WO2012083004A2 - Blood-borne mirnas as surrogate markers of drug efficacy for cardiac conditions - Google Patents

Blood-borne mirnas as surrogate markers of drug efficacy for cardiac conditions Download PDF

Info

Publication number
WO2012083004A2
WO2012083004A2 PCT/US2011/065120 US2011065120W WO2012083004A2 WO 2012083004 A2 WO2012083004 A2 WO 2012083004A2 US 2011065120 W US2011065120 W US 2011065120W WO 2012083004 A2 WO2012083004 A2 WO 2012083004A2
Authority
WO
WIPO (PCT)
Prior art keywords
mir
hsa
mirna
level
heart failure
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2011/065120
Other languages
French (fr)
Other versions
WO2012083004A3 (en
Inventor
Eva Van Rooij
Brent Dickinson
Anita Seto
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Viridian Therapeutics Inc
Original Assignee
Miragen Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Miragen Therapeutics Inc filed Critical Miragen Therapeutics Inc
Priority to CN2011800675783A priority Critical patent/CN103370424A/en
Priority to EP11804873.5A priority patent/EP2652146A2/en
Priority to JP2013544771A priority patent/JP2014507123A/en
Priority to US13/994,622 priority patent/US20140024700A1/en
Priority to AU2011343719A priority patent/AU2011343719A1/en
Priority to CA2818174A priority patent/CA2818174A1/en
Publication of WO2012083004A2 publication Critical patent/WO2012083004A2/en
Publication of WO2012083004A3 publication Critical patent/WO2012083004A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/04Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to the detection of micro RNAs for evaluating or monitoring the efficacy of a therapeutic intervention for cardiac disorders, or for assessing the level of severity or disease progression of heart failure in a patient.
  • the invention further relates to treating patients for cardiac disorders.
  • ventricular assist device VAD
  • CRT cardiac resynchronization therapy
  • Pharmacological approaches can include but are not limited to the use of inotropic agents (i.e., compounds that increase cardiac contractility), neurohumoral blockers (e.g., beta-blockers, angiotensin converting enzyme inhibitors), aldosterone antagonists, diuretics, and vasodilators.
  • inotropic agents i.e., compounds that increase cardiac contractility
  • neurohumoral blockers e.g., beta-blockers, angiotensin converting enzyme inhibitors
  • aldosterone antagonists e.g., aldosterone antagonists
  • diuretics e.g., diuretics
  • vasodilators e.g., vasodilators
  • Micro RN As are a class of regulatory RNAs that post-transcriptionaily regulate gene expression. miRNAs are evo!utionarily conserved, small non-coding RNA molecules of approximately 18 to 25 nucleotides in length.
  • miRNAs base pair with specific "target” mRNAs and in doing so inhibit translation or promote mRNA degradation (Battel, Cell, 116, 281-297 (2004)). miRNAs act as repressors of target mRNAs by promoting their degradation, when their sequences are perfectly complementary, or by inhibiting translation, when their sequences contain mismatches.
  • MicroRNAs have been implicated in a number of biological processes including regulation and maintenance of cardiac function (see, Eva Van Rooij and Eric Olson, MicroRNAs: Powerful new regulators of heart disease and proactive therapeutic targets, J. Clin. Invest. 117(9):2369-2376 (2007); and Chien KR, Molecular Medicine: MicroRNAs and the tell-tale heart, Nature 447, 389-390 (2007)). miRNAs have also been reported to be involved in the development of organisms (Ambros, Cell 113: 673-676) and are differentially expressed in numerous tissues (Xu et al., 2003 Curr. Biol.
  • miRs represent a relatively new class of therapeutic targets for conditions suc as cardiac hypertrophy, myocardial infarction, heart failure, vascular damage, and pathologic cardiac fibrosis, among others.
  • the present invention is based in part on the surprising discovery that detection of miRNAs is useful for evaluating and monitoring the therapeutic efficacy for treatment of a cardiac disorder, and for guiding treatment decisions.
  • the present invention provides methods for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder.
  • Such methods comprise measuring or detecting the level of at least one miRNA (or detecting a panel of miRNAs) in a biological sample from a patient receiving the therapeutic intervention.
  • the level of the at least one miRNA in the biological sample is compared to a reference level, or the measured level of the at least one miRN A in a control sample.
  • the measured level of said at least one miRNA is indicative of the therapeutic efficacy of the therapeutic intervention.
  • an increase or decrease in the level of the miRNA is indicative of the efficacy of the therapeutic intervention.
  • the at least one miRNA is selected from a miRNA listed in any of Tables 2-4.
  • a plurality of miRNAs from Tables 2-4 are measured, and compared to reference levels or levels in control samples, so as to assess or monitor the therapy.
  • the patient sample may be classified as indicative of effective or non-effective intervention on the basis of a classifier algorithm.
  • the therapeutic intervention is a chemically-modified a tisense oligonucleotide targeting miR-208a and/or miR-208b or a standard of care therapy, such as angiotensin-eonverting enzyme (ACE) inhibitor.
  • ACE angiotensin-eonverting enzyme
  • a change in the measured level of the at least one miRNA relative to a sample from the patient taken prior to treatment or earlier during the treatment regimen is indicative of the therapeutic efficacy of the therapeutic intervention.
  • the cardiac disorder is a myocardial infarction, pathologic cardiac hypertrophy, heart failure, or hypertension.
  • the present invention also provides methods for altering the treatment regimen of a therapeutic entity comprising detecting the level of at least one miRNA in a biological sample from a patient receiving the therapeutic intervention and altering the treatment regimen based on an increase or decrease in the level of the at least one miRNA in said biological sample.
  • the present invention further provides methods of providing useful information for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder comprising determining the level of at least one miRNA in a biological sample of a patient and providing the level of the at least one miRNA to an entity that provides a determination of the efficacy based on an increase or decrease in the level of the at least one miRNA.
  • the present invention also encompasses a method of predicting or assessing the level of severity of heart failure or heart failure progression in a patient.
  • the method comprises measuring the level of at least one miRNA selected from Table 1 in a biological sample from a patient; and comparing the measured level to a reference level or the level of said at least one miRNA in a control sample, wherein the measured level of said at least one miRNA is indicative of the level of severity of heart failure or heart failure progression in the patient.
  • an increase or decrease in the level of the miRNA is indicative of the level of severity of heart failure or heart failure progression in the patient.
  • the invention provides a method for treating a patient for heart failure, the patient having elevated levels (e.g., serum or plasma levels) of one or more of miR- 223, miR-16, miR-93, miR- 106(b), and/or miR-423-5p, or other combination of up-regulated or down-regulated markers (e.g., combination of at least two) listed in Table i.
  • the patient is treated for heart failure with conventional therapy (such as an ACE inhibitor), or with an anti-miR therapeutic strategy described herein (e.g., anti-miR-208(b)).
  • the levels of miR-223, miR-16, miR-93, miR- 106(b) and/or miR-423-5p may be determined prior to treatment, and/or during treatment to monitor efficacy of the regimen.
  • the treatment is anti-miR-208(b), and the level of miR- 19(b) or a combination of markers listed in one or more of Tables 2-4 is monitored during treatment.
  • kits containing a reagent for measuring at least one miRNA in a biological sample, instructions for measuring the at least one miRNA and instructions for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder in a patient based on the level of the at least one miRNA.
  • the kit contains reagents for measuring from two to about twenty human miRNAs, including at least one, two, three, or more from Tables 2-4.
  • Kits for assessing or predicting the severity or progression of heart failure in a subject may comprise a reagent for measuring at least one miRNA in a biological sample and instructions for assessing heart failure severity or progression based on the level of the at least one miRNA are also included in the invention.
  • the kit reagent comprises a miRNA-specific primer and/or probe for reverse transcribing, amplifying, and/or hybridizing to one or more miRNAs described herein.
  • kits can further comprise one or more normalization controls and/or a TaqMan probe specific for each miRNA of the kit.
  • Kaplan-Meier survival curves in the Dahl hypertensive rat model show a pronounced decrease in survival in response to an 8% high-salt (HS) diet for both HS/saline and HS/ ' control groups, which is significantly improved in response to antirniR-208a treatment.
  • Rats were dosed every 2 weeks at 25 mg/kg starting 1 week after the HS diet, B.
  • Body weight analysis indicates that Dahl hypertensive rats on an 8% HS diet exhibit reduced weight gain compared to animals on a low-salt (LS) diet, whereas HS/antimiR-208a-treated rats show a significantly better maintenance in weight gain.
  • the "n" on the graph represents total survivors remaining at week 8 after the diet.
  • Rats were dosed ever ⁇ ' 2 weeks at 25 mg/kg (control) or the indicated dose of anti-miR-208a starting 1 week after the HS diet. Red lines on graphs separate the groups.
  • A. Real-time PCR analysis indicates a dose-dependent reduction of miR-208a in both left ventricle (LV) and right ventricle (RV), which corresponds to a dose-dependent reduction in mi.R-499.
  • miR-208b is increased in response to the HS diet, antimiR-208a significantly blunts this response.
  • Administration of a scrambled control chemistry had no effect on the expression of miR- 208a, miR-499 or mi -208b.
  • miR-499 in plasma serves as a biomarker for antimiR-208a efficacy.
  • A. Real-time PGR analysis on plasma samples indicates an increase in miR-499 in response to high-salt (HS) diet, whereas antimiR-208a significantly lowers the detection of miR-499 in plasma 8 weeks after the start of a 4% HS diet and 7 weeks after the onset of antimiR treatment.
  • RNA was isolated from plasma samples using Trizol-LS with glycogen assisted RNA precipitation (Invitrogen) and RT-PCR was performed using commercial miRNA Taqman assays from Applied Biosystems.
  • FIG. 4 Food intake of Dahl salt-sensitive rats. Based on ingested amount of diet, there are no significant differences between the treatment groups, excluding that the differences in weight gain and health are due to differences in intake of the HS diet in the Dahl hypertensive rats. Week 4 (A), Week 5 (B), Week 6 (C) and Week 7 (D) are shown.
  • FIG. 1 Plasma detection of muscle specific miRNAs. Plasma detection of raiR- 208a (A) and miR-1 (B), two muscle-specific miRNAs, reveals that levels of these miRN As show no response to antimiR-208a treatment in Dahl hypertensive rats.
  • FIG. Cardiac tissue markers demonstrating molecular efficacy following antimiR treatment. All analyses were performed 8 weeks after the start of a 4% high-salt (HS) diet and 7 weeks after the start of antimiR treatment, A. Real-time PCR analysis for miR-208a in cardiac tissue in the indicated groups. B. Real-time PCR analysis shows that HS diet reduces Myh6 expression and antimiR-208a treatment prevents this decrease. Treatment with the control oligonucleotide has no effect on the HS diet-induced decrease in Myh6 expression. C. Real-time PCR analysis shows that HS diet increases Myh7 expression, and treatment with an atiitmiR-208a oligonucleotide reduces this increase. Figure 7.
  • AntimiR-208a treatment improves survival in Dahl salt-sensitive rats on a high-salt diet.
  • a pronounced decrease in survival is observed in response to a 6% high-salt (HS) diet for both HS/saline and HS/1.5 mg/kg
  • Captopri l groups which is significantly improved in response to antimiR-208a (M-101G1) treatment.
  • No mortality was observed in the low-salt (LS) controls or HS -10101 -treated rats.
  • FIG. 10 Real time PGR analysis of miR-208a (A), miR-499 (B) and miR-208b (C) in cardiac tissue in rats in the indicated treatment groups. #p ⁇ 0.05 vs. LS/saline, *p ⁇ G.05 vs. HS/saline.
  • Figure 11 Real time PGR analysis of oMHC (Myh6, A), Myh7b (B), and PMHC
  • FIG. 13 Real time PGR analysis of plasma levels of miR-423-5p (A), miR ⁇ 106b (B), miR- 16 (C), miR-92a (D), miR-378 (E), miR-210 (F), miR-378* (G), miR-20b (H), and miR-93 (I) in rats in the indicated treatment groups. Plasma levels of these miRNAs correlated with efficacy of both antimiR-208a and captopril treatments.
  • Figure 14 Real time PCR analysis of plasma levels of miR-19b (A), miR-223 (B), miR-2! (C), and miR-150 (D) in rats in the indicated treatment groups.
  • Plasma levels of miR- 19b and miR-223 appeared to correlate with efficacy of antimiR-208a olignucleotide therapy whereas plasma levels of miR-21 and miR-150 appeared to correlate with efficacy of captopril therapy.
  • the methods of the present invention are based, in part, on the surprising discovery that the level of one or more miRNAs can be used as an indicator of the therapeutic efficacy of a therapeutic intervention for cardiac disorders or assessing the severity or disease progression of cardiac disorders, such as heart failure.
  • the present invention provides methods for evaluating and/or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder. These methods can include the step of measuring the level of at least one miRNA in a biological sample from a patient receiving a therapeutic intervention and comparing the measured level to a reference level or the level of at least one miRNA in a control sample. The measured level of the at least one miRNA is indicative of the therapeutic efficacy of the therapeutic intervention.
  • the method further comprises altering the therapeutic intervention based on the measured level of said at least one miRNA in the biological sample.
  • one aspect of the methods of the present invention is providing for measuring or detecting the level of at least one miRN A in a biological sample.
  • the microRNA whose level is measured or detected is an intron-embedded miRNA.
  • the microRNA whose level is measured or detected is expressed in heart tissue.
  • the microRNA whose level is measured is selected from a microRNA listed in any one of Tables 1-4.
  • the level of each microRNA in a panel of microRNAs selected from any one of Tables 2-4 is measured.
  • two or more, three or more, four or more, five or more, ten or more, fifteen or more, twenty or more, twenty five or more, thirty or more, thirty five or more, forty or more, fifty or more, sixty or more, seventy or more, eighty or more, or ninety or more microRNAs selected from one or more of Tables 1-4 are measured.
  • the level of one or more microRNAs or a panel of microRNAs selected from Table 4 are measured.
  • a panel of less than twenty, less than fifteen, less than ten, or less than five miRNAs are tested, the panel including one, two, three, four, or five miRNAs from any one of Tables 1-4, Where the patient is suspected of having heart failure, and/or suspected of being in need of therapy, the panel may comprise miRNAs listed in Table 1. Where the patient is undergoing therapy for heart failure, the panel may comprise miRNAs selected from Table 2, 3, or 4,
  • Measuring or detecting the amount of micro RNA in a sampl e can be performed in any manner known to one skilled in the art and such techniques for measuring or detecting the level of an miRN A are well known and can be readily employed.
  • a variety of methods for detecting miRNAs have been described and include Northern blotting, microarrays, electrochemical methods (oxidation of miRNA-ligated nanoparticles), bioluminescent, bioluminescent protein reassembly, BRET-based (BRET: bioluminescence resonance energy transfer), RT-PCR, fluorescence correlation spectroscopy and surface-enhanced Raman spectroscopy (see, e.g., Cissell, . A. and Deo, S. K., Trends in microRNA detection, Anal. Bioanal. Chenx, 394: 1109-1116 (2009); incorporated herein by reference in its entirety).
  • kits such as the qRT-PCR miRNA Detection Kit available from Ambion, U.S.A., which can be used for detecting and quantifying microRNA using quantitative reverse transcriptase polymerase chain reaction.
  • TaqMan MicroRNA Assays which employ a target-specific stem-loop reverse transcription primer to compensate for the short length of the mature miRNA, is also available from Applied Biosystems (Life Technologies, Inc., USA).
  • qSTAR MicroRNA Detection Assays commercially available from OriGene, Inc. (USA), can also be used.
  • kits such as PAXgene Blood miRNA Kit (which uses silica-based RNA purification technology) can be employed for isolating miRNAs of 18 nucleotides or longer, available from Qiagen, USA.
  • the mi Script PCR System a three- component system which converts miRNA and mRNA into cDNA and allows for detection of miRNAs using SYBR Green-based real-time PCR, can be employed for quantification of mature miRNA, precursor miRNA, and mRNA all from a single sample (also available from Qiagen, USA).
  • GeneCopoeia has a commercial kit available that is based on using RT-PCR in conjunction with SYBR Green for quantitation of miRNA (All-in-OneTM miRNA qRT- PCR Detection Kit, available from GeneCopoeia, Inc., USA).
  • mirVANA available from Life Technologies, Inc. (USA), employs glass fiber filter (GFF)-based method for isolating small As.
  • the methods for detecting the miRNA can also include hybridization-based technology platforms and massively-parallel next generation small RNA sequencing that allow for detection of multiple microRNAs simultaneously.
  • One commercially-available hybridization-based technology utilizes a sandwich hybridization assay with signal amplification provided by a labeled branched DNA (Panomics).
  • Another hybridization-based technology is available from Nanostring Technology (nCounter miRNA Expression Assay), where multiple miRNA sequences are detected and distinguished with tluorescently-labeled sequence tags. Examples of next-generation sequencing are available from Life Technologies (SOLID platform) and Illumina, Inc.
  • miRNAs can also be isolated by methods described in the art for isolating small RNA molecules (see, e.g., U.S. Patent Publication No.
  • Other methods for isolation of miRNA from a sample include employing a method comprising the following steps: a) obtaining a sample having an miRNA; b) adding an extraction solution to the sample; c) adding an alcohol solution to the extracted sample; d) applying the sample to a mineral or polymer support; and, e) el u ting the RNA containing the miRNA from the mineral or polymer support with an ionic solution.
  • Other procedures for isolating miRNA molecules from a sample can involve: a) adding an alcohol solution to the sample; b) applying the sample to a mineral or polymer solid support; c) e luting miRNA molecules from the support with an ionic solution; and, d) using or characterizing the miRNA molecules.
  • miRNA can also be isolated by methods involving separation of miRNA from rnRNA, such as those described in U.S. Patent Publication No. 20060019258; incorporated herein by reference in its entirety.
  • These methods comprise the steps of a) providing a biological isolate including rnRNA having a 5' cap structure and small RNA having a 5' phosphate; b) contacting the isolate with a phosphate reactive reagent having a label moiety under conditions wherein the label moiety is preferentially added to the 5' phosphate over the 5' cap structure, thereby producing labeled small RNA; and c) distinguishing the small RNA from the mRNA according to the presence of the label.
  • Examples of methods of isolating and/or quantifying microRNAs can also include but are not limited to hybridizing at least a portion of the microRNA with a fluorescent nucleic acid (a fluorescent probe), and reacting the hybridized microRNA with a fluorescent reagent, wherein the hybridized microRNA emits a fluorescent light or hybridizing at least a portion the microRNA to a radio-labeled complementary nucleic acid.
  • a fluorescent probe a fluorescent nucleic acid
  • fluorescent reagents There are commercially available products for fluorescent labeling and detection of miRNAs.
  • NCode miRNA Rapid Labeling System and NCode Rapid Alexa Fluor 3 miRNA Labeling System are both commercially available from Life Technologies, Inc. (USA).
  • fluorescent labels are commercially available and can include the Molecular Probes Alexa Flour dyes, available from Life Technologies, Inc.
  • Alexa Fluor 3 Alexa Fluor 5, Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500, Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, and Alexa Fluor 750.
  • Cy dyes including Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5 and Cy7,
  • the DyLight fluorophores available from TbermoScientific (USA), mcludmg DyLight 350, DyLight 405, DyLight 488, DyLight 550, DyLight 594, DyLight 633, DyLight 650, DyLight 680, DyLight 750 and DyLight 800.
  • FluoProbes include FluoProbes 390, FluoProbes 488, FluoProbes 532, FluoProbes 547H, FluoProbes 594, FluoProbes 647H, FluoProbes 682, FluoProbes 752 and FluoProbes 782.
  • Locked nucleic acid probes can also be employed.
  • the miRCURY LNA microRNA f SH Optimization Kits FFPE
  • This kit employs double DIG*-labeled miRCURY LNATM microRNA Detection that can be used for in situ hybridization and is commercially available from Exiqon (USA and Denmark).
  • a probe for detecting an miRNA can include a single-stranded molecule, including a single-stranded deoxyribonucleic acid molecule, a single-stranded ribonucleic acid molecule, a single-stranded peptide nucleic acid (PNA), or a single-stranded locked nucleic acid (LNA).
  • a single-stranded molecule including a single-stranded deoxyribonucleic acid molecule, a single-stranded ribonucleic acid molecule, a single-stranded peptide nucleic acid (PNA), or a single-stranded locked nucleic acid (LNA).
  • the probe is substantially complementary, for example 80%, 85%, 90%, 95%», 96%, 97%, 98%, 99% or 100% identical to the complement of the miRNA being detected, such that the probe is capable of detecting the miRNA,
  • the probe is substantially identical, 80%, 85%, 90%, 95%,96%, 97%, 98%, 99%, or 100% identical to the miRNA, such that the probe is capable of detecting the complement of the miRNA.
  • the probe is at least 5 nucleotides, at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides or at least 40 nucleotides.
  • the probe may be no longer than 25 nucleotides, no longer than 35 nucleotides; no longer than 50 nucleotides; no longer than 75 nucleotides, no longer than 100 nucleotides or no longer than 125 nucleotides in length.
  • the probe is substantially com lementary to or substantially identical to at least 5 consecutive nucleotides of the miRNA, for example at least 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 20, 21 and 22, or more consecutive nucleotides.
  • the probe can be 5-20, 5-25, 5-50, 50-100, or over 100 consecutive nucleotides long.
  • the methods for detecting the miRNA include realtime PGR, miRNA Taqman array cards, and Northern blot analysis.
  • the miRNAs detected include hsa-miR-542-3p, hsa-miR- 185, hsa-miR- 199a-5p, hsa-miR- 20b, hsa-miR-423-5p, hsa-miR-451, hsa-miR-140-5p, hsa-miR-93, hsa-miR-27a, hsa-miR- 365, hsa-miR- 148a, hsa-miR-20a, hsa-miR- 133a, hsa-miR- 106b, hsa-miR-16, hsa-miR- 18a, hsa-miR-26b,
  • the miRNAs detected include miR-423-5p, miR-106b, miR-16, miR-92a, miR-378, miR-210, miR-378*, miR-20b, miR-93, miR-19b, miR-223, miR-21 , miR-150, or combinations thereof.
  • the level of the miRNA In order to be used as an indicator of the therapeutic efficacy of a therapeutic intervention for cardiac disorders, the level of the miRNA must be determined.
  • the amount of microRNA in a patient sample can be compared to a standard amount of the microRNA present in patients with a cardiac disorder (e.g., heart failure) or in the healthy population (e.g., each of which may be referred to as a reference level).
  • the level is compared to the amount of microRNA in a control sample (a sample not from a cardiac disorder subject) or compared to the amount of the microRNA in a sample taken from a patient prior to treatment with a therapeutic intervention or a sample taken from an untreated patient.
  • Standard levels for a microRNA can be determined by determining the level of a microRNA in a sufficiently large number of samples obtained from normal, healthy control subjects to obtain a pre-determined reference or threshold value.
