WO2012096436A2 - 과산소 노출에 의한 폐손상 모델 동물, 및 taz 마커를 이용한 과산소 노출에 의한 폐손상 진단용 키트 - Google Patents
과산소 노출에 의한 폐손상 모델 동물, 및 taz 마커를 이용한 과산소 노출에 의한 폐손상 진단용 키트 Download PDFInfo
- Publication number
- WO2012096436A2 WO2012096436A2 PCT/KR2011/008808 KR2011008808W WO2012096436A2 WO 2012096436 A2 WO2012096436 A2 WO 2012096436A2 KR 2011008808 W KR2011008808 W KR 2011008808W WO 2012096436 A2 WO2012096436 A2 WO 2012096436A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- taz
- exposure
- peroxygen
- mice
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5082—Supracellular entities, e.g. tissue, organisms
- G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0276—Knock-out vertebrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/15—Medicinal preparations ; Physical properties thereof, e.g. dissolubility
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/35—Animals modified by environmental factors, e.g. temperature, O2
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
Definitions
- Model of lung injury caused by peroxygen exposure kit for diagnosing lung injury caused by peroxygen exposure using TAZ marker
- the present invention relates to a lung injury model animal by peroxygen exposure, and a kit for diagnosing lung injury by over-oxygen exposure using a TAZ marker.
- Transcr ipt ional coact ivator with PDZ binding mot if known as WW-domain containing transcription regulator 1, interacts with 14-3—3 and PDZ domain proteins.
- TAZ protein is responsible for increasing the production of bone cells, CbfaKcore-binding f act or-l) / Runx2 (runt-related transcription factor ⁇ 2), TTF-1 (thyroid transcript ion factor ⁇ ) It is also known to function as a regulator of various transcription factors such as connective tissue growth factor (Ctgf) and smad2 / 3 3 ⁇ 4 Pax3 (paired box gene-3).
- TAZ The C terminus of TAZ performs a variety of interactions through the core transcriptional machinery for regulating gene expression.
- TAZ is located in the cell membrane, indicating that TAZ is involved in signaling from the cell membrane and the actin cytoskeleton to nucleus- 0 (Hong, J. et al., Cell cycle (Georgetown, Tex.) 5 (2): 176, 2006).
- TAZ has been reported to be associated with smad nuclear-cytoplasmic shuttling.
- TAZ deficiency of the TAZ gene in mice is known to induce abnormal morphology and pathological symptoms of various body organs. Cortical symptoms of ary ult i cystic formation were observed in the kidneys of TAZ knockout mice, and symptoms similar to those of human polycystic kidney disease were induced (Makita, R. et al., American Journal of Physiology- Renal Physiology: 00201.02007, 2008). In addition, in previous studies, TAZ deficiency caused malformations of lung development, Reported a phenotype similar to human emphysema. However, few studies have confirmed the association between organ damage caused by free radicals and TAZ.
- Pulmonary fibrosis refers to the development or formation of excessive fibrous connective tissue in the lungs, indicating damage to the lungs. These pulmonary fibrosis shows typical symptoms such as difficulty breathing, fatigue, weakness, chest pain, loss of appetite, and weight loss (Crouch, E, American Journal of Physiology- Lung Cellular and Molecular Physiology 259 (4): L159, 1990). Pulmonary fibrosis is caused by a variety of causes, such as GF- ⁇ signaling, silica exposure, continued cascade after cytokine irradiation, smoking, anticancer injections, and excessive oxygen exposure.
- pulmonary fibrosis is found to be a secondary effect of other diseases, most of the pulmonary fibrosis is classified as interstitial lung disease, such as viral infections, other minor wounds, autoimmune diseases.
- interstitial lung disease such as viral infections, other minor wounds, autoimmune diseases.
- idiopathic pulmonary fibrosis invented without knowing the cause.
- the oxidative stress is the most important cause in the lungs of the lungs (Thet, L. et al., Experimental lung- research 11 (3): 209-228, 1986; Oreffo, V. et al., Hvironmenta J Hea Jth Perspectives 85: 51, 1990).
- Model animals for pulmonary fibrosis due to peroxygen exposure are useful for identifying the pathogenesis of lung injury caused by oxidative stress under high oxygen conditions, and finding and efficacy of drugs to treat them. Will be. Accordingly, the present inventors prepared a transgenic model mouse lacking the TAZ gene, and the lung of the mouse was first confirmed that the symptoms are similar to the symptoms of peroxygen-induced pulmonary fibrosis. By examining the relationship between the oxidative stress mechanism, the TAZ mouse can be usefully used as a model of pulmonary fibrosis due to peroxygen exposure, and can be usefully used for screening therapeutic candidates. The present invention has been completed by revealing that the expression level can be usefully used for diagnosing and diagnosing pulmonary fibrosis due to peroxygen exposure.
- An object of the present invention is to provide a kit for diagnosing lung injury due to hyperoxygen exposure model animal using peroxygen exposure, and peroxygen exposure using TAZ marker.
- the present invention provides a mouse model of lung injury by peroxygen exposure, in which the TAZCtranscriptional coactivator with PDZ-binding motif gene is knocked out (TAZ).
- the present invention provides a method for producing a mouse knocked out of the TAZ gene.
- the present invention provides a method of screening a candidate drug for treating lung damage by over-oxygen exposure using the lung injury model mouse by exposure to peroxygen.
- the present invention provides a kit for diagnosing lung injury by peroxygen exposure comprising an antibody that specifically binds to a TAZ protein, or a primer or probe that specifically binds to a nucleic acid encoding the TAZ protein.
- the present invention also provides a protein detection method for providing information for diagnosing lung injury due to peroxygen exposure.
- the present invention is intended for use as a model of lung injury by exposure to peroxygen
- mice in which a transcriptional coactivator with PDZ-binding motif (TAZ) gene is knocked out (TAZ).
- TEZ transcriptional coactivator with PDZ-binding motif
- the present invention provides an antibody that specifically binds to a TAZ protein or a primer or probe that specifically binds to a nucleic acid encoding the TAZ protein for use as a kit for diagnosing lung injury due to peroxygen exposure.
- the present invention will be described in detail.
- the present invention provides a mouse lung injury model according to the TAZ (transcriptional coactivator with PDZ-binding motif) dielectric self-knockout (TA2 /), and oxygen exposure.
- the present invention provides a mouse in which a transcriptional coactivator with PDZ-binding motif (TAZ) gene is melted (TAZ ' ) for use as a model of lung injury caused by peroxygen exposure.
- TAZ transcriptional coactivator with PDZ-binding motif
- the TAZ gene is preferably described by the nucleic acid sequence of SEQ ID NO: 1, but is not limited thereto.
- Pulmonary injury caused by peroxygen exposure is preferably one selected from the group consisting of pulmonary fibrosis, bronchopulmonary dysplasia and chronic obstructive pulmonary disease, but is not limited thereto. And all lung damage caused by oxidative stress from peroxygen exposure.
- the present invention also provides a method for producing the lung injury model mouse.
- the preparation method preferably includes, but is not limited to the following steps:
- step 2) injecting embryonic stem cells of step 2) into the blastocyst of the blastocyst to obtain a chimeric mouse;
- step 5) cross-crossing the heterozygous mice of step 4) to obtain homozygous mice having the TA2 genotype.
- the TAZ gene is preferably described by the nucleic acid sequence of SEQ ID NO: 1, but is not limited thereto.
- mice knocked out of the TAZ gene are all homozygous chromosomal defects of the TAZ gene, and are homozygotes (homozygotes) having a genotype of TAZ _ / —, which are normally born but are induced by peroxygen exposure. It is characterized by lung damage.
- the TAZ gene knockout cassette of step 1) preferably has a cleavage map shown in B of FIG. 1, but is not limited thereto.
- Embryonic stem cells of mice using electroporation, microinjection, or calcium phosphate treatment to transfect the TAZ gene knockout cassette prepared in step 1) into embryonic stem cells Can be introduced.
- an embryonic stem cell clone may be injected into the blastocyst of a donor mouse and later transferred to the uterus.
- a heterozygote having germline transfer may be derived from the chimeric mouse and cross-crossed to prepare a TAZ molten cloth (TAZ) mouse which is a homozygote.
- TAZ molten cloth
- a TAZ gene deletion vector is prepared by including a TAZ gene knockout cassette (see FIG. 1) in which a part of the TAZ gene is substituted with a neo gene (see FIG. 1). It was.
- the vector deletes the TAZ gene present in embryonic stem cells and injects the embryonic stem cells whose gene deletion is confirmed into the blastocyst of the normally occurring blastocyst, thereby injecting chimera mice.
- the produced chimeric mice were born with F1 mice derived from embryonic stem cells through backcrossing with normal mice, and the TAZ gene was melted by crossover between heterozygotes (TAZ + / ⁇ ) mice lacking one gene. Homozygous TAZ) mice were prepared.
- the present inventors confirmed the lung tissue of the TA / _ mouse prepared in the present invention, it was confirmed that severe pulmonary fibrosis is induced by the oxidative stress caused by hyperoxic exposure, the symptoms appear to worsen with age (See FIG. 2), it was confirmed that pulmonary fibrosis was intensified by aging.
- Surfactant proteins SP
- Clara cell secretory protein CCSP
- several growth factor proteins which are well known to reduce lung injury after peroxygen exposure
- expression of cytokine genes with increased expression during inflammation in the lungs of mice.
- SP-C Surfactant proteins
- VEGF vascular endothelial growth factor
- CCAP CCAP gene expression levels were normal. It was found to be markedly decreased compared to that of inflammatory cytokines (see FIG. 3).
- pulmonary fibrosis similar to pulmonary tissue of ⁇ ⁇ '-mice was induced in normal mice exposed to peroxygen, and the expression levels of SP-C, VEGF, FGF-2 and CCAP genes were also reduced. (See Fig. 4), it was confirmed that the expression level of the ⁇ gene and protein is significantly reduced compared to the control group not exposed to the peroxygen (see Fig. 5). In addition, pulmonary fibrosis was most significantly induced when the mice were exposed to hyperoxia (see FIG. 6). In conclusion, the results showed that there was a similar relationship between lung injury induced by peroxygen exposure and lung injury caused by ⁇ deficiency.
- the present inventors confirmed the cell viability and cell proliferation of epithelial cells against peroxidation exposure through in vitro experiments.
- TAZ protein expression was decreased in adenocarcinoma human alveolar basal epithelial cells (A549).
- cell viability and cell proliferation were also significantly decreased compared to the control (see FIG. 7).
- A549 cells knocked down by the TAZ gene showed no significant change in cell proliferation, which was knocked down rather than knocked out of TAZ, resulting in low levels of TAZ protein. Because it is expressed.
- TAZ _ / When mouse embryonic fibroblasts (MEFs) derived from mice are exposed to normal conditions, normal Cell proliferation was shown to be reduced than in MEFs from group mice (see FIG. 8).
- the inventors have found that sulfonylated peroxiredoxin (Prx) increases due to peroxygen exposure, and is dependent on Nuclear factor erythroid 2-related factor 2 (Nrf2). Sulfiradoxin
- TAZ functions in regulating the expression of signal molecules related to oxidative stress in a normal state, and regulates lung homeostasis, and is induced by peroxygen by deficiency of these TAZ genes. It was confirmed that it causes a phenotype similar to lung injury.
- TAZ- / _ mice can be usefully used as a model mouse for the study of lung damage mechanisms and therapeutic agents by exposure to peroxygen, and can be useful for the production of such model mice.
- the present invention can be usefully used as a model mouse for the study of lung damage mechanisms and therapeutic agents by exposure to peroxygen, and can be useful for the production of such model mice.
- the present invention provides a method for screening a candidate drug for treating pulmonary injury by peroxygen exposure, comprising the step of selecting a test compound or composition in which the symptoms of lung injury due to peroxygen exposure are reduced in the experimental group compared to the control group.
- the lung injury caused by the exposure to peroxygen is pulmonary fibrosis
- fibrosis fibrosis
- bronchopulmonary dysplasia bronchopulmonary dysplasia
- chronic obstructive pulmonary disease is preferably any one selected from the group consisting of, but not limited to.
- test compound or composition of step 1) may be a natural compound, a synthetic compound, RNA, DNA, polypeptide, enzymes, proteins, ligands, antibodies, antigens, metabolites of bacteria or fungi and bioactive molecules.
- the method of administering step 1) may be performed by oral or parenteral administration, and any one injection selected from the group consisting of intradermal injection, subcutaneous injection, intravenous injection, intraperitoneal injection, and intramuscular injection during parenteral administration administration; Rectal administration; Topical application; Concubine; And iontophoresis (Iontophoresis) can be carried out by any one method selected from the group consisting of.
- Pulmonary injury symptom due to the peroxygen exposure of step 2) can be used histopathological method, ELISA, flow cytometry or polymerase chain reaction method, surfactant protein-surfactant protein-A), SP- B, SP-C, SP-D, Clara cell secretory protein (CCSP), ⁇ -catenin, VEGF, FGF-2, HNF3, F0XA2, HIF2-a, IL-6, TNF-a, MCP -1, cell proliferation, cell survival, at least one selected from the group consisting of sulfidoredxin (sulfiredoxin (Srx) and peroxyredoxin sulfinylation is preferably measured, but lung damage caused by peroxygen exposure is measured Any indicator that can be measured is measurable.
- sulfidoredxin sulfiredoxin (Srx) and peroxyredoxin sulfinylation
- test compound or composition obtained through the screening method and exhibiting inhibitory activity on lung injury due to peroxygen exposure may be a candidate drug for treating lung injury due to peroxygen exposure.
- candidates will act as a leader in the development of pulmonary damage treatments such as pulmonary fibrosis due to subsequent exposure to peroxygen, and the structure will be modified to show the effect of inhibiting lung damage from peroxygen exposure.
