net flow of water could be used to pull nucleotides into the pore for detection. A similar effect can be achieved using a neutral osmolyte, such as sucrose, glycerol or PEG. Another possibility is to use a solution with relatively low levels of KC1 and rely on an additional charge carrying species that is less disruptive to enzyme activity.
- the target sequence being analysed can be combined with known protecting chemistries to protect the sequence from being acted upon by the binding protein or exonuclease while in the bulk solution.
- the pore can then be used to remove the protecting chemistry. This can be achieved either by using protecting groups that are unhybridised by the pore, binding protein or enzyme under an applied potential (WO 2008/124107) or by using protecting chemistries that are removed by the binding protein or enzyme when held in close proximity to the pore (J Am Chem Soc. 2010 Dec 22;132(50):17961-72).
- Strand sequencing involves the controlled and stepwise translocation of nucleic acid polymers through a pore. Pores of the invention can be used in strand sequencing.
- One method of the invention uses a nucleic acid binding protein to control the movement of the target sequence through the pore.
- nucleic acid binding protein examples include, but are not limited to, nucleic acid handling enzymes, such as nucleases, polymerases, topoisomerases, ligases and helicases, and non-catalytic binding proteins such as those classified by SCOP (Structural Classification of Proteins) under the Nucleic acid-binding protein superfamily (50249).
- the binding protein may be single strand binding protein (SSB).
- a nucleic acid is a macromolecule comprising two or more nucleotides.
- the nucleic acid bound by the protein may comprise any combination of any nucleotides.
- the nucleotides may be any of those discussed above.
- the nucleic acid can be deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).
- the nucleic acid may be any synthetic nucleic acid known in the art, such as peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), locked nucleic acid (LNA) or other synthetic polymers with nucleotide side chains.
- the nucleic acid bound by the protein may be single stranded, such as cDNA, RNA, GNA, TNA or LNA, or double stranded, such as DNA.
- Proteins that bind single stranded nucleic acids may be used to sequence double stranded DNA as long as the double stranded DNA is dissociated into a single strand before it is bound by the protein.
- the nucleic acid binding protein is preferably a nucleic acid handling enzyme.
- a nucleic acid handling enzyme is a polypeptide that is capable of interacting with and modifying at least one property of a nucleic acid.
- the enzyme may modify the nucleic acid by cleaving it to form individual nucleotides or shorter chains of nucleotides, such as di- or trinucleotides.
- the enzyme may modify the nucleic acid by orienting it or moving it to a specific position.
- the nucleic acid handling enzyme does not need to display enzymatic activity as long as it is capable of binding the target sequence and controlling its movement through the pore. For instance, the enzyme may be modified to remove its enzymatic activity or may be used under conditions which prevent it from acting as an enzyme. Such conditions are discussed in more detail below.
- the nucleic acid handling enzyme is preferably derived from a nucleo lytic enzyme.
- the nucleic acid handling enzyme used in the construct of the enzyme is more preferably derived from a member of any of the Enzyme Classification (EC) groups 3.1.11, 3.1.13, 3.1.14, 3.1.15, 3.1.16, 3.1.21, 3.1.22, 3.1.25, 3.1.26, 3.1.27, 3.1.30 and 3.1.31.
- the enzyme may be any of those disclosed in International Application No. PCT/GB 10/000133 (published as WO 2010/086603).
- Preferred enzymes are polymerases, exonucleases, helicases and topoisomerases, such as gyrases.
- Suitable enzymes include, but are not limited to, exonuclease I from E. coli (SEQ ID NO: 6), exonuclease III enzyme from ⁇ . coli (SEQ ID NO: 8), RecJ from T. thermophilus (SEQ ID NO: 10) and bacteriophage lambda exonuclease (SEQ ID NO: 12) and variants thereof.
- Three subunits comprising the sequence shown in SEQ ID NO: 10 or a variant thereof interact to form a trimer exonuclease.
- the enzyme is preferably based on Phi29 DNA polymerase (SEQ ID NO: 4).
- a variant of SEQ ID NOs: 4, 6, 8, 10 or 12 is an enzyme that has an amino acid sequence which varies from that of SEQ ID NO: 4, 6, 8, 10 or 12 and which retains nucleic acid binding ability.
- the variant may include modifications that facilitate binding of the nucleic acid and/or facilitate its activity at high salt concentrations and/or room temperature.
- a variant will preferably be at least 50% homologous to that sequence based on amino acid identity. More preferably, the variant polypeptide may be at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%>, at least 85%, at least 90%> and more preferably at least 95%, 97% or 99% homologous based on amino acid identity to the amino acid sequence of SEQ ID NO: 4, 6, 8, 10 or 12 over the entire sequence.
- the variant may differ from the wild-type sequence in any of the ways discussed above with reference to SEQ ID NO: 2.
- the enzyme may be covalently attached to the pore as discussed above.
- the enzyme is not required to be in as close a proximity to the pore lumen as for individual nucleotide sequencing as there is no potential for disorder in the series in which nucleotides reach the sensing moiety of the pore.
- the two strategies for single strand DNA sequencing are the translocation of the DNA through the nanopore, both cis to trans and trans to cis, either with or against an applied potential.
- the most advantageous mechanism for strand sequencing is the controlled
- Exonucleases that act progressively or processively on double stranded DNA can be used on the cis side of the pore to feed the remaining single strand through under an applied potential or the trans side under a reverse potential.
- a helicase that unwinds the double stranded DNA can also be used in a similar manner.
- sequencing applications that require strand translocation against an applied potential, but the DNA must be first "caught" by the enzyme under a reverse or no potential. With the potential then switched back following binding the strand will pass cis to trans through the pore and be held in an extended
- the single strand DNA exonucleases or single strand DNA dependent polymerases can act as molecular motors to pull the recently translocated single strand back through the pore in a controlled stepwise manner, trans to cis, against the applied potential.
- Exonuclease-based methods can act as molecular motors to pull the recently translocated single strand back through the pore in a controlled stepwise manner, trans to cis, against the applied potential.
- the method of characterising a target nucleic acid sequence involves contacting the target sequence with an exonuclease enzyme. Any of the exonuclease enzymes discussed above may be used in the method. The exonuclease releases individual nucleotides from one end of the target sequence.
- the enzyme may be covalently attached to the pore as discussed above.
- Exonucleases are enzymes that typically latch onto one end of a nucleic acid sequence and digest the sequence one nucleotide at a time from that end.
- the exonuclease can digest the nucleic acid in the 5 ' to 3 ' direction or 3 ' to 5 ' direction.
- the end of the nucleic acid to which the exonuclease binds is typically determined through the choice of enzyme used and/or using methods known in the art. Hydroxyl groups or cap structures at either end of the nucleic acid sequence may typically be used to prevent or facilitate the binding of the exonuclease to a particular end of the nucleic acid sequence.
- the method involves contacting the nucleic acid sequence with the exonuclease so that the nucleotides are digested from the end of the nucleic acid at a rate that allows characterisation or identification of a proportion of nucleotides as discussed above.
- Methods for doing this are well known in the art. For example, Edman degradation is used to successively digest single amino acids from the end of polypeptide such that they may be identified using High
- HPLC Performance Liquid Chromatography
- the rate at which the exonuclease functions is typically slower than the optimal rate of a wild-type exonuclease.
- a suitable rate of activity of the exonuclease in the method of the invention involves digestion of from 0.5 to 1000 nucleotides per second, from 0.6 to 500 nucleotides per second, 0.7 to 200 nucleotides per second, from 0.8 to 100 nucleotides per second, from 0.9 to 50 nucleotides per second or 1 to 20 or 10 nucleotides per second.
- the rate is preferably 1, 10, 100, 500 or 1000 nucleotides per second.
- a suitable rate of exonuclease activity can be achieved in various ways. For example, variant exonucleases with a reduced optimal rate of activity may be used in accordance with the invention. Msp and Phi29 DNA polymerase
- characterisation is carried out using a pore derived from Msp and a Phi29 DNA polymerase.
- the method comprises (a) contacting the target sequence with a pore derived from Msp and a Phi29 DNA polymerase such that the polymerase controls the movement of the target sequence through the pore and a proportion of the nucleotides in the target sequence interacts with the pore and (b) measuring the current passing through the pore during each interaction and thereby characterising, such as determining the sequence, of the target sequence, wherein steps (a) and (b) are carried out with a voltage applied across the pore.
- the target sequence When the target sequence is contacted with a Phi29 DNA polymerase and a pore derived from Msp, the target sequence firstly forms a complex with the Phi29 DNA polymerase. When the voltage is applied across the pore, the target sequence/Phi29 DNA polymerase complex forms a complex with the pore and controls the movement of the target sequence through the pore.
- the target sequence moves through the pore at a rate that is commercially viable yet allows effective sequencing.
- the target sequence moves through the Msp pore more quickly than it does through a hemolysin pore.
- an increased current range is observed as the nucleic acid moves through the pore allowing the sequence to be determined more easily.
- a decreased current variance is observed when the specific pore and polymerase are used together thereby increasing the signal- to-noise ratio.
- nucleic acid sequence described above may be characterised or sequenced. At least a portion of the nucleic acid sequence is preferably double stranded.
- the pore may be any of the pores discussed above.
- the pore is preferably a pore of the invention.
- the pore may comprise eight monomers comprising the sequence shown in SEQ ID NO: 2, 16, 17 or 18 or a variant thereof.
- the pore does not have to include any of the mutations of the invention.
- Wild-type Phi29 DNA polymerase has polymerase and exonuclease activity. It may also unzip double stranded nucleic acids under the correct conditions. Hence, the enzyme may work in three modes. This is discussed in more detail below.
- the Phi29 DNA polymerase may comprise the sequence shown in SEQ ID NO: 4 or a variant thereof.
- a variant of SEQ ID NOs: 4 is an enzyme that has an amino acid sequence which varies from that of SEQ ID NO: 4 and which retains nucleic acid binding activity.
- the variant must work in at least one of the three modes discussed below. Preferably, the variant works in all three modes.
- the variant may include modifications that facilitate handling of the nucleic acid and/or facilitate its activity at high salt concentrations and/or room temperature.
- a variant will preferably be at least 40% homologous to that sequence based on amino acid identity. More preferably, the variant polypeptide may be at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% and more preferably at least 95%, 97% or 99% homologous based on amino acid identity to the amino acid sequence of SEQ ID NO: 4 over the entire sequence. There may be at least 80%, for example at least 85%, 90% or 95%, amino acid identity over a stretch of 200 or more, for example 230, 250, 270 or 280 or more, contiguous amino acids ("hard homology"). Homology is determined as described above. The variant may differ from the wild-type sequence in any of the ways discussed above with reference to SEQ ID NO: 2. The enzyme may be covalently attached to the pore as discussed above.
- the salt concentration is typically from 0.15M to 0.6M.
- the salt is preferably KC1.
- the method may be carried out in one of three preferred ways based on the three modes of the Phi29 DNA polymerase. Each way includes a method of proof reading the sequence.
- the method is preferably carried out using the P 29 DNA polymerase as a polymerase.
- steps (a) and (b) are carried out in the presence of free nucleotides and an enzyme co factor such that the polymerase moves the target sequence through the pore against the field resulting from the applied voltage.
- the target sequence moves in the 5' to 3' direction.
- the free nucleotides may be one or more of any of the individual nucleotides discussed above.
- the enzyme co factor is a factor that allows the Phi29 DNA polymerase to function either as a polymerase or an exonuclease.
- the enzyme cofactor is preferably a divalent metal cation.
- the divalent metal cation is preferably Mg , Mn , Ca or Co .
- the enzyme cofactor is most preferably Mg 2+ .
- the method preferably further comprises (c) removing the free nucleotides such that the polymerase moves the target sequence through the pore with the field resulting from the applied voltage (i.e. in the 3' and 5' direction) and a proportion of the nucleotides in the target sequence interacts with the pore and (d) measuring the current passing through the pore during each interaction and thereby proof reading the sequence of the target sequence obtained in step (b), wherein steps (c) and (d) are also carried out with a voltage applied across the pore.
- the method is preferably carried out using the Phi29 DNA polymerase as an exonuclease.
- steps (a) and (b) are carried out in the absence of free nucleotides and the presence of an enzyme cofactor such that the polymerase moves the target sequence through the pore with the field resulting from the applied voltage.
- the target sequence moves in the 3 ' to ' direction.
- the method preferably further comprises (c) adding free nucleotides such that the polymerase moves the target sequence through the pore against the field resulting from the applied voltage (i.e.
- steps (c) and (d) are also carried out with a voltage applied across the pore.
- the method is preferably carried out using the Phi29 DNA polymerase in unzipping mode. In this embodiment, steps (a) and (b) are carried out in the absence of free nucleotides and the absence of an enzyme co factor such that the polymerase controls the movement of the target sequence through the pore with the field resulting from the applied voltage (as it is unzipped).
- the polymerase acts like a brake preventing the target sequence from moving through the pore too quickly under the influence of the applied voltage.
- the method preferably further comprises (c) lowering the voltage applied across the pore such that the target sequence moves through the pore in the opposite direction to that in steps (a) and (b) (i.e. as it re-anneals) and a proportion of the nucleotides in the target sequence interacts with the pore and (d) measuring the current passing through the pore during each interaction and thereby proof reading the sequence of the target sequence obtained in step (b), wherein steps (c) and (d) are also carried out with a voltage applied across the pore.
- the invention also provides a method of forming a sensor for sequencing a target nucleic acid sequence, comprising (a) contacting a pore derived from Msp with a Phi29 DNA polymerase in the presence of the target nucleic acid sequence and (b) applying a voltage across the pore to form a complex between the pore and the polymerase and thereby forming a sensor for sequencing the target nucleic acid sequence.