  • reference value refers to a pre-determined value of the level or concentration of a miRNA ascertained from a known sample.
  • a standard level can also be determined by determining the level of the microRNA in a sample from a patient prior to treatment with the therapeutic intervention. Further, standard level information and methods for determining standard levels can be obtained from publically available databases, as well as other sources. (See, e.g., Bunk, D.M., "Reference Materials and Reference Measurement Procedures: An Overview from a National Metrology Institute," Clin. Biochem. Rev., 28(4): 131-137 (2007); and Remington: The Science and Practice of Pharmacy, Twenty First Edition (2005).) In some embodiments, a known quantity of another miRNA that is not normally present in the sample is added to the sample (i.e.
  • the sample is spiked with a known quantity of exogenous miRN A) and the level of one or miRNAs of interest is calculated based on the known quantity of the spiked miRNA.
  • the comparison of the measured levels of the one or more miRNAs to a reference amount or the level of one or more of the miRNAs in a control sample can be done by any method known to a skilled artisan.
  • comparing the amount of the microRNA in a sample to a standard amount can include comparing the ratio between 5S rRNA (or the spiked miRNA) and the miRNA in a sample to a published or known ratio between 5S rRNA (or the spiked miRNA) and the miRNA in a control sample.
  • control sample may be obtained from any source known to not be affected by a cardiac disorder.
  • the level of miRNA in a sample taken from a patient after administration of a therapeutic intervention can also be compared to the level of miRNA in a sample taken from the patient prior to administration of a therapeutic intervention.
  • a difference (increase or decrease) in the measured level of the miRNA relative to the level of the miRNA in the control sample (e.g., sample in patient prior to treatment or an untreated patient) or a predetermined reference value is indicative of the therapeutic efficacy of the therapeutic intervention.
  • an increase in the measured level of the miRNA relative to the level of the mi RNA in the control sample or pre-determined reference value is indicative of the therapeutic efficacy of the therapeutic intervention.
  • the increase is indicative of therapeutic efficacy of the therapeutic intervention.
  • the level of one or more miRNAs selected from hsa ⁇ miR ⁇ 19b, hsa ⁇ miR ⁇ 199b-5p, hsa-miR-204, hsa-miR- 145, hsa-miR-195, hsa-miR-125a-5p, hsa-miR-143, and hsa-miR-214 is increased when compared to the level in a control sample or pre-determined reference value in response to a therapeutic intervention, the increase is indicative of therapeutic efficacy of the therapeutic intervention.
  • a reduction or decrease in the measured level of the miRNA relative to the level of the miRNA in the control sample (e.g., sample in patient prior to treatment or an untreated patient) or pre-determined reference value is indicative of the therapeu tic efficacy of the therapeutic intervention.
  • the level of one or more miRNAs selected from an miRNA listed in Tables 2 or 4 is decreased when compared to the level in a control sample or pre-determined reference value in response to a therapeutic intervention, the decrease is indicative of therapeutic efficacy of the therapeutic intervention.
  • hsa-miR- 16 when the level of one or more miRNAs selected from hsa-miR- 16, hsa-miR-320, hsa-miR-223, hsa-miR-93, hsa-miR-] 06b, hsa ⁇ miR ⁇ 423 ⁇ 5p, hsa-miR-185, hsa-miR-92a, hsa-miR-210, hsa-miR- 140, hsa-miR-27a, hsa-miR-20b, hsa-miR- 150, hsa-miR-20a, hsa-miR-378, hsa-miR-22, hsa-miR- 21, hsa-miR-378*, hsa-miR- 122, hsa-miR- 126, hsa-
  • Samples can include any biological sample from which miRNA can be isolated.
  • Such samples can include serum, blood, plasma, whole blood and derivatives thereof, cardiac tissue, skin, hair, hair follicles, saliva, oral mucous, vaginal mucous, sweat, tears, epithelial tissues, urine, semen, seminal fluid, seminal plasma, prostatic fluid, pre-ejaculatory fluid (Cowper's fluid), excreta, biopsy, ascites, cerebrospinal fluid, lymph, cardiac tissue, as well as other tissue extract samples or biopsies, in some embodiments, the biological sample is plasma or serum . In other embodiments, the biological sample is cardiac tissue.
  • the biological sample for use in the disclosed methods can be obtained from the patient at any point following the start of the therapeutic intervention.
  • the sample is obtained at least I, 2, 3, or 6 months following the start of the therapeutic intervention.
  • the sample is obtained least 1 , 2, 3, 4, 6 or 8 weeks following the start of the therapeutic intervention.
  • the sample is obtained at least 1, 2, 3, 4, 5, 6, or 7 days following the start of the therapeutic intervention.
  • the sample is obtained at least 1 hour, 6 hours, 12 hours, 18 hours or 24 hours after the start of the therapeutic intervention.
  • the sample is obtained at least one week following the start of the therapeutic intervention.
  • one or more miRNAs selected from any one of Tables 2-4 is measured between 1 and 8 weeks following administration of a miRNA-based therapeutic, such as an antisense oligonucleotide targeting a miRNA ⁇ e.g. anti-miR treatment).
  • a miRNA-based therapeutic such as an antisense oligonucleotide targeting a miRNA ⁇ e.g. anti-miR treatment.
  • one or more of the miRNAs is measured in plasma samples between 2 and 7 weeks after an anti-miR treatment.
  • one or more of the miRNAs is measured in plasma samples at 1, 2, 3, 4, 5, 6, 7 or 8 weeks after an anti-miR treatment.
  • one or more of the miRNAs is measured in plasma samples at 7 weeks after an anti-miR treatment.
  • the samples for analysis may contain, in some embodiments, between about 1 ng and about 100 ng of RNA. In some embodiments, the sample contains between about 10 ng and about 90 ng of RNA. In some embodiments, the sample contains between about 20 ng and about 80 ng.
  • the samples for analysis may also contain between 0.1 and 10 ⁇ of plasma RN A equivalents (purified RNA from volume of plasma). In some cases, the samples for analysis can contain between 0.5 ⁇ and 5 ⁇ !
  • the samples for analysis can contain about 0.1 ⁇ , 0.5 ⁇ , 1 ⁇ , 2 ⁇ , 3 ⁇ , 4 ⁇ , 5 ⁇ , 6 ⁇ , 7 ⁇ , 8 ⁇ , 9 ⁇ or 10 ⁇ of plasma RNA equivalents (purified RN A from volume of plasma).
  • the methods of the present invention can also include methods for altering the treatment regimen of a therapeutic intervention.
  • Such methods comprise detecting the level of at least one miRNA, such as one or more miRNAs listed in any one of Tables 2-4, in a biological sample from a patient receiving the therapeutic intervention and altering the treatment regimen based on an increase or decrease in the level of the at least one miRNA in said biological sample.
  • the method comprises detecting two, three, four, five, ten, or more miRNAs (e.g., including all miRNAs) listed in one or more of Table 2-4.
  • the miRNAs are detected using a customized detection platform, and thus less than 100, less than 50, or less than 25 miRN As are detected, including the miRNAs from Table 2 to 4.
  • Altering the treatment regimen can include but is not limited to changing and/or modifying the type of therapeutic intervention, the dosage at which the therapeutic intervention is administered, the frequency of administration of the therapeutic intervention, the route of administration of the therapeutic intervention, as well as any other parameters that would be well known by a physician to change and/or modify.
  • the therapeutic intervention is continued.
  • the therapeutic intervention is altered.
  • a panel of miRNAs is determined from one of Tables 1 -4, and the panel classified on the basis of a classifier algorithm. For example, samples may be classified on the basis of threshold values as described, or based upon Mean and/or Median miRNA levels in one population or versus another (e.g., a population of healthy controls and population of patients with heart failure, or levels based on effective versus ineffective therapy).
  • classification schemes are known for classifying samples between two or more classes or groups, and these include, without limitation; Principal Components Analysis, Naive Bayes, Support Vector Machines, Nearest Neighbors, Decision Trees, Logistic, Artificial Neural Networks, Penalized Logistic Regression, and Rule -based schemes, in addition, the predictions from multiple models can be combined to generate an overall prediction.
  • a classification algorithm or "class predictor" may be constructed to classify samples. The process for preparing a suitable class predictor is reviewed in R. Simon, Diagnostic and prognostic prediction using gene expression profiles in high- dimensional microarray data, British Journal of Cancer (2003) 89, 1599-1604, which review is hereby incorporated by reference in its entirety.
  • the information regarding the increase or decrease in the level of at least one miRNA can be used to determine the treatment efficacy of treatment with the therapeutic intervention, as well as to tailor the treatment regimens of therapeutic interventions.
  • the treatment efficacy can be used to determine whether to continue a therapeutic intervention.
  • the treatment efficacy can be used to determine whether to discontinue a therapeutic intervention.
  • the treatment efficacy can be used to determine whether to modify a therapeutic intervention.
  • the treatment efficacy can be used to determine whether to increase or decrease the dosage of a therapeutic intervention.
  • the treatment efficacy can be used to determine whether to change the dosing frequency of a therapeutic intervention.
  • the treatment efficacy can be used to determine whether to change the number or the frequency of administration of the therapeutic intervention. In some embodiments, the treatment efficacy can be used to determine whether to change the number of doses per day, per week, times per day. In some embodiments the treatment efficacy can be used to determine whether to change the dosage amount.
  • the methods of the present invention also provide methods for providing useful information for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder. These methods can include determining the level of at least one mi UNA, such as one or more miRNAs listed in any one of Tables 2-4, in a biological sample of a patient and providing the level of the at least one miRNA to an entity thai provides a determination of the efficacy based on an increase or decrease in the level of the at least one miRNA.
  • mi UNA such as one or more miRNAs listed in any one of Tables 2-4
  • the phrase "indicative of the therapeutic efficacy” and variants thereof can include any methods for determining that a therapeutic intervention is providing a benefit to a patient.
  • the terms "therapeutic efficacy” and variants thereof are generally indicated by alleviation of one or more signs or symptoms associated with a cardiac disorder and alleviation of one or more signs or symptoms of the cardiac disorder being treated can be readily determined by one skilled in the art.
  • “Therapeutic efficacy” may also refer to the prevention or amelioration of signs and symptoms of toxicities typically associated with standard therapeutic interventions for cardiac disorders. Methods for determining therapeutic efficacy may be specific to the cardiac disorder being treated and can include any methods well known in the art for determining that a treatment is providing a beneficial effect to a cardiac disorder patient.
  • evidence of therapeutic efficacy can include but is not limited to improvement or alleviation of one or more symptoms of cardiac hypertrophy, heart failure, or myocardial infarction in the subject, or in the delay in the transition from cardiac hypertrophy to heart failure.
  • the one or more improved or alleviated symptoms can include, for example, increased exercise capacity, increased cardiac ejection volume, decreased left ventricular end diastolic pressure, decreased pulmonary capillary wedge pressure, increased cardiac output, increased cardiac index, lowered pulmonary artery pressures, decreased left ventricular end systolic and diastolic dimensions, decreased cardiac fibrosis, decreased collagen deposition in cardiac muscle, decreased left and right ventricular wall stress, decreased wall tension, increased quality of life, and decreased disease related morbidity or mortality.
  • therapeutic efficacy can also include general improvements in the overall health of the patient, such as but not limited to enhancement of patient life quality, increase in predicted survival rate, decrease in depression or decrease in rate of recurrence of the indication. (See, e.g., Physicians' Desk Reference (2010).) Efficacy of a therapeutic intervention can also include evaluating or monitoring for the improvement of one or more symptoms of cardiac hypertrophy, heart fai lure, or myocardial infarction in the subject, or for the delay in the transition from cardiac hypertrophy to heart fai lure.
  • the one or more improved symptoms may include, for example, increased exercise capacity, increased cardiac ejection volume, decreased left ventricular end d astolic pressure, decreased pulmonary capillary wedge pressure, increased cardiac output, increased cardiac index, lowered pulmonary artery pressures, decreased left ventricular end systolic and diastolic dimensions, decreased cardiac fibrosis, decreased col lagen deposition in cardiac muscle, decreased left and right ventricular wall stress, decreased wall tension, increased quality of life and decreased disease related morbidity or mortality.
  • the measured levels of plasma miRNAs e.g., any of the miRNAs listed in Tables 2-4
  • the kit contains a reagent for measuring at least one miRNA selected from any one of Tables 2-4 in a biological sample, instructions for measuring the at least one miRNA and instructions for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder in a patient based on the level of the at least one miRNA.
  • the kit contains reagents for measuring the level of at least two, three, four, five, ten, or twenty miRNAs (or more), from one of Tables 2 or 3, or collectively from Tables 2 and 3.
  • the kit is customized for determining the efficacy of therapy for heart failure, and thus provides the reagents for determining 50 or less, 40 or less, 30 or less, or twenty five or fewer miRNAs, including the miRNAs of Tables 2 and 3.
  • the kit contains a reagent for measuring one or more miRNAs selected from hsa-miR-16, hsa-miR-320, hsa-miR-223, hsa-miR-93, hsa-miR-106b, hsa-miR- 423-5p, hsa-miR-185, lisa-niiR-92a, hsa-miR-210, hsa-miR- 140, hsa-miR-27a, hsa-miR-20b, hsa-miR- 150, hsa-miR-20a, hsa-miR-378, hsa-miR-22, hsa-miR-21, hsa-miR-378*, hsa-miR- 122, hsa-miR-126, hsa-miR
  • the kit contains a reagent for measuring one or more miRNAs selected from miR-423-5p, miR- 106b, miR-16, miR-92a, miR-378, miR-210, miR-378*, miR ⁇ 20b, miR-93, miR ⁇ i9b, miR- 223, miR-21 , miR-150, instructions for measuring one or more of these miRNAs, and instructions for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder in a patient based on the level of one or more of these miRNAs.
  • the kit contains an miRNA-specific primer for reverse transcribing or amplifying a miRNA selected from hsa-miR-16, hsa-miR-320, hsa-miR-223, hsa-miR-93, hsa-miR-106b, hsa-miR-423-5p, hsa-miR-185, hsa-miR-92a, hsa-miR-210, hsa-miR-140, hsa-miR-27a, hsa-mi.R-20b, hsa-miR-150, hsa-miR-20a, hsa-miR-378, hsa-miR-22, hsa-miR- 21, hsa-miR-378*, hsa-miR-122, hsa-miR-126, h
  • the kit contains a reagent for measuring one or more miRNAs in a biological sample that are indicative of the therapeutic efficacy of a miRNA-based therapeutic.
  • the kit contains a reagent for measuring one or more miRNAs selected from miR-19b, niiR-223, miR-423-5p, miR-106b, miR-16, niiR-92a, miR-378, miR-210, miR-378*, rmR ⁇ 2Qb, and miR-93 in a biological sample, instructions for measuring one or more of these miRNAs, and instructions for evaluating or monitoring the efficacy of a chemical ly-modified antisense oligonucleotide targeting miR-208a and/or miR- 208b for treating a cardiac disorder in a patient based on the levels of one or more of these miRNAs.
  • the kit contains reagents for measuring the level of at least two, three, four five, ten, or twenty miRNAs (or more), from one of Tables 2 or 3, or collectively from Tables 2 and 3.
  • the kit is customized for determining the efficacy of therapy for heart failure, and thus provides the reagents for determining 50 or less, 40 or less, 30 or less, or twenty five or fewer miRNAs, including the miRNAs of Tables 2 and 3.
  • the kit contains a reagent for measuring one or more miRNAs in a biological sample that are indicative of the therapeutic efficacy of a standard of care therapeutic, such as an angiotensin-converting enzyme (ACE) inhibitor.
  • a standard of care therapeutic such as an angiotensin-converting enzyme (ACE) inhibitor.
  • the kit contains a reagent for measuring one or more miRNAs selected from miR-150, miR-21, miR-223, miR-423-5p, miR-106b, miR-16, miR-92a, miR-378, miR-210, miR-378*, miR-20b, and miR-93 in a biological sample, instructions for measuring one or more of these miRNAs, and instructions for evaluating or monitoring the efficacy of an ACE inhibitor for treating a cardiac disorder in a patient based on the levels of one or more of these miRNAs.
  • ACE angiotensin-converting enzyme
  • the kit contains reagents for measuring the level of at least two, three, four five, ten, or twenty miRNAs (or more), from one of Tables 2 or 3, or collectively from Tables 2 and 3.
  • the kit is customized for determining the efficacy of therapy for heart failure, and thus provides the reagents for determining 50 or less, 40 or less, 30 or less, or twenty five or fewer miRNAs, including the miRNAs of Tables 2 and 3.
  • the kit can further contain one or more normalization controls.
  • the one or more normalization controls are provided as one or more separate reagents for spiking samples or reactions.
  • the normalization control can be added in a range of from about 0.1 fmol to about 5 mol. In some embodiments, the normalization control is added at about 0,1 fmol, 0.5 fmol, 1 fmol, 2 fmol, 3 fmol, 4 fmol or 5 fmol.
  • the at least one normalization control is a non-endogenous RNA or miRNA, or a miRNA not expressed in the sample. In some embodiments, the at least one normalization control is a C. elegans miRNA.
  • the at least one normalization control is cel-miR-2, cel-lin-4 or ath-miR-! 59a.
  • the C. elegans sequences used were cel-miR-2 (UAUCACAGCCAGCUUUGAUGUGC, SEQ ID NO:5), and cel-lin-4 (UCCCUGAGACCUCAAGUGUGA; SEQ ID NO:6).
  • the sequence for ath-miR159a used was (UUUGGAUUGAAGGGAGCUCUA, SEQ ID NO: 7).
  • the kit can further contain a TaqMan probe specific for each miRNA of the kit.
  • the TaqMan probe is specific for a miRNA selected from the group consisting of hsa-miR-16, hsa-miR-320, hsa-miR-223, hsa-mi.R-93, hsa-miR-106b, hsa-miR-423-5p, hsa-miR-185, hsa-miR-92a, hsa-mlR-210, hsa-miR-140, hsa-miR-27a, hsa-miR-20b, hsa-miR-150, hsa-miR-20a, hsa-miR-378, hsa-miR-22, hsa-miR- 21, hsa-miR-378*, hsa-miR-122, lisa-miR-126, hsa-miR
  • the kit is contemplated for use with a biological sample from a patient receiving treatment for a cardiac disorder.
  • the biological sample is plasma or serum obtained from a patient receiving treatment for a cardiac disorder.
  • the cardiac disorder is myocardial infarction, pathologic cardiac hypertrophy, heart failure or hypertension.
  • the components of the kits may be packaged either in aqueous media or in lyophilized form.
  • the container means of the kits will general!' include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably ali quoted.
  • the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed (e.g., sterile, pharmaceutically acceptable buffer and/or other diluents).
  • additional components e.g., sterile, pharmaceutically acceptable buffer and/or other diluents
  • various combinations of components may be comprised in a vial.
  • the kits of the present invention also will typically include a means for containing the nucleic acids, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow molded plastic containers into which the desired vials are retained.
  • the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred.
  • the components of the kit may be provided as dried powder(s).
  • the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.
  • kits may also include components that preserve or maintain the reagents or that protect against their degradation.
  • Such components may be DNAse-free, RNAse-free or protect against nucleases (e.g., RNAses and DNAses).
  • Such kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution.
  • kits will also include instructions for employing the kit components as well the use of any other reagent not included in the kit. Instructions may include variations that can be implemented.
  • kits of the invention are embodiments of kits of the invention. Such kits, however, are not limited to the particular items identified above and may include any reagent used for the manipulation or characterization of miRNA.
  • the therapeutic interventions of the present invention can include any combination of therapies used to treat cardiac disorders. Examples can include but are not limited to miRNA
  • therapeutics including antisense oligonucleotides), antihyperlipoproteinemic agent, an antiarteriosclerotic agent, an antithrombotic/fibrinolytic agent, a blood coagulant, an antiarrhythmic agent, an antihypertensive agent, a vasopressor, a treatment agent for congestive heart failure, an antianginal agent, an antibacterial agent or a combination thereof.
  • antisense oligonucleotides including antisense oligonucleotides, antihyperlipoproteinemic agent, an antiarteriosclerotic agent, an antithrombotic/fibrinolytic agent, a blood coagulant, an antiarrhythmic agent, an antihypertensive agent, a vasopressor, a treatment agent for congestive heart failure, an antianginal agent, an antibacterial agent or a combination thereof.
  • the therapeutic intervention is a miRNA based therapeutic.
  • the miRNA based therapeutic is an antisense oligonucleotide.
  • the antisense oligonucleotides may be ribonucleotides or deoxyribonucleotides.
  • the miRNA based therapeutic is an antisense oligonucleotide targeting a miRNA expressed in heart tissue.
  • the therapeutic intervention is an antisense oligonucleotide targeting miR-208a and/or miR-208b.
  • a change in the measured level of the miRNA relative to the level of the miRNA in the control sample or pre-detennined reference value is indicative of decreased expression of miR-208a and/or miR-208b in heart tissue.
  • miR-20b, and niiR-93 as compared to the level of said one or more miRNAs in a control sample or pre-determined reference value is indicative of the therapeutic efficacy of a chemically-modified antisense oligonucleotide targeting miR- 208a and/or miR-208b.
  • the level of miR-19b and/or miR-223 as compared to the level of miR-19b and/or miR-223 in a control sample or pre-determined reference value is indicative of the therapeutic efficacy of a chemically-modified antisense oligonucleotide targeting miR-208a and/or miR-208b.
  • an increase in the level of miR-19b as compared to the level of miR-19b in a control sample or predetermined reference value is indicative of decreased expression of miR-208a and/or miR- 208b in heart tissue.
  • a decrease in the level of miR-223 as compared to the level of miR-223 in a control sample or pre-determined reference value is indicative of decreased expression of miR-208a and/or miR-208b in heart tissue.
  • the antisense oligonucleotide therapeutics have at least one chemical modification (i.e., the oligonucleotide is chemically modified).
  • suitable antisense oligonucleotides may be comprised of one or more "conformationally constrained” or bicyclic sugar nucleoside modifications, for example, "locked nucleic acids.”
  • the miRNA based therapeutic is a chemically-modified antisense oligonucleotide.
  • the miRNA based therapeutic is a chemically- modified antisense oligonucleotide targeting a miRNA expressed in heart tissue
  • the chemically-modified antisense oligonucleotide targets miR-208a and/or miR-208b.
  • the miR-208a and miR-208b microRNAs have been described in WO 2008/016924,
  • the pre-miRNA encoding sequences for miR-2G8a for human is shown below as SEQ ID NO: 8 and the mature miR-208a sequence is provided in SEQ ID NO: 9. (See, e.g., PCT/US2010/023234, which is incorporated herein by reference in its entirety.)
  • the pre-miRNA encoding sequences for miR-208b for human is shown below as SEQ ID NO: 10 and the mature tniR-208b sequence is provided in SEQ ID NO: 11.
  • the antisense oligonucleotides targeting miR-208a/miR-208b can contain combinations of LNAs or other modified nucleotides and ribonucleotides or deoxyribonucleotides.