- Lung fibrosis symptoms induced in lung tissues of TAZ _ / mice of the present invention were found to be very similar to pulmonary fibrosis caused by peroxygen exposure, and the expression of pulmonary injury following peroxygen exposure is known to change. Expression of epithelial development related genes, growth factors and inflammatory cytokines also changed. This is similar to the tendency in normal mouse lungs where lung damage was induced by peroxygen exposure, so a deficiency of TAZ was associated with Influences on oxidative stress-related signals such as bovine exposure effects.
- TAZ acts on a signal pathway that increases oxidative stress associated with Prx peroxidation and inhibits signal molecules, it has been found that TAZ has a function of controlling homeostasis of lungs.
- the present invention provides a kit for diagnosing lung damage by peroxygen exposure comprising an antibody that specifically binds to a TAZ protein, or a primer or probe that specifically binds to a nucleic acid encoding the TAZ protein.
- the present invention also provides an antibody that specifically binds to a TAZ protein, or a primer or probe that specifically binds to a nucleic acid encoding the TAZ protein for use as a kit for diagnosing lung injury due to peroxygen exposure.
- the TAZ protein preferably has an amino acid sequence set forth in SEQ ID NO: 2, but is not limited thereto.
- Antibodies that specifically bind to the TAZ protein may be prepared by injecting the TAZ protein or purchased commercially, and the antibody may bind to polyclonal antibodies, monoclonal antibodies, and epitopes. May contain fragments, etc.
- the polyclonal antibody can be produced by a conventional method of injecting the TAZ protein into an animal and collecting blood from the animal to obtain serum containing the antibody.
- These polyclonal antibodies can be purified by any method known in the art and can be obtained from any animal species host such as goat, rabbit, rat, rat, chicken, sheep, monkey, horse, pig, cow, dog, etc. It may be made, but is preferably a rabbit as a host, but is not limited thereto.
- the monoclonal antibodies can be prepared using any technique that provides for the production of antibody molecules through the culture of continuous cell lines. Such techniques include, but are not limited to, hybridoma technology, human and rat B-cell hybridoma technology, and EBV-hybridoma technology (Kohler G et al., Nature 256: 495-497). , 1975; Kozbor D et al., J Immunol Methods 81: 31-42, 1985; Cote RJ et al., Proc Natl Acad Sci 80: 2026—2030, 1983; and Cole SP et al., Mo I Cell Biol 62 : 109-120, 1984).
- antibody fragments containing specific binding sites for the TAZ protein can be prepared.
- F (ab ') 2 fragments are antibody molecules It can be prepared by digesting with pepsin, and Fab fragments can be prepared by reducing the disulfide bridges of F (ab ') 2 fragments.
- the Fab expression library can be made small to quickly and easily identify monoclonal Fab fragments with the desired specificity (Huse WD et al., Science 254: 1275-1281, 1989).
- the antibody can be bound to a solid substrate to facilitate steps after washing or separation of the complex.
- Solid substrates include, for example, synthetic resins, nitrocells, glass substrates, metal substrates, glass fibers, microspheres and microbeads.
- synthetic resins include polyester, polyvinyl chloride, polystyrene, polypropylene, PVDF, nylon and the like.
- the kit can diagnose lung cancer by quantitatively or qualitatively analyzing binding reactions through antigen-antibody binding reactions or protein-ligand binding reactions, and the binding reactions are conventional enzyme-linked immunoassays (ELISA), radioactivity.
- Immunoassay radioi ⁇ unoassay, RIA
- sandwich assay western blot, immunoprecipitation, immunohistochemical staining, fluorescence immunoassay, enzyme substrate coloration, antigen-antibody assay, etc. Can be measured.
- reagents required for PCR amplification such as a supernatant, a DNA polymerase (eg, Thermus aquat icus) (Taq), Thermus thermophi lus (Tth), Thermusf i liformis, Therm is flavus, Thermococcus literal is or thermally stable DNA polymerase obtained from Pyrococcus fur iosus (Pfu), DNA polymerase cofactors and dNTPs.
- the kit of the present invention may be manufactured in a number of separate packaging or compartments containing the reagent components described above.
- Probes of the kits are preferably designed to specifically bind to TAZ nucleic acid sequences under stringent shaking conditions, and are characterized by successive 15-25 nucleic acid length sense and / or antisense oligonucleotides, preferably 15-30 nucleic acid lengths. All of the sense and / or antisense oligonucleotides in length, more preferably 18 to 25 nucleic acids in length, can be used.
- the cleaning conditions that can maintain a specific shaking state are usually ⁇ IX SSC ⁇ 0.1% SDS, 37 ° CJ positive ⁇ conditions, more strictly r 0.5x SSC, 0.1% SDS, 42 ° CJ conditions, even more Moth Fiercely, conditions of ⁇ 0 ⁇ 1 ⁇ SSC, 0.1% SDS, about 65 ° CJ are mentioned.
- the probe can also be used by immobilization on any solid substrate.
- the solid substrate includes a gene chip cDNA microarray, an oligo DNA array, a membrane filter, and the like.
- the primer of the kit is preferably a primer pair consisting of a sense primer described in SEQ ID NO: 4 and an antisense primer described in SEQ ID NO: 5, but may have a length of 15 to 50 nucleic acids capable of amplifying the nucleic acid sequence described in SEQ ID NO: 1.
- both sense and antisense oligonucleotides of 15 to 30 nucleic acids in length, more preferably 18 to 25 nucleic acids in length are available:
- the kit may further include a deoxynucleotide mixture (dNTP mixture) and a complete solution as a component of the PCR reaction, and may further include a thermostable DNA polymerase such as Taq DNA polymerase.
- the kit of the present invention may further include a fluorescent material such as 6-FAM, NED or HEX, agarose and electrophoretic complete layer solution required to confirm the PCR result.
- the kit of the present invention may be provided in the form of a premix with the amplification reaction element and the primer.
- the kit may further comprise normal lung cells.
- the clinical sample to be analyzed of the kit of the present invention may be a biopsy sample or a blood sample
- the biopsy sample may be lung tissue collected from the subject during surgical operation in the case of lung injury diagnosis due to the exposure to hyperoxia
- Diagnosis of lung injury by exposure to oxygen may be tissue collected from the lungs of the individual in whom the lung injury is suspected.
- Lung fibrosis symptoms induced in lung tissue of TAZ— ⁇ mice of the present invention were found to be very similar to pulmonary fibrosis caused by peroxygen exposure, and the expression of pulmonary injury following peroxygen exposure is known to change.
- the expression of epithelial development related genes, growth factors and inflammatory cytokines also changed, similar to the trend in normal mouse lungs, where lung damage was induced by peroxygen exposure.
- TAZ acts on a signal pathway that increases oxidative stress and inhibits signal molecules, it has been confirmed that TAZ gene or protein has a function of controlling homeostasis of the lung. It can be usefully used in kits.
- the present invention provides a protein detection method for providing information of the diagnosis of lung damage due to peroxygen exposure.
- the detection method preferably includes the following steps, but is not limited thereto. Is:
- step 2) Comparing the TAZ expression level of the experimental group and the control group of step 1) to determine if there is a possibility of lung damage due to the exposure to oxygen peroxide when the TAZ expression level of the experimental group is reduced compared to the control group.
- the lung injury due to the exposure to peroxygen is preferably any one selected from the group consisting of pulmonary fibrosis, bronchopulmonary dysplasia and chronic obstructive pulmonary disease. It is not limited to this.
- the expression level of the TAZ gene in step 1) is RT-PCR, real-time RT-PCR, microarray, Northern blotting, continuous analysis of gene expression (SAGE, serial analysis of Gene expression) or RNase protection assay (RNase protection assay), the expression level of the TAZ protein is Western blotting, enzyme-linked immunosorbent assay (ELISA), immune tissue It can be measured by chemical staining (immunohistochemical staining), immunoprecipitation (immunoprecipitation) or immunofluorescence (immunofluorescence), but is not limited thereto.
- Subjects to which the present invention is applicable are vertebrates, including humans, preferably sacs, more preferably humans or laboratory animals such as rats, rabbits, guinea pigs, hamsters, dogs, cats, and most preferably It is a human or ape-like animal such as a chimpanzee or a gorilla.
- the clinical sample may be a biopsy sample or a blood sample, tissue, cells, whole blood, serum, plasma, saliva, cerebrospinal fluid or urine, the biopsy sample from the lung of the subject suspected of pulmonary injury due to exposure to oxygen It may be an organized tissue.
- Lung fibrosis symptoms induced in lung tissue of TAZ ⁇ / _ mice of the present invention were found to be very similar to pulmonary fibrosis caused by peroxygen exposure, and the expression of lung injury following peroxal exposure changes.
- the expression of known epithelial development related genes, growth factors and inflammatory cytokines also changed, which was similar to the tendency in normal mouse lungs where lung damage was induced by peroxygen exposure.
- TAZ acts on a signal pathway that increases oxidative stress, inhibiting signal molecules, Since it has been found to have a homeostatic regulation function, the TAZ gene or protein can be usefully used for diagnosing lung damage due to peroxygen exposure and for predicting prognosis.
- transgenic mice prepared by melting the TAZ gene of the present invention induce lung injury similar to pulmonary oxidosis induced by peroxygen exposure and lung induced in the TAZ z mouse. Since the damage is related to the mechanism of lung damage caused by free radicals, the transgenic mice can be used as a model animal for lung injury caused by peroxygen exposure, and can be used to screen for new therapeutic candidates, as well as to peroxylate exposure of TAZ. It can also be used effectively to reveal the physiological function as a suppressor gene (suppressor) by, and can be used as a marker for diagnosing or prognostic lung damage due to peroxygen exposure through the expression level of the TAZ.
- suppressor suppressor
- FIG. 1 shows the TAZ gene (A). And a cleavage map of the TAZ gene melting cassette (B) for producing TAZ mice.
- A lung tissue of normal group (WT) and TAZ z mice;
- FIG. D Normal and ⁇ '— mouse lung tissue analysis via H & E staining.
- Figure 3 shows the expression of various envelope surfactant proteins and inflammatory cytokine genes in normal and ⁇ _ / — mouse lungs:
- SP-A epithelial cell development related genes
- VEGF vascular endothelial growth factor
- FGF2 vascular endothelial growth factor
- beta-catenin vascular endothelial growth factor
- C expression of inflammatory cytokines (IL-6, TNFa and MCP-1).
- Figure 4 is a diagram showing the histological analysis (A) and gene expression changes (B) of the normal group mice induced pulmonary fibrosis due to peroxygen exposure.
- 5 is a diagram showing the change in expression of TAZ by peroxygen exposure:
- TAZ protein expression of TAZ protein
- FIG. 6 shows normal mice, TAZ mice and normal or TAZ exposed to peroxia
- FIG. 1 Figures show the expression levels of enveloped surfactant proteins (A and B) and inflammatory cytokines (C and D) genes in mouse lungs:
- Figure 7 is a diagram showing the shape (A) and cell number measurement (B) of A549 cells exposed to peroxygen.
- 8 is a graph showing cell proliferation of normal or TAZ + cells exposed to peroxygen:
- MEFs of normal group mice (MEFs WT) and MEFs of TAZ mice (MEFs 1KL 1 ′ ) at steady state.
- 9 is a diagram showing the expression of sulfidodoxin (Srx) and Prx sulfinylation (sulfinylation) in the TAZ— ⁇ mouse lung.
- Nrf2 and Srx proteins Expression of Nrf2 and Srx proteins in mouse or normal mouse lungs.
- a TAZ gene-deficient vector comprising the TAZ gene knockout cassette shown in FIG. 1 was prepared and subjected to electroporation to C57BL / 6j (Jackson Laboratory CBar Harbor, ME) mice. Derived embryonic stem cells (ES) were transfected. Southern blot analysis was performed on the DNA of the ES cells to select only embryonic stem cells inserted into the genome of embryonic stem cells, and ES cells confirmed the introduction of the TAZ gene knockout cassette. Clones were microinjected into the blastocoel of the blastocyst obtained from C57BL / 6j female mice and implanted into the surrogate uterus.
- C57BL / 6j Jackson Laboratory CBar Harbor, ME
- ES Derived embryonic stem cells
- tails obtained from 2.5 to 3 week old mice were subjected to 55 ° C. tail lysis buffer (Tris 100 mM, NaCl 200 mM, SDS 0.2%, EDTA 5 mM, and 100 ug / mi proteinase K). After one night, it was centrifuged (12000 rpra, 4 ° C., 10 minutes) to transfer the supernatant to a new tube, and an equal amount of isopropanol was added thereto for DNA precipitation. Then gently mix upside down. The DNA precipitate was transferred to 70% ethanol and mixed, and then the DNA was eluted with TE.
- tail lysis buffer Tris 100 mM, NaCl 200 mM, SDS 0.2%, EDTA 5 mM, and 100 ug / mi proteinase K. After one night, it was centrifuged (12000 rpra, 4 ° C., 10 minutes) to transfer the supernatant to a new tube, and an equal amount of isopropano
- TAZ ⁇ / _ mice PCR was performed using KS-Neo-R: 5'-GGAGAACCTGCGTGCAATCCATC-3 '(SEQ ID NO: 3), TAZ-GP2: 5'- ATGGGACAGTCCGGGAG-3' (SEQ ID NO: 4) , and TAZ -GP3: 5'-GTGCAAGTCAGAGGAGG-3 ' ( SEQ ID No.
- TAZ knockout mice TAZ _ /
- normal mice TAZ knockout mice or normal mice were exposed to isotropic peroxygen for 24 48 or 72 hours in a chamber saturated with 95% 0 2 of sufficient flow rate, and control mice were exposed to indoor air. All animal experiments were conducted in accordance with the guidelines of the Ewha Womens University Water Genome Center and approved by IACUC.