- the invention further provides a method of increasing the rate of activity of a Phi29 DNA polymerase, comprising contacting the Phi29 DNA polymerase with a pore derived from Msp in the presence of a nucleic acid sequence and applying a voltage across the pore to form a complex between the pore and the polymerase and thereby increasing the rate of activity of a Phi29 DNA polymerase.
- kits for characterising, such as sequencing, a target nucleic acid sequence comprises (a) a pore of the invention and (b) a nucleic acid handling enzyme.
- Another kit comprises (a) a pore derived from Msp and (b) a Phi29 DNA polymerase. Any of the embodiments discussed above with reference to the methods of the invention are equally applicable to the kits of the invention.
- kits of the invention may additionally comprise one or more other reagents or instruments which enable any of the embodiments mentioned above to be carried out.
- reagents or instruments include one or more of the following: suitable buffer(s) (aqueous solutions), means to obtain a sample from a subject (such as a vessel or an instrument comprising a needle), means to amplify and/or express polynucleotide sequences, a membrane as defined above or voltage or patch clamp apparatus.
- Reagents may be present in the kit in a dry state such that a fluid sample resuspends the reagents.
- the kit may also, optionally, comprise instructions to enable the kit to be used in the method of the invention or details regarding which patients the method may be used for.
- the kit may, optionally, comprise nucleotides.
- the invention also provides an apparatus for characterising, such as sequencing, target nucleic acid sequences in a sample.
- the apparatus may comprise (a) a plurality of pores of the invention and (b) a plurality of nucleic acid handling enzymes.
- the invention may comprise a plurality of pores derived from Msp and a plurality of Phi29 DNA polymerases.
- the apparatus may be any conventional apparatus for analyte analysis, such as an array or a chip.
- the apparatus preferably comprises:
- a sensor device that is capable of supporting the plurality of pores and being operable to perform nucleic acid characterising or sequencing using the pores and enzymes;
- At least one reservoir for holding material for performing the characterising or sequencing
- a fluidics system configured to controllably supply material from the at least one reservoir to the sensor device
- the apparatus may be any of those described in International Application No. PCT/GB 10/000789 (published as WO 2010/122293), International Application No. PCT/GB 10/002206 (not yet published) or International Application No. PCT/US99/25679 (published as WO 00/28312).
- PCT/GB 10/000789 published as WO 2010/122293
- PCT/GB 10/002206 not yet published
- PCT/US99/25679 published as WO 00/28312
- Homo-oligomers are pores where all the monomer units are identical. As the monomer units will self-assemble, these are the simplest constructs to produce. Our strategies for improving the base reader properties can be split into categories:
- Sterics - substitution for residues with bulk e.g. Phenylalanine, Tryptophan, Tyrosine, Histidine
- MS-(B1-D90R) 8 Charged Arginine at the constriction.
- MS-(B1-D90K) 8 Charged Lysine at the constriction.
- MS-(B1-D91K) 8 Charged Lysine at the constriction.
- MS-(B1-D91Q) 8 Glutamine at the constriction MS-(B1-D90Q/D91G) 8 Glutamine at the constriction, size reduction.
- Homo-oligomers can also be modified to contain reactive group, which can then be chemically modified.
- oligomer contains more than one different subunit (e.g. MS-(MutA) 6 (MutB) j(MutC) i)
- the pore is a hetero-oligomer.
- Hetero-oligomers typically only have one unit modified (e.g. MS- (MutA) 7 (MutB)i).
- Other ratios of hetero-oligomers could also be formed (e.g. MS- (MutA) 6 (MutB) 2 ).
- Subunits may also include SEQ ID NO: 2.
- hetero-oligomers are that a single chemical change can be made to the pore (rather than introducing a change to every monomer-unit). This is a less drastic change to the structure than a homo-oligomer and may allow residues to be introduced into the pore at a position which did not work for a homo-oligomer.
- a single residue interacting with the DNA may be beneficial compared to multiple units (e.g. a single Arg on a hetero-octamer, compared to eight Arg on an octamer). Mutants can also be combine to produce different effects at the same residue, an example of this would be to reduce the size of seven units, while increasing the size of one (e.g. MS-(D90G) 8 (D90Y) 1 ).
- DNAP Phi29 DNA polymerase
- a 134mer ssDNA template (SEQ ID NO: 13) was hybridised to a 84mer ssDNA (SEQ ID NO: 14) to form a 84mer dsDNA template with a 50mer ssDNA 5 ' overhang.
- This strand moved through the MS-(B1) 8 MspA mutant and the hemolysin mutant using Phi29 DNAP in Unzipping mode.
- Two runs were acquired; one at 400 mM KCl and the other 600 mM KCl, all at room temperature with 10 mM Hepes, pH 8.0, 1 mM EDTA, ImM DTT.
- the applied potential was optimised for each mutant construct; HL was ran at 220 mV and the MspA at 180 mV.
- the current levels are mainly dependent on the salt concentration, the applied voltage, and temperature.
- the HL and the MS-(B1)8 MspA mutants were compared in Unzipping mode using Phi29 DNA polymerase with set physical conditions of: 600 mM KCl, 10 mM Hepes, 1 mM EDTA, 1 mM DTT, pH 8.0, +220 mV.
- the DNA used in this experiment was a lOOmer hairpin with a 34mer single stranded 5' overhang (SEQ ID NO: 15). The runs were conducted at room temperature.
- the MspA mutant gives a significantly larger current range of approximately 50 pA compared with the HL mutant where the range is approximately 20 pA (Figs. 2 and 3).
- a large current range is advantageous as it will provide a greater signal to noise and make it easier to distinguish distinct current states. This is of particular benefit for sequencing applications, when N bases may contribute to the current signal, leading to 4 N possible current states.
- the current levels of Ms A pores can be controlled by mutating the 1105 position in the protein. We demonstrate that the open pore current can be increased by over 80% as a result of making a single mutation to the MspA monomer.
- the baseline MS-(B1)8 mutant produces pore that have an open pore current of approximately 150 pA at +160 mV (Fig. 5).
- Example 7 a MS-(B1-I105A)8 pore that spontaneously changes conductance
- MspA mutant pores have been observed to spontaneously change conductance during electrical recording experiments.
- a single MspA mutant pore is capable of interchanging between high and low conductance states spontaneously (Fig. 8). This suggests that the mutations to the MspA allow conformational changes that are rarely observed in the baseline MS-(B1)8 pore. It is possible that mutations at the 1105 position stabilise the high conductance state of the pore.
- Example 8 Comparison DNA currents when moving DNA through the baseline MS-(B1)8 pores compared to the MS-(B1-I1Q5A)8 pores
- the MS-(B1) 8 pore and the MS-(Bl-I105N)s pores were compared in unzipping mode using Phi29 DNA polymerase with set physical conditions of: 400 mM KCl, 10 mM Hepes, 1 mM EDTA, 1 mM DTT, pH 8.0, +180 mV.
- the DNA used in this experiment was a lOOmer hairpin with a 34mer single stranded 5' overhang (SEQ ID NO: 15). The runs were conducted at room temperature.
- the noise levels of MspA pores can be controlled by mutating the L88 position in the MspA monomer sequence. It was demonstrated that the noise level can be reduced by 19% as a result of making a single mutation to the MspA monomer.
- Primers were designed to amplify a -400 bp fragment of PhiX174. Each of the 5 '-ends of these primers included a 50 nucleotide non-complimentary region, either a homopolymeric stretch or repeating units of 10 nucleotide homopolymeric sections. These serve as identifiers for controlled translocation of the strand through a nanopore, as well as determining the
- the 5 '-end of the forward primer was "capped” to include four 2'-0-Methyl-Uracil (mU) nucleotides and the 5 '-end of the reverse primer was chemically phosphorylated.
- mU 2'-0-Methyl-Uracil
- the mU capping protects the sense strand from nuclease digestion whilst the P04 at the 5 ' of the antisense strand promotes it. Therefore after incubation with lambda exonuclease only the sense strand of the duplex remains intact, now as single stranded DNA (ssDNA).
- ssDNA single stranded DNA
- the DNA substrate design used in this experiment is shown in Fig. 11 (SEQ ID NOs: 19 and 20 (sequences and tags presented below)).
- the DNA substrate consists of a 400base section of ssDNA from PhiX, with a 50T 5 '-leader to aid capture by the nanopore. Annealed to this strand just after the 50T leader is a primer containing a 3' cholesterol tag (3' Cholesteryl-TEG) to enrich the DNA on the surface of the bilayer, and thus improve capture efficiency.
- Buffered solution 400 mM NaCl, 10 mM Hepes pH 8.0, 1 mM ATP, 1 mM MgCl 2 , 1 mM DTT Nanopores: MS(Bl)8 MspA;
- Ag/AgCl electrodes were connected to the buffered solutions so that the cis compartment (to which both nanopore and enzyme/DNA are added) is connected to the ground of the Axopatch headstage, and the trans compartment is connected to the active electrode of the headstage.
- Helicase ATPase activity was initiated as required by the addition of divalent metal (1 mM MgC ⁇ ) and NTP (1 mM ATP) to the cis compartment. Experiments were carried out at a constant potential of +140 mV. Current levels were extracted as events from the DNA in the enzyme bound state these events were indexed and the current level, duration and variance of the event recorded.
- the noise levels of MspA pores can be altered by mutating the L88 position in the protein. It was demonstrated that the noise level can be reduced as a result of making a single mutation to the MspA monomer.
- This example compares the MS-(B1)8 pore to the MS-(B1-L88N)8, MS-(B1-L88S)8 and MS-(B1-L88Q)8 pores in unzipping mode, by using Phi29 DNA polymerase to control the movement of intact DNA strands through a nanopore.
- the DNA substrate design used in all the experiments described in this example is shown in Fig. 12 (SEQ ID NOs: 21, 22 and 23).
- SEQ ID NO: 23 was tagged with an IDT Int Spacer 9 (iSp9) and 3' Cholesteryl-TEG (3CholTEG) as shown below. The runs were conducted at room temperature at an applied potential of +180 mV.
- Buffered solution 400 mM KC1, 10 mM Hepes pH 8.0, 1 mM EDTA, 1 mM DTT
- Nanopores MS(B1)8 MspA; MS(B1-L88N)8 MspA;
- the baseline MS-(B1)8 mutant exhibited high levels of noise (76.15% of standard deviations > 2.0, see Table 19) at +180 mV.
- the other three mutants tested, (MS- (B1-L88N)8, MS-(B1-L88S)8 and MS-(B1-L88Q)8) which had a single point mutation at position L88, all observed lower levels of noise (see Table 19) than the baseline pore over the same DNA strand sequence. Therefore, it was possible to reduce signal noise by applying point mutations at position L88 in MspA monomer sequence.
- the signal range of MspA pores can be increased by mutating various positions within the MspA protein monomer sequence.
- This example compares the MS-(B1)8 pore to the following pores - MS-(B1-D90Q)8, MS-(B1-I105L)8, MS-(B1-I105Y)8, MS-(B1-I89Y-D90S)8, MS-(B1-N86T)8 and
- Buffered solution 400 mM KC1, 10 mM Hepes pH 8.0, 1 mM EDTA, 1 mM DTT
- Experiments were carried out at a constant potential of +180 mV. Current levels observed when the DNA is in the enzyme bound state were indexed and the current level, its duration and variance were recorded.
- the baseline MS-(B1)8 mutant exhibited a maximum range of 35 pA at +180 mV (Table 20).
- the other 6 mutants tested (MS-(B1-D90Q)8, MS-(B1-I105L)8, MS- (B1-I105Y)8, MS-(B1-I89Y-D90S)8, MS-(B1-N86T)8 and MS-(B1-S103G)8) all observed a greater maximum range than the baseline pore (See Table 20) over the same DNA strand sequence. Therefore, it was possible to increase signal range by applying point mutations at various locations in the MspA monomer sequence.
- the sequencing profile of MspA pores can be controlled by mutating a variety of positions in the MspA protein monomer sequence.
- Buffered solution 400 mM NaCl, 10 mM Hepes pH 8.0, 1 mM ATP, 1 mM MgCl 2 , 1 mM DTT Nanopores: MS(B1)8 MspA;
- Enzyme 0.1 ⁇ ).
- Helicase ATPase activity was initiated as required by the addition of divalent metal (1 mM MgClz) and NTP (1 mM ATP) to the cis compartment. Experiments were carried out at a constant potential of +140 mV. Current levels observed when the DNA is in the enzyme bound state were indexed and the current level, its duration and variance were recorded.
- the baseline MS-(B 1)8 mutant produced the sequencing profile shown in Fig. 13a.
- the experiment was repeated with the following mutants MS-(B1-D90Q- D93S-I105A)8, MS-(B1-D90Q-Q126R), MS-(B1-L88N-D90Q-D91M)8, MS-(B1-L88N-D90Q- D91S)8 and MS-(B1-G75S-G77S-L88N-Q126R)8, which exhibited a variety of different sequencing profiles (see Fig. 13 b-f). Therefore, by making point mutations at a variety of positions within MspA monomer sequence it is possible to alter the sequencing profile that is detected.
- This example describes how the MspA baseline pore MS-(B1)8 combined with the Phi29 DNA polymerase can be used to sequence a strand of RNA.
- RNA/DNA hybrid substrate design used in this experiment is shown in Fig. 14 (SEQ ID NOs: 24 and 25). SEQ ID NOs: 24 and 25 are presented below (RNA in bold). The runs were conducted at room temperature at an applied potential of +180 mV.
- RNA/DNA hybrid strand 120 mer in length
- SEQ ID NOs: 24 and 25 This was achieved by using the complementary DNA adapter strand SEQ ID NO: 26 to bring the two strands into close proximity, where they were subsequently ligated together forming the 120mer DNA/RNA hybrid SEQ ID NO: 27.