  • the antisense oligonucleotides may comprise peptide nucleic acids (PNAs), which contain a peptide-based. backbone rather than a sugar-phosphate backbone.
  • PNAs peptide nucleic acids
  • Other chemical modifications that the antisense oligonucleotides may contain include, but are not limited to, sugar modifications, such as 2'-0-alkyl (e.g.
  • antisense oligonucleotides particularly those of shorter lengths (e.g., less than 15 nucleotides) can comprise one or more affinity enhancing modifications, such as, but not limited to, LNAs, bi cyclic nucleosides, phosphonoformates, 2' O alkyl and the like.
  • suitable antisense oligonucleotides are 2 ' -O-methox ethyl "gapmers" which contain 2'-0 ⁇ methoxyeth)4-modified ribonucleotides on both 5' and 3' ends with at least ten deoxyribonucleotides in the center. These "gapmers” are capable of triggering RNase H-dependent degradation mechanisms of R.NA. targets.
  • Other modifications of antisense oligonucleotides to enhance stability and improve efficacy such as those described in U.S. Patent No. 6,838,283, which is herein incorporated by reference in its entirety, are known in the art and are suitable for use in the methods of the invention.
  • antisense oligonucleotides useful for inhibiting the activity of miR are about 5 to about 50 nucleotides in length, about 10 to about 30 nucleotides in length, or about 20 to about 25 nucleotides in length. In certain embodiments, antisense oligonucleotides targeting miR-208a and/or miR-208b are about 8 to about 18 nucleotides in length, and in other embodiments about 12 to 16 nucleotides in length.
  • any 8-mer or longer that is complementary to miR ⁇ 208a or miR-208b may be used, i.e., any antimir sequence that is complementary to any consecutive sequence in miR-208a or miR-208b, starting from the 5' end of the miR to the 3' end of the mature sequence.
  • Antisense oligonucleotides may in some cases comprise a sequence that is at least partially complementary to a mature miRNA sequence, e.g., at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a mature mi RNA sequence.
  • the antisense oligonucleotide may be substantially complementary to a mature miRNA sequence, that is at least about 95%, 96%>, 97%, 98%, or 99% complementary to a target polynucleotide sequence. In one embodiment, the antisense oligonucleotide comprises a sequence that is 100%) complementary to a mature miRNA sequence.
  • LNAs Locked nucleic acids
  • U.S. Patent 6,268,490 U.S. Patent 6,316,198, U.S. Patent 6,403,566, U.S. Patent 6,770,748, U.S. Patent 6,998,484, U.S. Patent 6,670,461 , and U.S. Patent 7,034,133, all of which are hereby incorporated by reference in their entireties.
  • LNAs are modified nucleotides or ribonucleotides that contain an extra bridge between the 2' and 4' carbons of the ribose sugar moiety resulting in a "locked” conformation.
  • Other suitable locked nucleotides that can be incorporated in the oligonucleotides of the invention include those described in U.S. Patent 6,833,361, which is hereby incorporated by reference in their entirety.
  • the antisense oligonucleotides are antagomirs.
  • “Antagomirs” are single-stranded, chemically-modified ribonucleotides that are at least partially complementary to the miRNA sequence.
  • Antagomirs may comprise one or more modified nucleotides, such as 2 '-O-m ethyl-sugar modifications. In some embodiments, antagomirs comprise only modified nucleotides. Antagomirs may also comprise one or more phosphorothioate linkages resulting in a partial or full phosphorothioate backbone. To facilitate in vivo delivery and stability, the antagomir may be linked to a steroid such as cholesterol, a fatty acid, a vitamin, a carbohydrate, a peptide or another small molecule ligand at its 3' end.
  • a steroid such as cholesterol, a fatty acid, a vitamin, a carbohydrate, a peptide or another small molecule ligand at its 3' end.
  • Antagomirs suitable for inhibiting miRNAs may be about 15 to about 50 nucleotides in length, more preferably about 18 to about 30 nucleotides in length, and most preferably about 20 to about 25 nucleotides in length. "Partially complementary” refers to a sequence that is at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a target polynucleotide sequence. The antagomirs may be at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a mature miRNA sequence.
  • the antagomir may be substantially complementary to a mature miRNA sequence, that is at least about 95%, 96%, 97%, 98%, or 99% complementary to a target polynucleotide sequence. In other embodiments, the antagomirs are 100% complementary to the mature miRNA sequence.
  • the therapeutic intervention also includes other standard cardiac therapies, in addition to microRNA targeted treatments as described above.
  • the therapeutic interventions of the present invention can include antihyperlipoproteinemic agent, an antiarteriosclerotic agent, an antithrombotic/fibrinolytic agent, a blood coagulant, an antiarrhythmic agent, an antihypertensive agent, a vasopressor, a treatment agent for congestive heart failure, an antianginal agent, an antibacterial agent or a combination thereof. See, e.g., U.S. Patent Application No. 2010/0317713, incorporated by reference herein in its entirety.
  • the present invention provides a method for evaluating or monitoring the efficacy of a standard of care cardiac therapy, such as an ACE inhibitor, by measuring the level of at least one miRNA in a biological sample.
  • the method comprises measuring the level of at least one miRNA selected from miR-150, miR-21 , miR-223, miR-423- 5p, miR-106b, miR-16, miR-92a, miR-378, miR-210, miR-378*, miR-20b, and miR-93 in a biological sample from a patient receiving the ACE inhibitor; and comparing the measured level to the level of said at least one miRNA in a control sample or pre-determined reference value, wherein the measured level of said at least one miRNA is indicative of the therapeutic efficacy of the ACE inhibitor.
  • the method comprises measuring the level of miR-21 and/or miR-150 in a biological sample from a patient receiving the ACE inhibitor; and comparing the measured level to the level of miR-21 and/or miR-150 in a control sample or pre-determined reference value, wherein the measured level of said at least one miRNA is indicative of the therapeutic effica cy of the ACE inhibitor.
  • the measured level of one or more miRNAs relative to the level of said one or more miRNAs in a control sample or pre-determined reference value is indicative of the therapeutic efficacy of a combination therapy.
  • the combination therapy can two or more miRNA-based therapeutics, two or more standard of care therapies, or a combination of a miRNA-based therapeutic and a standard of care therapy.
  • the combination therapy may be a chemically-modified antisense oligonucleotide targeting a miRNA expressed in the heart and a standard of care therapy, such as an ACE inhibitor.
  • a standard of care therapy such as an ACE inhibitor.
  • the combination therapy is a chemically-modified antisense oligonucleotide targeting miR-208a and/or miR-208b and an ACE inhibitor, such as captopril.
  • the level of one or more miRNAs selected from miR-21 , miR-150, miR-378, miR-378*, and miR-93 relative to the level of one or more of these miRNAs in a control sample or pre-determined reference value is indicative of the therapeutic efficacy of a combination therapy of an antimiR-208 oligonucleotide and an ACE inhibitor (e.g. captopril).
  • an ACE inhibitor e.g. captopril
  • the level of miR- 378 and/or miR-378* relative to the level of miR-378 and/or miR-378* in a control sample or pre-determined reference value is indicative of the therapeutic efficacy of a combination therapy of an antimiR-208 oligonucleotide and an ACE inhibitor (e.g. captopril).
  • an ACE inhibitor e.g. captopril
  • the invention provides a method for treating a patient for heart failure, the patient having elevated levels (e.g., serum or plasma levels) of one or more of miR- 223, miR-16, miR-93, miR- 106(b), and/or miR-423-5p, or other combination of up-regulated or down-regulated markers (e.g., combination of at least two) listed in Table 1.
  • the patient is treated for heart failure with conventional therapy (such as an ACE inhibitor), or with an anti-miR therapeutic strategy described herein.
  • the therapy is with an anti-miR-208(a) antisense inhibitor or an anti-miR-208(b) antisense inhibitor.
  • the levels of miR-223, miR-16, miR-93, raiR- 106(b) and/or miR-423-5p may be determined prior to treatment, and'or during treatment to monitor efficacy of the regimen.
  • the treatment is an antisense anti-miR-208(b) inhibitor, and the level of miR- 19(b) or a combination of markers listed in one or more of Tables 2-4 is monitored during treatment.
  • the anti-miR-208(b) therapy is as described herein or in U.S. Provisional Application No. 61/495,224, which is hereby incorporated by reference in its entirety.
  • the inhibitor may be an antisense inhibitor of from 10 to 18 nucleotides (e.g., 16 nucleotides), and/or containing nine locked nucleic acids, in addition to other chemical motifs.
  • the inhibitor may be M-10101 as described in U.S. Provisional Application No. 61 /495,224, and may be administered subcutaneously.
  • the therapeutic intervention includes administration of an agent that lowers the concentration of one of more blood lipids and'or lipoproteins, known herein as an "antihyperlipoproteinemic," can be part of the therapeutic interventions according to the present invention.
  • antihvperlipoproteinemics can include but are not limited to acifran, azacosterol, benfiuorex, p-benzaibutyramide, carnitine, chondroitin sulfate, clomestrone, detaxtran, dextran sulfate sodium, 5, 8, 11, 14, 17-eicosapentaenoic acid, eritadenine, furazabol, rneglutol, melinamide, mytatrienediol, ornithine, y-oryzanol, pantethine, pentaerythritol tetraacetate, a-phenylbutyramide, pirozadil, probucol (lore
  • antihyperlipoproteinemic agents can further comprise an ary 1 oxyalkanoic/fibric acid derivative, a resin/bile acid sequesterant, a HMG CoA reductase inhibitor, a nicotinic acid derivative, a thyroid hormone or thyroid hormone analog, a miscellaneous agent or a combination thereof.
  • ary loxyalkanoic/ fibric acid derivatives can include but are not limited to beciobrate, enzafibrate, binifibrate, ciprofibrate, clinofibrate, clofibrate (atromide-S), clofibric acid, etofibrate, fenofibrate, gemfibrozil (lobid), nicofibrate, pirifibrate, ronifibrate, simfibrate and theofibrate.
  • resins/bile acid sequesterants can include but are not limited to cholestyramine (cholybar, questran), colestipol (coiestid) and polidexide.
  • HMG CoA reductase inhibitors can include but are not limited to lovastatm (mevacor), pravastatin pravochol) and simvastatin (zocor).
  • nicotinic acid derivatives can include but are not limited to nicotinate, aceplmox, niceritrol, nicoclonate, nicomol and oximacic acid.
  • thyroid hormones and analogs thereof can include but are not limited to etoroxate, thyropropic acid and thyroxine.
  • an antiarteriosclerotic can include but are not limited to pyridine! carbamate.
  • administration of an agent that aids in the removal or prevention of biood clots may be combined with administration of a modulator, particularly in treatment of athersclerosis and vasculature (e.g. , arterial) blockages.
  • a modulator particularly in treatment of athersclerosis and vasculature (e.g. , arterial) blockages.
  • antithrombotic and/or fibrinolytic agents can include but are not limited to anticoagulants, anticoagulant antagonists, antiplatelet agents, thrombolytic agents, thrombolytic agent antagonists or combinations thereof.
  • antithrombotic agents that can be included are those that are administered orally, such as, for example, aspirin and warfarin (Coumadin).
  • Anticoagulants can include but are not limited to acenocoumarol, ancrod, anisindione, bromindione, clorindione, coumetarol, cyclocumarol, dextran sulfate sodium, projectumaroi, diphenadione, ethyl biseoumaeetate, ethylidene dicoumaroi, fluiiidione, heparin, hirudin, lyapoiate sodium, oxazidione, pentosan poiysuifate, phenindione, phenprocoumon, phosvitin, picotamide, tioclomarol and warfarin.
  • Antiplatelet agents can include but are not limited to aspirin, a dextran, dipyridamole
  • Thrombolytic agents can include but are not limited to tissue plasminogen activator (activase), plasmin, pro-urokinase, urokinase (abbokinase) streptokinase (streptase) and anistreplasel APSAC (eminase).
  • tissue plasminogen activator activase
  • plasmin pro-urokinase
  • abokinase abbrevator
  • streptokinase streptokinase
  • anistreplasel APSAC eminase
  • an agent that may enhance blood coagulation can also be employed.
  • blood coagulation promoting agents include thrombolytic agent antagonists and anticoagulant antagonists.
  • Thrombolytic agent antagonists can include but are not limited to amiocaproic acid (amicar) and tranexamic acid (amstat).
  • Anticoagulant antagonists can include but are not limited to protamine and vitamin K.
  • the therapeutic intervention is an antithrombotic/fibrinolytic agent.
  • Antithrombotic fibrinolytic agents can include but are not limited to anagrelide, argatroban, cilstazol, daltroban, defibroti.de, enoxaparin, fraxiparine, indobufen, lamoparan, ozagrel, picotamide, plailbride, tedeiparin, ticlopidine and trifiusal.
  • the therapeutic intervention is an antiarrhythmic.
  • Antiarrhythmic agents can include but are not limited to Class I antiarrhythmic agents (sodium channel blockers), Class II antiarrhythm c agents (beta-adrenergic blockers), Class III antiarrhythmic agents (repolarization prolonging drugs), Class TV antiarrhythmic agents (calcium channel blockers) and miscellaneous antiarrhythmic agents.
  • Examples of sodium channel blockers can include but are not limited to Class IA, Class IB and Class IC antiarrhythmic agents.
  • Class IA antiarrhythmic agents include disppyramide (norpace), procainamide (pronestyi) and qui idine (quinidex).
  • Class IB antiarrhythmic agents can include but are not limited to lidocaine (xylocaine), tocainide (tonocard) and mexiietine (mexiril).
  • Examples of Class IC antiarrhythmic agents can include but are not limited to encainide (enkaid) and flecainide (tambocor).
  • beta blocker otherwise known as a p-adrenergic blocker, a p-adrenergic antagonist or a Class II antiarrhythmic agent
  • acebutolol can include but are not limited to acebutolol (sectral), alprenolol, amosulaiol, arotinoiol, atenolol, befunolol, betaxoloi, bevantoloi, bisoproloi, bopindolol, bucumolol, bufetolol, bufuralol, bunitrolol, bupranolol, butidrine hydrochloride, butofilolol, carazolol, carteolol, carvedilol, celiproloi, cetamolol, cloranolol, dilevalol, epanoloi, esmolol (brevibloe), in
  • the beta blocker can comprise an aryloxypropanolamine derivative.
  • aryloxypropanolamine derivatives can include but are not limited to acebutolol, alprenolol, arotinoiol, atenolol, betaxolol, bevantoloi, bisoproloi, bopindolol, bunitrolol, butofilolol, carazolol, carteolol, carvedilol, celiproloi, cetamolol, epanoloi, indenolol, epindolol, metipranolol, metoprolol, moprolol, nadolol, nipradiloi, oxprenoloi, penbutolol, pindolol, propanolol, talinolol, tertatolol, ti
  • agents that prolong repolarization can include but are not limited to include amiodarone (cordarone) and sotalol (bumblece).
  • a calcium channel blocker otherwise known as a Class IV antiarrhythmic agent, can include but are not limited to an arylalkylamine (e.g., bepridiie, diltiazem, fendiline, gallopamii, prenylamine, terodiline, verapamil), a dihydropyridine derivative (feiodipine, isradipine, nicardipine, nifedipine, nimodipine, nisoldipine, nitrendipine) a piperazinde derivative (e.g., cinnarizine, flunarizrae, lidoflazine) or a micellaneous calcium channel blocker such as bencyclane, eta
  • arylalkylamine e.g., bepri
  • miscellaneous antiarrhythmic agents can include but are not limited to include adenosine (adenocard), digoxin (lanoxin), acecainide, ajmaline, amoproxan, aprindine, bretyiium tosylate, bunaftine, butobendine, capobenic acid, cifenline, disopyranide, hydro quinidine, indecainide, ipatropium bromide, lidocaine, lorajmine, lorcainide, meobentiiie, moricizine, pirmenol, prajrnaline, propafenone, pyrinoline, quinidine polygaiacturonate, quinidine sulfate and viquidil.
  • adenosine adenocard
  • digoxin lanoxin
  • acecainide ajmaline
  • amoproxan aprindine
  • the therapeutic intervention is an antihypertensive agent.
  • antihypertensive agents can include but are not limited to sympatholytic, alpha/beta blockers, alpha blockers, anti-angiotensin II agents, beta blockers, calcium channel blockers, vasodilators and miscellaneous antihypertensives.
  • an alpha blocker also known as an a-adrenergic blocker or an a-adrenergic antagonist
  • an alpha blocker can include but are not limited to amosulalol, arotinolol, dapiprazole, doxazosin, ergoloid mesylates, fenspiride, indoramin, labetaloL nicergoline, prazosin, terazosin, tolazoline, trimazosin and yohimbine.
  • an alpha blocker may comprise a quinazoline derivative.
  • Quinazoline derivatives can include but are not limited to aifuzosin, bunazosin, doxazosin, prazosin, terazosin and trimazosin.
  • an antihypertensive agent is both an alpha and beta adrenergic antagonist.
  • alpha/beta blocker can include but are not limited to labetalol (normodyne, trandate).
  • anti-angiotensin ⁇ agents can include but are not limited to angiotensin converting enzyme inhibitors and angiotensin II receptor antagonists.
  • Angiotensin converting enzyme inhibitors can include but are not limited to alacepril, enalapril (vasotec), captopril, cilazapril, delapril, enalaprilat, fosinoprii, Hsinopri], moveltopril, perindopril, quinapril and ramipril.
  • angiotensin II receptor blocker also known as an angiotensin II receptor antagonist, an ANG receptor blocker or an ANG-II type-1 receptor blocker (ARBS)
  • angiocandesartan eprosartan, irbesartan, losartan and valsartan.
  • Examples of a sympatholytic include a centrally acting sympatholytic or a peripherialiy acting sympatholytic.
  • Examples of a centrally acting sympatholytic, also known as an central nervous system (CNS) sympatholytic can include but are not limited to clonidine (catapres), guanabenz (wytensin) guanfacine (tenex) and methyldopa (aldomet).
  • Examples of a peripherally acting sympatholytic can include but are not limited to a ganglion blocking agent, an adrenergic neuron blocking agent, a ⁇ -adrenergic blocking agent or a alphal-adrenergic blocking agent.
  • Examples of a ganglion blocking agent include mecamylamine (inversine) and trimethaphan (arfonad).
  • Examples of an adrenergic neuron blocking agent can include but are not limited to guanefhidine (ismelin) and reserpine (serpasil).
  • Examples of a ⁇ -adrenergic blocker can include but are not limited to acenitolol (sectrai), atenolol (tenormin), betaxolol (kerlone), carteolol (cartrol), labetalol (normodyne, trandate), metoprolol (lopressor), nadanol (corgard), penbutolol (levatol), pindolol (visken), propranolol (Inderal) and timolol (blocadren).
  • alphal-adrenergic blocker can include but are not limited to prazosin (minipress), doxazocin (cardura) and terazosin (hytrin).
  • the therapeutic intervention can comprise a vasodilator (e.g. , a cerebral vasodilator, a coronary vasodilator or a peripheral vasodilator).
  • a vasodilator comprises a coronary vasodilator.
  • Examples of a coronary vasodilator include but are not limited to amotriphene, bendazol, benfurodil hemisuccinate, benziodarone, chloracizine, chromonar, clobenfuroi, clonitrate, dilazep, dipyridamole, droprenil amine, efloxate, erythrityl tetra itrane, etafenone, fendiline, floredii, ganglefene, herestrol bis(p-diethylaminoethyi ether), hexobendine, itramin tosylate, khellin, lidoflanine, mannitol hexanitrane, medibazine, nicorglycerin, pentaerythritol tetranitrate, pentrinitrol, perhexiline, pimefyiline, trapidil, tricromyl,
  • a vasodilator can comprise a chronic therapy vasodilator or a hypertensive emergency vasodilator.
  • a chronic therapy vasodilator can include but are not limited to hydralazine (apresoline) and minoxidil (loniten).
  • a hypertensive emergency vasodilator can include but are not limited to nitropmsside (nipride), diazoxide (hyperstat IV), hydralazine (apresoline), minoxidil (loniten) and verapamil
  • the therapeutic intervention can include an antihypertensive.
  • miscellaneous antihypertensives include but are not limited to ajmaline, ⁇ -amino butyric acid, bufeniode, cicletairiine, ciclosidomine, a cryptenamme tannate, fenoklopam, flosequinan, ketanserin, mebutamate, mecamylamine, methyldopa, methyl 4-pyridyl ketone tbiosemicarbazone, muzo limine , pargyiine, pempidine, pinacidil, piperoxan, primaperone, a protoveratrine, raubasine, rescimetol, rilmenidene, saralasin, sodium nitrorusside, ticrynafen, trimethaphan eamsyiate, tyrosinase and urapidil.
  • an antihypertensive can comprise an arylethanolamine derivative, a benzothiadiazine derivative, a N-carboxyalkyi(peptide/lactam) derivative, a dihydropyridine derivative, a guanidine derivative, a hydrazines/phthaiazirie, an imidazole derivative, a quaternary ammonium compound, a reserpine derivative or a suflonamide derivative.
  • arylethanolamine derivatives can include but are not limited to amosulalol, bufuralol, dilevalol, iabetaloi, pronethalol, sotalol and sulfinalol.
  • benzothiadiazine derivatives can include but are not limited to althizide, bendroflumethiazide, benztbiazide, benzylhydrochloro thiazide, buthiazide, chlorothiazide, chlorthalidone, cyclopenthiazide, cyclothiazide, diazoxide, epithiazide, ethiazide, fenquizone, hydrocblorothizi.de, hydro flumethizide, methyclothiazide, meticrane, metolazone, paraflutizide, polythiz de, tetrachlonnethiazide and trichlormethiazide.
  • N-carboxyalkyl(peptide/lactam) derivatives can include but are not limited to alacepril, captopril, cilazapril, delapril, enalapril, enalaprilat, fosinopril, lisinoprii, moveltiprii, perindoprii, quinapril and ramiprii.
  • dihydropyridine derivatives can include but are not limited to amiodipine, felodipine, isradipine, nicardipine, nifedipine, nilvadipine, nisoldipine and nitrendipine.
  • guanidine derivatives can include but are not limited to bethamdine, debrisoquin, guanabenz, guanacline, guanadrel, guanazodine, guanethidine, guanfaeine, guanochlor, guanoxabenz and guanoxan.
  • hydrazines/phthaiazines can include but are not limited to budralazine, cadralazine, dihydralazine, endralazine, hydracarbazine, hydralazine, pheniprazine, pildralazine and todralazine.
  • imidazole deri vati ves can include but are not limited to clonidine, fofexidine, phentolamine, tiamenidine and tolonidine.
  • quaternar ammonium compounds can include but are not limited to azamethonium bromide, chlorisondamine chloride, hexamethonium, pentacynium bis(methylsuifate), pentamethonium bromide, pentolinium tartrate, phenactropinium chloride and trimethidinium methosulfate.