- ABI 7000 amplification using primer pairs for synthesized cDNA and TAZ genes (TAZ F: 5'—GTCACCMCAGTAGCTCAGATC— 3 '(SEQ ID NO: 6) and TAZ-R: 5' ⁇ AGTGATTACAGCCAGGTTAGA G-3 '(SEQ ID NO: 7)
- TAZ F 5'—GTCACCMCAGTAGCTCAGATC— 3 '(SEQ ID NO: 6
- TAZ-R 5' ⁇ AGTGATTACAGCCAGGTTAGA G-3 '(SEQ ID NO: 7
- Real-time PCR was performed through the system (Applide Biosystems) The relative expression level of each mRNA was measured after normalizing the expression level of ⁇ -actin.
- Equal amounts of 30 ug of protein per lane were loaded into 7.5% and 15% SDS-PAGE gels and 3% of the protein was transferred to nitrocel lulose membranes (what man internat ional), 3% Bovine serum albumin (BSA) -TBST (1 M Tris (pH 7.4), 4 M NaCl and 20% twin 20) was blocked at room temperature for 1 hour.
- Antibodies against TAZ protein were used diluted in 1% BSA-TBST and the membrane was left with primary antibody overnight at 4 ° C. The membrane was incubated three times with TBST and then left with secondary antibody (dilution of 1: 10,000 in TBST) at room temperature for 1 hour.
- the protein bands were then developed using ECL solution (1 ⁇ 2 ⁇ 511 Biosciences, Piscat away, NJ).
- Fig. 2C it was shown that the ⁇ protein is expressed in the normal mouse lung, but the expression of TAZ protein was hardly confirmed in the TAZ mouse lung (Fig. 2C).
- TAZ — / _ Mouse Lung Tissue Slide Lungs were separated from the TAZ— z mice and the normal group mice of Example ⁇ 1-1>, respectively, and the lung tissue was removed at 4 ° C. for 18 hours ( Or overnight) in 4% paraformaldehyde solution. Then, the lung tissues were transferred to a cassette, washed with scalp water for 5 hours, dried, replaced with xylene and replaced with paraffin, and the lung tissues were embedded in paramin to prepare 5 slice slides. .
- Example ⁇ 2-1> Liver cultures 20 minutes at 60 ° C. the slide fixed in the lung tissue prepared in Example ⁇ 2-1> Liver cultures.
- the slides were then soaked in xylene three times for 10 minutes each to remove paramin. Thereafter, 5 minutes in 100% ethanol, 5 minutes in 90% ethanol, 5 minutes in 80% ethanol, and 5 minutes in distilled water to perform a rehydration step.
- the dyeing was performed in hematoxylin for 10 minutes, washed in water for 10 minutes, left in 70% ethanol containing hydrogen chloride for several seconds, washed again in water for 5 minutes, and then treated with eosin for 1 minute. .
- Quantitative real-time PCR was performed using AY 7000 amplification system (Applide Biosystems) using SYBR Green PCR Master Mix. At this time, primer pairs for the epithelial surfactant proteins and inflammatory cytokines described in Table 1 were used. [Table 1]
- the marker genes associated with the epithelial structure in the lungs of TAZ mice are shown to have reduced expression compared to the normal group I got it.
- the expression levels of surfactant proteins A, B, C, and D, and clara cell secretory protein were found to be reduced in TAZ / _ mouse lungs compared to normal group lungs ( Figure 3A), and TAZ " / _ Vascular Endothelial Growth Factor (VEGF), Fibroblast Growth Factor-2 (FGF-2), Beta-Catenin ( ⁇ -catenine), Hepatocellular Nuclear Factor 3 in Mouse Lungs (Hepatocyte Nuclear Factor 3, HNF3), Forkhead box A2 (F0XA2), and hypoxia inducible factor 2-a (HIF2-a) were also decreased in the normal group.
- VEGF Vascular Endothelial Growth Factor
- FGF-2 Fibroblast Growth Factor-2
- Beta-Catenin Beta-Catenin
- Hepatocellular Nuclear Factor 3 in Mouse Lungs Hepatocyte Nuclear
- FIG. 3B shows that interleukin-6 (IL-6), an inflammatory cytokine in the lungs of TAZ mice, tumor necrosis factor- ⁇ , TNF- ⁇ 3 ⁇ 4 human monocyte chemotactic protein -Kmonocyte chemoat tract ant protein-1, MCP-1) expression was significantly reduced compared to the normal group (Fig. 3c).
- IL-6 interleukin-6
- Example ⁇ 1-4> the lung tissue of the normal group mice exposed to the peroxygen was subjected to H & E staining of Example ⁇ 3-2> and analyzed histologically.
- FIG. 4A As a result, as shown in FIG. 4A, by exposure to peroxygen for 72 hours, it was confirmed that the normal group of 9-week-old mice showed a phenotype of pulmonary fibrosis (FIG. 4A).
- envelope cell development proteins CCSP and SP-C
- cell development factors in TAZ _ / mouse or normal mouse lungs exposed to peroxygen for 72 hours Gene expression of (FGF-2 and VEGF) was confirmed.
- FGF-2 and VEGF were reduced (FIG. 4B), and the expression levels of CCSP, SP-C, FGF-2 and VEGF in peroxidated TAZ ⁇ mouse lungs were exposed to peroxygen. Significantly lower than in lungs of untreated TAZ / _ mice or normal mice exposed to peroxygen Confirmation (FIG. 6)
- Adenocarcinomic human alveolar basal epithelial cells a549 cells, used for the study of pulmonary epithelial pathogens such as pulmonary fibrosis, were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA). Purchased, RPBI 1640CGIBC0, Invitrogen with 100 U / m ⁇ penicillin, 100 mg / m ⁇ streptomycin and 10% fetal calf serum. Carlsbad, CA, USA).
- T549 knocked down A549 cells (Ti) were constructed by transducing siRNA ligation and nucleotides designed to melt TAZ ⁇ .
- Mouse embryo fibroblasts were constructed by immortalizing primary MEFs isolated from TAZ ⁇ / _ mice or normal group mice (MEFs TKL 1 ′ , MEFs WT), 100 U / m ⁇ phenylsilin, Cultured in DMEM (Dulbeco's modified Eagles medium, GIBC0) with 100 mg / ml straptomycin and 10% fetal calf serum.
- DMEM Dulbeco's modified Eagles medium, GIBC0
- A549 cells were incubated under 95% 0 2 conditions at 37 ° C. in 6 well culture dishes at a concentration of 1.5 ⁇ 10 5 cells. Cells were exposed to peroxygen for 48 hours at 37 ° C. in 53 ⁇ 4 C0 2 and 95% 0 2 environments, and then cell lysates were subjected to western blot using TAZ antibody to confirm TAZ protein expression. At this time, the control group, cells were stored at 37 ° C 5% C0 2 And 95% atmospheric environment.
- Srx and Prx-S0 3 expression level known to be induced in the peroxygen state was shown to increase in the normal group lung lungs exposed to the peroxygen compared to the control group (Fig. 9A ).
- the expression of Srx and Prx-S0 3 genes and proteins was increased in the lungs of TAZ single mice that were not exposed to hyperoxia than in normal mice (C and D in FIG. 9). Expression was also increased in the lungs of TAZ- ⁇ mice than in the normal group (Fig. 9B).
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Environmental Sciences (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- General Physics & Mathematics (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Animal Husbandry (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Plant Pathology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Toxicology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
【요약서】 본 발명은 과산소 노출에 의한 폐손상 모델 동물, 및 TAZ 마커를 이용한 과산소 노출에 의한 폐손상 진단용 키트에 관한 것으로서, TAZ 유전자가 결핍된(TAZ-/-) 마우스는 심각한 폐섬유증 증상이 유도되었고, 이는 과산소 노출된 정상군 마우스 폐에서 유발된 폐섬유증과 유사하였으며, TAZ는 산화적 스트레스 관련 신호 경로에 작용하여 신호분자들을 억제함으로써, 폐의 항상성 조절에 기능하므로, 상기 TAZ-/- 마우스는 과산소 노출에 의한 폐섬유증 모델 마우스로서 유용하게 사용할 수 있을 뿐 아니라, 과산소 노출에 의한 폐섬유증 모델 마우스의 제조, 및 이를 이용한 치료제 후보물질의 스크리닝에 유용하게 이용할 수 있고, TAZ 유전자 또는 단백질의 발현을 확인함으로써 과산소 노출에 의한 폐섬유증 진단 및 진단용 키트에 유용하게 이용할 수 있다.
Description
【명세서】
【발명의 명칭】
과산소 노출에 의한 폐손상 모델 동물, 및 TAZ 마커를 이용한 과산소 노 출에 의한 폐손상 진단용 키트
【기술분야】
본 발명은 과산소 노출에 의한 폐손상 모델 동물, 및 TAZ 마커를 이용한 과 산소 노출에 의한 폐손상 진단용 키트에 관한 것이다.
【배경기술】
전사 조절자 1을 포함하는 WW-도메인 (丽-domain containing transcription regulator 1, Wwtrl)으로 알려진, TAZ(transcr ipt ional coact ivator with PDZ binding mot if)는 14-3—3 및 PDZ 도메인 단백질의 상호작용에 의해 중간엽 줄기세 포에서 전사 조절제로서의 기능을 담당한다 (Kanai, F. et al . , The ΕΜΒΟ Journal, 19(24): 6778-6791, 2000; Hong, J. et al . , Science 309(5737): 1074, 2005) . 특 히, TAZ 단백질은 뼈세포의 생성올 증가시키는 역할을 하고, CbfaKcore-binding f act or-l)/Runx2(runt-r elated transcription factorᅳ 2), TTF-l(thyroid transcript ion factor一 1), Ctgf (connective tissue growth factor) , smad2/3 ¾ Pax3 (paired box gene-3)와 같은 다양한 전사인자의 조절자로서도 기능하는 것으로 알려져 있다.
TAZ의 C 말단은 유전자 발현을 조절하기 위한 코어 전사 기구 (core transcriptional machinery)를 통해 다양한 상호작용을 수행한다. TAZ는 세포막에 위치하며, 이는 TAZ가 세포막 및 액틴 세포골격 (actin cytoskeleton)으로부터 핵 -0 로의 신호전달과 관련되어 있음을 나타낸다 (Hong, J. et al., Cell cycle (Georgetown, Tex.) 5(2): 176, 2006) . 또한, TAZ는 smad 핵-세포질 셔를링 (nucleocytoplasmic shuttling)과 연관되어 있다고 보고되었다.
마우스에서 TAZ유전자의 결핍은 다양한 신체 기관의 비정상적인 형태 및 병 리적 증상을 유도하는 것으로 알려지고 있다. TAZ 녹아웃 마우스의 신장에서는 피 층 수질 다낭 형성 (corticomeduᅵᅵ ary ult i cystic formation)이 나타났고, 인간 다 낭성신질환 (polycystic kidney disease)과 다소 유사한 증상이 유도되었다 (Makita, R. et al . , American Journal of Physiology- Renal Physiology: 00201.02007, 2008) . 또한, 이전 연구에서는 TAZ 결핍이 폐 발생의 기형을 유발하고, 성체에서
는 인간 폐기종 (emphysema)과 유사한 표현형이 나타났음을 보고하였다. 그러나ᅳ 아직까지 활성산소에 의한 기관의 손상과 TAZ와의 관련성올 확인한 연구는 거의 없 을 뿐만 아니라, 산소에 직접적으로 노출되어 산소의 영향을 많이 받는 호흡기관인 폐의 산화적 스트레스로 인한 손상에 대한 TAZ의 연관성은 보고된 바 없다. 폐섬유증 (pulmonary fibrosis)은 폐에서의 과도한 섬유상 연결조직 발달 또 는 형성을 말하는 것으로서, 폐의 손상을 의미한다. 이러한 폐섬유증은 호흡곤란, 피로, 쇠약함, 가슴 통증, 식욕감퇴, 체중감소와 같은 전형적인 증상을 나타낸다 (Crouch, E, American Journal of Physiology- Lung Cellular and Molecular Physiology 259(4): L159, 1990) . 폐섬유증은 GF-β 신호, 실리카에 대한 노출 , 사이토카인 조사 후의 계속되는 케스케이드, 흡연, 항암제 주사 및 과도한 산소 노 출과 같은, 다양한 원인에 의해 발생한다. 특히, 폐섬유증이 다른 질환의 이차적 영향인 것으로 밝혀짐에 따라, 폐섬유증의 대부분은 바이러스 감염, 다른 미세한 상처, 자가면역질환과 같은, 간질성폐질환 (interstitial lung disease)로서 분류된 다. 그러나, 원인을 알 수 없이 발명하는 특발성 폐섬유증 (idiopathic pulmonary fibrosis)도 있다. 폐섬유증을 유발하는 다양한 원인 중에서, 폐는 호홉기관이라는 것에서 산화 적 스트레스가 가장 중요한 원인이 된다 (Thet, L. et al ., Experimental lung- research 11(3): 209-228, 1986; Oreffo, V. et al . , hvironmentaJ HeaJth Perspectives 85: 51, 1990) . 고농도의 산소 (9(» 이상)에 노출되면 마우스의 폐는 점진적인 손상을 입게 되고 3 내지 7일 뒤 사망에까지 이른다는 보고가 있고 (Crapo, J. et al . , The ½er i can review of respiratory disease 122(1): 123, 1980; O'Reilly, M, American Journal of Physiology- Lung Cellular and Molecular Physiology 281(2): 291, 2001; 01 ivera, W. et al . , American journal of respiratory and critical care medicine 152(4): 1229, 1995) , 이러한 폐의 손 상은 활성산소종 (R0S)의 증가에 의한 결과인 것으로 여겨진다 (Barazzone, C. et al ., American journal of respiratory cell and molecular biology 19(4): 573 , 1998; Boveris, A. et al . , Biochemical Journal 134(3): 707, 1973; Lakshminrusimha, S. et al . , American journal of res iratory and critical care medicine 174(12): 1370, 2006; Freeman, B. et al . , The Journal of biological chemistry 256(21): 10986, 1981).