- SEQ NO: 27 (plus cholesterol tag; RNA in bold):
- Buffered solution 400 mM KC1, 10 mM Hepes pH 8.0, 1 mM EDTA, 1 mM DTT Nanopore: MS(B1)8 MspA;
- This example describes the preparation and oligomerisation of the MspA dimer.
- MspA NNNRRK monomeric protein consists of 184 amino acid residues.
- a single polypeptide was designed to make a dimeric version of MspA-NNNRRK protein.
- DNA sequence encoding the 184 residue MspA-NNNRRK polypeptide was linked to a second DNA sequence encoding the identical polypeptide chain via a short DNA linker sequence.
- the linker DNA sequence encodes SGSGSGDDDDDDDDSGSGSS (SEQ ID NO: 33; shown as -(SG)3-D 8 -(SG)2(SS)-).
- An initiator codon (ATG) was added just before the first base and a DNA encoding two stop codons (TAATAG) was added after the last base. Therefore, the entire DNA sequence encoding MspA-NNNRRK-(SG) -D 8 -(SG) 2 (SS)-MspA-NNNRRK is shown in SEQ ID NO: 28.
- the DNA was synthesised at GenScript USA Inc and cloned into a pT7 vector for expression purposes.
- Protein was generated by coupled in vitro transcription and translation (IVTT) by using an E. coli T7-S30 extract system for circular DNA (Promega).
- the complete 1 mM amino acid mixture minus cysteine and the complete 1 mM amino acid mixture minus methionine were mixed in equal volumes to obtain the working amino acid solution required to generate high concentrations of the proteins.
- the amino acid mix (2.5.0 ⁇ ), premix solution (10 ⁇ ), [35S]L-methionine (0.5 ⁇ ) and rifampicin (2 ⁇ , 50 mg/mL) were mixed with plasmid DNA (4 ⁇ ⁇ ,400 ng/mL) and T7 S30 extract (7.5 ⁇ ).
- the membrane pellet was resuspended with amino acid mix (10.0 ⁇ ), premix solution (40 ⁇ ), [3 S]L-methionine and rifampicin (2 ⁇ , 50 mg/mL). Plasmid DNA (16 ⁇ ,400 ng/mL) and T7 S30 extract (30.0 ⁇ ) were added to initiate synthesis. Synthesis was carried out for 90 min at 37 °C to generate 100 ⁇ _, of IVTT protein. IVTT reaction sample was centrifuged (25,000g, 10 mins) and the resulting membrane pellet was washed with MBS A and subjected to SDS-polyacrylamide gel electrophoresis in a 7.5% gel.
- the gel was dried on a watman 3M paper at 50 °C for 3 hours and exposed to X-ray film for 2 hours.
- the gel showed 8 distinct bands for the oligomerised MspA dimer, all of which migrated more slowly in SDS PAGE than the oligomerised monomer.
- This example compares the MS-(B1)8 pore oligomerised from the monomer (SEQ ID NO: 2) with the MS-(B1-B1)4 pore oligomerised from the dimer (SEQ ID NO: 29) in translocating mode, by using a helicase to control the movement of intact DNA strands (SEQ ID NOs: 19 and 20 (sequence and tags shown above)) through a nanopore.
- Buffered solution 400 mM NaCl, 10 mM Hepes pH 8.0, 1 mM ATP, 1 mM MgCl 2 , 1 mM DTT
- Chips were initially washed with 20 mL ethanol, then 20 mL d3 ⁇ 40, then 20 mL ethanol prior to
- CF4 plasma treatment The chips used were then pre-treated by dip-coating, vacuum-sealed and stored at 4 °C. Prior to use the chips were allowed to warm to room temperature for at least 20 minutes.
- Bilayers were formed by passing a series of slugs of 3.6 mg/mL 1,2-diphytanoyl-glycero- 3-phosphocholine lipid (DPhPC, Avanti Polar Lipids, AL, USA) dissolved in 1 M KCl, 10 mM Tris, pH 7.5, at 0.45 ⁇ / ⁇ across the chip. Initially a lipid slug (250 ⁇ ) was flowed across the chip, followed by a 100 ⁇ ⁇ slug of air. Two further slugs of 155 ⁇ ⁇ and 150 ⁇ ⁇ of lipid solution, each separated by a 100 ⁇ , slug of air were then passed over the chip. After bilayer formation the chamber was flushed with 3 mL of buffer at a flow rate of 3 ⁇ /s. Electrical recording of the bilayer formation was carried out at 10 kHz with an integration capacitance of 1.0 pF.
- a solution of the biological nanopore was prepared using either the MS-(B1)8 pore oligomerised from the monomer or the MS-(B1-B1)4 pore oligomerised from the dimer in 10 mM Tris, 1 mM EDTA, pH 8.0.
- a holding potential of +180 mV was applied and the solution flowed over the chip and pores were allowed to enter bilayers.
- the sampling rate and the integration capacitance were then maintained at 10 kHz and 1.0 pF respectively and the applied potential reduced to zero.
- DNA polynucleotide (SEQ ID NOs: 19 and 20) and helicase were pre-incubated for 5 mins.
- Experiments were carried out at a constant potential of +180 mV. Current levels were extracted as events from the DNA in the enzyme bound state. These events were indexed and the current level, duration and variance of the event recorded.
- the MS- (B1-B1)4 pore mutant oligomerised from the dimer unit was found to be as good a pore as the MS-(B1)8 pore mutant oligomerised from the monomer unit.
- TTTTTTTTT/idSp/TTTTTTTTTTmCTTTTTTTTTTTTTmCGTTTTTTTTTTCGTTT TTTTTGTATCTCCATCGCTGCCCCCTTTTTCCCCCTTTTT (which is SEQ ID NO: 30 with 9 T nucleotidesand an IDT Int d Spacer (idSp) at the 5' end).
- mC represents 5-methylcytosine GGCAGCGATGGAGATACTTGAGGCGAGCGGTCAA (SEQ ID NO: 31) and 5CholTEG/TTGACCGCTCGCCTC (SEQ ID NO: 32 with a 5' Cholesteryl-TEG tag).
- DNA polynucleotide SEQ ID NOs: 30, 31 and 32
- Enzyme 100 nM).
- Helicase ATPase activity was initiated as required by the addition of divalent metal (1 mM MgClz) and NTP (1 mM ATP) to the cis compartment. Experiments were carried out at a constant potential of +120 mV. Current levels were extracted as events from the DNA in the enzyme bound state. These events were indexed and the current level, duration and variance of the event recorded.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Mycology (AREA)
- Animal Behavior & Ethology (AREA)
- Pulmonology (AREA)
- Communicable Diseases (AREA)
- Epidemiology (AREA)
- Peptides Or Proteins (AREA)
- Enzymes And Modification Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2013553029A JP6169976B2 (ja) | 2011-02-11 | 2012-02-10 | 変異体細孔 |
| CA2826374A CA2826374C (en) | 2011-02-11 | 2012-02-10 | Mutant pores |
| AU2012215135A AU2012215135B9 (en) | 2011-02-11 | 2012-02-10 | Mutant pores |
| KR1020137023664A KR101939420B1 (ko) | 2011-02-11 | 2012-02-10 | 돌연변이체 세공 |
| CN201280017717.6A CN103460040B (zh) | 2011-02-11 | 2012-02-10 | 突变型孔 |
| BR112013020411-7A BR112013020411B1 (pt) | 2011-02-11 | 2012-02-10 | Monômero de msp mutante, construto, polinucleotídeo, poro, kit e aparelho para caracterizar uma sequência de ácido nucleico alvo, e, método para caracterizar uma sequência de ácido nucleico alvo |
| US13/984,628 US9751915B2 (en) | 2011-02-11 | 2012-02-10 | Mutant pores |
| EP12703872.7A EP2673638B1 (en) | 2011-02-11 | 2012-02-10 | Mutant pores |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161441718P | 2011-02-11 | 2011-02-11 | |
| US61/441,718 | 2011-02-11 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012107778A2 true WO2012107778A2 (en) | 2012-08-16 |
| WO2012107778A3 WO2012107778A3 (en) | 2012-11-29 |
Family
ID=45592746
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2012/050301 Ceased WO2012107778A2 (en) | 2011-02-11 | 2012-02-10 | Mutant pores |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US9751915B2 (https=) |
| EP (1) | EP2673638B1 (https=) |
| JP (2) | JP6169976B2 (https=) |
| KR (1) | KR101939420B1 (https=) |
| CN (1) | CN103460040B (https=) |
| AU (1) | AU2012215135B9 (https=) |
| BR (1) | BR112013020411B1 (https=) |
| CA (1) | CA2826374C (https=) |
| WO (1) | WO2012107778A2 (https=) |
Cited By (102)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014096830A1 (en) * | 2012-12-19 | 2014-06-26 | Oxford Nanopore Technologies Limited | Analysis of a polynucleotide via a nanopore system |
| WO2014122467A1 (en) | 2013-02-06 | 2014-08-14 | Loxbridge Research Llp | Systems and methods for early disease detection and real-time disease monitoring |
| WO2015150787A1 (en) * | 2014-04-04 | 2015-10-08 | Oxford Nanopore Technologies Limited | Method of target molecule characterisation using a molecular pore |
| WO2015161117A2 (en) | 2014-04-16 | 2015-10-22 | The Uab Research Foundation | Msp nanopores and uses thereof |
| WO2015166275A1 (en) * | 2014-05-02 | 2015-11-05 | Oxford Nanopore Technologies Limited | Mutant pores |
| WO2016055778A1 (en) | 2014-10-07 | 2016-04-14 | Oxford Nanopore Technologies Limited | Mutant pores |
| WO2016055777A2 (en) | 2014-10-07 | 2016-04-14 | Oxford Nanopore Technologies Limited | Modified enzymes |
| WO2016059363A1 (en) | 2014-10-14 | 2016-04-21 | Oxford Nanopore Technologies Limited | Method |
| WO2016132123A1 (en) | 2015-02-19 | 2016-08-25 | Oxford Nanopore Technologies Limited | Hetero-pores |
| WO2016132124A1 (en) | 2015-02-19 | 2016-08-25 | Oxford Nanopore Technologies Limited | Method |
| US9540422B2 (en) | 2008-09-22 | 2017-01-10 | University Of Washington | MSP nanopores and related methods |
| CN107109489A (zh) * | 2014-10-17 | 2017-08-29 | 牛津纳米孔技术公司 | 纳米孔rna表征方法 |
| US9777049B2 (en) | 2012-04-10 | 2017-10-03 | Oxford Nanopore Technologies Ltd. | Mutant lysenin pores |
| WO2018060740A1 (en) | 2016-09-29 | 2018-04-05 | Oxford Nanopore Technologies Limited | Method for nucleic acid detection by guiding through a nanopore |
| WO2018073604A1 (en) | 2016-10-21 | 2018-04-26 | Oxford Nanopore Technologies Limited | Method |
| US9957560B2 (en) | 2011-07-25 | 2018-05-01 | Oxford Nanopore Technologies Ltd. | Hairpin loop method for double strand polynucleotide sequencing using transmembrane pores |
| WO2018100370A1 (en) | 2016-12-01 | 2018-06-07 | Oxford Nanopore Technologies Limited | Methods and systems for characterizing analytes using nanopores |
| US10006905B2 (en) | 2013-03-25 | 2018-06-26 | Katholieke Universiteit Leuven | Nanopore biosensors for detection of proteins and nucleic acids |
| WO2018146491A1 (en) | 2017-02-10 | 2018-08-16 | Oxford Nanopore Technologies Limited | Modified nanopores, compositions comprising the same, and uses thereof |
| WO2018211241A1 (en) * | 2017-05-04 | 2018-11-22 | Oxford Nanopore Technologies Limited | Transmembrane pore consisting of two csgg pores |
| US10221450B2 (en) | 2013-03-08 | 2019-03-05 | Oxford Nanopore Technologies Ltd. | Enzyme stalling method |
| US10246741B2 (en) | 2011-05-27 | 2019-04-02 | Oxford Nanopore Technologies Ltd. | Coupling method |
| US10338056B2 (en) | 2012-02-13 | 2019-07-02 | Oxford Nanopore Technologies Ltd. | Apparatus for supporting an array of layers of amphiphilic molecules and method of forming an array of layers of amphiphilic molecules |
| US10337060B2 (en) | 2014-04-04 | 2019-07-02 | Oxford Nanopore Technologies Ltd. | Method for characterising a double stranded nucleic acid using a nano-pore and anchor molecules at both ends of said nucleic acid |
| GB201907246D0 (en) | 2019-05-22 | 2019-07-03 | Oxford Nanopore Tech Ltd | Method |
| GB201907244D0 (en) | 2019-05-22 | 2019-07-03 | Oxford Nanopore Tech Ltd | Method |
| US10400014B2 (en) | 2014-09-01 | 2019-09-03 | Oxford Nanopore Technologies Ltd. | Mutant CsgG pores |
| WO2019227013A1 (en) | 2018-05-24 | 2019-11-28 | Oxford Nanopore Technologies Inc. | Droplet interfaces in electro-wetting devices |
| WO2019224558A1 (en) | 2018-05-24 | 2019-11-28 | Oxford Nanopore Technologies Limited | Method for selecting polynucleotides based on the size in a globular form |
| US10501767B2 (en) | 2013-08-16 | 2019-12-10 | Oxford Nanopore Technologies Ltd. | Polynucleotide modification methods |