  • reserpine derivatives can include but are not limited to bietaserpine, deserpidine, rescinnamine, reserpine and syrosingopiiie.
  • sulfonamide derivatives can include but are not limited to ambuside, clopamide, furosemide, indapamide, quinethazone, trip amide and xipamide.
  • agents for the treatment of congestive heart failure can include but are not limited to anti-angiotensin I I agents, afterload-preload reduction treatment, diuretics and inotropic agents.
  • agents for the treatment of congestive heart failure can include but are not limited to anti-angiotensin I I agents, afterload-preload reduction treatment, diuretics and inotropic agents.
  • a diuretic can include but are not limited to a thiazide or benzothiadiazine derivative (e.g.
  • althiazide bendroflumethazide
  • benzthiazide bendroflumethazide
  • benzylhydrochlorothiazide buthiazide
  • chlorothiazide chlorothiazide
  • chlorthalidone cyclopenthiazide
  • epithiazide ethiazide
  • ethiazide ethiazide
  • fenquizone hydrochlorothiazide, hydroflumethiazide, methyclothiazide, metierane, metoiazone, parafiutizide, polythizide, tetrachloromethiazide, trichlormefhiazide
  • an organomercurial e.g.
  • chlormerodrin e.g. , chlormerodrin, meralluride, mercamphamide, mercaptomerin sodium, mercumaliylic acid, mercumatilin dodium, mercurous chloride, mersaiyl), a pteridine (e.g. , furtereiie, triamterene), purines (e.g. , acefylline, 7-morpholinomethyltheophylline, pamobrom, protheobroniine, theobromine), steroids including aldosterone antagonists (e.g. , canrenone, oleandrin, spironolactone), a sulfonamide derivative (e.g.
  • acetazolamide ambuside, azosemide, bumetanide, butazolamide, chloraminophenamide, clofenamide, clopamide, clorexolone, diphenyimethane-4,4'-disulfonamide, disulfamide, ethoxzoiamide, furosemide, indapamide, mefruside, raethazolamide, piretanide, quinethazone, torasernide, trip araide , xipamide), a uracil (e.g., aminometradine, amisometradine), a potassium sparing antagonist (e.g.
  • amiloride triamterene
  • a miscellaneous diuretic such as aminozine, arbutin, chlorazanil, ethacrynic acid, etozolin, hydracarbazine, isosorbide, mannitol, metochalcone, muzo limine, perhexiline, ticmafen and urea.
  • Examples of a positive inotropic agent can include but are not limited to acefylline, an acetyidigitoxin, 2-amino-4-picoline, amrinone, benfurodii hemisuccinate, bucladesine, cerberosine, camphotamide, convallatoxin, cymarin, denopamine, deslanoside, digitalin, digitalis, digitoxin, digoxin, dobutamine, dopamine, dopexamine, enoximone, erythrophleine, fenalcomine, gitalin, gitoxin, glyeocyamine, heptaminol, hydrastinine, ibopamine, a ianatoside, metamivam, milrinone, nerifolin, oleandrin, ouabain, oxyfedrine, prenalterol, proscillaridine, resibufogen
  • an intropic agent is a cardiac glycoside, a beta-adrenergic agonist or a phosphodiesterase inhibitor.
  • a cardiac glycoside can include but are not limited to digoxin (ianoxin) and digitoxin (crystodigin).
  • Examples of a ⁇ -adrenergic agonist include but are not limited to albuterol, bambuterol, bitoiteroi, carbuterol, clenbuteroi, ciorprenaline, denop amine, dioxethedrine, dobutamine (dohutrex), dopamine (intropin), dopexamine, ephedrine, etafedrine, ethylnorepinephrine, fenoterol, formoterol, hex oprena line, ibopamine, isoetharine, isoproterenol, mabuterol, metaproterenol, methoxyphenamine, oxyfedrine, pirbuterol, procateroi, protokyloi, reproterol, rimiteroi, ritodrine, soterenoi, terbutahne, tretoquinol, tulobuterol and xamoterol
  • Antianginal agents may comprise organonitrates, calcium channel blockers, beta blockers and combinations thereof.
  • organonitrates also known as nitrovasodilators, can include but are not limited to nitroglycerin (nitro-bid, nitrostat), isosorbide dinitrate (isordil, sorbitrate) and amyl nitrate (aspirol, vaporoie).
  • Endothelin is a 21 -amino acid peptide that has potent physiologic and pathophysiologic effects that appear to be involved in the development of heart failure.
  • the effects of ET are mediated through interaction with two classes of cell surface receptors. Inhibiting the ability of ET to stimulate cells involves the use of agents that block the interaction of ET with its receptors.
  • Examples of endothelin receptor antagonists (ERA) can include but are not limited to Bosentan, Enrasentan, Ambrisentan, Darusentan, Tezosentan, Atrasentan, Avosentan, Clazosentan, Edonentan, sitaxsentan, TBC 371 1 , BQ 123, and BQ 788.
  • therapeutic intervention can include a secondary therapeutic aspect such as for example a surgery of some type, which includes, for example, preventative, diagnostic or staging, curative and palliative surgery.
  • Surgery and in particular a curative surgery, may be used in conjunction with other therapies, including one or more other agents as described herein.
  • Such surgical therapeutic agents for vascular and cardiovascular diseases and disorders are well known to those of skill in the art, and may include, but are not limited to, performing surgery on an organism, providing a cardiovascular mechanical prostheses, angioplasty, coronary artery reperfusion, catheter ablation, providing an implantable cardioverter defibrillator to the subject, mechanical circulatory support or a combination thereof.
  • Examples of a mechanical circulatory support thai may be used in the present invention comprise an intra - aortic balloon counterpulsation, left ventricular assist device or combination thereof.
  • the present invention also includes methods and kits for predicting or assessing the level of severity of heart failure or heart failure progression in a patient.
  • the present invention provides a method of predicting or assessing the level of severity of heart failure or heart failure progression in a patient comprising measuring the level of at least one miRNA selected from Table I in a biological sample from a patient; and comparing the measured level to the level of said at least one miRN A in a control sample (e.g. a sample obtained from a healthy, age-matched subject or a sample obtained from a subject not suffering from or diagnosed with heart failure) or pre-determined reference value, wherein the measured level of said at least one miRNA is indicative of the level of severity of heart failure or heart failure progression in the patient.
  • a control sample e.g. a sample obtained from a healthy, age-matched subject or a sample obtained from a subject not suffering from or diagnosed with heart failure
  • the biological sample can be any sample described herein. In certain embodiments, plasma or serum samples are preferred. In some embodiments, an increase in the measured level of the miRNA relative to the level of the miRNA in the control sample or pre-determined reference value is indicative of the level of severity of heart failure or heart failure progression in the patient.
  • the level of one or more miRNAs selected from hsa-miR-16, hsa- miR-223, hsa-rniR-320, hsa-miR-150, hsa-miR-378, hsa-miR-92a, hsa-rniR-423-5p, hsa- miR-133a, hsa-miR-22, hsa-miR-21, hsa-miR-210, hsa-miR ⁇ 2Gb, hsa-miR-499, hsa-miR- 378*, hsa-rniR-106b, hsa-miR- 155, and hsa-miR-93 is increased when compared to the level in a control sample or pre-determined reference value, the increase is indicative of the level of se verity of heart failure or heart failure progression in the patient
  • a reduction or decrease in the measured level of the miRNA relative to the level of the miRNA in the control sample is indicative of the level of severity of heart failure or heart failure progression in the patient.
  • the level of one or more miRNAs selected from hsa-miR-204, hsa-miR- 199b-5p, hsa- miR- 125a-5p, hsa-miR- 143, and hsa-miR- 195 is decreased when compared to the level in a control sample or pre-determmed reference value, the decrease is indicative of the level of severity of heart failure or heart failure progression in the patient.
  • kits for predicting or assessing the level of severity of heart failure or heart failure progression in a patient comprises a reagent for measuring at least one miRNA selected from Table 1 in a biological sample and instructions for measuring said at least one miRNA for predicting or assessing the level of severity of heart failure or heart failure progression in a patient.
  • the kit comprises a miRNA-specific primer for reverse transcribing or amplifying a miRNA selected from of hsa-miR-204, hsa-miR- 199b-5p, hsa-miR- 125a ⁇ 5p, hsa-miR- 143, hsa- miR- 195, hsa-miR- 16, hsa-miR-223, hsa-miR-320, hsa-miR- 150, hsa-miR-378, hsa-miR-92a, hsa-miR-423-5p, hsa-miR- 133a, hsa-miR-22, hsa-miR-21, hsa-miR-210, hsa-miR-20b, hsa-miR- 499, hsa-miR-378
  • kits can further comprise additional reagents described herein for kits for evaluating or monitoring the therapeutic efficacy of cardiac treatments, such as normalization controls and Taqman probes specific for each of the miRNAs in the kit.
  • Cardiac disorders can include any disorders that affect the cardiovascular system, including the heart and/or blood vessels, such as arteries and veins.
  • the cardiac disorders contemplated by the methods of the present invention can include cardiac diseases as well as cardiac failure. Cardiac disorders can also include disorders affecting the kidneys.
  • Cardiac disorders can include but are not limited to heart failure, cardiac hypertrophy, coronary heart disease, cardiovascular disease, cardiomyopathy, ischaemic heart disease, hypertensive heart disease, inflammatory heart disease, valvular heart disease, atherosclerosis, cardiorenal disease, renal disease and other renal disorders, in some embodiments, the cardiac disorder is myocardial infarction, pathologic cardiac hypertrophy, heart failure or hypertension.
  • Cardiovascular diseases can include but are not limited to diabetes mellitus, hypertension, hyperhomocysteinemia and hypercholesterolemia.
  • Cardiomyopathies can include but are not limited to alcoholic cardiomyopathy, coronary artery disease, congenital heart disease, ischemic (or ischaemic) cardiomyopathy, hypertensive cardiomyopathy, valvular cardiomyopathy, inflammatory cardiomyopathy and myocardiodystrophy.
  • Hypertensive heart diseases can include but are not limited to left ventricular hypertrophy, coronary heart, disease, heart failure (including congestive), hypertensive cardiomyopathy, cardiac arrhythmias and renal disorders.
  • Inflammatory heart diseases can include but are not limited to endocarditis, inflammatory cardiomegaly and myocarditis.
  • Example 1 Blood-borne miRNAs as Surrogate Markers of Drug Efficacy for Cardiac Conditions
  • RNA oligonucleotides have been shown to be effective in inactivating miRNAs in vivo through complementary base pairing (Elmen, J. et al. (2008) Nature 452, 896-899; Elmen, J. et al (2008) Nucleic Acids Res 36, 1153-1162; Krutzfeldt, J. et al. (2007) Nucleic Acids Res 35, 2885-2892; Krutzfeldt, J. et al. (2005) Nature 438, 685- 689; Lanford, R.E. et al. (2010) Science 327, 198-201), and represent a potentially effective means of inactivating pathological miRNAs.
  • This example describes the therapeutic efficacy in a heart failure model of an antisense oligonucleotide targeting miR-208a.
  • LNA locked nucleic acid
  • antisense oligonucleotides against miR-208a is sufficient to induce specific, potent, and sustained silencing of miR-208a in the heart.
  • anti-raiR-208a dose-dependently blunts stress-induced remodeling, functional deterioration, and cardiac myosin switching while improving general health and survival in a rat model of diastolic heart failure (Dahl salt-sensitive rats).
  • Dahl salt-sensitive rats diastolic heart failure
  • antimiR-208a inhibition To determine the therapeutic potential of mi.R-208a inhibition in vivo, we designed an antimiR targeting bases 2 to 17 of the 5' region of mature miR-208a and containing a combination of LNA and DN A linked by phosphorothioate bonds.
  • the sequence of the antimiR-208a which is referred to as M-10101 , was 5 '-CTTTTTGCTCGTCTT A-3 ' (SEQ ID NO: 12).
  • LS low-salt
  • HS high-salt
  • Anti-miR-208a caused a dose-dependent inhibition of miR-208a in both left and right ventricles 2 weeks after the last injection with anti-miR-208a, whereas a control oiigo showed no difference compared with saline ( Figure 2A).
  • miR-499 also showed a dose- dependent decrease in expression after sustained inhibition of miR-208a (Figure 2A).
  • miR- 208b was induced in both HS/saline- and HS/control-treated animals, paralleling the upregulation of ⁇ -myosin heavy chain; however, anti-miR-208a treatment resulted in a dose- dependent decrease in miR-208b levels (Figure 2A). This regulation of miR-499 and miR- 208b was confirmed by Northern blot analysis (Figure 2B). To assess the regulation of the myosin host genes, we examined Myh6, Myh7, and
  • Myh7b mRNA levels Myh7 was significantly increased in response to HS in both the HS/saline and HS/control groups. This increase was dose-dependently blunted in response to anti-miR-208a. Additionally, anti--miR-208a treatment normalized the decreased expression of Myh6 mRNA observed in both the HS/saline and HS/controi groups ( Figure 2C). Expression of Myhlh mirrored miR-499 levels, exhibiting a dose-dependent reduction on anti-miR-208a treatment. Furthermore, the dose-dependent regulation of MybJ was confirmed by Western blot (Figure 2D).
  • miR-499 although showing only modest increases in plasma detection under high salt, was significantly reduced in antimiR-208a-treated animals, suggesting miR-499 can act as a plasma-based marker for antimiR-208a efficacy (Figure 3). Additionally, miR-423-5p plasma levels, which were previously correlated to human heart failure (Tijsen, A. J., et al. (2010) Circ Res 106, 1035-1039), were found to be reduced in animals treated with antimiR-208a (Figure 3). Other muscle-specific miRNAs did not show significant differences between the groups tested ( Figure 5).
  • the results of this study indicate that therapeutic inhibition of miR-208 leads to a reduction in cardiac remodeling, which coincides with a significant improvement in survival and cardiac function during heart disease.
  • the efficacy of miR-208a inhibition in the heart can be monitored by measuring plasma levels of miR-499 and miR-423-5p as the plasma levels of these miRNAs correlated with miR-208a knockdown in heart tissue by an antimiR- 208 oligonucleotide.
  • plasma miRNA analysis showed that anti-miR-208a treatment results in a diminution of miR-499 and miR-423 ⁇ 5p in blood serum, which parallels the decrease in cardiac expression of Myh7b/miR-499 in response to anti-miR-208a treatment.
  • LNA-antimiR oligonucleotides were synthesized at miRagen Therapeutics, Inc. as unconjugated and fully phosphorothiolated oligonucleotides perfectly complementary to the 5' region of the mature miR-208a sequence.
  • the LNA control oligonucleotide consisted of a sequence directed against a C. elegans specific miRNA. Unless otherwise indicated, in vivo delivery of the oligonucleotide chemistries was achieved by low pressure intravenous (i.v.) injections via the tail vein or subcutaneous injections of either adult male C56B16 mice or adult male Dahl Salt-sensitive rats (Harlan, Indianapolis).
  • chemistries were dissolved and injected in a comparable end volume of saline after which the animals were examined for obvious side effects of the chemistries. Tissue samples were collected at the indicated timepoints for molecular or histological examination. Dahl rats were maintained on 0.25 NaCI or placed on 4% or 8% NaCl diet at 8 weeks of age (Harlan, I dianapolis).
  • Trizol Invitrogen
  • oligonucleotide probes were labeled with the Starfire Oligos Kit (IDT, Coralville, IA) and a ⁇ j2 P dATP (Amersham or Perkm Elmer). Probes were hybridized to the membranes overnight at 39°C in Rapid-hyb buffer (Amersham), after which they were washed twice for 10 minutes at 39°C with 0.5x SSC containing 0.1% SDS. The blots were exposed and quantified by Phosphorlmager analysis (GE HealthCare Life Sciences) and a U6 probe served as a loading control (ABI).
  • RNA from plasma samples was isolated using Trizol LS Reagent ( Invitrogen), using the manufacturer's protocol. Prior to RNA isolation, 250pmol of two different synthetic C. elegans miRNA sequences were added to serve as internal controls for normalization of target miRNAs.
  • the C. elegans sequences used were cel-miR-2 (UAUCACAGCCAGCUUUGAUGUGC, SEQ ID NO:5), and cel-lin-4 (UCCCUGAGACCUCAAGUGUGA; SEQ ID NO:6) (Dharmacon).
  • the final RNA pellet was re-suspended in a final volume equal to the initial plasma volume and 5 ⁇ 1 was used for subsequent RT-PCR reactions, as described above.
  • Plasma miRNAs are biomarkers of disease progression of heart failure ami therapeutic efficacy of antimiR-208 oligonucleotides.
  • the M-10591 oligonucleotide targets miR-67 from (1 elegans, which is not expressed in mammalian tissue, and therefore was used as a control.
  • Dahl salt- sensitive rats were implanted with catheters at week zero and baseline blood was taken. Following catheter implant surgery, high-salt diet was initiated. One week following the initiation of the 4.0% NaCl diet, rats were dosed subcutaneously (s.c.) with saline or a imiRs at 25 mg/kg once ever 2 weeks. On alternating weeks (non-injection weeks) 1.5 mis of blood was drawn from the catheter for plasma isolation. Animals were sacrificed 8 weeks after the initial injection. Plasma and tissue molecular endpoints were evaluated using Taqman RT-PCR assays.
  • RNA from plasma samples was isolated using Trizol LS (Invitrogen). Synthetic C. elegans miRNA sequences for iin-4 and miR-2 were added at a constant concentration to each sample to monitor purification efficiency and for normalization. Tissue RNA was isolated using standard Trizol RNA isolation. Standard ABI Taqman miRNA assay protocols were used to determine relative miRNA levels.
  • Table 1 Fold chasige of plasma miRNAs lai Healthy Rats vs. rats with hypertension- induced heart failure (LS-Saline vs. HS-Saline). Changes in plasma miRNA. levels between rats suffering from hypertension-induced heart fai lure (HS/saline group) and rats treated with an antimi R-208a oligonucleotide (HS/M- 10101) were assessed at 8 weeks by both miRNA Taqman array card analysis (Tables 2 and 3) and real-time PGR analysis (Table 4). Table 2. Fold ehas3 ⁇ 4ge of plasma mi NAs that are decreased in response to therapeutic treatment in rats with hypertension-induced heart failure (HS-saline/HS-10101) measured by miRNA Taqman array card analysis.
  • Example 3 Both Asitimi and Captopril Treatments Affect Circulating miRs
  • the Dahl salt-sensitive rat model of congestive heart failure (see Example 1) was used to evaluate the effects of different therapeutic approaches on plasma miRN A levels. Specifically, rats were treated with a LNA-containmg antimiR-208 oligonucleotide (M- 10101), Captopril (an angiotensin-convertmg enzyme (ACE) inhibitor), or a combination of the two ( -10101 + Captopril). he following experimental groups were evaluated:
  • rats were dosed subcutaneously (sc) with saline or oligonucleotides (M-10101 , 5 '-CTTTTTGCTCGTCTTA- 3' (SEQ ID NO: 12) or M-I0591, 5 ' -TCCTAGAAAGAGTAGA-3 ' (SEQ ID NO: 13)) at 25 mg kg every 2 weeks.
  • Captopril or water were dosed daily by oral gavage. Echocardiography was performed every 2 weeks starting one week post iv dosing. The Captopril dose for rat was selected to match the standard human dose in man. Plasma and tissue molecular endpoints were evaluated using Taqman RT-PCR assays.
  • Body weight graphs were generated by carrying over final body weights of those rats that died prior to the end of the study. As shown in Figure 9, only treatment with antimiR-208a (M-IQ! 01) alone significantly improved survival following placement of the animals on a high-salt diet (* p ⁇ 0.05; M- 10101, water vs. high-salt diet, saline-treated rats). No mortality was observed in the LS, saline controls or HS, M-l 0101-treated rats.
  • plasma miRNA levels from rats in each of the different treatment groups were measured to determine whether plasma miRNA levels were affected by other cardiac treatments, such as captopril.
  • Plasma levels of several miRNAs appeared to correlate with efficacy of both antimiR-208a oligonucleotide and Captopril therapy appeared to correlate with efficacy of both antimiR-208a oligonucleotide and Captopril therapy (Figure 13A-I).
  • real time PCR analysis showed that miR- 423-5p, mi.R-106b, mi -16, miR-92a, miR-378, mi.R-210, miR-378*, miR-20b, and miR-93 were decreased in response to both antimiR-208a and Captopril treatment.
  • Plasma levels of other miRNAs were correlated with either antimiR-208a oligonucleotide therapy or Captopril therapy. For instance, plasma levels of miR-19B were significantly increased in animals that received the antirniR-208a oligonucleotide ( Figure 14 A). Although plasma levels of miR-223 were significantly reduced in response to both types of treatment, a more significant decrease was observed in animals receiving the aiitimiR-208a oligonucleotide ( Figure 14B). In contrast, levels of miR-21 and miR-150 in plasma were reduced specifically with Captopril treatment ( Figures 14C-D).
  • plasma miRNA levels can be used to not only monitor efficacy of cardiac therapies in general, but also to monitor the efficacy of specific therapeutic interventions or combined treatments.
  • LNA-modified antimiRs Animals and delivery of LNA-modified antimiRs.
  • the L ' NA-antimi oligonucleotides were synthesized at miRagen Therapeutics, Inc. as unconjugated and fully phosphorothioiated oligonucleotides perfectly complementary to the 5' region of the mature miR ⁇ 208a sequence.
  • the LNA control oligonucleotide consisted of a sequence directed against a C. elegans specific miRNA. Unless else indicated, in vivo deliver ⁇ ' of the oligonucleotide chemistries was achieved by low pressure intravenous (i.v.) injections via the tail vein or subcutaneous injection of adult male Dahl Salt-sensitive rats (Harlan, Indianapolis).
  • Ail chemistries were dissolved and injected in a comparable end volume of saline after which the animals were examined for obvious side effects of the chemistries. Tissue samples were collected at the indicated timepomts for molecular or histological examination. Dahl rats were maintained on 0.25 NaCl or placed on 4%, 6% or 8% NaCl diet at 8 weeks of age (Harlan, Indianapolis).
  • Trizol Invitrogen
  • To detect the level of miR-208 R.T-PCR. was performed using the Taqman MicroRNA assay (Applied Biosystems, ABI) according the manufacturer's recommendations, using 10-100 ng of total RNA.
  • RNA from plasma samples was isolated using Trizol LS Reagent (Invitrogen), using the manufacturer's protocol Prior to RNA isolation, 250pmol of two different synthetic C. elegans miRNA sequences were added to serve as internal controls for normalization of target miRNAs, The C. elegans sequences used were cel-miR-2 (UAUCACAGCCAGCUUUGAUGUGC, SEQ ID NO:5), and cel-lin-4 (UCCCUGAGACCUCAAGUGUGA; SEQ ID NO:6) (Dharmacon). The final RNA pellet was re-suspended in a final volume equal to the initial plasma volume and 5 ⁇ 1 was used for subsequent RT-PCR reactions, as described above.