따라서, 과산소에 의해 유도되는 폐섬유증과 같은 폐손상에 대한 근본적인 치료를 위하여ᅳ 효과적으로 과산소 조건하에서 발병되는 폐손상을 치료할 수 있는 신규한 치료제의 개발이 요구된다. 이에 따라, 신규한 치료제의 개발을 위해서는 과산소에 의한 폐섬유증을 치료할 수 있는 효과적인 약물을 발굴하기 위한 전략이 필요하다. 이를 위해서는 과산소 상태에 노출된 인간의 폐섬유증과 유사한 모¾ 동물의 개발이 필수적이다. 고농도의 산소 조건하의 산화적 스트레스에 의해 발병 되는 폐손상의 병인 기전을 규명하고, 이를 치료하기 위한 약물의 발굴 및 효능 g— 검증하는데, 과산소 노출에 의한 폐섬유증에 대한 모델 동물이 유용하게 활용될 것 이다. 이에, 본 발명자들은 TAZ유전자가 결핍된 형질전환 모델 마우스를 제조하였 고, 상기 마우스의 폐는 과산소에 의해 유도되는 폐섬유증의 증상과 유사함을 최초 로 확인하였으며, TAZ와 과산소 노출에 의한 산화적 스트레스 기전의 관련성을 규 명함으로써, 상기 TAZ 마우스는 과산소 노출에 의한 폐섬유증 모델 마우스로서 유용하게 사용할 수 있고, 이를 이용하여 치료제 후보물질의 스크리닝에 유용하게 이용할 수 있을 뿐만 아니라, TAZ의 발현 수준올 확인함으로써 과산소 노출에 의한 폐섬유증 진단 및 진단용 키트에 유용하게 이용할 수 있음을 밝힘으로써 본 발명을 완성하였다.
【발명의 상세한 설명】
【기술적 과제】
본 발명의 목적은 과산소 노출에 의한 폐손상 모델 동물, 및 TAZ 마커를 이 용한 과산소 노출에 의한 폐손상 진단용 키트를 제공하기 위한 것이다.
【기술적 해결방법】
상기 목적을 달성하기 위하여, 본 발명은 TAZCtranscriptional coactivator with PDZ-binding motif) 유전자가 녹아웃 (TAZ )된, 과산소 노출에 의한 폐손상 모델 마우스를 제공한다.
또한, 본 발명은 상기 TAZ 유전자가 녹아웃된 마우스의 제조방법을 제공한 다.
또한, 본 발명은 상기 과산소 노출에 의한 폐손상 모델 마우스를 사용한 과 산소 노출에 의한폐손상 치료제 후보물질의 스크리닝 방법을 제공한다.
또한, 본 발명은 TAZ 단백질에 특이적으로 결합하는 항체, 또는 상기 TAZ 단 백질를 암호화하는 핵산에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 과산소 노출에 의한 폐손상 진단용 키트를 제공한다.
또한, 본 발명은 과산소 노출에 의한 폐손상 진단의 정보를 제공하기 위한 단백질 검출 방법을 제공한다.
또한, 본 발명은 과산소 노출에 의한 폐손상 모델 마우스로 사용하기 위한
TAZ(transcriptional coactivator with PDZ-binding motif) 유전자가 녹아웃 (TAZ )된 마우스를 제공한다.
아울러, 본 발명은 과산소 노출에 의한 폐손상 진단용 키트로 사용하기 위한 TAZ 단백질에 특이적으로 결합하는 항체, 또는 상기 TAZ 단백질를 암호화하는 핵산 에 특이적으로 결합하는 프라이머 또는 프로브를 제공한다. 이하, 본 발명을 상세히 설명한다. 본 발명은 TAZ(transcriptional coactivator with PDZ-binding motif) 유전 자가녹아웃 (TA2 / )된, 과산소 노출에 의한 폐손상 모델 마우스를 제공한다.
또한, 본 발명은 과산소 노출에 의한 폐손상 모델 마우스로 사용하기 위한 TAZ(transcriptional coactivator with PDZ-binding motif) 유전자가 녹아옷 (TAZ ' )된 마우스를 제공한다.
상기 TAZ 유전자는 서열번호 1의 핵산 서열로 기재되는 것이 바람직하나 이 에 한정되지 않는다.
상기 과산소 노출에 의한 폐손상은 폐섬유증 (fibrosis), 기관지폐이형성증 (bronchopulmonary dysplasia) 및 만성폐쇄성폐질환 (chronic obstructive pulmonary disease)으로 이루어진 군으로부터 선택되는 어느 하나인 것이 바람직하 나 이에 한정되지 않고, 과산소 노출에 의한 산화적 스트레스로 인해 발병되는 모 든 폐손상은 이에 포함된다. 또한, 본 발명은 상기 폐손상 모델 마우스의 제조방법을 제공한다.
상기 제조방법은 하기의 단계를 포함하는 것이 바람직하나 이에 한정되지 않 는다:
1) TAZ유전자 녹아웃 카세트를 제조하는 단계;
2) 단계 1)의 TAZ 유전자 녹아웃 카세트를 배아줄기세포에 형질감염시키는 단계;
3) 단계 2)의 배아줄기세포를 포배아의 포배강에 주입하여 키메라 마우스를 얻는 단계,
4) 단계 3)의 키메라 마우스로부터 TAZ+/_ 유전형질을 갖는 이형접합체 마우 스를 얻는 단계 ; 및
5) 상기 단계 4)의 이형접합체 마우스를 상호교배시켜 TA2 유전형질을 갖 는 동형접합체 마우스를 얻는 단계 .
상기 TAZ 유전자는 서열번호 1의 핵산 서열로 기재되는 것이 바람직하나 이 에 한정되지 않는다.
상기 TAZ 유전자가 녹아웃된 마우스는 TAZ 유전자의 결손이 상동 염색체 1쌍 에서 모두 일어난 것으로서, TAZ_/—의 유전형질을 갖는 동형접합체 (homozygote)이 며 , 정상적으로 출생하지만, 과산소 노출에 의해 유도되는 폐손상을 갖는 특징이 있다.
상기 제조방법에 있어서, 단계 1)의 TAZ 유전자 녹아웃 카세트는 도 1의 B에 도시된 개열지도를 갖는 것이 바람직하나 이에 한정되지 않는다.
상기 단계 1)에서 제조한 TAZ 유전자 녹아웃 카세트를 배아줄기세포에 형질 감염하기 위하여 전기천공법 (electroporation), 미세주사법 (microinjection) 또는 칼슘포스페이트법 (calcium phosphate treatment)을 이용하여 마우스의 배아줄기세 포에 도입시킬 수 있다.
상기 단계 3)에 있어서, 상기 형질전환된 배아줄기세포를 포배아의 포배강에 주입하기 위하여, 배아줄기세포 클론을 도너 (donor) 마우스의 배반포 (blastocyst) 에 주사하고 이를 추후 자궁으로 옮길 수 있다.
상기 단계 4)에 있어서, 상기 키메라 마우스로부터 생식계열전달을 가지는 이형접합체를 유도하고 이를 상호교배시켜 동형접합체인 TAZ 녹아옷 (TAZ ) 마우스 를 제조할 수 있다.
본 발명의 구체적인 실시예에 있어서, TAZ 유전자를 결손시키기 위하여, TAZ 유전자의 일부를 네오 (neo) 유전자로 치환시킨 TAZ 유전자 녹아웃 카세트 (도 1 참 조)를 백터 내에 포함시켜 TAZ 유전자 결손 백터를 제작하였다. 상기 백터로 배아 줄기세포에 존재하는 TAZ 유전자를 결손시키고, 유전자 결손이 확인된 배아줄기세 포를 정상적으로 발생중인 배반포의 포배강 내에 주입하여 키메라 (chimera) 생쥐를
생산하였다. 생산된 키메라 생쥐는 정상 마우스와의 역교배를 통하여 배아줄기세 포 유래의 F1 마우스가 출생하였고, 한쪽 유전자가 결손된 이형접합체 (TAZ+/ᅳ) 마우 스 간의 교배에 의하여 TAZ 유전자가 녹아옷된 동형접합체 TAZ ) 마우스를 제조하 였다.
본 발명자들은 본 발명에서 제조한 TA /_ 마우스의 폐 조직을 확인한 결과, 과산소 노출에 의한 산화적 스트레스로 인하여 심각한 폐섬유증이 유도되는 것을 확인하였고, 나이가 증가할수록 증상이 악화되는 것으로 나타남으로써 (도 2 참조), 노화에 의해 폐섬유증이 심화되는 것올 확인하였다. 또한, 과산소 노출에 의해 폐 손상 발생시 감소하는 것으로 잘 알려져 있는 폐 상피세포 마커인, 계면활성제 단 백질 (surfactant protein, SP), 클라라세포 분비 단백질 (Clara cell secretory protein, CCSP) , 여러 성장 인자 단백질과, 염증시 발현이 증가하는 사이토카인 유 전자의 발현량을 ΎΚΪ'— 마우스 폐에서 측정한 결과, SP-C, 혈관내피성장인자 (vascular endothelial growth factor, VEGF) 및 CCAP 유전자의 발현량이 정상군에 비해 현저히 감소하는 것으로 나타났고, 염증성 사이토카인의 발현올 증가하였다 ( 도 3 참조). 한편, 과산소에 노출된 정상군의 마우스에서도 ΎΚΪ'- 마우스의 폐 조 직과 유사한 폐섬유증이 유도되는 것으로 나타났고, SP-C, VEGF, FGF-2 및 CCAP 유 전자의 발현량도 감소하였으며 (도 4 참조), ΤΑΖ 유전자 및 단백질의 발현량이 과산 소에 노출되지 않은 대조군에 비해 현저히 감소되는 것을 확인하였다 (도 5 참조). 또한, Ί Ζ—'ᅳ 마우스를 과산소 상태에 노출한 경우 폐섬유증이 가장 현저하게 유도 되는 것으로 나타났다 (도 6 참조). 이에, 상기의 결과들을 종합하면, 과산소 노출 로 인해 유도되는 폐손상과 ΤΑΖ의 결핍으로 인해 일어나는 폐손상 사이에는 유사한 관계가 있음을 알 수 있었다.
본 발명자들은 시험관 내 (in vitro) 실험을 통해 과산소 노출에 대한 상피세 포의 세포생존률 및 세포증식을 확인한 결과, 과산소에 노출된 선암 인간 폐포 기 저 상피세포 (A549)에서는 TAZ 단백질 발현이 감소하였고 (도 5의 C 참조), 세포생존 률 및 세포증식 또한 대조군에 비해 현저히 감소하였다 (도 7 참조). 반면에, TAZ 유전자가 녹다운된 A549 세포 (Ti 세포)는 세포증식에 유의적인 변화가 나타나지 않 았는데, 이는 TAZ가 녹아웃된 것이 아닌 녹다운 (knock-down)된 것이므로, TAZ 단백 질이 낮은 수준으로도 발현되었기 때문이다. TAZ_/— 마우스 유래의 마우스배아섬유 아세포 (mouse embryonic fibroblast, MEF)를 정상 상태에 노출시긴 경우에는, 정상
군 마우스 유래의 MEF에서보다 세포증식이 감소된 것으로 나타났다 (도 8 참조). 본 발명자들은, 과산소 노출로 인해 술포닐화 (sulfonylation)된 퍼록시레독 신 (peroxiredoxin, Prx)이 증가하고, 핵 인자 적혈구 2-관련 인자 2(Nuclear factor erythroid 2-related factor 2, Nrf2)에 의존하는 술피레독신
(sulfiredoxin, Srx)의 양도 증가한다는 최근 연구 결과에 착안하여, TAZ 마우스 폐에서의 Srx 및 Nrf2 발현량, 및 Prx의 술포닐화에 대하여 분석하였다. 산화적 스트레스에 노출된 세포는 하이드로퍼록사이드 (hydroperoxide)를 제거함으로써 상기
Prx를 보고하는 것으로 알려져 있고, Prx는 가역적으로 시스테인 술핀산 (cystein sulfinic acid)에 과산화된다. 이러한 상황에서 상기 Srx는 과산화를 전환하기위 한 효소로서 작용하므로, 실제 과산소에 노출된 폐에서는 Srx 수준이 증가하게 된 다. Srx, Nrf2, 및 Prx-P03 분석 결과, TAZ 마우스는 과산소 자극이 없는 상황에 서도 정상군에 비해 폐에서의 Srx 및 술포닐화된 Prx가 증가되어 있음을 알 수 있 었다 (도 9 참조). 이러한 결과는 TAZ가 산화적 스트레스를 증가시키는 신호 분자 를 억제한다는 것을 나타낸다.
따라서, 상기 결과를 통해 TAZ가 정상 상태에서 산화적 스트레스에 관계되는 신호분자의 발현을 조절하고, 폐의 항상성을 조절하는데 기능한다는 것을 알 수 있 으며, 이러한 TAZ 유전자를 결핍시킴으로써 과산소에 의해 유도되는 폐손상과 유사 한 표현형을 유발한다는 것을 확인하였다.
이에, TAZ— /_ 마우스는 과산소 노출에 의한 폐손상 기전연구 및 치료제 개 을 위한 모델 마우스로서 유용하게 사용될 수 있고, 이러한 모델 마우스의 제조에 유용하게 활용될 수 있다. 또한, 본 발명은
1) 실험군으로서, 상기 과산소 노출에 의한 폐손상 모델 마우스에 피검화합 물 또는 조성물을 처리하는 단계;
2) 단계 1)의 피검화합물 또는 조성물이 처리된 실험군 마우스, 및 피검화합 물 또는 조성물이 처리되지 않은 대조군 마우스로부터 각각 과산소 노출에 의한 폐 손상의 증상을 측정하는 단계 ; 및
3) 대조군에 비하여 실험군에서 과산소 노출에 의한 폐손상의 증상이 감소된 피검화합물 또는 조성물을 선별하는 단계를 포함하는, 과산소 노출에 의한 폐손상 치료제 후보물질의 스크리닝 방법을 제공한다.