| WO2019234432A1 (en) | 2018-06-06 | 2019-12-12 | Oxford Nanopore Technologies Limited | Method |
| GB201917060D0 (en) | 2019-11-22 | 2020-01-08 | Oxford Nanopore Tech Ltd | Method |
| WO2020049293A1 (en) | 2018-09-04 | 2020-03-12 | Oxford Nanopore Technologies Ltd | Method for determining a polymer sequence |
| GB202004944D0 (en) | 2020-04-03 | 2020-05-20 | King S College London | Method |
| US10669578B2 (en) | 2014-02-21 | 2020-06-02 | Oxford Nanopore Technologies Ltd. | Sample preparation method |
| WO2020109773A1 (en) | 2018-11-28 | 2020-06-04 | Oxford Nanopore Technologies Limited | Analysis of nanopore signal using a machine-learning technique |
| WO2020109800A1 (en) | 2018-11-28 | 2020-06-04 | Oxford Nanopore Technologies Ltd. | Sensing system and method of operation |
| US10689697B2 (en) | 2014-10-16 | 2020-06-23 | Oxford Nanopore Technologies Ltd. | Analysis of a polymer |
| WO2020128517A1 (en) | 2018-12-21 | 2020-06-25 | Oxford Nanopore Technologies Limited | Method of encoding data on a polynucleotide strand |
| US10739341B2 (en) | 2012-02-15 | 2020-08-11 | Oxford Nanopore Technologies Limited | Aptamer method |
| US10760114B2 (en) | 2014-10-17 | 2020-09-01 | Oxford Nanopore Technologies Ltd. | Methods for delivering an analyte to transmembrane pores |
| US10814298B2 (en) | 2012-10-26 | 2020-10-27 | Oxford Nanopore Technologies Ltd. | Formation of array of membranes and apparatus therefor |
| WO2020234595A1 (en) | 2019-05-22 | 2020-11-26 | Oxford Nanopore Technologies Limited | Sensing interactions between molecular entities and nanopores |
| US10976300B2 (en) | 2015-12-08 | 2021-04-13 | Katholieke Universiteit Leuven | Modified nanopores, compositions comprising the same, and uses thereof |
| US10975428B2 (en) | 2016-03-02 | 2021-04-13 | Oxford Nanopore Technologies Ltd. | Mutant pore |
| WO2021111125A1 (en) | 2019-12-02 | 2021-06-10 | Oxford Nanopore Technologies Limited | Method of characterising a target polypeptide using a nanopore |
| WO2021111139A1 (en) | 2019-12-04 | 2021-06-10 | Oxford Nanopore Technologies Limited | Method |
| GB202107192D0 (en) | 2021-05-19 | 2021-06-30 | Oxford Nanopore Tech Ltd | Method |
| WO2021133168A1 (en) | 2019-12-24 | 2021-07-01 | Technische Universiteit Delft | Protein and peptide fingerprinting and sequencing by nanopore translocation of peptide-oligonucleotide complexes |
| GB202107354D0 (en) | 2021-05-24 | 2021-07-07 | Oxford Nanopore Tech Ltd | Method |
| US11098355B2 (en) | 2016-05-25 | 2021-08-24 | Oxford Nanopore Technologies Ltd. | Method of nanopore sequencing of concatenated nucleic acids |
| US11104709B2 (en) | 2016-04-06 | 2021-08-31 | Oxford Nanopore Technologies Ltd. | Mutant pore |
| US11111532B2 (en) | 2013-10-18 | 2021-09-07 | Oxford Nanopore Technologies Ltd. | Method of characterizing a target ribonucleic acid (RNA) comprising forming a complementary polynucleotide which moves through a transmembrane pore |
| US11155860B2 (en) | 2012-07-19 | 2021-10-26 | Oxford Nanopore Technologies Ltd. | SSB method |
| US11169138B2 (en) | 2015-04-14 | 2021-11-09 | Katholieke Universiteit Leuven | Nanopores with internal protein adaptors |
| GB202113935D0 (en) | 2021-09-29 | 2021-11-10 | Cambridge Entpr Ltd | Nucleic acid characterisation |
| CN113735948A (zh) * | 2021-09-28 | 2021-12-03 | 成都齐碳科技有限公司 | 孔蛋白单体的突变体、蛋白孔及其应用 |
| WO2021255475A1 (en) | 2020-06-18 | 2021-12-23 | Oxford Nanopore Technologies Limited | A method of selectively characterising a polynucleotide using a detector |
| WO2021255477A1 (en) | 2020-06-18 | 2021-12-23 | Oxford Nanopore Technologies Limited | Method of repeatedly moving a double-stranded polynucleotide through a nanopore |
| WO2021255476A2 (en) | 2020-06-18 | 2021-12-23 | Oxford Nanopore Technologies Limited | Method |
| WO2022020461A1 (en) | 2020-07-22 | 2022-01-27 | Oxford Nanopore Technologies Inc. | Solid state nanopore formation |
| WO2022069022A1 (en) | 2020-09-29 | 2022-04-07 | Ecole Polytechnique Federale De Lausanne (Epfl) | Systems and methods for digital information decoding and data storage in hybrid macromolecules |
| US11352664B2 (en) | 2009-01-30 | 2022-06-07 | Oxford Nanopore Technologies Plc | Adaptors for nucleic acid constructs in transmembrane sequencing |
| US11534763B2 (en) | 2017-12-21 | 2022-12-27 | Oxford Nanopore Technologies Plc | Droplet interfaces in electro-wetting devices |
| US11572387B2 (en) | 2017-06-30 | 2023-02-07 | Vib Vzw | Protein pores |
| WO2023026039A1 (en) | 2021-08-23 | 2023-03-02 | Cambridge Enterprise Limited | Nucleic acid detection |
| US11596940B2 (en) | 2016-07-06 | 2023-03-07 | Oxford Nanopore Technologies Plc | Microfluidic device |
| US11649480B2 (en) | 2016-05-25 | 2023-05-16 | Oxford Nanopore Technologies Plc | Method for modifying a template double stranded polynucleotide |
| WO2023094806A1 (en) | 2021-11-29 | 2023-06-01 | Oxford Nanopore Technologies Plc | Nanopore measurement signal analysis |
| WO2023118892A1 (en) | 2021-12-23 | 2023-06-29 | Oxford Nanopore Technologies Plc | Method |
| WO2023118891A1 (en) | 2021-12-23 | 2023-06-29 | Oxford Nanopore Technologies Plc | Method of characterising polypeptides using a nanopore |
| GB202307486D0 (en) | 2023-05-18 | 2023-07-05 | Oxford Nanopore Tech Plc | Method |
| US11725205B2 (en) | 2018-05-14 | 2023-08-15 | Oxford Nanopore Technologies Plc | Methods and polynucleotides for amplifying a target polynucleotide |
| US11725235B2 (en) | 2014-01-22 | 2023-08-15 | Oxford Nanopore Technologies Plc | Method for attaching one or more polynucleotide binding proteins to a target polynucleotide |
| US11789014B2 (en) | 2017-05-04 | 2023-10-17 | Oxford Nanopore Technologies Plc | Method of determining the presence or absence of a target analyte comprising using a reporter polynucleotide and a transmembrane pore |
| WO2023222994A1 (en) | 2022-05-18 | 2023-11-23 | Oxford Nanopore Technologies Plc | Calibration of a nanopore array device |
| WO2023222657A1 (en) | 2022-05-17 | 2023-11-23 | Oxford Nanopore Technologies Plc | Method and adaptors |
| EP4293349A2 (en) | 2015-02-05 | 2023-12-20 | President and Fellows of Harvard College | Nanopore sensor including fluidic passage |
| GB202401864D0 (en) | 2024-02-12 | 2024-03-27 | Fund Centre De Regulacio Genòmica | A method of detecting non-canonical bases in sequencing data |
| US11959906B2 (en) | 2012-02-16 | 2024-04-16 | Oxford Nanopore Technologies Plc | Analysis of measurements of a polymer |
| WO2024084211A1 (en) | 2022-10-19 | 2024-04-25 | Oxford Nanopore Technologies Plc | Analysis of a polymer |
| WO2024094986A1 (en) | 2022-10-31 | 2024-05-10 | Oxford Nanopore Technologies Plc | Method |
| WO2024094966A1 (en) | 2022-11-01 | 2024-05-10 | Oxford Nanopore Technologies Plc | Biochemical analysis system and method of controlling a biochemical analysis system |
| WO2024100270A1 (en) | 2022-11-11 | 2024-05-16 | Oxford Nanopore Technologies Plc | Novel pore monomers and pores |
| GB202407228D0 (en) | 2024-05-21 | 2024-07-03 | Oxford Nanopore Tech Plc | Method |
| EP4397775A2 (en) | 2017-05-04 | 2024-07-10 | Oxford Nanopore Technologies PLC | Machine-learning analysis of nanopore measurements |
| WO2024089270A3 (en) * | 2022-10-28 | 2024-07-18 | Oxford Nanopore Technologies Plc | Pore monomers and pores |
| WO2024156993A1 (en) | 2023-01-25 | 2024-08-02 | Oxford Nanopore Technologies Plc | Calibration of a nanopore array device |
| WO2024200280A1 (en) | 2023-03-24 | 2024-10-03 | Oxford Nanopore Technologies Plc | Method and kits |
| US12121894B2 (en) | 2017-11-29 | 2024-10-22 | Oxford Nanopore Technologies Plc | Microfluidic device |
| WO2024235919A1 (en) | 2023-05-12 | 2024-11-21 | Oxford Nanopore Technologies Plc | Modified helicases |
| US12195777B2 (en) | 2018-02-02 | 2025-01-14 | Oxford Nanopore Technologies Plc | Polynucleotide synthesis method, kit and system |
| US12216110B2 (en) | 2011-09-23 | 2025-02-04 | Oxford Nanopore Technologies Plc | Method and system of estimating a sequence of polymer units |
| WO2025099094A1 (en) | 2023-11-06 | 2025-05-15 | Oxford Nanopore Technologies Plc | Method |
| US12411125B2 (en) | 2020-07-17 | 2025-09-09 | Oxford Nanopore Technologies Plc | Nanopore sensing device |
| WO2025238371A1 (en) | 2024-05-17 | 2025-11-20 | Oxford Nanopore Technologies Plc | Polymer analysis using transformer neural network |
| US12552661B2 (en) | 2018-05-24 | 2026-02-17 | Oxford Nanopore Technologies Plc | Nanopore array with electrode connectors protected from electrostatic discharge |
| WO2026052811A2 (en) | 2024-09-06 | 2026-03-12 | Oxford Nanopore Technologies Plc | Method |
| WO2026052817A1 (en) | 2024-09-06 | 2026-03-12 | Oxford Nanopore Technologies Plc | Method |
| WO2026058009A1 (en) | 2024-09-16 | 2026-03-19 | Oxford Nanopore Technologies Plc | Augmented consensus and variant calling |
| WO2026062385A1 (en) | 2024-09-18 | 2026-03-26 | Oxford Nanopore Technologies Plc | Preprocessing nanopore signals |
| WO2026073826A1 (en) | 2024-09-27 | 2026-04-09 | Oxford Nanopore Technologies Plc | Oligonucleotide compositions for identifying and characterising drug-resistant |
Families Citing this family (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0905140D0 (en) | 2009-03-25 | 2009-05-06 | Isis Innovation | Method |
| CN104039979B (zh) | 2011-10-21 | 2016-08-24 | 牛津纳米孔技术公司 | 使用孔和Hel308解旋酶表征目标多核苷酸的酶方法 |
| AU2012360244B2 (en) | 2011-12-29 | 2018-08-23 | Oxford Nanopore Technologies Limited | Enzyme method |
| US9617591B2 (en) | 2011-12-29 | 2017-04-11 | Oxford Nanopore Technologies Ltd. | Method for characterising a polynucleotide by using a XPD helicase |
| CA2879261C (en) | 2012-07-19 | 2022-12-06 | Oxford Nanopore Technologies Limited | Modified helicases |
| JP6429773B2 (ja) | 2012-07-19 | 2018-11-28 | オックスフォード ナノポール テクノロジーズ リミテッド | 酵素構築物 |
| US9551023B2 (en) | 2012-09-14 | 2017-01-24 | Oxford Nanopore Technologies Ltd. | Sample preparation method |
| WO2014072703A1 (en) | 2012-11-06 | 2014-05-15 | Oxford Nanopore Technologies Limited | Quadruplex method |
| GB201406151D0 (en) | 2014-04-04 | 2014-05-21 | Oxford Nanopore Tech Ltd | Method |
| CN117947149A (zh) | 2013-10-18 | 2024-04-30 | 牛津纳米孔科技公开有限公司 | 经修饰的酶 |
| US10359395B2 (en) * | 2014-02-19 | 2019-07-23 | University Of Washington | Nanopore-based analysis of protein characteristics |
| WO2015148567A1 (en) * | 2014-03-24 | 2015-10-01 | Bernick David L | Molecular adapter for capture and manipulation of transfer rna |
| GB201508003D0 (en) | 2015-05-11 | 2015-06-24 | Oxford Nanopore Tech Ltd | Apparatus and methods for measuring an electrical current |
| CN109196116B (zh) | 2016-05-25 | 2022-09-27 | 牛津纳米孔科技公开有限公司 | 一种表征靶多核苷酸的方法 |
| WO2018152050A1 (en) | 2017-02-14 | 2018-08-23 | Axbio Inc. | Apparatus and methods for continuous diagnostics of macromolecules |
| US20210325406A1 (en) * | 2018-08-28 | 2021-10-21 | Nanjing University | Protein nanopore for identifying an analyte |
| CA3118808A1 (en) * | 2018-11-08 | 2020-05-14 | Oxford Nanopore Technologies Limited | Pore |
| CN111164096B (zh) * | 2019-09-29 | 2021-02-19 | 北京齐碳科技有限公司 | 一种Mmup单体变体及其应用 |
| WO2021056599A1 (zh) | 2019-09-29 | 2021-04-01 | 北京齐碳科技有限公司 | 一种Mnep单体变体及其应用 |
| CN111164097B (zh) * | 2019-09-29 | 2021-02-19 | 北京齐碳科技有限公司 | 一种Mnep单体变体及其应用 |
| CN115052882B (zh) * | 2020-02-06 | 2024-05-24 | 豪夫迈·罗氏有限公司 | 减少模板穿入纳米孔的组合物 |