  • Trizol LS Reagent Invitrogen

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Cardiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Urology & Nephrology (AREA)
  • Pathology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Epidemiology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Hospice & Palliative Care (AREA)

Abstract

The present invention provides methods for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder. Such methods comprise measuring or detecting the level of at least one miRNA in a biological sample from a patient receiving the therapeutic intervention and comparing the level to the level of said at least one miRNA in a control sample, wherein the measured level of said at least one miRNA is indicative of the therapeutic efficacy of the therapeutic intervention. Methods of predicting or assessing the severity or progression of heart failure in a patient by measuring one or more miRNAs in a biological sample from the patient are also disclosed.

Description

BLOOD-BORNE miR As AS SURROGATE MARKERS OF DRUG EFFICACY FOR
CARDIAC CONDITIONS
PRIORITY This Application claims priority to U.S. Provisional Application No. 61/538,585, filed
September 23, 2011, to U.S. Provisional Application No. 61/495,220, filed June 9, 2011, and to U.S. Provisional Application No. 61/423,456, filed December 15, 2010, each of which are hereby incorporated by reference in their entireties.
FI ELD OF THE INVENTION The present invention relates to the detection of micro RNAs for evaluating or monitoring the efficacy of a therapeutic intervention for cardiac disorders, or for assessing the level of severity or disease progression of heart failure in a patient. The invention further relates to treating patients for cardiac disorders.
BACKGROUND
Current treatments for cardiac disorders, including heart failure, include pharmacological methods, devices such as the ventricular assist device (VAD), cardiac resynchronization therapy (CRT), and heart transplantation. Pharmacological approaches can include but are not limited to the use of inotropic agents (i.e., compounds that increase cardiac contractility), neurohumoral blockers (e.g., beta-blockers, angiotensin converting enzyme inhibitors), aldosterone antagonists, diuretics, and vasodilators. However, none of these agents is fully effective either alone or in combination. Availability of transplants is highly limited, and since many individuals suffering from heart failure are in poor health, they are frequently not good surgical candidates. For these reasons, heart failure remains a major cause of morbidity and mortality, particularly in the developed world. In addition, it can be difficult to determine the precise etiology of heart failure, a factor impeding the development of more specific therapies. Furthermore, there is a general lack of diagnostic techniques at the molecular level. Thus, there is a need in the art for the discover}' of additional diagnostic markers to assist in evaluating the severity of heart failure and its response to treatment, both current and yet to be described. The present invention addresses the foregoing needs, among others. Micro RN As (miRNAs, microRNAs or rniRs) are a class of regulatory RNAs that post-transcriptionaily regulate gene expression. miRNAs are evo!utionarily conserved, small non-coding RNA molecules of approximately 18 to 25 nucleotides in length. miRNAs base pair with specific "target" mRNAs and in doing so inhibit translation or promote mRNA degradation (Battel, Cell, 116, 281-297 (2004)). miRNAs act as repressors of target mRNAs by promoting their degradation, when their sequences are perfectly complementary, or by inhibiting translation, when their sequences contain mismatches.
MicroRNAs have been implicated in a number of biological processes including regulation and maintenance of cardiac function (see, Eva Van Rooij and Eric Olson, MicroRNAs: Powerful new regulators of heart disease and proactive therapeutic targets, J. Clin. Invest. 117(9):2369-2376 (2007); and Chien KR, Molecular Medicine: MicroRNAs and the tell-tale heart, Nature 447, 389-390 (2007)). miRNAs have also been reported to be involved in the development of organisms (Ambros, Cell 113: 673-676) and are differentially expressed in numerous tissues (Xu et al., 2003 Curr. Biol. 13:790-795; Landgraf et al., 2007 Ceil 129: 1401-14), in viral infection processes (Pfeffer et al., 2004 Science 304: 734-736), and associated with oncogenesis (Calin, et al., 2004 Proc. Natl. Acad. Sci. USA 101 : 2999- 3004; Calin et al, 2002, Proc. Natl. Acad. Sci. USA 99(24): 15524-15529). Therefore, miRs represent a relatively new class of therapeutic targets for conditions suc as cardiac hypertrophy, myocardial infarction, heart failure, vascular damage, and pathologic cardiac fibrosis, among others. The present invention is based in part on the surprising discovery that detection of miRNAs is useful for evaluating and monitoring the therapeutic efficacy for treatment of a cardiac disorder, and for guiding treatment decisions.
SUMMARY OF THE INVENTION
The present invention provides methods for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder. Such methods comprise measuring or detecting the level of at least one miRNA (or detecting a panel of miRNAs) in a biological sample from a patient receiving the therapeutic intervention. In some embodiments, the level of the at least one miRNA in the biological sample is compared to a reference level, or the measured level of the at least one miRN A in a control sample. The measured level of said at least one miRNA is indicative of the therapeutic efficacy of the therapeutic intervention. In some cases, an increase or decrease in the level of the miRNA is indicative of the efficacy of the therapeutic intervention. In some embodiments, the at least one miRNA is selected from a miRNA listed in any of Tables 2-4. In some embodiments, a plurality of miRNAs from Tables 2-4 are measured, and compared to reference levels or levels in control samples, so as to assess or monitor the therapy. Where a panel of miRNAs are determined in the patient sample, the patient sample may be classified as indicative of effective or non-effective intervention on the basis of a classifier algorithm. In some embodiments, the therapeutic intervention is a chemically-modified a tisense oligonucleotide targeting miR-208a and/or miR-208b or a standard of care therapy, such as angiotensin-eonverting enzyme (ACE) inhibitor. Based on the measured miRNAs levels, therapy may be continued or altered, e.g., by change of dose or dosing frequency, or by addition of other active agents, or change of therapeutic regimen altogether.
In some embodiments, a change in the measured level of the at least one miRNA relative to a sample from the patient taken prior to treatment or earlier during the treatment regimen is indicative of the therapeutic efficacy of the therapeutic intervention.
In some embodiments, the cardiac disorder is a myocardial infarction, pathologic cardiac hypertrophy, heart failure, or hypertension.
The present invention also provides methods for altering the treatment regimen of a therapeutic entity comprising detecting the level of at least one miRNA in a biological sample from a patient receiving the therapeutic intervention and altering the treatment regimen based on an increase or decrease in the level of the at least one miRNA in said biological sample. The present invention further provides methods of providing useful information for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder comprising determining the level of at least one miRNA in a biological sample of a patient and providing the level of the at least one miRNA to an entity that provides a determination of the efficacy based on an increase or decrease in the level of the at least one miRNA.
The present invention also encompasses a method of predicting or assessing the level of severity of heart failure or heart failure progression in a patient. In one embodiment, the method comprises measuring the level of at least one miRNA selected from Table 1 in a biological sample from a patient; and comparing the measured level to a reference level or the level of said at least one miRNA in a control sample, wherein the measured level of said at least one mi RNA is indicative of the level of severity of heart failure or heart failure progression in the patient. In some embodiments, an increase or decrease in the level of the miRNA is indicative of the level of severity of heart failure or heart failure progression in the patient.
In still other aspects, the invention provides a method for treating a patient for heart failure, the patient having elevated levels (e.g., serum or plasma levels) of one or more of miR- 223, miR-16, miR-93, miR- 106(b), and/or miR-423-5p, or other combination of up-regulated or down-regulated markers (e.g., combination of at least two) listed in Table i. In accordance with this aspect, the patient is treated for heart failure with conventional therapy (such as an ACE inhibitor), or with an anti-miR therapeutic strategy described herein (e.g., anti-miR-208(b)). The levels of miR-223, miR-16, miR-93, miR- 106(b) and/or miR-423-5p may be determined prior to treatment, and/or during treatment to monitor efficacy of the regimen. In some embodiments, the treatment is anti-miR-208(b), and the level of miR- 19(b) or a combination of markers listed in one or more of Tables 2-4 is monitored during treatment.
Another aspect of the invention is a kit containing a reagent for measuring at least one miRNA in a biological sample, instructions for measuring the at least one miRNA and instructions for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder in a patient based on the level of the at least one miRNA. In some embodiments, the kit contains reagents for measuring from two to about twenty human miRNAs, including at least one, two, three, or more from Tables 2-4. Kits for assessing or predicting the severity or progression of heart failure in a subject may comprise a reagent for measuring at least one miRNA in a biological sample and instructions for assessing heart failure severity or progression based on the level of the at least one miRNA are also included in the invention. In some embodiments, the kit reagent comprises a miRNA-specific primer and/or probe for reverse transcribing, amplifying, and/or hybridizing to one or more miRNAs described herein. Such kits can further comprise one or more normalization controls and/or a TaqMan probe specific for each miRNA of the kit.
DESCRIPTION OF THE FIGURES
Figure 1. Therapeutic silencing of miR-208a is beneficial during heart failure. A,
Kaplan-Meier survival curves in the Dahl hypertensive rat model show a pronounced decrease in survival in response to an 8% high-salt (HS) diet for both HS/saline and HS/'control groups, which is significantly improved in response to antirniR-208a treatment. Rats were dosed every 2 weeks at 25 mg/kg starting 1 week after the HS diet, B. Body weight analysis indicates that Dahl hypertensive rats on an 8% HS diet exhibit reduced weight gain compared to animals on a low-salt (LS) diet, whereas HS/antimiR-208a-treated rats show a significantly better maintenance in weight gain. For A and B, n~6 for LS/Saline; n=15 for HS/'Saiiiie and HS/Control; and n=14 for HS/antimiR-208a. The "n" on the graph represents total survivors remaining at week 8 after the diet. C. Body weight analysis of Dahl rats on the 4% HS diet shows significant reductions in weight gain compared to LS diet controls, whereas both 5 and 25 mg/kg injections every 2 weeks are sufficient to maintain weight gain comparable to that in animals on a normal diet. D„ Echocardiography measurements indicate that the increase in isovolumic relaxation time (IVRT) and decrease in mitral valve early to active filling velocity ratio (MV E/A) in response to 4% HS diet are significantly improved in response to antirniR-208a treatment 8 weeks after the start of the diet. For C and D, n=10 for all groups. E. Representative images of hematoxylin and eosin (H&E)- and Picrosirius Red- stained left ventricular histological sections indicate an increase in cardiomyocyte hypertrophy and perivascular fibrosis in response to the 4% HS diet for 8 weeks, whereas both parameters are reduced in response to antimiR-208a treatment. F. Bar-graph representation of histological quantification showing significantly less hypertrophy and fibrosis in the presence of antimiR-208a. In D and F, error bars depict SEM, * p<0.05 vs. HS saline, # p<0.Q5 vs. LS saline, Figure 2. AntimiR~208a treatment reduces niiR~499 and Myh7 in Dahl salt- sensitive rats. All analyses were performed 8 weeks after the start of a 4% high-salt (HS) diet and 7 weeks after the start of antimiR treatment (n=10 for all groups in A and C), In B and D, each lane is a representative animal from the n=10 group. Rats were dosed ever}' 2 weeks at 25 mg/kg (control) or the indicated dose of anti-miR-208a starting 1 week after the HS diet. Red lines on graphs separate the groups. A. Real-time PCR analysis indicates a dose-dependent reduction of miR-208a in both left ventricle (LV) and right ventricle (RV), which corresponds to a dose-dependent reduction in mi.R-499. Although miR-208b is increased in response to the HS diet, antimiR-208a significantly blunts this response. Administration of a scrambled control chemistry had no effect on the expression of miR- 208a, miR-499 or mi -208b. B. Regulation of miR-499 and miR-208b in response to antimiR-208a treatment shown by Northern blot analysis. C. Real-time PCR analysis shows that HS diet reduces Myh6 and increases Myh7. AnitmiR-208a treatment dose-dependently increases Myh6 expression and reduces Myh7b expression. The HS diet-induced increase in Myh7 is dose-dependently reduced by antimiR-208a. D. Western blot analysis for Myh7 from ventricular tissue confirms the dose-dependent reduction in response to antimiR-208a treatment. GAPDH is used as a loading control. E. Quantification of ΗΡΙβ Western blot showing miR-208a target derepression in the presence of anti-miR-208a. In A and C, error bars depict SE , * p<0.05 vs. HS saline, # p<0.05 vs. LS saline.
Figure 3. miR-499 in plasma serves as a biomarker for antimiR-208a efficacy. A. Real-time PGR analysis on plasma samples indicates an increase in miR-499 in response to high-salt (HS) diet, whereas antimiR-208a significantly lowers the detection of miR-499 in plasma 8 weeks after the start of a 4% HS diet and 7 weeks after the onset of antimiR treatment. B. Further miRNA analysis additionally indicates a decrease in plasma detectable miR-423-5p in response to antimiR-208a. RNA was isolated from plasma samples using Trizol-LS with glycogen assisted RNA precipitation (Invitrogen) and RT-PCR was performed using commercial miRNA Taqman assays from Applied Biosystems. Prior to RNA purification, 5 fmoi of synthetic C. Elegans liii-4 and miR-2 were added to samples and plasma mi RNA values were normalized to the average recovery of synthetic input sequences. *P<0.05 vs HS saline (n=10 per group).
Figure 4. Food intake of Dahl salt-sensitive rats. Based on ingested amount of diet, there are no significant differences between the treatment groups, excluding that the differences in weight gain and health are due to differences in intake of the HS diet in the Dahl hypertensive rats. Week 4 (A), Week 5 (B), Week 6 (C) and Week 7 (D) are shown.
Figure 5. Plasma detection of muscle specific miRNAs. Plasma detection of raiR- 208a (A) and miR-1 (B), two muscle-specific miRNAs, reveals that levels of these miRN As show no response to antimiR-208a treatment in Dahl hypertensive rats.
Figure 6. Cardiac tissue markers demonstrating molecular efficacy following antimiR treatment. All analyses were performed 8 weeks after the start of a 4% high-salt (HS) diet and 7 weeks after the start of antimiR treatment, A. Real-time PCR analysis for miR-208a in cardiac tissue in the indicated groups. B. Real-time PCR analysis shows that HS diet reduces Myh6 expression and antimiR-208a treatment prevents this decrease. Treatment with the control oligonucleotide has no effect on the HS diet-induced decrease in Myh6 expression. C. Real-time PCR analysis shows that HS diet increases Myh7 expression, and treatment with an atiitmiR-208a oligonucleotide reduces this increase. Figure 7. Time course data showing plasma miRNA levels as measured by real time PGR for miR-16 (A), mi R- 19b (B), miR-423-5p (C), and miR-499 (D) with disease progression in rats with hypertension-induced heart failure treated with antimiR-208a oligonucleotide (10101), control oligonucleotide (10591 ), or saline. Figure 8. Line graphs depicting body weight versus weeks on high-salt diet for each of the indicated treatment groups. Panel A shows body weight over time for all treatment groups whereas panel B shows a subset of the treatment groups. # indicates as significance of p < 0.05 by ANOVA. Body weight graphs were generated by carrying over final body weights of those rats that died prior to the end of the study. Figure 9. AntimiR-208a treatment improves survival in Dahl salt-sensitive rats on a high-salt diet. Kaplan -Meier survival curves in the Dahl hypertensive rat model exposed to the indicated treatments. A pronounced decrease in survival is observed in response to a 6% high-salt (HS) diet for both HS/saline and HS/1.5 mg/kg Captopri l groups, which is significantly improved in response to antimiR-208a (M-101G1) treatment. No mortality was observed in the low-salt (LS) controls or HS -10101 -treated rats. * p<0.05 vs M-10101 alone.
Figure 10. Real time PGR analysis of miR-208a (A), miR-499 (B) and miR-208b (C) in cardiac tissue in rats in the indicated treatment groups. #p<0.05 vs. LS/saline, *p<G.05 vs. HS/saline. Figure 11. Real time PGR analysis of oMHC (Myh6, A), Myh7b (B), and PMHC
(Myh7, C) in cardiac tissue in rats in the indicated treatment groups. #p<0.05 vs. LS/saline, *p<0.05 vs. HS/saline.
Figure 12. Real time PGR analysis of direct target genes of miR-208, Dynltl (A), Vcpip (B), and Tegt (C), in cardiac tissue in rats in the indicated treatment groups. #p<0.05 vs. LS/saline, *p<0.05 vs. HS/saline,
Figure 13. Real time PGR analysis of plasma levels of miR-423-5p (A), miR~106b (B), miR- 16 (C), miR-92a (D), miR-378 (E), miR-210 (F), miR-378* (G), miR-20b (H), and miR-93 (I) in rats in the indicated treatment groups. Plasma levels of these miRNAs correlated with efficacy of both antimiR-208a and captopril treatments. Figure 14. Real time PCR analysis of plasma levels of miR-19b (A), miR-223 (B), miR-2! (C), and miR-150 (D) in rats in the indicated treatment groups. Plasma levels of miR- 19b and miR-223 appeared to correlate with efficacy of antimiR-208a olignucleotide therapy whereas plasma levels of miR-21 and miR-150 appeared to correlate with efficacy of captopril therapy.
DETAILED DESCRIPTION OF THE INVENTION
The methods of the present invention are based, in part, on the surprising discovery that the level of one or more miRNAs can be used as an indicator of the therapeutic efficacy of a therapeutic intervention for cardiac disorders or assessing the severity or disease progression of cardiac disorders, such as heart failure. In some embodiments, the present invention provides methods for evaluating and/or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder. These methods can include the step of measuring the level of at least one miRNA in a biological sample from a patient receiving a therapeutic intervention and comparing the measured level to a reference level or the level of at least one miRNA in a control sample. The measured level of the at least one miRNA is indicative of the therapeutic efficacy of the therapeutic intervention. In certain embodiments, the method further comprises altering the therapeutic intervention based on the measured level of said at least one miRNA in the biological sample.
Accordingly, one aspect of the methods of the present invention is providing for measuring or detecting the level of at least one miRN A in a biological sample. In some embodiments, the microRNA whose level is measured or detected is an intron-embedded miRNA. In some embodiments, the microRNA whose level is measured or detected is expressed in heart tissue. In particular embodiments, the microRNA whose level is measured is selected from a microRNA listed in any one of Tables 1-4. In certain embodiments, the level of each microRNA in a panel of microRNAs selected from any one of Tables 2-4 is measured. For instance, in some embodiments of the method, two or more, three or more, four or more, five or more, ten or more, fifteen or more, twenty or more, twenty five or more, thirty or more, thirty five or more, forty or more, fifty or more, sixty or more, seventy or more, eighty or more, or ninety or more microRNAs selected from one or more of Tables 1-4 are measured. In particular embodiments, the level of one or more microRNAs or a panel of microRNAs selected from Table 4 are measured. In some embodiments, a panel of less than twenty, less than fifteen, less than ten, or less than five miRNAs are tested, the panel including one, two, three, four, or five miRNAs from any one of Tables 1-4, Where the patient is suspected of having heart failure, and/or suspected of being in need of therapy, the panel may comprise miRNAs listed in Table 1. Where the patient is undergoing therapy for heart failure, the panel may comprise miRNAs selected from Table 2, 3, or 4,
Measuring or detecting the amount of micro RNA in a sampl e can be performed in any manner known to one skilled in the art and such techniques for measuring or detecting the level of an miRN A are well known and can be readily employed. A variety of methods for detecting miRNAs have been described and include Northern blotting, microarrays, electrochemical methods (oxidation of miRNA-ligated nanoparticles), bioluminescent, bioluminescent protein reassembly, BRET-based (BRET: bioluminescence resonance energy transfer), RT-PCR, fluorescence correlation spectroscopy and surface-enhanced Raman spectroscopy (see, e.g., Cissell, . A. and Deo, S. K., Trends in microRNA detection, Anal. Bioanal. Chenx, 394: 1109-1116 (2009); incorporated herein by reference in its entirety).
There are also commercially available kits, such as the qRT-PCR miRNA Detection Kit available from Ambion, U.S.A., which can be used for detecting and quantifying microRNA using quantitative reverse transcriptase polymerase chain reaction. TaqMan MicroRNA Assays, which employ a target-specific stem-loop reverse transcription primer to compensate for the short length of the mature miRNA, is also available from Applied Biosystems (Life Technologies, Inc., USA). qSTAR MicroRNA Detection Assays, commercially available from OriGene, Inc. (USA), can also be used.
Other commercially available kits, such as PAXgene Blood miRNA Kit (which uses silica-based RNA purification technology) can be employed for isolating miRNAs of 18 nucleotides or longer, available from Qiagen, USA. The mi Script PCR System, a three- component system which converts miRNA and mRNA into cDNA and allows for detection of miRNAs using SYBR Green-based real-time PCR, can be employed for quantification of mature miRNA, precursor miRNA, and mRNA all from a single sample (also available from Qiagen, USA). GeneCopoeia has a commercial kit available that is based on using RT-PCR in conjunction with SYBR Green for quantitation of miRNA (All-in-One™ miRNA qRT- PCR Detection Kit, available from GeneCopoeia, Inc., USA). mirVANA, available from Life Technologies, Inc. (USA), employs glass fiber filter (GFF)-based method for isolating small As.
The methods for detecting the miRNA can also include hybridization-based technology platforms and massively-parallel next generation small RNA sequencing that allow for detection of multiple microRNAs simultaneously. One commercially-available hybridization-based technology utilizes a sandwich hybridization assay with signal amplification provided by a labeled branched DNA (Panomics). Another hybridization-based technology is available from Nanostring Technology (nCounter miRNA Expression Assay), where multiple miRNA sequences are detected and distinguished with tluorescently-labeled sequence tags. Examples of next-generation sequencing are available from Life Technologies (SOLID platform) and Illumina, Inc. miRNAs can also be isolated by methods described in the art for isolating small RNA molecules (see, e.g., U.S. Patent Publication No. 20100291580, U.S. Patent Publication No. 20100222564, U.S. Patent Publication No. 20060019258, U.S. Patent Publication No. 20110054009 and U.S. Patent Publication No. 20090023149; all of which are incorporated herein by reference in their entireties).
Other methods for isolation of miRNA from a sample include employing a method comprising the following steps: a) obtaining a sample having an miRNA; b) adding an extraction solution to the sample; c) adding an alcohol solution to the extracted sample; d) applying the sample to a mineral or polymer support; and, e) el u ting the RNA containing the miRNA from the mineral or polymer support with an ionic solution. Other procedures for isolating miRNA molecules from a sample can involve: a) adding an alcohol solution to the sample; b) applying the sample to a mineral or polymer solid support; c) e luting miRNA molecules from the support with an ionic solution; and, d) using or characterizing the miRNA molecules. (See, U.S. Patent Publication No. 20100222564; incorporated herein by reference in its entirety.) miRNA can also be isolated by methods involving separation of miRNA from rnRNA, such as those described in U.S. Patent Publication No. 20060019258; incorporated herein by reference in its entirety. These methods comprise the steps of a) providing a biological isolate including rnRNA having a 5' cap structure and small RNA having a 5' phosphate; b) contacting the isolate with a phosphate reactive reagent having a label moiety under conditions wherein the label moiety is preferentially added to the 5' phosphate over the 5' cap structure, thereby producing labeled small RNA; and c) distinguishing the small RNA from the mRNA according to the presence of the label.