상기 방법에 있어서, 상기 과산소 노출에 의한 폐손상은 폐섬유증
(fibrosis), 기관지폐이형성증 (bronchopulmonary dysplasia) 및 만성폐쇄성폐질환 (chronic obstructive pulmonary disease)으로 이루어진 군으로부터 선택되는 어느 하나인 것이 바람직하나 이에 한정되지 않는다.
상기 단계 1)의 피검화합물 또는 조성물은 천연화합물, 합성화합물, RNA, DNA, 폴리펩티드, 효소, 단백질, 리간드, 항체, 항원, 박테리아 또는 진균의 대사 산물 및 생활성 분자일 수 있다.
상기 단계 1)의 투여 방법은 경구 투여 또는 비경구 투여를 통해 수행될 수 있으며, 상기 비경구 투여시 피내주사, 피하주사, 정맥주사, 복강주사, 근육주사로 이루어지는 군으로부터 선택되는 어느 하나의 주사 투여; 직장 투여; 국소도포; 첩 포; 및 이온토포레시스 (Iontophoresis)로 이루어지는 군으로부터 선택되는 어느 하 나의 방법으로 수행될 수 있다.
상기 단계 2)의 과산소 노출에 의한 폐손상 증상의 측정은 조직병리학적 방 법, ELISA, 유세포분석법 또는 중합효소연쇄반웅 방법을 사용할 수 있고, 계면활성 제 단백질 - surfactant protein-A), SP-B, SP-C, SP-D, 클라라세포 분비 단백질 (clara cell secretory protein, CCSP) , β-카테닌, VEGF, FGF-2, HNF3, F0XA2, HIF2-a , IL-6, TNF- a , MCP-1 , 세포증식, 세포생존를, 술피레독신 (sulfiredoxin, Srx) 및 퍼록시레독신 술피닐화로 이루어진 군으로부터 선택되는 어느 하나 이상을 측정하는 것이 바람직하나, 과산소 노출에 의한 폐손상을 측정할 수 있는 지표라면 무엇이든 측정가능하다.
상기 스크리닝 방법을 통해 수득한, 과산소 노출에 의한 폐손상 억제 활성을 나타내는 피검화합물 또는 조성물은 과산소 노출에 의한 폐손상 치료제 후보물질이 될 수 있다. 이와 같은 후보물질은 이후의 과산소 노출에 의한 폐섬유증과 같은 폐손상 치료제 개발 과정에서 선도물질로서 작용하게 되며, 선도물질이 과산소 노 출에 의한 폐손상 억제 효과를 나타낼 수 있도록 그 구조를 변형시키고 최적화함으 로써 산화적 스트레스로 인해 기인하는 폐손상을 위한 신규한 치료제를 개발할 수 있다.
본 발명의 TAZ_/ 마우스의 폐 조직에서 유도된 폐섬유증 (lung fibrosis) 증 상은 과산소 노출에 의해 발생하는 폐섬유증과 매우 유사한 것으로 나타났고, 과산 소 노출에 따른 폐손상시 발현이 변화한다고 알려진 상피 발생 관련 유전자, 성장 인자 및 염증성 사이토카인의 발현 또한 변화하였다. 이는 과산소 노출에 의해 폐 손상이 유발된 정상군 마우스 폐에서의 경향과 유사하였으므로, TAZ의 결핍은 과산
소 노출 효과와 같은 산화적 스트레스 관련 신호에 영향을 주는 것을 알 수 있다. 또한, TAZ가 Prx의 과산화와 관련되어 산화적 스트레스를 증가시키는 신호 경로에 작용하여 신호 분자들을 억제시킴으로써, 폐의 항상성 조절 기능을 갖는 것을 확인 하였으므로, TAZ 마우스는 과산소 노출에 의한 폐손상 치료제의 탐색 및 개발을 위해 유용하게 사용될 수 있다. 또한, 본 발명은 TAZ 단백질에 특이적으로 결합하는 항체, 또는 상기 TAZ 단 백질를 암호화하는 핵산에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 과산소 노출에 의한 폐손상 진단용 키트를 제공한다.
또한, 본 발명은 과산소 노출에 의한 폐손상 진단용 키트로 사용하기 위한 TAZ 단백질에 특이적으로 결합하는 항체 , 또는 상기 TAZ 단백질를 암호화하는 핵산 에 특이적으로 결합하는 프라이머 또는 프로브를 제공한다.
상기 TAZ 단백질은 서열번호 2로 기재되는 아미노산 서열을 갖는 것이 바람 직하나, 이에 한정되지 않는다.
상기 TAZ 단백질에 특이적으로 결합하는 항체는 TAZ 단백질의 주입을 통해 제조된 것 또는 시판되어 구입한 것이 모두 사용 가능하고, 상기 항체는 다클론 항 체, 단클론 항체 및 에피토프 (epitope)와 결합할 수 있는 단편 등을 포함할 수 있 다.
상기 다클론 항체는 상기 TAZ 단백질을 동물에 주사하고 해당 동물로부터 채 혈하여 항체를 포함하는 혈청을 수득하는 종래의 방법에 의해 생산할 수 있다. 이 러한 다클론 항체는 당업계에 알려진 어떠한 방법에 의해서든 정제될 수 있고, 염 소, 토끼, 쥐, 래트, 닭, 양, 원숭이, 말, 돼지, 소, 개 등의 임의의 동물 종 숙주 로부터 만들어질 수 있고, 토끼를 숙주로 하는 것이 바람직하나, 이에 한정되지 않 는다.
상기 단클론 항체는 연속 세포주의 배양을 통한 항체분자의 생성을 제공하는 어떠한 기술을 사용하여도 제조할 수 있다. 이러한 기술로는 이들로 한정되는 것 은 아니지만 하이브리도마 기술, 사람 및 쥐 B-세포 하이브리도마 기술 및 EBV-하 이브리도마 기술이 포함된다 (Kohler G et al. , Nature 256:495-497, 1975; Kozbor D et al., J Immunol Methods 81:31-42, 1985; Cote RJ et al . , Proc Natl Acad Sci 80:2026—2030, 1983; 및 Cole SP et al. , Mo I Cell Biol 62:109-120, 1984) .
또한, 상기 TAZ 단백질에 대한 특정 결합 부위를 함유한 항체 단편이 제조될 수 있다. 예를 들면 이들로 한정되는 것은 아니지만 F(ab')2 단편은 항체분자를
펩신으로 분해시켜 제조할 수 있으며, Fab 단편은 F(ab')2 단편의 디설파이드 브릿 지를 환원시킴으로써 제조할 수 있다. 다른 방법으로서, Fab 발현 라이브러리를 작게하여 원하는 특이성을 갖는 단클론 Fab 단편을 신속하고 간편하게 동정할 수 있다 (Huse WD et al . , Science 254: 1275-1281 , 1989) .
상기 항체는 세척이나 복합체의 분리 둥 그 이후의 단계를 용이하게 하기 위 해 고형 기질 (solid substrate)에 결합될 수 있다. 고형 기질은 예를 들어 합성수 지, 니트로셀를로오스, 유리기판, 금속기판, 유리섬유, 미세구체 및 미세비드 등이 있다. 또한, 상기 합성수지에는 폴리에스터, 폴리염화비닐, 폴리스티렌, 폴리프로 필렌, PVDF 및 나일론 등이 있다.
상기 키트는 항원 -항체 결합반웅, 또는 단백질-리간드 결합반웅을 통하여 결 합 반웅을 정량 또는 정성적으로 분석함으로써 폐암을 진단할 수 있으며, 상기 결 합 반웅은 통상의 효소면역분석법 (ELISA), 방사능면역분석법 (radioi睡 unoassay, RIA), 샌드위치 측정법 (sandwich assay) , 웨스턴 블랏, 면역침강법, 면역조직화학 염색법 (immunohistochemical staining), 형광면역법, 효소기질발색법, 항원-항체 웅집법 등의 방법을 이용하여 측정할 수 있다.
상기 TAZ 단백질를 암호화하는 핵산에 특이적으로 결합하는 프라이머를 TAZ 유전자 검출 시, PCR 증폭반응에 적용하는 경우, 선택적으로, PCR 증폭에 필요한 시약, 예컨대, 완층액 , DNA 중합효소 (예컨대, Thermus aquat icus(Taq) , Thermus thermophi lus(Tth) , Thermusf i liformis, Therm is flavus, Thermococcus literal is 또는 Pyrococcus fur iosus(Pfu)로부터 수득한 열 안정성 DNA 중합효소), DNA 중합 효소 조인자 및 dNTPs를 포함할 수 있다. 본 발명의 상기 키트는 상기한 시약 성 분을 포함하는 다수의 별도 패키징 또는 컴파트먼트로 제작될 수 있다.
상기 키트의 프로브는 엄격한 흔성화 조건하에서 TAZ 핵산 서열에 특이적으 로 결합하도록 제작된 것이 바람직하며, 연속적인 15 내지 25 핵산 길이의 센스 및 /또는 안티센스 올리고뉴클레오티드, 바람직하게는 15 내지 30 핵산 길이의 길이, 더욱 바람직하게는 18 내지 25 핵산 길이의 센스 및 /또는 안티센스 올리고뉴클레오 티드인 것은 모두사용 가능하다.
상기 특이적 결합은 비특이적인 흔성체가 형성되지 않고, 특이적인 흔성체가 형성되는 것을 의미하고, 상기 엄격한 혼성화 조건은 통상적인 방법에 따라 흔성채 를 형성하는 핵산의 융해 온도 (Tm) 등에 기초하여 결정할 수 있다. 구체적인 흔성 화 상태를 유지할 수 있는 세정 조건으로는 통상 「IX SSCᅳ 0.1% SDS, 37°CJ 정 Γ 의 조건, 더욱 엄격하게는 r0.5x SSC, 0.1% SDS, 42°CJ 정도의 조건, 더욱더 엄
격하게는 Γ0·1Χ SSC, 0.1% SDS, 65°CJ 정도의 조건을 들 수 있다.
상기 프로브는 임의의 고형 기질에 고정화해 이용할 수도 있다. 상기 고형 기질로는 유전자 칩 cDNA 마이크로 어레이 , 올리고 DNA 어레이, 멤브레인 필터 (membrane filter) 등이 포함된다.
상기 키트의 프라이머는 서열번호 4로 기재되는 센스 프라이머 및 서열번호 5로 기재되는 안티센스 프라이머로 구성된 프라이머쌍인 것이 바람직하나, 서열번 호 1로 기재되는 핵산 서열을 증폭할 수 있는 15 내지 50 핵산 길이, 바람직하게는 15 내지 30 핵산 길이, 더욱 바람직하게는 18 내지 25 핵산 길이의 센스 및 안티센 스 올리고뉴클레오티드는 모두 사용 가능하다:
이때, 상기 키트는 PCR 반웅의 요소로써 디옥시뉴클레오티드 흔합물 (dNTP mixture) 및 완층용액을 추가로 포함할 수 있으며, Taq DNA 중합효소와 같은 열안 정성 DNA 중합효소를 추가로 포함할 수 있다. 또한, 본 발명의 키트에는 PCR 결과 를 확인하는데 필요한 6-FAM, NED 또는 HEX 등의 형광물질, 아가로스와 전기영동 완층용액 등이 추가로 포함될 수 있다. 또한, 본 발명의 키트는 상기 증폭반웅 요 소가 상기 프라이머와의 사전흔합물 (premix) 형태로 제공될 수 있다.
상기 키트는 추가로 정상 폐 세포를 포함할 수 있다.
본 발명의 키트의 분석대상이 되는 임상시료는 생검시료 또는 혈액시료일 수 있고, 상기 생검시료는 과산소 노출에 의한 폐손상 진단의 경우 외과적 수술 도중 개체로부터 적취된 폐 조직일 수 있고, 과산소 노출에 의한 폐손상 진단의 경우 상 기 폐손상이 의심되는 개체의 폐로부터 적취된 조직일 수 있다.
본 발명의 TAZ— Λ마우스의 폐 조직에서 유도된 폐섬유증 (lung fibrosis) 증 상은 과산소 노출에 의해 발생하는 폐섬유증과 매우 유사한 것으로 나타났고, 과산 소 노출에 따른 폐손상시 발현이 변화한다고 알려진 상피 발생 관련 유전자, 성장 인자 및 염증성 사이토카인의 발현 또한 변화하며, 이는 과산소 노출에 의해 폐손 상이 유발된 정상군 마우스 폐에서의 경향과 유사하였다. 또한, TAZ가 산화적 스 트레스를 증가시키는 신호 경로에 작용하여 신호 분자들을 억제시킴으로써, 폐의 항상성 조절 기능을 갖는 것을 확인하였으므로, TAZ 유전자 또는 단백질은 과산소 노출에 의한 폐손상 진단 및 예후 예측용 키트에 유용하게 사용될 수 있다. 또한, 본 발명은 과산소 노출에 의한 폐손상 진단의 정보를 제공하기 위한 단백질 검출 방법을 제공한다.
상기 검출 방법은 하기 단계를 포함하는 것이 바람직하나 이에 한정되지 않
는다:
1) 실험군인 과산소 노출에 의한 폐손상이 의심되는 개체와 대조군인 과산소 노출에 의한 폐손상에 걸리지 않은 개체로부터 유래한 각각의 임상시료에서 TAZ 유 전자또는 단백질의 발현수준을 측정하는 단계 ; 및
2) 단계 1)의 실험군과 대조군의 TAZ 발현수준을 비교하여 실험군의 TAZ 발 현수준이 대조군에 비해 감소하는 경우 과산소 노출에 의한 폐손상 발병가능성이 있는 것으로 판정하는 단계 .
상기 방법에 있어서, 상기 과산소 노출에 의한 폐손상은 폐섬유증 (fibrosis), 기관지폐이형성증 (bronchopulmonary dysplasia) 및 만성폐쇄성폐질환 (chronic obstructive pulmonary disease)으로 이루어진 군으로부터 선택되는 어느 하나인 것이 바람직하나 이에 한정되지 않는다.