| US20240377380A1 (en) * | 2021-03-31 | 2024-11-14 | Illumina, Inc. | Nanopore sensor devices |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000028312A1 (en) | 1998-11-06 | 2000-05-18 | The Regents Of The University Of California | A miniature support for thin films containing single channels or nanopores and methods for using same |
| WO2006100484A2 (en) | 2005-03-23 | 2006-09-28 | Isis Innovation Limited | Deliver of molecules to a li id bila |
| WO2008124107A1 (en) | 2007-04-04 | 2008-10-16 | The Regents Of The University Of California | Compositions, devices, systems, and methods for using a nanopore |
| WO2009035647A1 (en) | 2007-09-12 | 2009-03-19 | President And Fellows Of Harvard College | High-resolution molecular graphene sensor comprising an aperture in the graphene layer |
| WO2009077734A2 (en) | 2007-12-19 | 2009-06-25 | Oxford Nanopore Technologies Limited | Formation of layers of amphiphilic molecules |
| WO2010004265A1 (en) | 2008-07-07 | 2010-01-14 | Oxford Nanopore Technologies Limited | Enzyme-pore constructs |
| WO2010086602A1 (en) | 2009-01-30 | 2010-08-05 | Oxford Nanopore Technologies Limited | Hybridization linkers |
| WO2010122293A1 (en) | 2009-04-20 | 2010-10-28 | Oxford Nanopore Technologies Limited | Lipid bilayer sensor array |
Family Cites Families (77)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IE56026B1 (en) | 1982-10-19 | 1991-03-27 | Cetus Corp | Cysteine-depleted muteins of biologically active proteins |
| WO1994025616A1 (en) | 1993-04-28 | 1994-11-10 | Worcester Foundation For Experimental Biology | Cell-targeted lytic pore-forming agents |
| US5777078A (en) | 1993-04-28 | 1998-07-07 | Worcester Foundation For Experimental Biology | Triggered pore-forming agents |
| DE4320201A1 (de) | 1993-06-18 | 1995-01-12 | Asta Medica Ag | Verwendung von Cetrorelix und weiteren Nona- und Dekapeptiden zur Herstellung eines Arzneimittels zur Bekämpfung von Aids und zur Wachstumsstimulation |
| US5386373A (en) | 1993-08-05 | 1995-01-31 | Pavilion Technologies, Inc. | Virtual continuous emission monitoring system with sensor validation |
| US5561043A (en) | 1994-01-31 | 1996-10-01 | Trustees Of Boston University | Self-assembling multimeric nucleic acid constructs |
| US7569341B2 (en) | 1994-01-31 | 2009-08-04 | Trustees Of Boston University | Nucleic acid directed immobilization arrays and methods of assembly |
| US6362002B1 (en) | 1995-03-17 | 2002-03-26 | President And Fellows Of Harvard College | Characterization of individual polymer molecules based on monomer-interface interactions |
| US5795782A (en) | 1995-03-17 | 1998-08-18 | President & Fellows Of Harvard College | Characterization of individual polymer molecules based on monomer-interface interactions |
| AU8586298A (en) | 1997-07-25 | 1999-02-16 | University Of Massachusetts | Designed protein pores as components for biosensors |
| US6087099A (en) | 1997-09-08 | 2000-07-11 | Myriad Genetics, Inc. | Method for sequencing both strands of a double stranded DNA in a single sequencing reaction |
| US6127166A (en) | 1997-11-03 | 2000-10-03 | Bayley; Hagan | Molluscan ligament polypeptides and genes encoding them |
| JPH11137260A (ja) | 1997-11-06 | 1999-05-25 | Soyaku Gijutsu Kenkyusho:Kk | 抗インフルエンザウイルス環状ダンベル型rna−dnaキメラ化合物及び抗インフルエンザウイルス剤 |
| US6123819A (en) | 1997-11-12 | 2000-09-26 | Protiveris, Inc. | Nanoelectrode arrays |
| DE19826758C1 (de) | 1998-06-15 | 1999-10-21 | Soft Gene Gmbh | Darstellung von linearen kovalent geschlossenen DNA-Molekülen als Expressionskonstrukte |
| US7155344B1 (en) | 1998-07-27 | 2006-12-26 | Caliper Life Sciences, Inc. | Distributed database for analytical instruments |
| US6426231B1 (en) | 1998-11-18 | 2002-07-30 | The Texas A&M University System | Analyte sensing mediated by adapter/carrier molecules |
| NO986133D0 (no) | 1998-12-23 | 1998-12-23 | Preben Lexow | FremgangsmÕte for DNA-sekvensering |
| EP2383776B1 (en) | 1999-06-22 | 2015-02-25 | President and Fellows of Harvard College | Solid state nanopore device for evaluating biopolymers |
| US7087729B1 (en) | 1999-06-29 | 2006-08-08 | University Health Network | Peptide conjugates for the stabilization of membrane proteins and interactions with biological membranes |
| EP1208207A2 (de) | 1999-08-31 | 2002-05-29 | Michael Niederweis | Verfahren zur herstellung eines kanalbildenden proteins |
| WO2001040516A2 (en) | 1999-12-02 | 2001-06-07 | Molecular Staging Inc. | Generation of single-strand circular dna from linear self-annealing segments |
| WO2001059453A2 (en) | 2000-02-11 | 2001-08-16 | The Texas A & M University System | Biosensor compositions and methods of use |
| US20020132978A1 (en) | 2000-03-21 | 2002-09-19 | Hans-Peter Gerber | VEGF-modulated genes and methods employing them |
| CA2404216A1 (en) | 2000-03-22 | 2001-09-27 | Curagen Corporation | Novel polypeptides, and nucleic acids encoding the same |
| US7001792B2 (en) | 2000-04-24 | 2006-02-21 | Eagle Research & Development, Llc | Ultra-fast nucleic acid sequencing device and a method for making and using the same |
| AU2001289914A1 (en) | 2000-09-25 | 2002-04-02 | Sensovation Ag | Image sensor device, apparatus and method for optical measurements |
| WO2002042496A2 (en) | 2000-11-27 | 2002-05-30 | The Regents Of The University Of California | Methods and devices for characterizing duplex nucleic acid molecules |
| US20030087232A1 (en) | 2001-01-25 | 2003-05-08 | Fred Christians | Methods for screening polypeptides |
| US7807408B2 (en) | 2001-03-19 | 2010-10-05 | President & Fellows Of Harvard College | Directed evolution of proteins |
| US6995236B2 (en) | 2001-05-08 | 2006-02-07 | Riken | Sphingomyelin detecting probe |
| US6863833B1 (en) | 2001-06-29 | 2005-03-08 | The Board Of Trustees Of The Leland Stanford Junior University | Microfabricated apertures for supporting bilayer lipid membranes |
| WO2003004992A2 (en) | 2001-07-03 | 2003-01-16 | The Regents Of The University Of California | Mammalian sweet and amino acid heterodimeric taste receptors |
| EP1504114B1 (en) | 2002-05-10 | 2017-07-12 | The Texas A & M University System | Stochastic sensing through covalent interactions |
| US7163658B2 (en) | 2003-04-23 | 2007-01-16 | Rouvain Bension | Rapid sequencing of polymers |
| US7344882B2 (en) | 2003-05-12 | 2008-03-18 | Bristol-Myers Squibb Company | Polynucleotides encoding variants of the TRP channel family member, LTRPC3 |
| US20070122885A1 (en) | 2005-08-22 | 2007-05-31 | Fermalogic, Inc. | Methods of increasing production of secondary metabolites by manipulating metabolic pathways that include methylmalonyl-coa |
| WO2005056750A2 (en) | 2003-12-11 | 2005-06-23 | Quark Biotech, Inc. | Inversion-duplication of nucleic acids and libraries prepared thereby |
| US7238485B2 (en) | 2004-03-23 | 2007-07-03 | President And Fellows Of Harvard College | Methods and apparatus for characterizing polynucleotides |
| WO2005124888A1 (en) | 2004-06-08 | 2005-12-29 | President And Fellows Of Harvard College | Suspended carbon nanotube field effect transistor |
| US7972858B2 (en) | 2004-08-13 | 2011-07-05 | President And Fellows Of Harvard College | Ultra high-throughput opti-nanopore DNA readout platform |
| US20060105461A1 (en) | 2004-10-22 | 2006-05-18 | May Tom-Moy | Nanopore analysis system |
| EP1842061A4 (en) | 2004-12-21 | 2009-05-13 | Texas A & M Univ Sys | HIGH-TEMPERATURE ION CHANNELS AND ION PORES |
| US7272518B2 (en) | 2005-07-01 | 2007-09-18 | Square D Company | Automated hierarchy classification in utility monitoring systems |
| US7877154B2 (en) | 2005-09-30 | 2011-01-25 | Fisher-Rosemount Systems, Inc. | Method and system for controlling a batch process |
| KR100730350B1 (ko) | 2005-10-17 | 2007-06-19 | 삼성전자주식회사 | 표면처리된 나노포어를 이용한 dna 검출방법 및검출장치 |
| GB0523282D0 (en) | 2005-11-15 | 2005-12-21 | Isis Innovation | Methods using pores |
| WO2007075987A2 (en) | 2005-12-22 | 2007-07-05 | Pacific Biosciences Of California, Inc. | Active surface coupled polymerases |
| US7932029B1 (en) | 2006-01-04 | 2011-04-26 | Si Lok | Methods for nucleic acid mapping and identification of fine-structural-variations in nucleic acids and utilities |
| CA2663047A1 (en) | 2006-09-06 | 2008-03-13 | Phase Bioscience, Inc. | Therapeutic elastin-like polypeptide (elp) fusion proteins |
| US7638034B2 (en) | 2006-09-21 | 2009-12-29 | Los Alamos National Security, Llc | Electrochemical detection of single molecules using abiotic nanopores having electrically tunable dimensions |
| US20100311602A1 (en) | 2006-10-13 | 2010-12-09 | J. Craig Venter Institute, Inc. | Sequencing method |
| US8594848B2 (en) | 2006-11-28 | 2013-11-26 | Lester F. Ludwig | Reconfigurable chemical process systems |
| US20110121840A1 (en) | 2007-02-20 | 2011-05-26 | Gurdial Singh Sanghera | Lipid Bilayer Sensor System |
| GB0716005D0 (en) | 2007-08-16 | 2007-09-26 | Imp Innovations Ltd | Single molecule spectroscopy using nanoporpus membranes |
| GB0716264D0 (en) | 2007-08-21 | 2007-09-26 | Isis Innovation | Bilayers |
| GB2453377A (en) | 2007-10-05 | 2009-04-08 | Isis Innovation | Transmembrane protein pores and molecular adapters therefore. |
| WO2009084721A1 (en) | 2007-12-31 | 2009-07-09 | Fujirebio Inc. | Clusters of microresonators for cavity mode optical sensing |
| US8231969B2 (en) | 2008-03-26 | 2012-07-31 | University Of Utah Research Foundation | Asymmetrically functionalized nanoparticles |
| EP4230747A3 (en) | 2008-03-28 | 2023-11-15 | Pacific Biosciences Of California, Inc. | Compositions and methods for nucleic acid sequencing |
| EP2293921A4 (en) | 2008-05-22 | 2013-05-22 | Univ California | MEMBRANE PROBLEMS AND MEMBRANES MADE FROM THESE |
| EP2310534B1 (en) * | 2008-07-07 | 2018-09-05 | Oxford Nanopore Technologies Limited | Base-detecting pore |
| CA2774710C (en) * | 2008-09-22 | 2016-08-02 | University Of Washington | Msp nanopores and related methods |
| GB0820927D0 (en) | 2008-11-14 | 2008-12-24 | Isis Innovation | Method |
| US20110246084A1 (en) | 2008-11-26 | 2011-10-06 | Mostafa Ronaghi | Methods and systems for analysis of sequencing data |
| EP2391732B1 (en) | 2009-01-30 | 2015-05-27 | Oxford Nanopore Technologies Limited | Methods using adaptors for nucleic acid constructs in transmembrane sequencing |
| AU2010215761B2 (en) | 2009-02-23 | 2017-04-06 | Cytomx Therapeutics, Inc | Proproteins and methods of use thereof |
| GB0905140D0 (en) | 2009-03-25 | 2009-05-06 | Isis Innovation | Method |
| FR2943656A1 (fr) | 2009-03-25 | 2010-10-01 | Air Liquide | Procede et installation de production d'hydrogene mettant en oeuvre un compresseur thermocinetique |
| US9127313B2 (en) | 2009-12-01 | 2015-09-08 | Oxford Nanopore Technologies Limited | Biochemical analysis instrument |
| FR2955773B1 (fr) | 2010-02-01 | 2017-05-26 | Commissariat Energie Atomique | Complexe moleculaire de ciblage des antigenes vers les cellules presentatrices d'antigene et ses applications pour la vaccination |
| WO2012042226A2 (en) | 2010-10-01 | 2012-04-05 | Oxford Nanopore Technologies Limited | Biochemical analysis apparatus and rotary valve |
| GB201100516D0 (en) | 2011-01-12 | 2011-02-23 | Isis Innovation | Method using fluorinated amphiphiles |
| EP4737389A2 (en) | 2011-05-27 | 2026-05-06 | Oxford Nanopore Technologies PLC | Coupling method |