Examples of methods of isolating and/or quantifying microRNAs can also include but are not limited to hybridizing at least a portion of the microRNA with a fluorescent nucleic acid (a fluorescent probe), and reacting the hybridized microRNA with a fluorescent reagent, wherein the hybridized microRNA emits a fluorescent light or hybridizing at least a portion the microRNA to a radio-labeled complementary nucleic acid. There are commercially available products for fluorescent labeling and detection of miRNAs. NCode miRNA Rapid Labeling System and NCode Rapid Alexa Fluor 3 miRNA Labeling System are both commercially available from Life Technologies, Inc. (USA). Furthermore, fluorescent labels are commercially available and can include the Molecular Probes Alexa Flour dyes, available from Life Technologies, Inc. (USA), including Alexa Fluor 3, Alexa Fluor 5, Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500, Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700, and Alexa Fluor 750. Lumiprobes Cy dyes, including Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5 and Cy7, The DyLight fluorophores, available from TbermoScientific (USA), mcludmg DyLight 350, DyLight 405, DyLight 488, DyLight 550, DyLight 594, DyLight 633, DyLight 650, DyLight 680, DyLight 750 and DyLight 800. FluoProbes include FluoProbes 390, FluoProbes 488, FluoProbes 532, FluoProbes 547H, FluoProbes 594, FluoProbes 647H, FluoProbes 682, FluoProbes 752 and FluoProbes 782.
Locked nucleic acid probes can also be employed. For example, the miRCURY LNA microRNA f SH Optimization Kits (FFPE) provides for detection of microRN As. This kit employs double DIG*-labeled miRCURY LNA™ microRNA Detection that can be used for in situ hybridization and is commercially available from Exiqon (USA and Denmark).
In some embodiments a probe for detecting an miRNA can include a single-stranded molecule, including a single-stranded deoxyribonucleic acid molecule, a single-stranded ribonucleic acid molecule, a single-stranded peptide nucleic acid (PNA), or a single-stranded locked nucleic acid (LNA). in some embodiments the probe is substantially complementary, for example 80%, 85%, 90%, 95%», 96%, 97%, 98%, 99% or 100% identical to the complement of the miRNA being detected, such that the probe is capable of detecting the miRNA, In some embodiments, the probe is substantially identical, 80%, 85%, 90%, 95%,96%, 97%, 98%, 99%, or 100% identical to the miRNA, such that the probe is capable of detecting the complement of the miRNA. In some instances the probe is at least 5 nucleotides, at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides or at least 40 nucleotides. In some cases, the probe may be no longer than 25 nucleotides, no longer than 35 nucleotides; no longer than 50 nucleotides; no longer than 75 nucleotides, no longer than 100 nucleotides or no longer than 125 nucleotides in length. In some embodiments the probe is substantially com lementary to or substantially identical to at least 5 consecutive nucleotides of the miRNA, for example at least 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 20, 21 and 22, or more consecutive nucleotides. In some embodiments, the probe can be 5-20, 5-25, 5-50, 50-100, or over 100 consecutive nucleotides long.
In some preferred embodiments, the methods for detecting the miRNA include realtime PGR, miRNA Taqman array cards, and Northern blot analysis. In some embodiments, the miRNAs detected include hsa-miR-542-3p, hsa-miR- 185, hsa-miR- 199a-5p, hsa-miR- 20b, hsa-miR-423-5p, hsa-miR-451, hsa-miR-140-5p, hsa-miR-93, hsa-miR-27a, hsa-miR- 365, hsa-miR- 148a, hsa-miR-20a, hsa-miR- 133a, hsa-miR- 106b, hsa-miR-16, hsa-miR- 18a, hsa-miR-26b, hsa-miR-192, hsa-miR-320a, hsa-miR-223, hsa-miR-744, hsa-miR-301 a, hsa- miR- 188-5p, hsa-miR- 195, hsa-miR- 122, hsa-miR- 197, hsa-miR- 125b-5p, hsa-miR-486-5p, hsa-miR-484, hsa-miR- 184, hsa-miR- 17, hsa-miR-324-5p, hsa-miR- 182, hsa-miR- 181 c, hsa- miR-29c, hsa-miR-25, hsa-miR-218, hsa-miR-30a, hsa-miR-30b, hsa-miR-92a, hsa-miR -340- 5p, hsa-miR-27b, hsa-miR-24, hsa-miR- 103a, hsa-miR-203, hsa-miR-222, hsa-miR-101 a, hsa-let-7b, hsa-m.iR-335-5p, hsa-miR- 142-3p, hsa-m.iR-296-5p, hsa-miR~125a-3p, hsa-miR- 196b, hsa-miR-143, hsa-miR-28, hsa-miR-107, hsa-miR-125a-5p, hsa-miR-204, hsa-miR- 19b, hsa-miR- 199a-3p, hsa-let-7g, hsa-miR-18 la, hsa-miR-449a, hsa-miR-29b, hsa-miR- 487b, hsa-miR-99b, hsa-miR-130a, hsa-rniR-574-3p, hsa-miR-339-5p, hsa-miR-302a, hsa- miR- 145, hsa-miR- 152, hsa-miR- 126-5p (miR-126*), hsa-miR-142-5 p, hsa-iet-7d, hsa-miR- 19a, hsa-miR-340-3p, hsa-miR-186, hsa-miR- 128a, hsa-miR-155, hsa-miR-532-3p, hsa-let- 7e, hsa-miR- 187, hsa-miR-214, hsa-let-7c, hsa-miR-331 -3p, hsa-miR-31, hsa-miR-26a, hsa- miR-30c, hsa-miR-375, hsa-m.iR-29a, hsa-miR-30d, hsa-miR-126, hsa-miR-130b, hsa-miR- 191, hsa-miR- 146a, lisa-miR-342-3p, hsa-miR- 139-5p, hsa-miR- 138, hsa-miR-324-3p, hsa- miR-30e, or combinations thereof, in other embodiments, the miRNAs detected include hsa- miR-16, hsa-miR-320, hsa-miR-223, hsa-miR-93, hsa-miR- 106b, hsa-miR-423-5p, hsa-miR- 185, hsa~miR~92a, hsa-miR-210, hsa-miR-140, hsa-miR-27a, hsa-miR-20b, hsa-miR-150, hsa-miR-20a, hsa-miR-378, hsa-miR-22, hsa-miR-21, hsa-miR-378*, hsa-miR-122, hsa-miR- 126, hsa-miR-133a, hsa-miR-499, hsa-miR-19b, hsa-miR-199b-5p, hsa-miR-204, hsa-miR- 145, hsa-miR-195, hsa-miR-125a-5p, hsa-miR-143, hsa-miR-214, or any combination thereof. In still other embodiments, the miRNAs detected include miR-423-5p, miR-106b, miR-16, miR-92a, miR-378, miR-210, miR-378*, miR-20b, miR-93, miR-19b, miR-223, miR-21 , miR-150, or combinations thereof.
In order to be used as an indicator of the therapeutic efficacy of a therapeutic intervention for cardiac disorders, the level of the miRNA must be determined. The amount of microRNA in a patient sample can be compared to a standard amount of the microRNA present in patients with a cardiac disorder (e.g., heart failure) or in the healthy population (e.g., each of which may be referred to as a reference level). In other embodiments, the level is compared to the amount of microRNA in a control sample (a sample not from a cardiac disorder subject) or compared to the amount of the microRNA in a sample taken from a patient prior to treatment with a therapeutic intervention or a sample taken from an untreated patient. Standard levels for a microRNA can be determined by determining the level of a microRNA in a sufficiently large number of samples obtained from normal, healthy control subjects to obtain a pre-determined reference or threshold value. As used herein, "reference value" refers to a pre-determined value of the level or concentration of a miRNA ascertained from a known sample.
A standard level can also be determined by determining the level of the microRNA in a sample from a patient prior to treatment with the therapeutic intervention. Further, standard level information and methods for determining standard levels can be obtained from publically available databases, as well as other sources. (See, e.g., Bunk, D.M., "Reference Materials and Reference Measurement Procedures: An Overview from a National Metrology Institute," Clin. Biochem. Rev., 28(4): 131-137 (2007); and Remington: The Science and Practice of Pharmacy, Twenty First Edition (2005).) In some embodiments, a known quantity of another miRNA that is not normally present in the sample is added to the sample (i.e. the sample is spiked with a known quantity of exogenous miRN A) and the level of one or miRNAs of interest is calculated based on the known quantity of the spiked miRNA. The comparison of the measured levels of the one or more miRNAs to a reference amount or the level of one or more of the miRNAs in a control sample can be done by any method known to a skilled artisan. For example, comparing the amount of the microRNA in a sample to a standard amount can include comparing the ratio between 5S rRNA (or the spiked miRNA) and the miRNA in a sample to a published or known ratio between 5S rRNA (or the spiked miRNA) and the miRNA in a control sample. In instances when the amount of microRNA is compared to a control, the control sample may be obtained from any source known to not be affected by a cardiac disorder. The level of miRNA in a sample taken from a patient after administration of a therapeutic intervention can also be compared to the level of miRNA in a sample taken from the patient prior to administration of a therapeutic intervention.
According to the present invention, in some embodiments a difference (increase or decrease) in the measured level of the miRNA relative to the level of the miRNA in the control sample (e.g., sample in patient prior to treatment or an untreated patient) or a predetermined reference value is indicative of the therapeutic efficacy of the therapeutic intervention. In some embodiments, an increase in the measured level of the miRNA relative to the level of the mi RNA in the control sample or pre-determined reference value is indicative of the therapeutic efficacy of the therapeutic intervention. For instance, in such embodiments, when the level of one or more miRNAs selected from an miRNA listed in Table 3 or 4 is increased when compared to the level in a control sample or pre-determined reference value in response to a therapeutic intervention, the increase is indicative of therapeutic efficacy of the therapeutic intervention. In certain embodiments, when the level of one or more miRNAs selected from hsa~miR~19b, hsa~miR~199b-5p, hsa-miR-204, hsa-miR- 145, hsa-miR-195, hsa-miR-125a-5p, hsa-miR-143, and hsa-miR-214 is increased when compared to the level in a control sample or pre-determined reference value in response to a therapeutic intervention, the increase is indicative of therapeutic efficacy of the therapeutic intervention. According to the present invention, in some embodiments a reduction or decrease in the measured level of the miRNA relative to the level of the miRNA in the control sample (e.g., sample in patient prior to treatment or an untreated patient) or pre-determined reference value is indicative of the therapeu tic efficacy of the therapeutic intervention. For instance, in such embodiments, when the level of one or more miRNAs selected from an miRNA listed in Tables 2 or 4 is decreased when compared to the level in a control sample or pre-determined reference value in response to a therapeutic intervention, the decrease is indicative of therapeutic efficacy of the therapeutic intervention. In certain embodiments, when the level of one or more miRNAs selected from hsa-miR- 16, hsa-miR-320, hsa-miR-223, hsa-miR-93, hsa-miR-] 06b, hsa~miR~423~5p, hsa-miR-185, hsa-miR-92a, hsa-miR-210, hsa-miR- 140, hsa-miR-27a, hsa-miR-20b, hsa-miR- 150, hsa-miR-20a, hsa-miR-378, hsa-miR-22, hsa-miR- 21, hsa-miR-378*, hsa-miR- 122, hsa-miR- 126, hsa-miR-133a, and hsa-miR-499 is decreased when compared to the level in a control sample or pre-determined reference value in response to a therapeutic intervention, the decrease is indicative of therapeutic efficacy of the therapeutic intervention.
Sampling methods are well known by those skilled in the art and any applicable techniques for obtaining biological samples of any type are contemplated and can be employed with the methods of the present invention. (See, e.g., Clinical Proteolytics: Methods and Protocols, Vol. 428 in Methods in Molecular Biology, Ed. Antonia Vlahou (2008),) Samples can include any biological sample from which miRNA can be isolated. Such samples can include serum, blood, plasma, whole blood and derivatives thereof, cardiac tissue, skin, hair, hair follicles, saliva, oral mucous, vaginal mucous, sweat, tears, epithelial tissues, urine, semen, seminal fluid, seminal plasma, prostatic fluid, pre-ejaculatory fluid (Cowper's fluid), excreta, biopsy, ascites, cerebrospinal fluid, lymph, cardiac tissue, as well as other tissue extract samples or biopsies, in some embodiments, the biological sample is plasma or serum . In other embodiments, the biological sample is cardiac tissue.
The biological sample for use in the disclosed methods can be obtained from the patient at any point following the start of the therapeutic intervention. In some embodiments, the sample is obtained at least I, 2, 3, or 6 months following the start of the therapeutic intervention. In some embodiments, the sample is obtained least 1 , 2, 3, 4, 6 or 8 weeks following the start of the therapeutic intervention. In some embodiments, the sample is obtained at least 1, 2, 3, 4, 5, 6, or 7 days following the start of the therapeutic intervention. In some embodiments, the sample is obtained at least 1 hour, 6 hours, 12 hours, 18 hours or 24 hours after the start of the therapeutic intervention. In other embodiments, the sample is obtained at least one week following the start of the therapeutic intervention. In some embodiments, one or more miRNAs selected from any one of Tables 2-4 is measured between 1 and 8 weeks following administration of a miRNA-based therapeutic, such as an antisense oligonucleotide targeting a miRNA {e.g. anti-miR treatment). In some embodiments, one or more of the miRNAs is measured in plasma samples between 2 and 7 weeks after an anti-miR treatment. In some embodiments, one or more of the miRNAs is measured in plasma samples at 1, 2, 3, 4, 5, 6, 7 or 8 weeks after an anti-miR treatment. In some embodiments, one or more of the miRNAs is measured in plasma samples at 7 weeks after an anti-miR treatment. In some embodiments, one or more of the miRNAs is measured in plasma samples at 2 weeks after an anti-miR treatment, For detecting microRNAs as contemplated by the methods of the present invention, the samples for analysis may contain, in some embodiments, between about 1 ng and about 100 ng of RNA. In some embodiments, the sample contains between about 10 ng and about 90 ng of RNA. In some embodiments, the sample contains between about 20 ng and about 80 ng. For detecting microRNAs as contemplated by the methods of the present invention, the samples for analysis may also contain between 0.1 and 10 μΐ of plasma RN A equivalents (purified RNA from volume of plasma). In some cases, the samples for analysis can contain between 0.5 μΐ and 5 μ! of plasma RNA equivalents (purified RNA from volume of plasma). In some cases, the samples for analysis can contain about 0.1 μΐ, 0.5 μΐ, 1 μΐ, 2 μΐ, 3 μί, 4 μΐ, 5 μΐ, 6 μΐ , 7 μΐ, 8 μΐ, 9 μΐ or 10 μΐ of plasma RNA equivalents (purified RN A from volume of plasma).
The methods of the present invention can also include methods for altering the treatment regimen of a therapeutic intervention. Such methods comprise detecting the level of at least one miRNA, such as one or more miRNAs listed in any one of Tables 2-4, in a biological sample from a patient receiving the therapeutic intervention and altering the treatment regimen based on an increase or decrease in the level of the at least one miRNA in said biological sample. In some embodiments, the method comprises detecting two, three, four, five, ten, or more miRNAs (e.g., including all miRNAs) listed in one or more of Table 2-4. In some such embodiments, the miRNAs are detected using a customized detection platform, and thus less than 100, less than 50, or less than 25 miRN As are detected, including the miRNAs from Table 2 to 4. Altering the treatment regimen can include but is not limited to changing and/or modifying the type of therapeutic intervention, the dosage at which the therapeutic intervention is administered, the frequency of administration of the therapeutic intervention, the route of administration of the therapeutic intervention, as well as any other parameters that would be well known by a physician to change and/or modify. For example, where miRNAs of Table 2 decrease during therapy or match reference levels, and or where miRNAs of Table 3 increase during therapy or match reference levels, the therapeutic intervention is continued. In embodiments where miRNAs of Table 2 do not decrease during therapy or match reference levels, and/or where miRNAs of Table do not increase during therapy or match reference levels, the therapeutic intervention is altered.
In certain embodiments, a panel of miRNAs is determined from one of Tables 1 -4, and the panel classified on the basis of a classifier algorithm. For example, samples may be classified on the basis of threshold values as described, or based upon Mean and/or Median miRNA levels in one population or versus another (e.g., a population of healthy controls and population of patients with heart failure, or levels based on effective versus ineffective therapy).
Various classification schemes are known for classifying samples between two or more classes or groups, and these include, without limitation; Principal Components Analysis, Naive Bayes, Support Vector Machines, Nearest Neighbors, Decision Trees, Logistic, Artificial Neural Networks, Penalized Logistic Regression, and Rule -based schemes, in addition, the predictions from multiple models can be combined to generate an overall prediction. Thus, a classification algorithm or "class predictor" may be constructed to classify samples. The process for preparing a suitable class predictor is reviewed in R. Simon, Diagnostic and prognostic prediction using gene expression profiles in high- dimensional microarray data, British Journal of Cancer (2003) 89, 1599-1604, which review is hereby incorporated by reference in its entirety.
In some embodiments, the information regarding the increase or decrease in the level of at least one miRNA can be used to determine the treatment efficacy of treatment with the therapeutic intervention, as well as to tailor the treatment regimens of therapeutic interventions. In some embodiments the treatment efficacy can be used to determine whether to continue a therapeutic intervention. In some embodiments the treatment efficacy can be used to determine whether to discontinue a therapeutic intervention. In some embodiments the treatment efficacy can be used to determine whether to modify a therapeutic intervention. In some embodiments the treatment efficacy can be used to determine whether to increase or decrease the dosage of a therapeutic intervention. In some embodiments the treatment efficacy can be used to determine whether to change the dosing frequency of a therapeutic intervention. In some embodiments, the treatment efficacy can be used to determine whether to change the number or the frequency of administration of the therapeutic intervention. In some embodiments, the treatment efficacy can be used to determine whether to change the number of doses per day, per week, times per day. In some embodiments the treatment efficacy can be used to determine whether to change the dosage amount.
The methods of the present invention also provide methods for providing useful information for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder. These methods can include determining the level of at least one mi UNA, such as one or more miRNAs listed in any one of Tables 2-4, in a biological sample of a patient and providing the level of the at least one miRNA to an entity thai provides a determination of the efficacy based on an increase or decrease in the level of the at least one miRNA.
The phrase "indicative of the therapeutic efficacy" and variants thereof can include any methods for determining that a therapeutic intervention is providing a benefit to a patient. The terms "therapeutic efficacy" and variants thereof are generally indicated by alleviation of one or more signs or symptoms associated with a cardiac disorder and alleviation of one or more signs or symptoms of the cardiac disorder being treated can be readily determined by one skilled in the art. "Therapeutic efficacy" may also refer to the prevention or amelioration of signs and symptoms of toxicities typically associated with standard therapeutic interventions for cardiac disorders. Methods for determining therapeutic efficacy may be specific to the cardiac disorder being treated and can include any methods well known in the art for determining that a treatment is providing a beneficial effect to a cardiac disorder patient. For example, evidence of therapeutic efficacy can include but is not limited to improvement or alleviation of one or more symptoms of cardiac hypertrophy, heart failure, or myocardial infarction in the subject, or in the delay in the transition from cardiac hypertrophy to heart failure. The one or more improved or alleviated symptoms can include, for example, increased exercise capacity, increased cardiac ejection volume, decreased left ventricular end diastolic pressure, decreased pulmonary capillary wedge pressure, increased cardiac output, increased cardiac index, lowered pulmonary artery pressures, decreased left ventricular end systolic and diastolic dimensions, decreased cardiac fibrosis, decreased collagen deposition in cardiac muscle, decreased left and right ventricular wall stress, decreased wall tension, increased quality of life, and decreased disease related morbidity or mortality. Further, therapeutic efficacy can also include general improvements in the overall health of the patient, such as but not limited to enhancement of patient life quality, increase in predicted survival rate, decrease in depression or decrease in rate of recurrence of the indication. (See, e.g., Physicians' Desk Reference (2010).) Efficacy of a therapeutic intervention can also include evaluating or monitoring for the improvement of one or more symptoms of cardiac hypertrophy, heart fai lure, or myocardial infarction in the subject, or for the delay in the transition from cardiac hypertrophy to heart fai lure. The one or more improved symptoms may include, for example, increased exercise capacity, increased cardiac ejection volume, decreased left ventricular end d astolic pressure, decreased pulmonary capillary wedge pressure, increased cardiac output, increased cardiac index, lowered pulmonary artery pressures, decreased left ventricular end systolic and diastolic dimensions, decreased cardiac fibrosis, decreased col lagen deposition in cardiac muscle, decreased left and right ventricular wall stress, decreased wall tension, increased quality of life and decreased disease related morbidity or mortality. In some embodiments, the measured levels of plasma miRNAs (e.g., any of the miRNAs listed in Tables 2-4) serve as a surrogate marker for efficacy of the therapeutic intervention.
Any of the compositions described herein may be comprised in a kit. In one embodiment, the kit contains a reagent for measuring at least one miRNA selected from any one of Tables 2-4 in a biological sample, instructions for measuring the at least one miRNA and instructions for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder in a patient based on the level of the at least one miRNA. In some embodiments, the kit contains reagents for measuring the level of at least two, three, four, five, ten, or twenty miRNAs (or more), from one of Tables 2 or 3, or collectively from Tables 2 and 3. In some embodiments, the kit is customized for determining the efficacy of therapy for heart failure, and thus provides the reagents for determining 50 or less, 40 or less, 30 or less, or twenty five or fewer miRNAs, including the miRNAs of Tables 2 and 3.
In some embodiments, the kit contains a reagent for measuring one or more miRNAs selected from hsa-miR-16, hsa-miR-320, hsa-miR-223, hsa-miR-93, hsa-miR-106b, hsa-miR- 423-5p, hsa-miR-185, lisa-niiR-92a, hsa-miR-210, hsa-miR- 140, hsa-miR-27a, hsa-miR-20b, hsa-miR- 150, hsa-miR-20a, hsa-miR-378, hsa-miR-22, hsa-miR-21, hsa-miR-378*, hsa-miR- 122, hsa-miR-126, hsa-miR-133a, hsa-miR-499, hsa-miR-19b, hsa-miR- 199b-5p, hsa-miR- 204, hsa-miR-] 45, hsa-miR- 195, hsa-miR- 125 a-5p, hsa-miR- 143, and hsa-miR-214, instructions for measuring one or more of these miRNAs, and instructions for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder in a patient based on the level of one or more of these miRNAs. In particular embodiments, the kit contains a reagent for measuring one or more miRNAs selected from miR-423-5p, miR- 106b, miR-16, miR-92a, miR-378, miR-210, miR-378*, miR~20b, miR-93, miR~i9b, miR- 223, miR-21 , miR-150, instructions for measuring one or more of these miRNAs, and instructions for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder in a patient based on the level of one or more of these miRNAs. in some embodiments, the kit contains an miRNA-specific primer for reverse transcribing or amplifying a miRNA selected from hsa-miR-16, hsa-miR-320, hsa-miR-223, hsa-miR-93, hsa-miR-106b, hsa-miR-423-5p, hsa-miR-185, hsa-miR-92a, hsa-miR-210, hsa-miR-140, hsa-miR-27a, hsa-mi.R-20b, hsa-miR-150, hsa-miR-20a, hsa-miR-378, hsa-miR-22, hsa-miR- 21, hsa-miR-378*, hsa-miR-122, hsa-miR-126, hsa-miR-133a, hsa-miR-499, hsa-miR-19b, hsa~miR-199b-5p, hsa-miR-204, hsa-miR-145, hsa-mi.R-195, hsa-miR-125a-5p, hsa-miR- 143, hsa-miR-214, and combinations thereof.