상기 방법에 있어서, 상기 단계 1)의 TAZ유전자의 발현수준은 RT-PCR법, 실 시간 RT-PCR법, 마이크로어레이법, 노던블랏 (northern blotting), 유전자 발현의 연속 분석법 (SAGE, serial Analysis of Gene Expression) 또는 RNase 보호분석법 (RNase protection assay)을 통해 측정할 수 있고, 상기 TAZ 단백질의 발현수준은 웨스턴블랏 (Western blotting), 효소-면역화학 검출법 (Enzyme-linked immunosorbent assay, ELISA) , 면역조직화학 염색법 (immunohistochemical staining) , 면역침강 (immunoprecipitation) 또는 면역형광법 (immunofluorescence) 을 통해 측정할 수 있으나, 이에 한정되지 않는다.
본 발명이 적용가능한 개체는 인간을 포함한 척추동물이고 바람직하게는 포 유동물이며, 그보다 바람직하게는 인간 또는, 쥐, 토끼, 기니아피그, 햄스터, 개, 고양이와 같은 실험동물이고, 가장 바람직하게는 인간 또는 침팬지, 고릴라와 같은 유인원류 동물이다.
상기 임상시료는 생검시료 또는 혈액시료일 수 있고, 조직, 세포, 전혈, 혈 청, 혈장, 타액, 뇌척수액 또는 뇨일 수 있으며, 상기 생검시료는 과산소 노출에 의한 폐손상이 의심되는 개체의 폐으로부터 적취된 조직일 수 있다.
본 발명의 TAZ一 /_마우스의 폐 조직에서 유도된 폐섬유증 (lung fibrosis) 증 상은 과산소 노출에 의해 발생하는 폐섬유증과 매우 유사한 것으로 나타났고, 과산 소 노출에 따른 폐손상시 발현이 변화한다고 알려진 상피 발생 관련 유전자, 성장 인자 및 염증성 사이토카인의 발현 또한 변화하며, 이는 과산소 노출에 의해 폐손 상이 유발된 정상군 마우스 폐에서의 경향과 유사하였다. 또한, TAZ가 산화적 스 트레스를 증가시키는 신호 경로에 작용하여 신호 분자들을 억제시킴으로써, 폐의
항상성 조절 기능을 갖는 것을 확인하였으므로, TAZ 유전자 또는 단백질은 과산소 노출에 의한 폐손상을 진단하고 예후를 예측하는데 유용하게 사용될 수 있다.
【유리한 효과】
상기에서 살펴본 바와 같이, 본 발명의 TAZ 유전자를 녹아옷 (TAZ/_)시킨 형 질전환 마우스는 과산소 노출에 의해 유발되는 폐산화증과 유사한 폐손상이 유도되 고 상기 TAZ z 마우스에서 유도된 폐손상은 활성산소에 의한 폐손상 기작과 관련되 어 있으므로, 상기 형질전환 마우스는 과산소 노출에 의한 폐손상의 모델 동물로시 이용하여 새로운 치료 후보물질의 스크리닝이 가능할 뿐만 아니라, TAZ의 과산소 노출에 의한 폐손상 억제 (suppressor) 유전자로서의 생리적 기능을 밝히는 데도 효 과적으로 이용될 수 있으며, 상기 TAZ의 발현수준을 통해 과산소 노출에 의한 폐손 상의 진단 또는 예후 예측용 마커로서 이용가능하다.
【도면의 간단한 설명】
도 1은 TAZ 유전자 (A). 및 TAZ 마우스를 제조하기 위한 TAZ 유전자 녹아 웃 카세트 (B)의 개열지도를 나타내는 그림이다.
도 2는 TAZ+ 마우스에서 유도된 폐섬유화증을 나타내는 그림이다:
A: 정상군 (WT) 및 TAZ z 마우스의 폐 조직 ;
B: 정상군 및 TAZ 마우스 폐에서 TA2 유전자의 발현;
C: 정상군 및 TAZ /_ 마우스 폐에서 TAZ 단백질의 발현; 및
D: H&E 염색을 통한 정상군 및 ΎΚΪ'— 마우스 폐 조직 분석 . 도 3은 정상군 및 ΤΑΖ_/— 마우스 폐에서의 다양한 외피 계면활성제 단백질 및 염증성 사이토카인 유전자의 발현을 확인한그림이다:
Α: 상피세포 발생 관련 유전자 (SP-A, Β, (: 및 D, CCSP)의 발현;
Β: 세포 발생 인자 (VEGF, FGF2, 베타-카테닌, HNF3- α, F0XA2, HIF-1 α 및 HIF-2a)의 발현; 및
C: 염증성 사이토카인 (IL-6, TNFa 및 MCP-1)의 발현.
도 4는 과산소 노출에 의해 폐섬유화증이 유도된 정상군 마우스의 조직학적 분석 (A) 및 유전자 발현 변화 (B)를 나타낸 그림이다.
도 5는 과산소 노출에 의한 TAZ의 발현 변화를 나타낸 그림이다:
A: TAZ 단백질의 발현;
B: 과산소에 72시간 동안 노출된 정상군 마우스 폐에서의 TAZ 유전자 발현;
C: 과산소에 48시간 동안 노출된 A549 세포에서의 TAZ 단백질 발현.
도 6은 정상군 마우스, TAZ 마우스 및 과산소에 노출된 정상군 또는 TAZ
'― 마우스 폐에서의 외피 계면활성제 단백질 (A 및 B) 및 염증성 사이토카인 (C 및 D) 유전자의 발현량을 확인한 그림이다:
도 7은 과산소에 노출된 A549 세포의 형태 (A) 및 이의 세포수 측정 (B)을 나 타낸 그림이다. 도 8은 과산소에 노출된 정상군 또는 TAZ+세포의 세포증식을 나타낸 그래 프이다:
A: 과산소 또는 정상 상태에 노출된 A549 세포;
B: 정상 상태에서의 A549 대조군 (BP) 세포 및 Ti 세포 (TAZ가 녹다운된 A549 세포); 및
C: 정상 상태에서의 정상군 마우스의 MEF(MEFs WT) 및 TAZ 마우스의 MEF(MEFs 1KL1') . 도 9는 TAZ— Λ 마우스 폐에서 술피레독신 (sulfiredoxin, Srx) 발현 및 Prx 술 피닐화 (sulfinylation)를 나타낸 그림이다.
A: 과산소에 노출된 정상군 마우스 및 정상상태에서의 정상군 마우스 폐의 Srx 및 Prx-P03 단백질의 발현;
B: TAZ"7" 마우스 또는 정상군 마우스 폐에서의 Nrf2 및 Srx 유전자의 발현;
C: 마우스 또는 정상군 마우스 폐에서의 Nrf2 및 Srx 단백질의 발현.
【발명의 실시를 위한 최선의 형태】
이하, 본 발명을 실시예에 의해 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실 시예에 한정되는 것은 아니다.
<실시예 1> TAZ 마우스 제조 및 유전자형 분석
<1-1> TAZ 유전자가 결핍된 마우스의 제조
TAZ 유전자가 녹아웃된 마우스를 제조하기 위해, 도 1에 나타낸 TAZ 유전자 녹아웃 카세트를 포함하는 TAZ 유전자 결손 백터를 제조하여, 이를 전기천공법 (electroporation)을 통해 C57BL/6j (Jackson LaboratoryCBar Harbor, ME) 마우스 유래의 배아줄기세포 (ES)에 형질감염시켰다. 상기 ES 세포의 DNA에 대하여 서던 블랏 (Southern blot) 분석을 실시하여 상기 백터가 배아줄기 세포의 게놈 (genome) 내에 삽입된 배아줄기세포만을 선별하였고, TAZ 유전자 녹아웃 카세트의 도입이 확 인된 ES 세포 클론을 C57BL/6j 암컷 마우스로부터 수득한 배반포 (blastocyst)의 포 배강 (blastocoel)에 미세주입 (microinjection)하여 이를 대리모 자궁에 이식하였 다. 대리모로부터 출생한 키메라 생쥐는 배아줄기세포가 생식선으로 이행 (ger line transmission)되었는지 여부를 확인하기 위해 다시 정상 마우스와 역교배시켰 다. 그런 다음, TAZ 유전자 결손이 확인된 마우스 간의 교배를 통하여 완전하게 양쪽 유전자가 모두 결손된 동형접합체 (TAZ— Λ) 마우스를 제조하였다. <1-2> 마우스의 유전자형 분석
실험에 사용된 마우스의 유전자형을 분석하기 위해, 2.5 내지 3주령의 마우 스로부터 수득한 꼬리를 55°C의 꼬리용해버퍼 (tail lysis buffer)(Tris 100 mM, NaCl 200 m M, SDS 0.2%, EDTA 5 mM, 및 100 ug/mi proteinase K)에서 용해시켰디 . 하룻 밤 뒤, 이를 원심분리하여 (12000 rpra, 4°C, 10분) 상층액을 새로운 튜브에 옮 기고, DNA 침전을 위해 여기에 동량의 아이소프로판을 (isopropanol)을 첨가하였다. 그런 다음, 부드럽게 위아래로 뒤집어 섞어주었다. DNA 침전물을 70% 에탄올로 옮 기고 혼합한 후, DNA를 TE로 용출하였다. 용출된 DNA는 55°C에서 2 내지 3시간 동 안 방치한 뒤 유전자형 분석을 위한 PCR에 사용하였다. TAZᅳ /_ 마우스를 확인하기 위해, PCR은 KS-Neo-R: 5 ' -GGAGAACCTGCGTGCAATCCATC-3 ' (서열번호 3), TAZ-GP2: 5'- ATGGGACAGTCCGGGAG-3' (서열번호 4), 및 TAZ-GP3: 5'-GTGCAAGTCAGAGGAGG-3' (서열번 호 5) 프라이머를 사용하여, 94°C에서 3분 수행한 후, 94°C에서 30초, 59°C에서 1 분 및 72°C에서 30초를 34 사이클 반복한 다음, 72°C에서 10분간 수행하였다. 증 폭된 유전자 단편의 크기는 IX TAE 버퍼 (Tris/Acetate/EDTA)에서 1% 아가로스 ¾ 로 확인하였다 (정상군: 510 bp, TAZ 800bp) .
<l-3>마우스 사육 상기 실시예 <1-1>에서 제조한 TAZ 녹아웃 마우스 (TAZ— z 및 정상군 마우스 를 사료 및 물을 자유롭게 섭취하도록 하여 사육하였다. 모든 실험은 성별 및 나 이가 일치하는 마우스를 이용하여 실시하였다.
<1-4>마우스의 과산소 노출
TAZ 녹아웃 마우스 (TAZ_/ ) 또는 정상군 마우스를, 충분한 유속의 95% 02로 포화된 챔버에서 24 48 또는 72시간 동안 등압의 과산소에 노출시켰고, 대조군 마 우스는 실내공기에 노출시켰다. 모든 동물 실험은 이화여자대학교의 이화 실험동 물유전체센터의 가이드라인에 따라 실시되었고, IACUC의 승인을 받았다.
<실시예 2> TAZ— Λ 마우스 폐에서 ΤΑΖ 발현의 확인
<2-1> ΤΑΖ 유전자의 발현 확인
m1' 마우스 폐에서의 KL 유전자의 발현을 확인하기 위해, 실시간 중합효 소연쇄반웅 (real time polymerase chain reaction)을 실시하였다. TAZ 7 마우스 또는 정상군 마우스의 폐 조직으로부터 TRIzol 시약을 사용하여 총 RNA를 분리하였 고, 이를 superscript Π reverse t r anscr i pt ase ( Inv i t r ogen , Carlsbad, CA)를 사용 한 cDNA 합성에 사용하였다. 합성된 cDNA 및 TAZ 유전자에 대한 프라이머쌍 (TAZ F: 5'— GTCACCMCAGTAGCTCAGATC— 3' (서열번호 6) 및 TAZ-R: 5'一 AGTGATTACAGCCAGGTTAGA G-3' (서열번호 7)을 사용하여 ABI 7000 amplification system(Applide Biosystems)을 통해 실시간 PCR을 실시하였다. 각각의 mRNA의 상 대적인 발현량은 β-엑틴의 발현 정도로 표준화한 후 측정하였다.
그 결과, 도 2의 Β에 나타낸 바와 같이, ΤΑΖᅳ /_ 마우스 폐에서 ΤΑΖ 유전자의 발현량은 정상군 마우스 폐에서의 발현량보다 현저히 감소한 것으로 나타났다 (도 2 의 Β)
<2-2> ΤΑΖ 단백질의 발현 확인
TAZ ' 마우스 폐에서의 TAZ 단백질의 발현을 확인하기 위해, 웨스턴 블랏팅
을 실시하였다. TAZ 마우스 또는 정상군 마우스의 폐 조직으로부터 분리한 세포 용해물은 10¾» 글리세롤 (glycerol), 50 mM 헤페스 (HepesXpH 7.5), 0.1% 트리톤 X- 100, 150 mM NaCl , 50 mM β-글리세롤 포스페이트 (β -glycerol phosphate) , 25 mM NaF, 20 mM EGTACpH 8.0), 15 mM MgCl2, 1 mM DTT, 1 raM Na3V04, 1 mM PMSF, 및 프 로테아제 억제제 (protease inhibitor)가 포함된 버퍼에서 제조하였다. 단백질 함 량은 브래드포드 분석 (Bradford assay)을 통해 측정하였다. 하나의 레인당 30 ug 의 동일한 양의 단백질을 7.5% 및 15% SDS-PAGE 젤에 로딩하였고, 나이트로셀를로 스 막 (nitrocel lulose membranes) (what man internat ional )으로 단백질을 옮긴 루, 3% 소혈청알부민 (bovine serum albumin, BSA)-TBST(1 M Tris (pH 7.4), 4 M NaCl 및 20%트윈 20)으로 1시간 동안 상온에서 블로킹하였다. TAZ 단백질에 대한 항체 는 1% BSA-TBST에 희석하여 사용하였고, 상기 막은 4°C 조건에서 하룻밤 동안 일차 항체와 함께 방치하였다. 막을 배양한 후 TBST로 3회 세척한 다음, 1시간 동안 상 온에서 이차 항체 (TBST에 1: 10,000으로 회석)와 함께 방치하였다. 그런 다음, ECL 용액(½^511 Biosciences, Pi scat away, NJ)을 사용하여 단백질 밴드를 현상하였 다.