| KR102083695B1 (ko) | 2012-04-10 | 2020-03-02 | 옥스포드 나노포어 테크놀로지즈 리미티드 | 돌연변이체 리세닌 기공 |
| TWI655213B (zh) | 2012-07-13 | 2019-04-01 | Menicon Co., Ltd. | 自我組織化肽衍生物的製造方法 |
| US20140206842A1 (en) | 2013-01-22 | 2014-07-24 | Muhammed Majeed | Peptides Modified with Triterpenoids and Small Organic Molecules: Synthesis and use in Cosmeceutical |
-
2012
- 2012-02-10 KR KR1020137023664A patent/KR101939420B1/ko active Active
- 2012-02-10 AU AU2012215135A patent/AU2012215135B9/en active Active
- 2012-02-10 EP EP12703872.7A patent/EP2673638B1/en active Active
- 2012-02-10 US US13/984,628 patent/US9751915B2/en active Active
- 2012-02-10 CN CN201280017717.6A patent/CN103460040B/zh active Active
- 2012-02-10 CA CA2826374A patent/CA2826374C/en active Active
- 2012-02-10 BR BR112013020411-7A patent/BR112013020411B1/pt active IP Right Grant
- 2012-02-10 JP JP2013553029A patent/JP6169976B2/ja active Active
- 2012-02-10 WO PCT/GB2012/050301 patent/WO2012107778A2/en not_active Ceased
-
2017
- 2017-03-22 JP JP2017055552A patent/JP2017148052A/ja active Pending
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000028312A1 (en) | 1998-11-06 | 2000-05-18 | The Regents Of The University Of California | A miniature support for thin films containing single channels or nanopores and methods for using same |
| WO2006100484A2 (en) | 2005-03-23 | 2006-09-28 | Isis Innovation Limited | Deliver of molecules to a li id bila |
| WO2008124107A1 (en) | 2007-04-04 | 2008-10-16 | The Regents Of The University Of California | Compositions, devices, systems, and methods for using a nanopore |
| WO2009035647A1 (en) | 2007-09-12 | 2009-03-19 | President And Fellows Of Harvard College | High-resolution molecular graphene sensor comprising an aperture in the graphene layer |
| WO2009077734A2 (en) | 2007-12-19 | 2009-06-25 | Oxford Nanopore Technologies Limited | Formation of layers of amphiphilic molecules |
| WO2010004265A1 (en) | 2008-07-07 | 2010-01-14 | Oxford Nanopore Technologies Limited | Enzyme-pore constructs |
| WO2010086602A1 (en) | 2009-01-30 | 2010-08-05 | Oxford Nanopore Technologies Limited | Hybridization linkers |
| WO2010086603A1 (en) | 2009-01-30 | 2010-08-05 | Oxford Nanopore Technologies Limited | Enzyme mutant |
| WO2010122293A1 (en) | 2009-04-20 | 2010-10-28 | Oxford Nanopore Technologies Limited | Lipid bilayer sensor array |
Non-Patent Citations (17)
| Title |
|---|
| ALTSCHUL S. F., J MOL EVOL, vol. 36, 1993, pages 290 - 300 |
| ALTSCHUL, S.F ET AL., J MOL BIOL, vol. 215, 1990, pages 403 - 10 |
| CHEM BIOL., vol. 4, no. 7, July 1997 (1997-07-01), pages 497 - 505 |
| DECK ET AL., INORG. CHEM., vol. 41, 2002, pages 669 - 677 |
| DEVEREUX ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387 - 395 |
| ELISEEV, A. V.; SCHNEIDER, H-J., J. AM. CHEM. SOC., vol. 116, 1994, pages 6081 - 6088 |
| GONZALEZ-PEREZ ET AL., LANGMUIR, vol. 25, 2009, pages 10447 - 10450 |
| GUNDLACH, PROC NATL ACAD SCI U S A., vol. 107, no. 37, 26 August 2010 (2010-08-26), pages 16060 - 5 |
| HALL ET AL., NAT NANOTECHNOL., vol. 5, 2010, pages 874 - 877 |
| HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 10915 - 10919 |
| J AM CHEM SOC., vol. 132, no. 50, 22 December 2010 (2010-12-22), pages 17961 - 72 |
| KARLIN; ALTSCHUL, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 5787 |
| LIEBERMAN KR ET AL., J AM CHEM SOC., vol. 132, no. 50, 2010, pages 17961 - 72 |
| M.A. HOLDEN; H. BAYLEY, J. AM. CHEM. SOC., vol. 127, 2005, pages 6502 - 6503 |
| PROC NATL ACAD SCI U S A., vol. 105, no. 52, 30 December 2008 (2008-12-30), pages 20647 - 52 |
| SAMBROOK, J.; RUSSELL, D.: "Molecular Cloning: A Laboratory Manual, 3rd Edition.", 2001, COLD SPRING HARBOR LABORATORY PRESS |
| STODDART D ET AL., PROC NATL ACAD SCI, vol. 106, no. 19, pages 7702 - 7 |
Cited By (214)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9540422B2 (en) | 2008-09-22 | 2017-01-10 | University Of Washington | MSP nanopores and related methods |
| US11352664B2 (en) | 2009-01-30 | 2022-06-07 | Oxford Nanopore Technologies Plc | Adaptors for nucleic acid constructs in transmembrane sequencing |
| US11459606B2 (en) | 2009-01-30 | 2022-10-04 | Oxford Nanopore Technologies Plc | Adaptors for nucleic acid constructs in transmembrane sequencing |
| US11946102B2 (en) | 2011-05-27 | 2024-04-02 | Oxford Nanopore Technologies Plc | Coupling method |
| US10246741B2 (en) | 2011-05-27 | 2019-04-02 | Oxford Nanopore Technologies Ltd. | Coupling method |
| US11041194B2 (en) | 2011-05-27 | 2021-06-22 | Oxford Nanopore Technologies Ltd. | Coupling method |
| US12473595B2 (en) | 2011-05-27 | 2025-11-18 | Oxford Nanopore Technologies Plc | Coupling method |
| US12152276B2 (en) | 2011-05-27 | 2024-11-26 | Oxford Nanopore Technologies Plc | Coupling method |
| US11136623B2 (en) | 2011-05-27 | 2021-10-05 | Oxford Nanopore Technologies Limited | Coupling method |
| US11959135B2 (en) | 2011-05-27 | 2024-04-16 | Oxford Nanopore Technologies Plc | Coupling method |
| US10851409B2 (en) | 2011-07-25 | 2020-12-01 | Oxford Nanopore Technologies Ltd. | Hairpin loop method for double strand polynucleotide sequencing using transmembrane pores |
| US11261487B2 (en) | 2011-07-25 | 2022-03-01 | Oxford Nanopore Technologies Plc | Hairpin loop method for double strand polynucleotide sequencing using transmembrane pores |
| US10597713B2 (en) | 2011-07-25 | 2020-03-24 | Oxford Nanopore Technologies Ltd. | Hairpin loop method for double strand polynucleotide sequencing using transmembrane pores |
| US12168799B2 (en) | 2011-07-25 | 2024-12-17 | Oxford Nanopore Technologies Plc | Hairpin loop method for double strand polynucleotide sequencing using transmembrane pores |
| US9957560B2 (en) | 2011-07-25 | 2018-05-01 | Oxford Nanopore Technologies Ltd. | Hairpin loop method for double strand polynucleotide sequencing using transmembrane pores |
| US11168363B2 (en) | 2011-07-25 | 2021-11-09 | Oxford Nanopore Technologies Ltd. | Hairpin loop method for double strand polynucleotide sequencing using transmembrane pores |
| US12216110B2 (en) | 2011-09-23 | 2025-02-04 | Oxford Nanopore Technologies Plc | Method and system of estimating a sequence of polymer units |
| US11913936B2 (en) | 2012-02-13 | 2024-02-27 | Oxford Nanopore Technologies Plc | Apparatus for supporting an array of layers of amphiphilic molecules and method of forming an array of layers of amphiphilic molecules |
| US12540937B2 (en) | 2012-02-13 | 2026-02-03 | Oxford Nanopore Technologies Plc | Apparatus for supporting an array of layers of amphiphilic molecules and method of forming an array of layers of amphiphilic molecules |
| US11561216B2 (en) | 2012-02-13 | 2023-01-24 | Oxford Nanopore Technologies Plc | Apparatus for supporting an array of layers of amphiphilic molecules and method of forming an array of layers of amphiphilic molecules |
| US10338056B2 (en) | 2012-02-13 | 2019-07-02 | Oxford Nanopore Technologies Ltd. | Apparatus for supporting an array of layers of amphiphilic molecules and method of forming an array of layers of amphiphilic molecules |
| US11685922B2 (en) | 2012-02-15 | 2023-06-27 | Oxford Nanopore Technologies Plc | Aptamer method |
| US10739341B2 (en) | 2012-02-15 | 2020-08-11 | Oxford Nanopore Technologies Limited | Aptamer method |
| US11959906B2 (en) | 2012-02-16 | 2024-04-16 | Oxford Nanopore Technologies Plc | Analysis of measurements of a polymer |
| US12258375B2 (en) | 2012-04-10 | 2025-03-25 | Oxford Nanopore Technologies Plc | Mutant lysenin pores |
| US9777049B2 (en) | 2012-04-10 | 2017-10-03 | Oxford Nanopore Technologies Ltd. | Mutant lysenin pores |
| US10882889B2 (en) | 2012-04-10 | 2021-01-05 | Oxford Nanopore Technologies Ltd. | Mutant lysenin pores |
| US12448646B2 (en) | 2012-07-19 | 2025-10-21 | Oxford Nanopore Technologies Plc | SSB method |
| US11155860B2 (en) | 2012-07-19 | 2021-10-26 | Oxford Nanopore Technologies Ltd. | SSB method |
| US12458945B2 (en) | 2012-10-26 | 2025-11-04 | Oxford Nanopore Technologies Plc | Formation of array of membranes and apparatus therefor |
| US10814298B2 (en) | 2012-10-26 | 2020-10-27 | Oxford Nanopore Technologies Ltd. | Formation of array of membranes and apparatus therefor |
| US12350637B2 (en) | 2012-10-26 | 2025-07-08 | Oxford Nanopore Technologies Plc | Formation of array of membranes and apparatus therefor |
| US12351867B2 (en) | 2012-12-19 | 2025-07-08 | Oxford Nanopore Technologies Plc | Analysis of a polynucleotide via a nanopore system |
| US11085077B2 (en) | 2012-12-19 | 2021-08-10 | Oxford Nanopore Technologies Ltd. | Analysis of a polynucleotide via a nanopore system |
| WO2014096830A1 (en) * | 2012-12-19 | 2014-06-26 | Oxford Nanopore Technologies Limited | Analysis of a polynucleotide via a nanopore system |
| US12486534B2 (en) | 2012-12-19 | 2025-12-02 | Oxford Nanopore Technologies Plc | Analysis of a polynucleotide via a nanopore system |
| US10131943B2 (en) | 2012-12-19 | 2018-11-20 | Oxford Nanopore Technologies Ltd. | Analysis of a polynucleotide via a nanopore system |
| WO2014122467A1 (en) | 2013-02-06 | 2014-08-14 | Loxbridge Research Llp | Systems and methods for early disease detection and real-time disease monitoring |
| US11560589B2 (en) | 2013-03-08 | 2023-01-24 | Oxford Nanopore Technologies Plc | Enzyme stalling method |
| US10221450B2 (en) | 2013-03-08 | 2019-03-05 | Oxford Nanopore Technologies Ltd. | Enzyme stalling method |
| US10006905B2 (en) | 2013-03-25 | 2018-06-26 | Katholieke Universiteit Leuven | Nanopore biosensors for detection of proteins and nucleic acids |
| US10514378B2 (en) | 2013-03-25 | 2019-12-24 | Katholieke Universiteit Leuven | Nanopore biosensors for detection of proteins and nucleic acids |
| US10976311B2 (en) | 2013-03-25 | 2021-04-13 | Katholieke Universiteit Leuven | Nanopore biosensors for detection of proteins and nucleic acids |
| US10802015B2 (en) | 2013-03-25 | 2020-10-13 | Katholieke Universiteit Leuven | Nanopore biosensors for detection of proteins and nucleic acids |
| US11761956B2 (en) | 2013-03-25 | 2023-09-19 | Katholieke Universiteit Leuven | Nanopore biosensors for detection of proteins and nucleic acids |
| US10501767B2 (en) | 2013-08-16 | 2019-12-10 | Oxford Nanopore Technologies Ltd. | Polynucleotide modification methods |
| US11186857B2 (en) | 2013-08-16 | 2021-11-30 | Oxford Nanopore Technologies Plc | Polynucleotide modification methods |
| US12473593B2 (en) | 2013-10-18 | 2025-11-18 | Oxford Nanopore Technologies Plc | Method of characterizing a target ribonucleic acid (RNA) comprising forming a complementary polynucleotide which moves through a transmembrane pore |
| US11111532B2 (en) | 2013-10-18 | 2021-09-07 | Oxford Nanopore Technologies Ltd. | Method of characterizing a target ribonucleic acid (RNA) comprising forming a complementary polynucleotide which moves through a transmembrane pore |
| US11725235B2 (en) | 2014-01-22 | 2023-08-15 | Oxford Nanopore Technologies Plc | Method for attaching one or more polynucleotide binding proteins to a target polynucleotide |
| US12584168B2 (en) | 2014-02-21 | 2026-03-24 | Oxford Nanopore Technologies Plc | Sample preparation method |
| US10669578B2 (en) | 2014-02-21 | 2020-06-02 | Oxford Nanopore Technologies Ltd. | Sample preparation method |
| US11542551B2 (en) | 2014-02-21 | 2023-01-03 | Oxford Nanopore Technologies Plc | Sample preparation method |