In some embodiments, the kit contains a reagent for measuring one or more miRNAs in a biological sample that are indicative of the therapeutic efficacy of a miRNA-based therapeutic. For instance, in one embodiment, the kit contains a reagent for measuring one or more miRNAs selected from miR-19b, niiR-223, miR-423-5p, miR-106b, miR-16, niiR-92a, miR-378, miR-210, miR-378*, rmR~2Qb, and miR-93 in a biological sample, instructions for measuring one or more of these miRNAs, and instructions for evaluating or monitoring the efficacy of a chemical ly-modified antisense oligonucleotide targeting miR-208a and/or miR- 208b for treating a cardiac disorder in a patient based on the levels of one or more of these miRNAs. In some embodiments, the kit contains reagents for measuring the level of at least two, three, four five, ten, or twenty miRNAs (or more), from one of Tables 2 or 3, or collectively from Tables 2 and 3. In some embodiments, the kit is customized for determining the efficacy of therapy for heart failure, and thus provides the reagents for determining 50 or less, 40 or less, 30 or less, or twenty five or fewer miRNAs, including the miRNAs of Tables 2 and 3.
In other embodiments, the kit contains a reagent for measuring one or more miRNAs in a biological sample that are indicative of the therapeutic efficacy of a standard of care therapeutic, such as an angiotensin-converting enzyme (ACE) inhibitor. For instance, in one embodiment, the kit contains a reagent for measuring one or more miRNAs selected from miR-150, miR-21, miR-223, miR-423-5p, miR-106b, miR-16, miR-92a, miR-378, miR-210, miR-378*, miR-20b, and miR-93 in a biological sample, instructions for measuring one or more of these miRNAs, and instructions for evaluating or monitoring the efficacy of an ACE inhibitor for treating a cardiac disorder in a patient based on the levels of one or more of these miRNAs. In some embodiments, the kit contains reagents for measuring the level of at least two, three, four five, ten, or twenty miRNAs (or more), from one of Tables 2 or 3, or collectively from Tables 2 and 3. In some embodiments, the kit is customized for determining the efficacy of therapy for heart failure, and thus provides the reagents for determining 50 or less, 40 or less, 30 or less, or twenty five or fewer miRNAs, including the miRNAs of Tables 2 and 3.
In some embodiments, the kit can further contain one or more normalization controls. In some other embodiments, the one or more normalization controls are provided as one or more separate reagents for spiking samples or reactions. The normalization control can be added in a range of from about 0.1 fmol to about 5 mol. In some embodiments, the normalization control is added at about 0,1 fmol, 0.5 fmol, 1 fmol, 2 fmol, 3 fmol, 4 fmol or 5 fmol. In some embodiments, the at least one normalization control is a non-endogenous RNA or miRNA, or a miRNA not expressed in the sample. In some embodiments, the at least one normalization control is a C. elegans miRNA. In some embodiments, the at least one normalization control is cel-miR-2, cel-lin-4 or ath-miR-! 59a. In some embodiments, the C. elegans sequences used were cel-miR-2 (UAUCACAGCCAGCUUUGAUGUGC, SEQ ID NO:5), and cel-lin-4 (UCCCUGAGACCUCAAGUGUGA; SEQ ID NO:6). The sequence for ath-miR159a used was (UUUGGAUUGAAGGGAGCUCUA, SEQ ID NO: 7). In some embodiments, the kit can further contain a TaqMan probe specific for each miRNA of the kit. In some embodiments, the TaqMan probe is specific for a miRNA selected from the group consisting of hsa-miR-16, hsa-miR-320, hsa-miR-223, hsa-mi.R-93, hsa-miR-106b, hsa-miR-423-5p, hsa-miR-185, hsa-miR-92a, hsa-mlR-210, hsa-miR-140, hsa-miR-27a, hsa-miR-20b, hsa-miR-150, hsa-miR-20a, hsa-miR-378, hsa-miR-22, hsa-miR- 21, hsa-miR-378*, hsa-miR-122, lisa-miR-126, hsa-miR-I33a, hsa-miR-499, hsa-miR-19b, hsa-miR-199b-5p, hsa-miR-204, hsa-miR-145, hsa-mi.R-195, hsa-miR- 125a-5p, hsa-miR- 143, and hsa-miR-214.
In some embodiments, the kit is contemplated for use with a biological sample from a patient receiving treatment for a cardiac disorder. In further embodiments, the biological sample is plasma or serum obtained from a patient receiving treatment for a cardiac disorder. In yet further embodiments, the cardiac disorder is myocardial infarction, pathologic cardiac hypertrophy, heart failure or hypertension. The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will general!)' include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably ali quoted. Where there is more than one component in the kit, the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed (e.g., sterile, pharmaceutically acceptable buffer and/or other diluents). However, various combinations of components may be comprised in a vial. The kits of the present invention also will typically include a means for containing the nucleic acids, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow molded plastic containers into which the desired vials are retained.
When the components of the kit are provided in one and/or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred.
However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.
Such kits may also include components that preserve or maintain the reagents or that protect against their degradation. Such components may be DNAse-free, RNAse-free or protect against nucleases (e.g., RNAses and DNAses). Such kits generally will comprise, in suitable means, distinct containers for each individual reagent or solution.
A kit will also include instructions for employing the kit components as well the use of any other reagent not included in the kit. Instructions may include variations that can be implemented.
It is contemplated that such reagents are embodiments of kits of the invention. Such kits, however, are not limited to the particular items identified above and may include any reagent used for the manipulation or characterization of miRNA.
The therapeutic interventions of the present invention can include any combination of therapies used to treat cardiac disorders. Examples can include but are not limited to miRNA
99 based therapeutics (including antisense oligonucleotides), antihyperlipoproteinemic agent, an antiarteriosclerotic agent, an antithrombotic/fibrinolytic agent, a blood coagulant, an antiarrhythmic agent, an antihypertensive agent, a vasopressor, a treatment agent for congestive heart failure, an antianginal agent, an antibacterial agent or a combination thereof. (See, e.g., U.S. Patent Application No. 2010/0317713; incorporated by reference herein in its entirety.)
In some embodiments, the therapeutic intervention is a miRNA based therapeutic. In some embodiments, the miRNA based therapeutic is an antisense oligonucleotide. The antisense oligonucleotides may be ribonucleotides or deoxyribonucleotides. In some embodiments, the miRNA based therapeutic is an antisense oligonucleotide targeting a miRNA expressed in heart tissue. In some embodiments, the therapeutic intervention is an antisense oligonucleotide targeting miR-208a and/or miR-208b. In certain such embodiments, a change in the measured level of the miRNA relative to the level of the miRNA in the control sample or pre-detennined reference value is indicative of decreased expression of miR-208a and/or miR-208b in heart tissue. In such embodiments, the level of one or more miRNAs selected from miR-19b, miR-223, miR~423-5p, mi.R-106b, miR-16, miR-92a, nilR-378, miR-210, miR-378*. miR-20b, and niiR-93 as compared to the level of said one or more miRNAs in a control sample or pre-determined reference value is indicative of the therapeutic efficacy of a chemically-modified antisense oligonucleotide targeting miR- 208a and/or miR-208b. In one particular embodiment, the level of miR-19b and/or miR-223 as compared to the level of miR-19b and/or miR-223 in a control sample or pre-determined reference value is indicative of the therapeutic efficacy of a chemically-modified antisense oligonucleotide targeting miR-208a and/or miR-208b. In certain embodiments, an increase in the level of miR-19b as compared to the level of miR-19b in a control sample or predetermined reference value is indicative of decreased expression of miR-208a and/or miR- 208b in heart tissue. In other embodiments, a decrease in the level of miR-223 as compared to the level of miR-223 in a control sample or pre-determined reference value is indicative of decreased expression of miR-208a and/or miR-208b in heart tissue.
Preferably, the antisense oligonucleotide therapeutics have at least one chemical modification (i.e., the oligonucleotide is chemically modified). For instance, suitable antisense oligonucleotides may be comprised of one or more "conformationally constrained" or bicyclic sugar nucleoside modifications, for example, "locked nucleic acids." In some embodiments, the miRNA based therapeutic is a chemically-modified antisense oligonucleotide. In some embodiments, the miRNA based therapeutic is a chemically- modified antisense oligonucleotide targeting a miRNA expressed in heart tissue, in some embodiments, the chemically-modified antisense oligonucleotide targets miR-208a and/or miR-208b. The miR-208a and miR-208b microRNAs have been described in WO 2008/016924,
WO 2009/018492 and WO 2010/091204. The pre-miRNA encoding sequences for miR-2G8a for human is shown below as SEQ ID NO: 8 and the mature miR-208a sequence is provided in SEQ ID NO: 9. (See, e.g., PCT/US2010/023234, which is incorporated herein by reference in its entirety.) The pre-miRNA encoding sequences for miR-208b for human is shown below as SEQ ID NO: 10 and the mature tniR-208b sequence is provided in SEQ ID NO: 11.
Human pre-miR-208a (SEQ ID NO: 8)
ACGGGCGAGC TTTTGGCCCG GGTTATACCT GATGCTCACG TATAAGACGA GCAAAAAGCT TGTTGGTCAG A
Mature miR-208a (SEQ ID NO: 9)
AUAAGACGAGCAAAAAGCUUGU
Human pre-miR-208b (SEQ ID NO: 10)
CCUCUCAGGGAAGCUUUUUGCUCGAAUUAUGUUUCUGAUCCGAAUAUAAGAC GAACAAAAGGUUUGUCUGAGGGCAG
Mature miR-208b (SEQ ID NO: 11)
AU A AG AC G A AC A AA AGG UUU G U
The antisense oligonucleotides targeting miR-208a/miR-208b can contain combinations of LNAs or other modified nucleotides and ribonucleotides or deoxyribonucleotides. Alternatively, the antisense oligonucleotides may comprise peptide nucleic acids (PNAs), which contain a peptide-based. backbone rather than a sugar-phosphate backbone. Other chemical modifications that the antisense oligonucleotides may contain include, but are not limited to, sugar modifications, such as 2'-0-alkyl (e.g. 2'-0-methyl, 2'- O-rnethoxyethyl), 2'-fluoro, and 4' thio modifications, and backbone modifications, such as one or more phosphorothioate, morpholino, or phosphonocarboxylate linkages (see, for example, U.S. Patent Nos. 6,693,187 and 7,067,641, which are herein incorporated by reference in their entireties). For instance, antisense oligonucleotides, particularly those of shorter lengths (e.g., less than 15 nucleotides) can comprise one or more affinity enhancing modifications, such as, but not limited to, LNAs, bi cyclic nucleosides, phosphonoformates, 2' O alkyl and the like.
In some embodiments, suitable antisense oligonucleotides are 2 ' -O-methox ethyl "gapmers" which contain 2'-0~methoxyeth)4-modified ribonucleotides on both 5' and 3' ends with at least ten deoxyribonucleotides in the center. These "gapmers" are capable of triggering RNase H-dependent degradation mechanisms of R.NA. targets. Other modifications of antisense oligonucleotides to enhance stability and improve efficacy, such as those described in U.S. Patent No. 6,838,283, which is herein incorporated by reference in its entirety, are known in the art and are suitable for use in the methods of the invention. Preferable antisense oligonucleotides useful for inhibiting the activity of miR As are about 5 to about 50 nucleotides in length, about 10 to about 30 nucleotides in length, or about 20 to about 25 nucleotides in length. In certain embodiments, antisense oligonucleotides targeting miR-208a and/or miR-208b are about 8 to about 18 nucleotides in length, and in other embodiments about 12 to 16 nucleotides in length. In particular, any 8-mer or longer that is complementary to miR~208a or miR-208b may be used, i.e., any antimir sequence that is complementary to any consecutive sequence in miR-208a or miR-208b, starting from the 5' end of the miR to the 3' end of the mature sequence. Antisense oligonucleotides may in some cases comprise a sequence that is at least partially complementary to a mature miRNA sequence, e.g., at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a mature mi RNA sequence. In some embodiments, the antisense oligonucleotide may be substantially complementary to a mature miRNA sequence, that is at least about 95%, 96%>, 97%, 98%, or 99% complementary to a target polynucleotide sequence. In one embodiment, the antisense oligonucleotide comprises a sequence that is 100%) complementary to a mature miRNA sequence.
"Locked nucleic acids" (LNAs) are modified ribonucleotides that contain an extra bridge between the 2' and 4' carbons of the ribose sugar moiety resulting in a "locked" conformation that confers enhanced thermal stability to oligonucleotides containing the LNAs. LNAs are described, for example, in U.S. Patent 6,268,490, U.S. Patent 6,316,198, U.S. Patent 6,403,566, U.S. Patent 6,770,748, U.S. Patent 6,998,484, U.S. Patent 6,670,461 , and U.S. Patent 7,034,133, all of which are hereby incorporated by reference in their entireties. LNAs are modified nucleotides or ribonucleotides that contain an extra bridge between the 2' and 4' carbons of the ribose sugar moiety resulting in a "locked" conformation. Other suitable locked nucleotides that can be incorporated in the oligonucleotides of the invention include those described in U.S. Patent 6,833,361, which is hereby incorporated by reference in their entirety. In other embodiments, the antisense oligonucleotides are antagomirs. "Antagomirs" are single-stranded, chemically-modified ribonucleotides that are at least partially complementary to the miRNA sequence. Antagomirs may comprise one or more modified nucleotides, such as 2 '-O-m ethyl-sugar modifications. In some embodiments, antagomirs comprise only modified nucleotides. Antagomirs may also comprise one or more phosphorothioate linkages resulting in a partial or full phosphorothioate backbone. To facilitate in vivo delivery and stability, the antagomir may be linked to a steroid such as cholesterol, a fatty acid, a vitamin, a carbohydrate, a peptide or another small molecule ligand at its 3' end. Antagomirs suitable for inhibiting miRNAs may be about 15 to about 50 nucleotides in length, more preferably about 18 to about 30 nucleotides in length, and most preferably about 20 to about 25 nucleotides in length. "Partially complementary" refers to a sequence that is at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a target polynucleotide sequence. The antagomirs may be at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a mature miRNA sequence. In some embodiments, the antagomir may be substantially complementary to a mature miRNA sequence, that is at least about 95%, 96%, 97%, 98%, or 99% complementary to a target polynucleotide sequence. In other embodiments, the antagomirs are 100% complementary to the mature miRNA sequence.
The therapeutic intervention also includes other standard cardiac therapies, in addition to microRNA targeted treatments as described above. In these embodiments, the therapeutic interventions of the present invention can include antihyperlipoproteinemic agent, an antiarteriosclerotic agent, an antithrombotic/fibrinolytic agent, a blood coagulant, an antiarrhythmic agent, an antihypertensive agent, a vasopressor, a treatment agent for congestive heart failure, an antianginal agent, an antibacterial agent or a combination thereof. See, e.g., U.S. Patent Application No. 2010/0317713, incorporated by reference herein in its entirety. In one embodiment, the present invention provides a method for evaluating or monitoring the efficacy of a standard of care cardiac therapy, such as an ACE inhibitor, by measuring the level of at least one miRNA in a biological sample. In some embodiments, the method comprises measuring the level of at least one miRNA selected from miR-150, miR-21 , miR-223, miR-423- 5p, miR-106b, miR-16, miR-92a, miR-378, miR-210, miR-378*, miR-20b, and miR-93 in a biological sample from a patient receiving the ACE inhibitor; and comparing the measured level to the level of said at least one miRNA in a control sample or pre-determined reference value, wherein the measured level of said at least one miRNA is indicative of the therapeutic efficacy of the ACE inhibitor. In another embodiment, the method comprises measuring the level of miR-21 and/or miR-150 in a biological sample from a patient receiving the ACE inhibitor; and comparing the measured level to the level of miR-21 and/or miR-150 in a control sample or pre-determined reference value, wherein the measured level of said at least one miRNA is indicative of the therapeutic effica cy of the ACE inhibitor. in certain embodiments, the measured level of one or more miRNAs relative to the level of said one or more miRNAs in a control sample or pre-determined reference value is indicative of the therapeutic efficacy of a combination therapy. The combination therapy can two or more miRNA-based therapeutics, two or more standard of care therapies, or a combination of a miRNA-based therapeutic and a standard of care therapy. For instance, the combination therapy may be a chemically-modified antisense oligonucleotide targeting a miRNA expressed in the heart and a standard of care therapy, such as an ACE inhibitor. In one particular embodiment, the combination therapy is a chemically-modified antisense oligonucleotide targeting miR-208a and/or miR-208b and an ACE inhibitor, such as captopril. In such embodiments, the level of one or more miRNAs selected from miR-21 , miR-150, miR-378, miR-378*, and miR-93 relative to the level of one or more of these miRNAs in a control sample or pre-determined reference value is indicative of the therapeutic efficacy of a combination therapy of an antimiR-208 oligonucleotide and an ACE inhibitor (e.g. captopril). In some embodiments, the level of miR- 378 and/or miR-378* relative to the level of miR-378 and/or miR-378* in a control sample or pre-determined reference value is indicative of the therapeutic efficacy of a combination therapy of an antimiR-208 oligonucleotide and an ACE inhibitor (e.g. captopril).
In still other aspects, the invention provides a method for treating a patient for heart failure, the patient having elevated levels (e.g., serum or plasma levels) of one or more of miR- 223, miR-16, miR-93, miR- 106(b), and/or miR-423-5p, or other combination of up-regulated or down-regulated markers (e.g., combination of at least two) listed in Table 1. In accordance with this aspect, the patient is treated for heart failure with conventional therapy (such as an ACE inhibitor), or with an anti-miR therapeutic strategy described herein. In some embodiments, the therapy is with an anti-miR-208(a) antisense inhibitor or an anti-miR-208(b) antisense inhibitor. The levels of miR-223, miR-16, miR-93, raiR- 106(b) and/or miR-423-5p may be determined prior to treatment, and'or during treatment to monitor efficacy of the regimen. In some embodiments, the treatment is an antisense anti-miR-208(b) inhibitor, and the level of miR- 19(b) or a combination of markers listed in one or more of Tables 2-4 is monitored during treatment. In some embodiments, the anti-miR-208(b) therapy is as described herein or in U.S. Provisional Application No. 61/495,224, which is hereby incorporated by reference in its entirety. For example, the inhibitor may be an antisense inhibitor of from 10 to 18 nucleotides (e.g., 16 nucleotides), and/or containing nine locked nucleic acids, in addition to other chemical motifs. The inhibitor may be M-10101 as described in U.S. Provisional Application No. 61 /495,224, and may be administered subcutaneously.
In some embodiments, the therapeutic intervention includes administration of an agent that lowers the concentration of one of more blood lipids and'or lipoproteins, known herein as an "antihyperlipoproteinemic," can be part of the therapeutic interventions according to the present invention. Examples of antihvperlipoproteinemics can include but are not limited to acifran, azacosterol, benfiuorex, p-benzaibutyramide, carnitine, chondroitin sulfate, clomestrone, detaxtran, dextran sulfate sodium, 5, 8, 11, 14, 17-eicosapentaenoic acid, eritadenine, furazabol, rneglutol, melinamide, mytatrienediol, ornithine, y-oryzanol, pantethine, pentaerythritol tetraacetate, a-phenylbutyramide, pirozadil, probucol (lorelco), p-sitosterol, sultosilic acid- piperazine salt, tiadenol, triparanol and xenbucin.
In some embodiments, antihyperlipoproteinemic agents can further comprise an ary 1 oxyalkanoic/fibric acid derivative, a resin/bile acid sequesterant, a HMG CoA reductase inhibitor, a nicotinic acid derivative, a thyroid hormone or thyroid hormone analog, a miscellaneous agent or a combination thereof. Examples of ary loxyalkanoic/ fibric acid derivatives can include but are not limited to beciobrate, enzafibrate, binifibrate, ciprofibrate, clinofibrate, clofibrate (atromide-S), clofibric acid, etofibrate, fenofibrate, gemfibrozil (lobid), nicofibrate, pirifibrate, ronifibrate, simfibrate and theofibrate.
Examples of resins/bile acid sequesterants can include but are not limited to cholestyramine (cholybar, questran), colestipol (coiestid) and polidexide. Examples of HMG CoA reductase inhibitors can include but are not limited to lovastatm (mevacor), pravastatin pravochol) and simvastatin (zocor).
Examples of nicotinic acid derivatives can include but are not limited to nicotinate, aceplmox, niceritrol, nicoclonate, nicomol and oximacic acid. Examples of thyroid hormones and analogs thereof can include but are not limited to etoroxate, thyropropic acid and thyroxine.
Examples of an antiarteriosclerotic can include but are not limited to pyridine! carbamate.
In some embodiments, administration of an agent that aids in the removal or prevention of biood clots may be combined with administration of a modulator, particularly in treatment of athersclerosis and vasculature (e.g. , arterial) blockages. Examples of antithrombotic and/or fibrinolytic agents can include but are not limited to anticoagulants, anticoagulant antagonists, antiplatelet agents, thrombolytic agents, thrombolytic agent antagonists or combinations thereof.
In some embodiments, antithrombotic agents that can be included are those that are administered orally, such as, for example, aspirin and warfarin (Coumadin). Anticoagulants can include but are not limited to acenocoumarol, ancrod, anisindione, bromindione, clorindione, coumetarol, cyclocumarol, dextran sulfate sodium, clicumaroi, diphenadione, ethyl biseoumaeetate, ethylidene dicoumaroi, fluiiidione, heparin, hirudin, lyapoiate sodium, oxazidione, pentosan poiysuifate, phenindione, phenprocoumon, phosvitin, picotamide, tioclomarol and warfarin. Antiplatelet agents can include but are not limited to aspirin, a dextran, dipyridamole
(persantin), heparin, sulfmpyranone (anturane) and ticlopidine (ticlid).