그 결과, 도 2의 C에 나타낸 바와 같이, 정상군 마우스 폐에서는 ΎΙ단백질 이 발현되는 것으로 나타났으나, TAZ 마우스 폐에서는 TAZ 단백질의 발현이 거의 확인되지 않았다 (도 2의 C).
<실시예 3> TAZ_ " 마우스 폐의 폐섬유화증 분석
<3-1> TAZ— /_ 마우스 폐 조직 슬라이드의 제작 상기 실시예 <1-1>의 TAZ— z 마우스, 및 정상군 마우스로부터 각각 폐를 분리 하여, 폐 조직을 4°C에서 18시간 (또는 하룻밤) 동안 4% 파라포름알데하이드 용액 에 고정하였다. 그런 다음 폐 조직을 카세트에 옮기고, 5시간 동안 수듯물로 세 척하여 건조한 후, 자일렌으로 교체하고 파라핀으로 교체하는 단계를 거친 다음, 폐 조직을 파라민에 포매하여 5 의 절편 슬라이드를 제작하였다.
<3-2>해마톡실린 및 에오신 염색 (Hematoxylin and eosin staining)을 통한 폐 조직의 분석
상기 실시예 <2-1>에서 제작한, 폐 조직이 고정된 슬라이드를 60°C에서 20분
간 배양하였다. 그런 다음, 파라민을 제거하기 위해 각각 10분씩 3회에 걸쳐 상기 슬라이드를 자일렌에 담가 두었다. 그 후, 100% 에탄올에 5분, 90% 에탄올에 5분, 80% 에탄올에 5분, 및 증류수에 5분간 방치하여 재수화 단계를 실시하였다. 염색 은 헤마톡실린에서 10분간 수행한 후, 10분간 수듯물에서 세척하였고, 몇 초간 \ 염화수소가 담긴 70% 에탄올에 방치한 후, 5분간 수듯물에서 다시 세척한 다음, 1 분간 에오신을 처리하였다. 그 후, 80% 에탄올에 2분, 90% 에탄올에 2분, 100% 에 탄올에 2분, 및 자일렌에 3분간 3회 방치하여 탈수 단계를 실시하였다. 그런 다 음, 마운팅 용액 (mounting solution) 및 캐나다 발삼 (Canada valsam)(Fluka chemika, Buchs, Switzerland)을 사용하여 20분 이상 공기 중에 건조시키고 커버 글라스로 덮어주었다.
그 결과, 도 2에 나타낸 바와 같이, TA /_마우스의 폐는 정상군 마우스에 비해 부피가 크고 표면 및 조직구성의 손상이 나타나는 폐섬유화증의 증상이 확인 되었다 (도 2의 A). 또한, H&E 염색을 통해 폐 조직을 확인한 결과, 기도 상피세포 에 염색된 정도는 TAZᅳ /_마우스와 정상군 마우스에서 유의적인 차이가 나타나지 않 았으나, TAZ_/ 마우스 폐의 폐포벽 (alveolar walls)은 심하게 파괴된 것으로 나타났 다. 이때, 24주령 TAZ_/_마우스의 폐는 9주령 마우스의 폐에서보다 염증이 더욱 심 하게 나타난 것으로 확인되어 나이가 많을수록 폐섬유화증이 심화되는 경향을 나타 냈다 (도 2의 D).
<3-3>상피 구조 관련 마커 유전자 및 염증성 사이토카인 발현의 확인 상기와 같이, TAZ 마우스 폐의 표현형에 기초하여, 인간의 말단부 전달기 도 (distal conducting airway)의 정상 상피의 유지에 결정적인 역할을 하는 것으로 알려진 다양한 상피 구조 관련 마커 유전자들의 발현과 염증성 사이토카인의 발현 을 확인하기 위해 정량적 실시간 PCR을 실시하였다. 9주령의 TAZ_/—마우스 또는 정상군 마우스 폐 조직으로부터 TRIzol 시약을 사용하여 총 RNA를 분리하였고, 을 리고 (dT) 프라이머를 사용하여 역전사를 실시하여 상기 RNA로부터 cDNA를 합성하였 다. SYBR Green PCR Master Mix를 사용하여 ABI 7000 amplification system(Applide Biosystems)을 통해 정량적 실시간 PCR은 실시하였다. 이때, 하기 표 1에 기재된 상피 계면활성제 단백질 및 염증성 사이토카인에 대한 프라이머쌍을 사용하였다.
【표 1]
그 결과, 도 3a, b, 및 c에 나타낸 바와 같이, TAZ 마우스 폐에서의 대부 상피 구조 관련 마커 유전자들은 정상군에 비해 발현이 감소되는 것으로 나타
났다. 계면활성제 단백질 A, B, C, 및 D, 클라라 세포 분비 단백질 (clara cell secretory protein)의 발현량은 정상군 마우스 폐에 비해 TAZ /_마우스 폐에서 감소 하는 것으로 나타났고 (도 3a), TAZ"/_마우스 폐에서의 혈관내피성장인자 (Vascular Endothelial growth factor, VEGF) , 섬유아세포 성장인자 -2(Fibroblast growth Factor— 2, FGF-2) , 베타-카테닌 (β-catenine), 간세포핵인자 3(Hepatocyte Nuclear Factor 3, HNF3), 포크헤드 박스 A2(Forkhead box A2, F0XA2) 및 저산소증 유도성 인자 (Hypoxia inducible factor 2-a, HIF2-a)의 발현도 정상군에서보다 감소하였다
(도 3b). 한편, TAZ 마우스 폐에서의 염증성 사이토카인인 인터루킨- 6(interleukin-6, IL-6) , 종양괴사인자一 a (tumor necrosis factor- α , TNF- α ) ¾ 인간 단핵구 화학주성 단백질 -Kmonocyte chemoat tract ant protein-1, MCP-1)의 발 현량은 정상군에 비해 유의적으로 감소하였다 (도 3c).
<실시예 4> 과산소 노출된 마우스의 폐섬유화증과 TAZ와의 관련성 확인
<4-1> 과산소 노출된 정상군 마우스 폐의 조직학적 분석
상기 실시예 <1-4>의 방법에 따라 과산소가 노출된 정상군 마우스의 폐 조직 을 상기 실시예 <3-2>의 H&E 염색을 실시하여 조직학적으로 분석하였다.
그 결과, 도 4의 A에 나타낸 바와 같이, 과산소에 72시간 동안 노출됨으로 써, 9주령의 정상군 마우스는 폐섬유화증의 표현형을 나타내는 것으로 확인되었다 ( 도 4의 A).
<4-2>과산소 노출에 의한 상피 구조 관련 마커 유전자 및 염증성 사이토카 인 발현 변화의 확인
상기 실시예 <3-3>의 방법에 따라, 72시간 동안 과산소에 노출된 TAZ_/ 마우 스 또는 정상군 마우스 폐에서의 외피세포 발생 단백질 (CCSP 및 SP-C), 및 세포 발 생 인자 (FGF-2 및 VEGF)의 유전자 발현을 확인하였다.
그 결과, 도 4의 B 및 도 5에 나타낸 바와 같이, 과산소 노출되지 않은 대조 군에 비해 과산소에 노출되어 폐섬유화증이 유도된 정상군 마우스에서 CCSP, SP-C,
FGF-2 및 VEGF의 발현이 감소된 것으로 나타났고 (도 4의 B), 과산소에 노출된 TAZ Λ마우스 폐에서의 CCSP, SP-C, FGF-2 및 VEGF의 발현량은 과산소에 노출되지 않은 TAZ /_마우스 또는 과산소에 노출된 정상군 마우스의 폐에서보다 현저히 낮은 것을
확인하였다 (도 6)
<4-3>과산소 노출된 정상군 마우스 폐에서 TAZ 발현의 확인
과산소 노출된 정상군 마우스 폐에서의 TAZ의 발현을 확인하기 위해, 상기 < 실시예 2>의 방법에 따라, 실시간 PCR 및 웨스턴 블릿:을 실시하였다.
그 결과, 도 5에 나타낸 바와 같이, 과산소 노출된 정상군 마우스 폐에서는 TAZ 단백질 및 유전자의 발현이 감소한 것을 확인하였다. 이때, 단시간 (24 또는 48시간) 동안 과산소에 노출된 경우에는 TAZ 단백질의 발현이 대조군 마우스와 유 의적인 차이가 없었으나, 과산소에 72시간 동안 노출된 경우에는 TAZ 단백질의 발 현이 대조군 마우스에 비해 유의적으로 감소하는 것으로 확인되었다 (도 5의 A 및 B).
<실시예 5> 과산소 노출된 세포와 TAZ의 관련성 확인
<5-1> 세포 배양
폐섬유화증과 같은 폐 상피 병원체 연구에 사용되는, 선암 인간 폐포 기저 상피세포인 (adenocarcinomic human alveolar basal epithelial cell) A549 세포를 미국 타입 컬쳐 콜렉션 (American Type Culture Collection, ATCC, Rockville, MD, U.S.A.)으로부터 구입하여, 100 U/m^ 페닐실린 (penicillin), 100 mg/m^ 스트렙토마 이신 (streptomycin) 및 10% 우태아혈청이 첨가된 RPBI 1640CGIBC0, Invitrogen. Carlsbad, CA, USA)에 배양하였다. TAZ가 녹다운된 A549 세포 (Ti)는 TAZ를 녹다^ 시키기 위해 설계된 siRNA 을리고뉴클레오티드를 형질도입하여 제작하였다. 마우 스 배아 섬유아세포 (Mouse embryo fibroblasts, MEFs)는 TAZᅳ /_ 마우스 또는 정상 군 마우스로부터 분리한 일차 MEF를 불멸화하여 제작하였고 (MEFs TKL1' , MEFs WT) , 100 U/m^ 페닐실린, 100 mg/ml 스트랩토마이신 및 10% 우태아혈청이 첨가된 DMEM(Dulbeco's modified Eagles medium, GIBC0)에서 배양하였다.
<5-2>과산소 노출된 A549 세포의 TAZ 단백질의 발현 확인
A549 세포를 1.5X105 세포수 의 농도로 6 웰 배양 접시에서 37°C의 95% 02 조건하에서 배양하였다. 세포를 37°C의 5¾ C02 및 95% 02 환경하에서 48시간 동 안 과산소에 노출시킨 뒤, 세포 용해물에 대해 TAZ 항체를 이용한 웨스턴 블랏을 실시하여 TAZ 단백질 발현을 확인하였다. 이때, 대조군은, 세포를 37°C의 5% C02
및 95% 대기 환경하에서 배양하였다.
그 결과, 도 5의 C에 나타낸 바와 같이, 과산소 노출된 A549 세포는, 과산소 에 노출되지 않은 대조군 세포에 비해 TAZ 단백질의 발현이 감소하는 것으로 나타 났다 (도 5의 C).
<5-3> 과산소 노출된 세포의 세포증식 변화 확인
상기 실시예 <5-1>에서 배양한 A549, Ti, MEFs WT 또는 MEFs TAZ_/세포를 3 xlO5 세포수 /웰의 농도로 6 웰 배양 접시의 10% 우태아혈청이 포함된 RPMI 배지에 서 배양하여 , 37°C의 95% 02조건하에서 24또는 48시간 동안 과산소에 노출시켰다. 그런 다음, 트립신 /EDTA를 사용하여 A549 세포를 배양 접시로부터 수득하여 헤마토 사이토미터 (hematocytometer)로 세포수를 측정하였다. 또한, 세포증식을 분석하기 위해, CFSE 염색을 실시하였다. 0.1% BSA가 포함된 PBS에 A549 세포를 1>〈10? 세포 수 / 의 농도로 준비하고, 이를 37°C에서 10분간 5 μΜ 카르복시플루어레세인 디아 세테이트 (carboxyf luorescein diacetate) 및 숙신이미딜 에스터 (succinimidy 1 ester, CFSE)와 함께 배양하였다. 배양 후 반웅을 종결하기 위해, PBS를 첨가하고 10% FBS가 포함된 RPMI로 세척하였다. 그런 다음, 세포를 과산소 또는 정상 상태 하에서 배양하였다. 배양 후 24, 48 및 72시간 후, 세포를 수득하여 CFSE의 검출 을 위해 유세포분석 (flow cytometry)을 실시하였다. 형광 활성 세포분석 (fluorescence activated cell sorting, FACS) 결과는 Cel 1 Quest software(Becton Dickinson, CA, USA)를 사용하여 분석하였다.
그 결과, 도 7 및 8에 나타낸 바와 같이, A549 세포의 세포수 측정을 통해, 과산소에 노출된 A549 세포는 세포수가 급격히 감소한 것으로 확인되었고 (도 7의 A 및 B), CFSE 염색을 통해, 과산소에 의해 유도된 폐섬유화증은 상피세포 증식을 감 소시키는 것으로 확인되었다 (도 8의 A). 한편, 과산소에 노출된 TAZ 녹다운 Ti 세 포 (도 8의 D)는 대조군인 BP 세포에 비해 유의적인 상피세포 증식 감소가 나타나지 않았으나 (도 8의 B), 정상상태에 노출된 MEFs TAZ 세포의 세포증식은 정상군의 MEF 세포에 비해 감소하였다 (도 8의 C). 즉, TAZ 결핍에 의한 폐섬유증은 과산소 에 노출되어 유도된 폐섬유증은 같이, 상피세포 증식이 억제됨을 확인하였다.