| US10774378B2 (en) | 2014-04-04 | 2020-09-15 | Oxford Nanopore Technologies Ltd. | Method of target molecule characterisation using a molecular pore |
| WO2015150787A1 (en) * | 2014-04-04 | 2015-10-08 | Oxford Nanopore Technologies Limited | Method of target molecule characterisation using a molecular pore |
| US10337060B2 (en) | 2014-04-04 | 2019-07-02 | Oxford Nanopore Technologies Ltd. | Method for characterising a double stranded nucleic acid using a nano-pore and anchor molecules at both ends of said nucleic acid |
| US12571035B2 (en) | 2014-04-04 | 2026-03-10 | Oxford Nanopore Technologies Plc | Method of target molecule characterisation using a molecular pore |
| US11236385B2 (en) | 2014-04-04 | 2022-02-01 | Oxford Nanopore Technologies Ltd. | Method for characterising a double stranded nucleic acid using a nano-pore and anchor molecules at both ends of said nucleic acid |
| US11649490B2 (en) | 2014-04-04 | 2023-05-16 | Oxford Nanopore Technologies Plc | Method of target molecule characterisation using a molecular pore |
| US12312385B2 (en) | 2014-04-16 | 2025-05-27 | The Uab Research Foundation | MSP nanopores and uses thereof |
| US11858966B2 (en) | 2014-04-16 | 2024-01-02 | The Uab Research Foundation | Msp nanopores and uses thereof |
| WO2015161117A3 (en) * | 2014-04-16 | 2016-12-08 | The Uab Research Foundation | Msp nanopores and uses thereof |
| US10781237B2 (en) | 2014-04-16 | 2020-09-22 | The Uab Research Foundation | MSP nanopores and uses thereof |
| WO2015161117A2 (en) | 2014-04-16 | 2015-10-22 | The Uab Research Foundation | Msp nanopores and uses thereof |
| US11292817B2 (en) | 2014-04-16 | 2022-04-05 | The Uab Research Foundation | Msp nanopores and uses thereof |
| CN106574300A (zh) * | 2014-05-02 | 2017-04-19 | 牛津纳米孔技术公司 | 改善目标多核苷酸相对于跨膜孔移动的方法 |
| WO2015166275A1 (en) * | 2014-05-02 | 2015-11-05 | Oxford Nanopore Technologies Limited | Mutant pores |
| US10167503B2 (en) | 2014-05-02 | 2019-01-01 | Oxford Nanopore Technologies Ltd. | Mutant pores |
| US11739377B2 (en) | 2014-05-02 | 2023-08-29 | Oxford Nanopore Technologies Plc | Method of improving the movement of a target polynucleotide with respect to a transmembrane pore |
| US10844432B2 (en) | 2014-05-02 | 2020-11-24 | Oxford Nanopore Technologies, Ltd. | Method of improving the movement of a target polynucleotide with respect to a transmembrane pore |
| US10443097B2 (en) | 2014-05-02 | 2019-10-15 | Oxford Nanopore Technologies Ltd. | Method of improving the movement of a target polynucleotide with respect to a transmembrane pore |
| EP3137490B1 (en) | 2014-05-02 | 2021-01-27 | Oxford Nanopore Technologies Limited | Mutant pores |
| WO2015166276A1 (en) * | 2014-05-02 | 2015-11-05 | Oxford Nanopore Technologies Limited | Method of improving the movement of a target polynucleotide with respect to a transmembrane pore |
| US11034734B2 (en) | 2014-09-01 | 2021-06-15 | Oxford Nanopore Technologies Ltd. | Mutant pores |
| US10400014B2 (en) | 2014-09-01 | 2019-09-03 | Oxford Nanopore Technologies Ltd. | Mutant CsgG pores |
| US12275761B2 (en) | 2014-09-01 | 2025-04-15 | Vib Vzw | Mutant CsgG pores |
| WO2016055777A2 (en) | 2014-10-07 | 2016-04-14 | Oxford Nanopore Technologies Limited | Modified enzymes |
| WO2016055778A1 (en) | 2014-10-07 | 2016-04-14 | Oxford Nanopore Technologies Limited | Mutant pores |
| EP4108679A1 (en) | 2014-10-07 | 2022-12-28 | Oxford Nanopore Technologies plc | Modified enzymes |
| US10266885B2 (en) | 2014-10-07 | 2019-04-23 | Oxford Nanopore Technologies Ltd. | Mutant pores |
| US11390904B2 (en) | 2014-10-14 | 2022-07-19 | Oxford Nanopore Technologies Plc | Nanopore-based method and double stranded nucleic acid construct therefor |
| US10570440B2 (en) | 2014-10-14 | 2020-02-25 | Oxford Nanopore Technologies Ltd. | Method for modifying a template double stranded polynucleotide using a MuA transposase |
| WO2016059363A1 (en) | 2014-10-14 | 2016-04-21 | Oxford Nanopore Technologies Limited | Method |
| US11401549B2 (en) | 2014-10-16 | 2022-08-02 | Oxford Nanopore Technologies Plc | Analysis of a polymer |
| US10689697B2 (en) | 2014-10-16 | 2020-06-23 | Oxford Nanopore Technologies Ltd. | Analysis of a polymer |
| EP4397972A2 (en) | 2014-10-16 | 2024-07-10 | Oxford Nanopore Technologies PLC | Alignment mapping estimation |
| EP3971300A1 (en) | 2014-10-16 | 2022-03-23 | Oxford Nanopore Technologies plc | Sorting of polymers |
| US12545956B2 (en) | 2014-10-16 | 2026-02-10 | Oxford Nanopore Technologies Plc | Analysis of a polymer |
| US12545955B2 (en) | 2014-10-16 | 2026-02-10 | Oxford Nanopore Technologies Plc | Analysis of a polymer |
| US12129518B2 (en) | 2014-10-17 | 2024-10-29 | Oxford Nanopore Technologies Plc | Method for nanopore RNA characterization |
| US11613771B2 (en) | 2014-10-17 | 2023-03-28 | Oxford Nanopore Technologies Plc | Methods for delivering an analyte to transmembrane pores |
| US10480026B2 (en) * | 2014-10-17 | 2019-11-19 | Oxford Nanopore Technologies Ltd. | Method for nanopore RNA characterisation |
| US11021747B2 (en) | 2014-10-17 | 2021-06-01 | Oxford Nanopore Technologies Ltd. | Method for nanopore RNA characterisation |
| US10760114B2 (en) | 2014-10-17 | 2020-09-01 | Oxford Nanopore Technologies Ltd. | Methods for delivering an analyte to transmembrane pores |
| CN107109489A (zh) * | 2014-10-17 | 2017-08-29 | 牛津纳米孔技术公司 | 纳米孔rna表征方法 |
| EP4293349A2 (en) | 2015-02-05 | 2023-12-20 | President and Fellows of Harvard College | Nanopore sensor including fluidic passage |
| WO2016132124A1 (en) | 2015-02-19 | 2016-08-25 | Oxford Nanopore Technologies Limited | Method |
| US10472673B2 (en) | 2015-02-19 | 2019-11-12 | Oxford Nanopore Technologies Ltd. | Hetero-pores |
| EP4019535A1 (en) | 2015-02-19 | 2022-06-29 | Oxford Nanopore Technologies plc | Hetero-pores |
| WO2016132123A1 (en) | 2015-02-19 | 2016-08-25 | Oxford Nanopore Technologies Limited | Hetero-pores |
| US11307192B2 (en) | 2015-02-19 | 2022-04-19 | Oxford Nanopore Technologies Plc | Method for producing a hetero-oligomeric pore comprising two different monomers in a specific stiochiometric ratio |
| US11169138B2 (en) | 2015-04-14 | 2021-11-09 | Katholieke Universiteit Leuven | Nanopores with internal protein adaptors |
| US10976300B2 (en) | 2015-12-08 | 2021-04-13 | Katholieke Universiteit Leuven | Modified nanopores, compositions comprising the same, and uses thereof |
| US12018326B2 (en) | 2016-03-02 | 2024-06-25 | Oxford Nanopore Technologies Plc | Mutant pore |
| US11186868B2 (en) | 2016-03-02 | 2021-11-30 | Oxford Nanopore Technologies Plc | Mutant pore |
| US11685949B2 (en) | 2016-03-02 | 2023-06-27 | Oxford Nanopore Technologies Plc | Mutant pore |
| US12227800B2 (en) | 2016-03-02 | 2025-02-18 | Oxford Nanopore Technologies Plc | Mutant pores |
| US10975428B2 (en) | 2016-03-02 | 2021-04-13 | Oxford Nanopore Technologies Ltd. | Mutant pore |
| US11597970B2 (en) | 2016-03-02 | 2023-03-07 | Oxford Nanopore Technologies Plc | Mutant pores |
| US10995372B2 (en) | 2016-03-02 | 2021-05-04 | Oxford Nanopore Technologies Ltd. | Mutant pores |
| US11939359B2 (en) | 2016-04-06 | 2024-03-26 | Oxford Nanopore Technologies Plc | Mutant pore |
| US11104709B2 (en) | 2016-04-06 | 2021-08-31 | Oxford Nanopore Technologies Ltd. | Mutant pore |
| US12371458B2 (en) | 2016-04-06 | 2025-07-29 | Oxford Nanopore Technologies Plc | Mutant pore |
| US11098355B2 (en) | 2016-05-25 | 2021-08-24 | Oxford Nanopore Technologies Ltd. | Method of nanopore sequencing of concatenated nucleic acids |
| US11649480B2 (en) | 2016-05-25 | 2023-05-16 | Oxford Nanopore Technologies Plc | Method for modifying a template double stranded polynucleotide |
| US12584170B2 (en) | 2016-05-25 | 2026-03-24 | Oxford Nanopore Technologies Plc | Method of nanopore sequencing of concatenated nucleic acids |
| US11596940B2 (en) | 2016-07-06 | 2023-03-07 | Oxford Nanopore Technologies Plc | Microfluidic device |
| US11085078B2 (en) | 2016-09-29 | 2021-08-10 | Oxford Nanopore Technologies Limited | Method for nucleic acid detection by guiding through a nanopore |
| WO2018060740A1 (en) | 2016-09-29 | 2018-04-05 | Oxford Nanopore Technologies Limited | Method for nucleic acid detection by guiding through a nanopore |
| US11739379B2 (en) | 2016-09-29 | 2023-08-29 | Oxford Nanopore Technologies Plc | Method for nucleic acid detection by guiding through a nanopore |
| US12553085B2 (en) | 2016-09-29 | 2026-02-17 | Oxford Nanopore Technologies Plc | Sequencing kit |
| WO2018073604A1 (en) | 2016-10-21 | 2018-04-26 | Oxford Nanopore Technologies Limited | Method |
| US11390910B2 (en) | 2016-10-21 | 2022-07-19 | Oxford Nanopore Technologies Plc | Method |
| US12509721B2 (en) | 2016-12-01 | 2025-12-30 | Oxford Nanopore Technologies Plc | Methods and systems for characterizing analytes using nanopores |
| EP4269617A2 (en) | 2016-12-01 | 2023-11-01 | Oxford Nanopore Technologies plc | Methods and systems for characterizing analytes using nanopores |
| WO2018100370A1 (en) | 2016-12-01 | 2018-06-07 | Oxford Nanopore Technologies Limited | Methods and systems for characterizing analytes using nanopores |
| US11466317B2 (en) | 2016-12-01 | 2022-10-11 | Oxford Nanopore Technologies Plc | Methods and systems for characterizing analytes using nanopores |
| US11840556B2 (en) | 2017-02-10 | 2023-12-12 | Oxford Nanopore Technologies Plc | Modified nanopores, compositions comprising the same, and uses thereof |
| WO2018146491A1 (en) | 2017-02-10 | 2018-08-16 | Oxford Nanopore Technologies Limited | Modified nanopores, compositions comprising the same, and uses thereof |
| WO2018211241A1 (en) * | 2017-05-04 | 2018-11-22 | Oxford Nanopore Technologies Limited | Transmembrane pore consisting of two csgg pores |
| US11789014B2 (en) | 2017-05-04 | 2023-10-17 | Oxford Nanopore Technologies Plc | Method of determining the presence or absence of a target analyte comprising using a reporter polynucleotide and a transmembrane pore |
| EP3892627A1 (en) * | 2017-05-04 | 2021-10-13 | Oxford Nanopore Technologies Limited | Transmembrane pore consisting of two csgg pores |
| US12024541B2 (en) | 2017-05-04 | 2024-07-02 | Oxford Nanopore Technologies Plc | Transmembrane pore consisting of two CsgG pores |
| US12437184B2 (en) | 2017-05-04 | 2025-10-07 | Oxford Nanopore Technologies Plc | Machine learning analysis of nanopore measurements |
| EP4397775A2 (en) | 2017-05-04 | 2024-07-10 | Oxford Nanopore Technologies PLC | Machine-learning analysis of nanopore measurements |
| US11945840B2 (en) | 2017-06-30 | 2024-04-02 | Vib Vzw | Protein pores |
| US12084477B2 (en) | 2017-06-30 | 2024-09-10 | Vib Vzw | Protein pores |
| US11572387B2 (en) | 2017-06-30 | 2023-02-07 | Vib Vzw | Protein pores |
| US12121894B2 (en) | 2017-11-29 | 2024-10-22 | Oxford Nanopore Technologies Plc | Microfluidic device |
| EP4390394A2 (en) | 2017-12-21 | 2024-06-26 | Oxford Nanopore Technologies PLC | Droplet interfaces in electro-wetting devices |
| US11534763B2 (en) | 2017-12-21 | 2022-12-27 | Oxford Nanopore Technologies Plc | Droplet interfaces in electro-wetting devices |
| US12290815B2 (en) | 2017-12-21 | 2025-05-06 | Oxford Nanopore Technologies Plc | Droplet interfaces in electro-wetting devices |
| US12195777B2 (en) | 2018-02-02 | 2025-01-14 | Oxford Nanopore Technologies Plc | Polynucleotide synthesis method, kit and system |