<실시예 6> 과산소 노출된 정상군 마우스 및 TAZ 마우스의 폐섬유화증 비교
과산소는 퍼록사이드 (peroxide)의 세포내 수준을 증가시킴으로써 Nrf-2 의존 적인 술피레독신 (sulfiredoxin, Srx) 발현 유도를 증가시킨다고 보고되었고, 이는 과산소 노출된 폐에서 퍼록시레독신 m(Prxin)가 분해되어 술포닉 형태로의 산화를 통한 것이라고 알려져 있으므로, TAZ_/— 마우스의 폐에서의 Srx 발현 및 Prx 술피닐 화 (sulfinylation)를 확인하고자 하였다. 먼저, 3일 동안 과산소에 노출된 정상군 마우스와 정상 상태의 정상군 마우스의 폐 조직으로부터 분리된 50 j g의 단백질과, Srx, 2-Cys Prx-S03 및 -엑틴에 특이적인 각각의 항체를 사용하여 면역블랏 분석 을 실시하였다. 또한, ΤΑΖ 마우스 또는 정상군 마우스의 폐로부터 총 RNA를 분 리하여, Nrf2, Srx 및 -액틴 mRBA에 특이적인 각각의 프라이머쌍을 사용하여 실 시간 PCR을 실시하였고, TAZ 마우스 또는 정상군 마우스의 폐로부터 50 의 단 백질을 분리하여 상기와 같이, 면역블랏 분석을 실시하여 Srx 및 ? -303의 발현을 확인하고자하였다.
그 결과, 도 9에 나타낸 바와 같이, 과산소 상태에서 유도된다고 알려진 Srx 및 Prx-S03 발현 수준은, 대조군에 비해 과산소에 노출된 정상군 마우스 폐에서 증 가한 것으로 나타났고 (도 9의 A), 과산소에 노출되지 않은 TAZ 一卜 마우스의 폐에서 도 Srx 및 Prx-S03 유전자 및 단백질의 발현이 정상군 마우스에서보다 증가하였 °- 며, (도 9의 C 및 D), Nrf2의 발현 역시 정상군보다 TAZ -卜 마우스의 폐에서 증가하 였다 (도 9의 B).
Claims
【청구항 1]
TAZ(transcriptional coactivator with PDZ-binding motif) 유전자가 녹아웃 (TAZ )된, 과산소 노출에 의한 폐손상 모델 마우스.
【청구항 2]
제 1항에 있어서, 상기 TAZ유전자는 서열번호 1로 기재되는 것을 특징으로 하는 과산소 노출에 의한 폐손상모델 마우스 .
【청구항 3】
제 1항에 있어서, 상기 과산소 노출에 의한 폐손상은 폐섬유증 (fibrosis), 기관지폐이형성증 (bronchopulmonary dysplasia) 및 만성폐쇄성폐질환 (chronic obstructive pulmonary disease)으로 이투어진 군으로부터 선택되는 어느 하나인 것을 특징으로 하는 과산소 노출에 의한 폐손상 모델 마우스.
【청구항 4]
1) TAZ유전자 녹아웃 카세트를 제조하는 단계 ;
2) 단계 1)의 TAZ 유전자 녹아웃 카세트를 배아줄기세포에 형질감염시키 : 단계;
3) 단계 2)의 배아줄기세포를 포배아의 포배강에 주입하여 키메라 마우스를 얻는 단계,
4) 단계 3)의 키메라 마우스로부터 ΤΑΖ+/— 유전형질을 갖는 이형접합체 마우 스를 얻는 단계; 및
5) 단계 4)의 이형접합체 마우스를 상호교배시켜 ΤΑΖ— 유전형질을 갖는 동 형접합체 마우스를 얻는 단계를 포함하는, ΤΑΖ 유전자가 녹아웃된 마우스의 제조방 법.
【청구항 5]
제 4항에 있어서, 상기 단계 1)의 ΤΑΖ유전자 녹아웃 카세트는 도 1의 Β에 도시된 개열지도를 갖는 것을 특징으로 하는 제조방법 .
【청구항 6]
1) 실험군으로서, 제 1항의 과산소 노출에 의한 폐손상모델 마우스에 피검 화합물 또는 조성물을 처리하는 단계 ;
2) 단계 1)의 피검화합물 또는 조성물이 처리된 실험군 마우스 및 피검화합 물 또는 조성물이 처리되지 않은 대조군 마우스로부터 각각 과산소 노출에 의한 폐 손상의 증상을 측정하는 단계 ; 및
3) 대조군에 비하여 실험군에서 과산소 노출에 의한 폐손상의 증상이 감소된 피검화합물 또는 조성물을 선별하는 단계를 포함하는, 과산소 노출에 의한 폐손상 치료제 후보물질의 스크리닝 방법.
【청구항 7】
제 6항에 있어서, 상기 단계 1)의 피검화합물 또는 조성물은 천연화합물, 합 성화합물, RNA, DNA, 폴리펩티드, 효소, 단백질, 리간드, 항체, 항원, 박테리아 또 는 진균의 대사산물 및 생활성 분자로 이루어진 군으로부터 선택되는 어느 하나인 것을 특징으로 하는 스크리닝 방법 .
【청구항 8】
제 6항에 있어서, 상기 단계 2)의 과산소 노출에 의한 폐손상 증상의 측정은 계면활성제 단백질 -A( surfactant protein-A), SP-B, SP-C, SP-D, 클라라세포 분비 단백질 (clara cell secretory protein, CCSP) , β-카테닌, VEGF, FGF-2, HNF3, F0XA2, HIF2- a , IL-6, TNF— a, MCP-1, 세포증식, 세포생존률,
술피레독신 (sulfiredoxin, Srx) 및 퍼록시레독신 술피닐화로 이루어진 군으로부터 선택되는 어느 하나 이상을 측정하는 것을 특징으로 하는 스크리닝 방법.
【청구항 9】
TAZ단백질에 특이적으로 결합하는 항체, 또는 상기 TAZ단백질를 암호화하 는 핵산에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 과산소 노출에 의한 폐손상 진단용 키트.
【청구항 10】
1) 실험군인 과산소 노출에 의한 폐손상이 의심되는 개체와 대조군인 과산소 노출에 의한 폐손상에 걸리지 않은 개체로부터 유래한 각각의 임상시료에서 TAZ유
전자 또는 단백질의 발현수준을 측정하는 단계 ; 및
2) 단계 1)의 실험군과 대조군의 TAZ 발현수준을 비교하여 실험군의 TAZ 발 현수준이 대조군에 비해 감소하는 경우 과산소 노출에 의한 폐손상 발병가능성이 있는 것으로 판정하는 단계를 포함하는, 과산소 노출에 의한 폐손상의 정보를 제공 하기 위한 단백질 검출 방법.
【청구항 11】
제 10항에 있어서, 단계 1)의 TAZ유전자의 발현수준은 RT-PCR법, 실시간 RT-PCR법, 마이크로어레이법, 노던블랏 (northern blotting), 유전자 발현의 연속 분석법 (SAGE, serial Analysis of Gene Expression) 및 RNase보호분석법 (RNase protection assay)으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 방법.
【청구항 12】
제 10항에 있어서, 단계 1)의 TAZ단백질의 발현수준은 웨스턴블랏 (Western blotting) , 효소一면역화학 검출법 (Enzymeᅳ linked immunosorbent assay, EL ISA) , 면 역조직화학 염색법 (i^unohistochemical staining) ,
면역침강 (immunoprecipitation) 및 면역형광법 (immunofluorescence)으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 방법.
【청구항 13]
제 10항에 있어서, 단계 1)의 임상시료는 조직, 세포, 전혈, 혈청, 혈장, 타 액, 뇌척수액 및 뇨로 이루어진 군으로부터 선택되는 것을 특징으로 하는 방법.
【청구항 14]
과산소 노출에 의한 폐손상 모델 마우스로 사용하기 위한
TAZ( transcriptional coactivator with PDZ-binding motif) 유전자가 녹아웃 (TAZ Λ )된 마우스.
【청구항 15]
과산소 노출에 의한 폐손상 진단용 키트로 사용하기 위한 ΤΑΖ 단백질에 특이 적으로 결합하는 항체, 또는 상기 ΤΑΖ 단백질를 암호화하는 핵산에 특이적으로 ¾ 합하는 프라이머 또는 프로브.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020110003666A KR101300777B1 (ko) | 2011-01-13 | 2011-01-13 | 과산소 노출에 의한 폐손상 모델 동물, 및 taz 마커를 이용한 과산소 노출에 의한 폐손상 진단용 키트 |
| KR10-2011-0003666 | 2011-01-13 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012096436A2 true WO2012096436A2 (ko) | 2012-07-19 |
| WO2012096436A3 WO2012096436A3 (ko) | 2012-09-07 |
Family
ID=46507526
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2011/008808 Ceased WO2012096436A2 (ko) | 2011-01-13 | 2011-11-17 | 과산소 노출에 의한 폐손상 모델 동물, 및 taz 마커를 이용한 과산소 노출에 의한 폐손상 진단용 키트 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR101300777B1 (ko) |
| WO (1) | WO2012096436A2 (ko) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115772539A (zh) * | 2022-11-17 | 2023-03-10 | 南京医科大学 | 一种具有ⅰ型气管发育不全表型的双侧肺脏缺失小鼠模型及其构建方法 |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102162283B1 (ko) * | 2017-11-28 | 2020-10-06 | 충남대학교 산학협력단 | Golga2 유전자 넉아웃 간 섬유화 마우스 모델 |
| KR102162289B1 (ko) * | 2017-11-28 | 2020-10-06 | 충남대학교 산학협력단 | Golga2 유전자 넉아웃 폐 섬유화 마우스 모델 |
| KR102235072B1 (ko) * | 2018-04-19 | 2021-04-02 | 이화여자대학교 산학협력단 | Taz 폴리펩티드를 포함하는 폐 질환 예방 또는 치료용 약학적 조성물 및 이를 이용한 방법 |
| WO2019212305A1 (ko) * | 2018-05-04 | 2019-11-07 | 사회복지법인 삼성생명공익재단 | 기관지 폐 이형성증 (bpd) 예방 또는 치료용 물질 스크리닝 방법 |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7514593B2 (en) * | 2003-05-30 | 2009-04-07 | The University Of North Carolina At Chapel Hill | Animal model for chronic obstructive pulmonary disease and cystic fibrosis |
| SG119251A1 (en) * | 2004-08-04 | 2006-02-28 | Agency Science Tech & Res | Methods |
-
2011
- 2011-01-13 KR KR1020110003666A patent/KR101300777B1/ko active Active
- 2011-11-17 WO PCT/KR2011/008808 patent/WO2012096436A2/ko not_active Ceased
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115772539A (zh) * | 2022-11-17 | 2023-03-10 | 南京医科大学 | 一种具有ⅰ型气管发育不全表型的双侧肺脏缺失小鼠模型及其构建方法 |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20120082271A (ko) | 2012-07-23 |
| WO2012096436A3 (ko) | 2012-09-07 |
| KR101300777B1 (ko) | 2013-08-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sadl et al. | The mouse Kreisler (Krml1/MafB) segmentation gene is required for differentiation of glomerular visceral epithelial cells | |
| US7632507B2 (en) | Synovial cell protein | |
| Hsu et al. | Mesenchymal nuclear factor IB regulates cell proliferation and epithelial differentiation during lung maturation | |
| Augustin et al. | Loss of epidermal Evi/Wls results in a phenotype resembling psoriasiform dermatitis | |
| Hong et al. | Cerebral cavernous malformations are driven by ADAMTS5 proteolysis of versican | |
| Prasad et al. | Pkd2 dosage influences cellular repair responses following ischemia-reperfusion injury | |
| Martino et al. | Endothelial SOCS3 maintains homeostasis and promotes survival in endotoxemic mice | |
| Pazirandeh et al. | Multiple phenotypes in adult mice following inactivation of the Coxsackievirus and Adenovirus Receptor (Car) gene | |
| WO2012096436A2 (ko) | 과산소 노출에 의한 폐손상 모델 동물, 및 taz 마커를 이용한 과산소 노출에 의한 폐손상 진단용 키트 | |
| JP2011083279A (ja) | 皮膚炎症性疾患の診断方法 | |
| Phelep et al. | MITF–A controls branching morphogenesis and nephron endowment | |
| US7273927B2 (en) | Mdm2 splice variants | |
| Nagarajan et al. | Ets1 blocks terminal differentiation of keratinocytes and induces expression of matrix metalloproteases and innate immune mediators | |
| Adams et al. | Follistatin-like 1 regulates renal IL-1β expression in cisplatin nephrotoxicity | |
| CN106994185B (zh) | Tie2对视网膜及其他组织中静脉血管的保护作用及应用 | |
| KR102592460B1 (ko) | 폐동맥고혈압 동물모델 및 이를 이용한 폐동맥고혈압 예방 또는 치료용 물질의 스크리닝 방법 | |
| Petersen et al. | A previously uncharacterized Factor Associated with Metabolism and Energy (FAME/C14orf105/CCDC198/1700011H14Rik) is related to evolutionary adaptation, energy balance, and kidney physiology | |
| Chou et al. | The thrombin receptor PAR1 orchestrates changes in lymphatic endothelial cell junction morphology to augment lymphatic drainage during lung injury | |
| Lin et al. | Expression of human carcinoembryonic antigen‐related cell adhesion molecule 6 and alveolar progenitor cells in normal and injured lungs of transgenic mice | |
| US20100061973A1 (en) | Graded Expression of Snail as Marker of Cancer Development and DNA Damage-Based Diseases | |
| EP2918166A1 (en) | TTP/MRP14 double knock out mouse model of psoriasis | |
| Meng et al. | Cardiac fibroblasts regulate cardiomyocyte hypertrophy through dynamic regulation of type I collagen | |
| JP5676892B2 (ja) | サイトグロビン遺伝子ノックアウト非ヒト癌モデル動物 | |
| JP2016064985A (ja) | 拡張性心不全を治療または診断するための組成物およびその利用 | |
| Ross | Evaluation of Podocalyxin-Like Protein in Zebrafish Liver Development and Liver Cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11855503 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 11855503 Country of ref document: EP Kind code of ref document: A2 |