| US11725205B2 (en) | 2018-05-14 | 2023-08-15 | Oxford Nanopore Technologies Plc | Methods and polynucleotides for amplifying a target polynucleotide |
| WO2019224558A1 (en) | 2018-05-24 | 2019-11-28 | Oxford Nanopore Technologies Limited | Method for selecting polynucleotides based on the size in a globular form |
| WO2019227013A1 (en) | 2018-05-24 | 2019-11-28 | Oxford Nanopore Technologies Inc. | Droplet interfaces in electro-wetting devices |
| US12269037B2 (en) | 2018-05-24 | 2025-04-08 | Oxford Nanopore Technologies Plc | Droplet interfaces in electro-wetting devices |
| US12383903B2 (en) | 2018-05-24 | 2025-08-12 | Oxford Nanopore Technologies Plc | Droplet interfaces in electro-wetting devices |
| US12552661B2 (en) | 2018-05-24 | 2026-02-17 | Oxford Nanopore Technologies Plc | Nanopore array with electrode connectors protected from electrostatic discharge |
| US11920193B2 (en) | 2018-06-06 | 2024-03-05 | Oxford Nanopore Technologies Plc | Method of characterizing a polynucleotide |
| WO2019234432A1 (en) | 2018-06-06 | 2019-12-12 | Oxford Nanopore Technologies Limited | Method |
| WO2020049293A1 (en) | 2018-09-04 | 2020-03-12 | Oxford Nanopore Technologies Ltd | Method for determining a polymer sequence |
| WO2020109773A1 (en) | 2018-11-28 | 2020-06-04 | Oxford Nanopore Technologies Limited | Analysis of nanopore signal using a machine-learning technique |
| US12264360B2 (en) | 2018-11-28 | 2025-04-01 | Oxford Nanopore Technologies Plc | Analysis of nanopore signal using a machine-learning technique |
| WO2020109800A1 (en) | 2018-11-28 | 2020-06-04 | Oxford Nanopore Technologies Ltd. | Sensing system and method of operation |
| US12256863B2 (en) | 2018-11-28 | 2025-03-25 | Oxford Nanopore Technologies Plc | Sensing system and method of operation |
| EP4636767A2 (en) | 2018-12-21 | 2025-10-22 | Oxford Nanopore Technologies PLC | Method of encoding data on a polynucleotide strand |
| WO2020128517A1 (en) | 2018-12-21 | 2020-06-25 | Oxford Nanopore Technologies Limited | Method of encoding data on a polynucleotide strand |
| WO2020234612A1 (en) | 2019-05-22 | 2020-11-26 | Oxford Nanopore Technologies Limited | Method |
| GB201907246D0 (en) | 2019-05-22 | 2019-07-03 | Oxford Nanopore Tech Ltd | Method |
| GB201907244D0 (en) | 2019-05-22 | 2019-07-03 | Oxford Nanopore Tech Ltd | Method |
| WO2020234595A1 (en) | 2019-05-22 | 2020-11-26 | Oxford Nanopore Technologies Limited | Sensing interactions between molecular entities and nanopores |
| WO2021099801A1 (en) | 2019-11-22 | 2021-05-27 | Oxford Nanopore Technologies Limited | Method for double strand sequencing |
| GB201917060D0 (en) | 2019-11-22 | 2020-01-08 | Oxford Nanopore Tech Ltd | Method |
| WO2021111125A1 (en) | 2019-12-02 | 2021-06-10 | Oxford Nanopore Technologies Limited | Method of characterising a target polypeptide using a nanopore |
| EP4671766A2 (en) | 2019-12-02 | 2025-12-31 | Oxford Nanopore Technologies PLC | METHOD FOR CHARACTERIZING A TARGET POLYPEPTIDE USING A NANOPORE |
| EP4270008A2 (en) | 2019-12-02 | 2023-11-01 | Oxford Nanopore Technologies PLC | Method of characterising a target polypeptide using a nanopore |
| WO2021111139A1 (en) | 2019-12-04 | 2021-06-10 | Oxford Nanopore Technologies Limited | Method |
| WO2021133168A1 (en) | 2019-12-24 | 2021-07-01 | Technische Universiteit Delft | Protein and peptide fingerprinting and sequencing by nanopore translocation of peptide-oligonucleotide complexes |
| EP4325223A3 (en) * | 2019-12-24 | 2024-05-22 | Technische Universiteit Delft | Protein and peptide fingerprinting and sequencing by nanopore translocation of peptide-oligonucleotide complexes |
| NL2024579B1 (en) * | 2019-12-24 | 2021-09-06 | Univ Delft Tech | Protein and peptide fingerprinting and sequencing by nanopore translocation of peptide-oligonucleotide complexes |
| EP4325223A2 (en) | 2019-12-24 | 2024-02-21 | Technische Universiteit Delft | Protein and peptide fingerprinting and sequencing by nanopore translocation of peptide-oligonucleotide complexes |
| WO2021198695A1 (en) | 2020-04-03 | 2021-10-07 | King's College London | Method of detecting an analyte in a medium comprising a light scattering constituent |
| GB202004944D0 (en) | 2020-04-03 | 2020-05-20 | King S College London | Method |
| WO2021255477A1 (en) | 2020-06-18 | 2021-12-23 | Oxford Nanopore Technologies Limited | Method of repeatedly moving a double-stranded polynucleotide through a nanopore |
| WO2021255475A1 (en) | 2020-06-18 | 2021-12-23 | Oxford Nanopore Technologies Limited | A method of selectively characterising a polynucleotide using a detector |
| WO2021255476A2 (en) | 2020-06-18 | 2021-12-23 | Oxford Nanopore Technologies Limited | Method |
| US12411125B2 (en) | 2020-07-17 | 2025-09-09 | Oxford Nanopore Technologies Plc | Nanopore sensing device |
| US12535457B2 (en) | 2020-07-22 | 2026-01-27 | Oxford Nanopore Technologies Plc | Solid state nanopore formation |
| WO2022020461A1 (en) | 2020-07-22 | 2022-01-27 | Oxford Nanopore Technologies Inc. | Solid state nanopore formation |
| WO2022069022A1 (en) | 2020-09-29 | 2022-04-07 | Ecole Polytechnique Federale De Lausanne (Epfl) | Systems and methods for digital information decoding and data storage in hybrid macromolecules |
| WO2022243691A1 (en) | 2021-05-19 | 2022-11-24 | Oxford Nanopore Technologies Plc | Multiplex methods of detecting molecules using nanopores |
| GB202107192D0 (en) | 2021-05-19 | 2021-06-30 | Oxford Nanopore Tech Ltd | Method |
| GB202107354D0 (en) | 2021-05-24 | 2021-07-07 | Oxford Nanopore Tech Ltd | Method |
| WO2023026039A1 (en) | 2021-08-23 | 2023-03-02 | Cambridge Enterprise Limited | Nucleic acid detection |
| GB2610380A (en) | 2021-08-23 | 2023-03-08 | Cambridge Entpr Ltd | Nucleic acid detection |
| CN113735948B (zh) * | 2021-09-28 | 2024-02-02 | 成都齐碳科技有限公司 | 孔蛋白单体的突变体、蛋白孔及其应用 |
| CN113735948A (zh) * | 2021-09-28 | 2021-12-03 | 成都齐碳科技有限公司 | 孔蛋白单体的突变体、蛋白孔及其应用 |
| GB202113935D0 (en) | 2021-09-29 | 2021-11-10 | Cambridge Entpr Ltd | Nucleic acid characterisation |
| WO2023052769A1 (en) | 2021-09-29 | 2023-04-06 | Cambridge Enterprise Limited | Nucleic acid characterisation |
| WO2023094806A1 (en) | 2021-11-29 | 2023-06-01 | Oxford Nanopore Technologies Plc | Nanopore measurement signal analysis |
| WO2023118891A1 (en) | 2021-12-23 | 2023-06-29 | Oxford Nanopore Technologies Plc | Method of characterising polypeptides using a nanopore |
| WO2023118892A1 (en) | 2021-12-23 | 2023-06-29 | Oxford Nanopore Technologies Plc | Method |
| WO2023222657A1 (en) | 2022-05-17 | 2023-11-23 | Oxford Nanopore Technologies Plc | Method and adaptors |
| WO2023222994A1 (en) | 2022-05-18 | 2023-11-23 | Oxford Nanopore Technologies Plc | Calibration of a nanopore array device |
| WO2024084211A1 (en) | 2022-10-19 | 2024-04-25 | Oxford Nanopore Technologies Plc | Analysis of a polymer |
| WO2024089270A3 (en) * | 2022-10-28 | 2024-07-18 | Oxford Nanopore Technologies Plc | Pore monomers and pores |
| WO2024094986A1 (en) | 2022-10-31 | 2024-05-10 | Oxford Nanopore Technologies Plc | Method |
| WO2024094966A1 (en) | 2022-11-01 | 2024-05-10 | Oxford Nanopore Technologies Plc | Biochemical analysis system and method of controlling a biochemical analysis system |
| WO2024100270A1 (en) | 2022-11-11 | 2024-05-16 | Oxford Nanopore Technologies Plc | Novel pore monomers and pores |
| WO2024156993A1 (en) | 2023-01-25 | 2024-08-02 | Oxford Nanopore Technologies Plc | Calibration of a nanopore array device |
| WO2024200280A1 (en) | 2023-03-24 | 2024-10-03 | Oxford Nanopore Technologies Plc | Method and kits |
| WO2024235919A1 (en) | 2023-05-12 | 2024-11-21 | Oxford Nanopore Technologies Plc | Modified helicases |
| WO2024236325A1 (en) | 2023-05-18 | 2024-11-21 | Oxford Nanopore Technologies Plc | Method and products for characterizing a polynucleotide using a nanopore |
| GB202307486D0 (en) | 2023-05-18 | 2023-07-05 | Oxford Nanopore Tech Plc | Method |
| WO2025099094A1 (en) | 2023-11-06 | 2025-05-15 | Oxford Nanopore Technologies Plc | Method |
| GB202401864D0 (en) | 2024-02-12 | 2024-03-27 | Fund Centre De Regulacio Genòmica | A method of detecting non-canonical bases in sequencing data |
| WO2025238371A1 (en) | 2024-05-17 | 2025-11-20 | Oxford Nanopore Technologies Plc | Polymer analysis using transformer neural network |
| GB202407228D0 (en) | 2024-05-21 | 2024-07-03 | Oxford Nanopore Tech Plc | Method |
| WO2026052817A1 (en) | 2024-09-06 | 2026-03-12 | Oxford Nanopore Technologies Plc | Method |
| WO2026052811A2 (en) | 2024-09-06 | 2026-03-12 | Oxford Nanopore Technologies Plc | Method |
| WO2026058009A1 (en) | 2024-09-16 | 2026-03-19 | Oxford Nanopore Technologies Plc | Augmented consensus and variant calling |
| WO2026062385A1 (en) | 2024-09-18 | 2026-03-26 | Oxford Nanopore Technologies Plc | Preprocessing nanopore signals |
| WO2026073826A1 (en) | 2024-09-27 | 2026-04-09 | Oxford Nanopore Technologies Plc | Oligonucleotide compositions for identifying and characterising drug-resistant |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101939420B1 (ko) | 2019-01-16 |
| BR112013020411B1 (pt) | 2021-09-08 |
| JP6169976B2 (ja) | 2017-07-26 |
| WO2012107778A3 (en) | 2012-11-29 |
| BR112013020411A2 (pt) | 2017-06-06 |
| CN103460040A (zh) | 2013-12-18 |
| EP2673638A2 (en) | 2013-12-18 |
| AU2012215135B9 (en) | 2017-03-09 |
| CN103460040B (zh) | 2016-08-17 |
| AU2012215135B2 (en) | 2017-02-02 |
| US20140186823A1 (en) | 2014-07-03 |
| US9751915B2 (en) | 2017-09-05 |
| CA2826374A1 (en) | 2012-08-16 |
| CA2826374C (en) | 2024-01-23 |
| EP2673638B1 (en) | 2019-10-30 |
| JP2017148052A (ja) | 2017-08-31 |
| KR20140049511A (ko) | 2014-04-25 |
| JP2014506575A (ja) | 2014-03-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2012107778A2 (en) | Mutant pores | |
| AU2012215135A1 (en) | Mutant pores | |
| US11186857B2 (en) | Polynucleotide modification methods | |
| US20250313889A1 (en) | Sample preparation method | |
| EP2614156B1 (en) | Control of dna movement in a nanopore at one nucleotide precision by a processive enzyme | |
| US10167503B2 (en) | Mutant pores | |
| US10472673B2 (en) | Hetero-pores | |
| EP2964779B1 (en) | Use of spacer elements in a nucleic acid to control movement of a helicase | |
| EP2895618B1 (en) | Sample preparation method | |
| EP3204511B1 (en) | Mutant pores | |
| AU2009269792A2 (en) | Base-detecting pore | |
| WO2013153359A1 (en) | Mutant lysenin pores | |
| WO2013019759A1 (en) | Enzymatic preparation of 10 base to 50 kb double-strand dna reagent for sequencing with a nanopore-polymerase sequencing device |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12703872 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2826374 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2012215135 Country of ref document: AU Date of ref document: 20120210 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2013553029 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012703872 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 20137023664 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13984628 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112013020411 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112013020411 Country of ref document: BR Kind code of ref document: A2 Effective date: 20130809 |