Thrombolytic agents can include but are not limited to tissue plasminogen activator (activase), plasmin, pro-urokinase, urokinase (abbokinase) streptokinase (streptase) and anistreplasel APSAC (eminase). In other embodiments, wherein a subject is suffering from a hemorrhage or an increased likelihood of hemorrhaging, an agent that may enhance blood coagulation can also be employed. Examples of blood coagulation promoting agents include thrombolytic agent antagonists and anticoagulant antagonists. Thrombolytic agent antagonists can include but are not limited to amiocaproic acid (amicar) and tranexamic acid (amstat).
Anticoagulant antagonists can include but are not limited to protamine and vitamin K.
In some embodiments, the therapeutic intervention is an antithrombotic/fibrinolytic agent. Antithrombotic fibrinolytic agents can include but are not limited to anagrelide, argatroban, cilstazol, daltroban, defibroti.de, enoxaparin, fraxiparine, indobufen, lamoparan, ozagrel, picotamide, plailbride, tedeiparin, ticlopidine and trifiusal.
In some embodiments, the therapeutic intervention is an antiarrhythmic. Antiarrhythmic agents can include but are not limited to Class I antiarrhythmic agents (sodium channel blockers), Class II antiarrhythm c agents (beta-adrenergic blockers), Class III antiarrhythmic agents (repolarization prolonging drugs), Class TV antiarrhythmic agents (calcium channel blockers) and miscellaneous antiarrhythmic agents.
Examples of sodium channel blockers can include but are not limited to Class IA, Class IB and Class IC antiarrhythmic agents. Non-limiting examples of Class IA antiarrhythmic agents include disppyramide (norpace), procainamide (pronestyi) and qui idine (quinidex). Examples of Class IB antiarrhythmic agents can include but are not limited to lidocaine (xylocaine), tocainide (tonocard) and mexiietine (mexiril). Examples of Class IC antiarrhythmic agents can include but are not limited to encainide (enkaid) and flecainide (tambocor).
Examples of a beta blocker, otherwise known as a p-adrenergic blocker, a p-adrenergic antagonist or a Class II antiarrhythmic agent, can include but are not limited to acebutolol (sectral), alprenolol, amosulaiol, arotinoiol, atenolol, befunolol, betaxoloi, bevantoloi, bisoproloi, bopindolol, bucumolol, bufetolol, bufuralol, bunitrolol, bupranolol, butidrine hydrochloride, butofilolol, carazolol, carteolol, carvedilol, celiproloi, cetamolol, cloranolol, dilevalol, epanoloi, esmolol (brevibloe), indenoiol, labetaiol, levobunoloi, mepindolol, metipranoloi, metoproloi, moprolol, nadolol, nadoxolol, nifenalol, nipradilol, oxprenolol, penbutolol, pindolol, practolol, pronethalol, propanolol (inderal), sotalol (betapace), suliinaloi, talinoloi, tertatolol, timolol, toliprolol and xibinolol.
In some embodiments, the beta blocker can comprise an aryloxypropanolamine derivative. Examples of aryloxypropanolamine derivatives can include but are not limited to acebutolol, alprenolol, arotinoiol, atenolol, betaxolol, bevantoloi, bisoproloi, bopindolol, bunitrolol, butofilolol, carazolol, carteolol, carvedilol, celiproloi, cetamolol, epanoloi, indenolol, epindolol, metipranolol, metoprolol, moprolol, nadolol, nipradiloi, oxprenoloi, penbutolol, pindolol, propanolol, talinolol, tertatolol, timolol and toliprolol.
Examples of agents that prolong repolarization, also known as a Class ill antiarrhythmic agent, can include but are not limited to include amiodarone (cordarone) and sotalol (betapace). Examples of a calcium channel blocker, otherwise known as a Class IV antiarrhythmic agent, can include but are not limited to an arylalkylamine (e.g., bepridiie, diltiazem, fendiline, gallopamii, prenylamine, terodiline, verapamil), a dihydropyridine derivative (feiodipine, isradipine, nicardipine, nifedipine, nimodipine, nisoldipine, nitrendipine) a piperazinde derivative (e.g., cinnarizine, flunarizrae, lidoflazine) or a micellaneous calcium channel blocker such as bencyclane, etafenone, magnesium, mibefradil or perhexiline. In some embodiments, a calcium channel blocker comprises a long-acting dihydropyridine (nifedipine-type) calcium antagonist.
Examples of miscellaneous antiarrhythmic agents can include but are not limited to include adenosine (adenocard), digoxin (lanoxin), acecainide, ajmaline, amoproxan, aprindine, bretyiium tosylate, bunaftine, butobendine, capobenic acid, cifenline, disopyranide, hydro quinidine, indecainide, ipatropium bromide, lidocaine, lorajmine, lorcainide, meobentiiie, moricizine, pirmenol, prajrnaline, propafenone, pyrinoline, quinidine polygaiacturonate, quinidine sulfate and viquidil.
In some embodiments, the therapeutic intervention is an antihypertensive agent. Examples of antihypertensive agents can include but are not limited to sympatholytic, alpha/beta blockers, alpha blockers, anti-angiotensin II agents, beta blockers, calcium channel blockers, vasodilators and miscellaneous antihypertensives.
Examples of an alpha blocker, also known as an a-adrenergic blocker or an a-adrenergic antagonist, can include but are not limited to amosulalol, arotinolol, dapiprazole, doxazosin, ergoloid mesylates, fenspiride, indoramin, labetaloL nicergoline, prazosin, terazosin, tolazoline, trimazosin and yohimbine. In certain embodiments, an alpha blocker may comprise a quinazoline derivative. Quinazoline derivatives can include but are not limited to aifuzosin, bunazosin, doxazosin, prazosin, terazosin and trimazosin.
In certain embodiments, an antihypertensive agent is both an alpha and beta adrenergic antagonist. Examples of an alpha/beta blocker can include but are not limited to labetalol (normodyne, trandate).
j l Examples of anti-angiotensin Π agents can include but are not limited to angiotensin converting enzyme inhibitors and angiotensin II receptor antagonists. Angiotensin converting enzyme inhibitors (ACE inhibitors) can include but are not limited to alacepril, enalapril (vasotec), captopril, cilazapril, delapril, enalaprilat, fosinoprii, Hsinopri], moveltopril, perindopril, quinapril and ramipril. Examples of an angiotensin II receptor blocker, also known as an angiotensin II receptor antagonist, an ANG receptor blocker or an ANG-II type-1 receptor blocker (ARBS), include but are not limited to angiocandesartan, eprosartan, irbesartan, losartan and valsartan.
Examples of a sympatholytic include a centrally acting sympatholytic or a peripherialiy acting sympatholytic. Examples of a centrally acting sympatholytic, also known as an central nervous system (CNS) sympatholytic, can include but are not limited to clonidine (catapres), guanabenz (wytensin) guanfacine (tenex) and methyldopa (aldomet).
Examples of a peripherally acting sympatholytic can include but are not limited to a ganglion blocking agent, an adrenergic neuron blocking agent, a β-adrenergic blocking agent or a alphal-adrenergic blocking agent. Examples of a ganglion blocking agent include mecamylamine (inversine) and trimethaphan (arfonad). Examples of an adrenergic neuron blocking agent can include but are not limited to guanefhidine (ismelin) and reserpine (serpasil).
Examples of a β-adrenergic blocker can include but are not limited to acenitolol (sectrai), atenolol (tenormin), betaxolol (kerlone), carteolol (cartrol), labetalol (normodyne, trandate), metoprolol (lopressor), nadanol (corgard), penbutolol (levatol), pindolol (visken), propranolol (Inderal) and timolol (blocadren).
Examples of alphal-adrenergic blocker can include but are not limited to prazosin (minipress), doxazocin (cardura) and terazosin (hytrin).
In some embodiments, the therapeutic intervention can comprise a vasodilator (e.g. , a cerebral vasodilator, a coronary vasodilator or a peripheral vasodilator). In other embodiments, a vasodilator comprises a coronary vasodilator. Examples of a coronary vasodilator include but are not limited to amotriphene, bendazol, benfurodil hemisuccinate, benziodarone, chloracizine, chromonar, clobenfuroi, clonitrate, dilazep, dipyridamole, droprenil amine, efloxate, erythrityl tetra itrane, etafenone, fendiline, floredii, ganglefene, herestrol bis(p-diethylaminoethyi ether), hexobendine, itramin tosylate, khellin, lidoflanine, mannitol hexanitrane, medibazine, nicorglycerin, pentaerythritol tetranitrate, pentrinitrol, perhexiline, pimefyiline, trapidil, tricromyl, trimetazidine, trolnitrate phosphate and visnadine. In some embodiments, a vasodilator can comprise a chronic therapy vasodilator or a hypertensive emergency vasodilator. Examples of a chronic therapy vasodilator can include but are not limited to hydralazine (apresoline) and minoxidil (loniten). Examples of a hypertensive emergency vasodilator can include but are not limited to nitropmsside (nipride), diazoxide (hyperstat IV), hydralazine (apresoline), minoxidil (loniten) and verapamil, in some embodiments, the therapeutic intervention can include an antihypertensive. Examples of miscellaneous antihypertensives include but are not limited to ajmaline, γ-amino butyric acid, bufeniode, cicletairiine, ciclosidomine, a cryptenamme tannate, fenoklopam, flosequinan, ketanserin, mebutamate, mecamylamine, methyldopa, methyl 4-pyridyl ketone tbiosemicarbazone, muzo limine , pargyiine, pempidine, pinacidil, piperoxan, primaperone, a protoveratrine, raubasine, rescimetol, rilmenidene, saralasin, sodium nitrorusside, ticrynafen, trimethaphan eamsyiate, tyrosinase and urapidil.
In certain embodiments, an antihypertensive can comprise an arylethanolamine derivative, a benzothiadiazine derivative, a N-carboxyalkyi(peptide/lactam) derivative, a dihydropyridine derivative, a guanidine derivative, a hydrazines/phthaiazirie, an imidazole derivative, a quaternary ammonium compound, a reserpine derivative or a suflonamide derivative.
Examples of arylethanolamine derivatives can include but are not limited to amosulalol, bufuralol, dilevalol, iabetaloi, pronethalol, sotalol and sulfinalol. Examples of benzothiadiazine derivatives can include but are not limited to althizide, bendroflumethiazide, benztbiazide, benzylhydrochloro thiazide, buthiazide, chlorothiazide, chlorthalidone, cyclopenthiazide, cyclothiazide, diazoxide, epithiazide, ethiazide, fenquizone, hydrocblorothizi.de, hydro flumethizide, methyclothiazide, meticrane, metolazone, paraflutizide, polythiz de, tetrachlonnethiazide and trichlormethiazide. Examples of N-carboxyalkyl(peptide/lactam) derivatives can include but are not limited to alacepril, captopril, cilazapril, delapril, enalapril, enalaprilat, fosinopril, lisinoprii, moveltiprii, perindoprii, quinapril and ramiprii.
Examples of dihydropyridine derivatives can include but are not limited to amiodipine, felodipine, isradipine, nicardipine, nifedipine, nilvadipine, nisoldipine and nitrendipine. Examples of guanidine derivatives can include but are not limited to bethamdine, debrisoquin, guanabenz, guanacline, guanadrel, guanazodine, guanethidine, guanfaeine, guanochlor, guanoxabenz and guanoxan.
Examples of hydrazines/phthaiazines can include but are not limited to budralazine, cadralazine, dihydralazine, endralazine, hydracarbazine, hydralazine, pheniprazine, pildralazine and todralazine.
Examples of imidazole deri vati ves can include but are not limited to clonidine, fofexidine, phentolamine, tiamenidine and tolonidine.
Examples of quaternar ammonium compounds can include but are not limited to azamethonium bromide, chlorisondamine chloride, hexamethonium, pentacynium bis(methylsuifate), pentamethonium bromide, pentolinium tartrate, phenactropinium chloride and trimethidinium methosulfate.
Examples of reserpine derivatives can include but are not limited to bietaserpine, deserpidine, rescinnamine, reserpine and syrosingopiiie. Examples of sulfonamide derivatives can include but are not limited to ambuside, clopamide, furosemide, indapamide, quinethazone, trip amide and xipamide.
Examples of agents for the treatment of congestive heart failure can include but are not limited to anti-angiotensin I I agents, afterload-preload reduction treatment, diuretics and inotropic agents. Examples of a diuretic can include but are not limited to a thiazide or benzothiadiazine derivative (e.g. , althiazide, bendroflumethazide, benzthiazide, benzylhydrochlorothiazide, buthiazide, chlorothiazide, chlorothiazide, chlorthalidone, cyclopenthiazide, epithiazide, ethiazide, ethiazide, fenquizone, hydrochlorothiazide, hydroflumethiazide, methyclothiazide, metierane, metoiazone, parafiutizide, polythizide, tetrachloromethiazide, trichlormefhiazide), an organomercurial (e.g. , chlormerodrin, meralluride, mercamphamide, mercaptomerin sodium, mercumaliylic acid, mercumatilin dodium, mercurous chloride, mersaiyl), a pteridine (e.g. , furtereiie, triamterene), purines (e.g. , acefylline, 7-morpholinomethyltheophylline, pamobrom, protheobroniine, theobromine), steroids including aldosterone antagonists (e.g. , canrenone, oleandrin, spironolactone), a sulfonamide derivative (e.g. , acetazolamide, ambuside, azosemide, bumetanide, butazolamide, chloraminophenamide, clofenamide, clopamide, clorexolone, diphenyimethane-4,4'-disulfonamide, disulfamide, ethoxzoiamide, furosemide, indapamide, mefruside, raethazolamide, piretanide, quinethazone, torasernide, trip araide , xipamide), a uracil (e.g., aminometradine, amisometradine), a potassium sparing antagonist (e.g. , amiloride, triamterene) or a miscellaneous diuretic such as aminozine, arbutin, chlorazanil, ethacrynic acid, etozolin, hydracarbazine, isosorbide, mannitol, metochalcone, muzo limine, perhexiline, ticmafen and urea.
Examples of a positive inotropic agent, also known as a cardiotonic, can include but are not limited to acefylline, an acetyidigitoxin, 2-amino-4-picoline, amrinone, benfurodii hemisuccinate, bucladesine, cerberosine, camphotamide, convallatoxin, cymarin, denopamine, deslanoside, digitalin, digitalis, digitoxin, digoxin, dobutamine, dopamine, dopexamine, enoximone, erythrophleine, fenalcomine, gitalin, gitoxin, glyeocyamine, heptaminol, hydrastinine, ibopamine, a ianatoside, metamivam, milrinone, nerifolin, oleandrin, ouabain, oxyfedrine, prenalterol, proscillaridine, resibufogenin, scillaren, scillarenin, strphanfhin, sulmazole, theobromine and xamoterol.
In some embodiments, an intropic agent is a cardiac glycoside, a beta-adrenergic agonist or a phosphodiesterase inhibitor. Examples of a cardiac glycoside can include but are not limited to digoxin (ianoxin) and digitoxin (crystodigin). Examples of a β-adrenergic agonist include but are not limited to albuterol, bambuterol, bitoiteroi, carbuterol, clenbuteroi, ciorprenaline, denop amine, dioxethedrine, dobutamine (dohutrex), dopamine (intropin), dopexamine, ephedrine, etafedrine, ethylnorepinephrine, fenoterol, formoterol, hex oprena line, ibopamine, isoetharine, isoproterenol, mabuterol, metaproterenol, methoxyphenamine, oxyfedrine, pirbuterol, procateroi, protokyloi, reproterol, rimiteroi, ritodrine, soterenoi, terbutahne, tretoquinol, tulobuterol and xamoterol. Examples of a phosphodiesterase inhibitor can include but are not limited to amrinone (inocor).
Antianginal agents may comprise organonitrates, calcium channel blockers, beta blockers and combinations thereof. Examples of organonitrates, also known as nitrovasodilators, can include but are not limited to nitroglycerin (nitro-bid, nitrostat), isosorbide dinitrate (isordil, sorbitrate) and amyl nitrate (aspirol, vaporoie).
Endothelin (ET) is a 21 -amino acid peptide that has potent physiologic and pathophysiologic effects that appear to be involved in the development of heart failure. The effects of ET are mediated through interaction with two classes of cell surface receptors. Inhibiting the ability of ET to stimulate cells involves the use of agents that block the interaction of ET with its receptors. Examples of endothelin receptor antagonists (ERA) can include but are not limited to Bosentan, Enrasentan, Ambrisentan, Darusentan, Tezosentan, Atrasentan, Avosentan, Clazosentan, Edonentan, sitaxsentan, TBC 371 1 , BQ 123, and BQ 788.
In certain embodiments, therapeutic intervention can include a secondary therapeutic aspect such as for example a surgery of some type, which includes, for example, preventative, diagnostic or staging, curative and palliative surgery. Surgery, and in particular a curative surgery, may be used in conjunction with other therapies, including one or more other agents as described herein. Such surgical therapeutic agents for vascular and cardiovascular diseases and disorders are well known to those of skill in the art, and may include, but are not limited to, performing surgery on an organism, providing a cardiovascular mechanical prostheses, angioplasty, coronary artery reperfusion, catheter ablation, providing an implantable cardioverter defibrillator to the subject, mechanical circulatory support or a combination thereof. Examples of a mechanical circulatory support thai may be used in the present invention comprise an intra - aortic balloon counterpulsation, left ventricular assist device or combination thereof.
The present invention also includes methods and kits for predicting or assessing the level of severity of heart failure or heart failure progression in a patient. In one embodiment, the present invention provides a method of predicting or assessing the level of severity of heart failure or heart failure progression in a patient comprising measuring the level of at least one miRNA selected from Table I in a biological sample from a patient; and comparing the measured level to the level of said at least one miRN A in a control sample (e.g. a sample obtained from a healthy, age-matched subject or a sample obtained from a subject not suffering from or diagnosed with heart failure) or pre-determined reference value, wherein the measured level of said at least one miRNA is indicative of the level of severity of heart failure or heart failure progression in the patient. The biological sample can be any sample described herein. In certain embodiments, plasma or serum samples are preferred. In some embodiments, an increase in the measured level of the miRNA relative to the level of the miRNA in the control sample or pre-determined reference value is indicative of the level of severity of heart failure or heart failure progression in the patient. For instance, in such embodiments, when the level of one or more miRNAs selected from hsa-miR-16, hsa- miR-223, hsa-rniR-320, hsa-miR-150, hsa-miR-378, hsa-miR-92a, hsa-rniR-423-5p, hsa- miR-133a, hsa-miR-22, hsa-miR-21, hsa-miR-210, hsa-miR~2Gb, hsa-miR-499, hsa-miR- 378*, hsa-rniR-106b, hsa-miR- 155, and hsa-miR-93 is increased when compared to the level in a control sample or pre-determined reference value, the increase is indicative of the level of se verity of heart failure or heart failure progression in the patient. In other embodiments, a reduction or decrease in the measured level of the miRNA relative to the level of the miRNA in the control sample (e.g., a sample obtained from a health)', age-matched subject or a sample obtained from a subject not suffering from or diagnosed with heart failure) or pre-detennitied reference value is indicative of the level of severity of heart failure or heart failure progression in the patient. For instance, in such embodiments, when the level of one or more miRNAs selected from hsa-miR-204, hsa-miR- 199b-5p, hsa- miR- 125a-5p, hsa-miR- 143, and hsa-miR- 195 is decreased when compared to the level in a control sample or pre-determmed reference value, the decrease is indicative of the level of severity of heart failure or heart failure progression in the patient.
The present invention also encompasses kits for predicting or assessing the level of severity of heart failure or heart failure progression in a patient. In one embodiment, the kit comprises a reagent for measuring at least one miRNA selected from Table 1 in a biological sample and instructions for measuring said at least one miRNA for predicting or assessing the level of severity of heart failure or heart failure progression in a patient. For instance, in certain embodiments, the kit comprises a miRNA-specific primer for reverse transcribing or amplifying a miRNA selected from of hsa-miR-204, hsa-miR- 199b-5p, hsa-miR- 125a~5p, hsa-miR- 143, hsa- miR- 195, hsa-miR- 16, hsa-miR-223, hsa-miR-320, hsa-miR- 150, hsa-miR-378, hsa-miR-92a, hsa-miR-423-5p, hsa-miR- 133a, hsa-miR-22, hsa-miR-21, hsa-miR-210, hsa-miR-20b, hsa-miR- 499, hsa-miR-378*, hsa-miR- 106b, hsa-miR-155, and hsa-miR-93, and instructions for measuring said at least one miRNA for predicting or assessing the level of severity of heart failure or heart failure progression in a patient. The kits can further comprise additional reagents described herein for kits for evaluating or monitoring the therapeutic efficacy of cardiac treatments, such as normalization controls and Taqman probes specific for each of the miRNAs in the kit. Cardiac disorders can include any disorders that affect the cardiovascular system, including the heart and/or blood vessels, such as arteries and veins. The cardiac disorders contemplated by the methods of the present invention can include cardiac diseases as well as cardiac failure. Cardiac disorders can also include disorders affecting the kidneys. Cardiac disorders can include but are not limited to heart failure, cardiac hypertrophy, coronary heart disease, cardiovascular disease, cardiomyopathy, ischaemic heart disease, hypertensive heart disease, inflammatory heart disease, valvular heart disease, atherosclerosis, cardiorenal disease, renal disease and other renal disorders, in some embodiments, the cardiac disorder is myocardial infarction, pathologic cardiac hypertrophy, heart failure or hypertension.
j / Cardiovascular diseases can include but are not limited to diabetes mellitus, hypertension, hyperhomocysteinemia and hypercholesterolemia.
Cardiomyopathies can include but are not limited to alcoholic cardiomyopathy, coronary artery disease, congenital heart disease, ischemic (or ischaemic) cardiomyopathy, hypertensive cardiomyopathy, valvular cardiomyopathy, inflammatory cardiomyopathy and myocardiodystrophy.
Hypertensive heart diseases can include but are not limited to left ventricular hypertrophy, coronary heart, disease, heart failure (including congestive), hypertensive cardiomyopathy, cardiac arrhythmias and renal disorders. Inflammatory heart diseases can include but are not limited to endocarditis, inflammatory cardiomegaly and myocarditis.
The following examples are included solely to illustrate various aspects of the invention. However, those of skill in the art should, in light of the present disclosure, appreciate that the invention is equally applicable to any human or other animal. EXAMPLES
Example 1: Blood-borne miRNAs as Surrogate Markers of Drug Efficacy for Cardiac Conditions
The importance of miRNAs for cardiac function and dysfunction suggests opportunities for therapeutically exploiting the biology of miRN As in the setting of heart disease. Single-stranded RNA oligonucleotides have been shown to be effective in inactivating miRNAs in vivo through complementary base pairing (Elmen, J. et al. (2008) Nature 452, 896-899; Elmen, J. et al (2008) Nucleic Acids Res 36, 1153-1162; Krutzfeldt, J. et al. (2007) Nucleic Acids Res 35, 2885-2892; Krutzfeldt, J. et al. (2005) Nature 438, 685- 689; Lanford, R.E. et al. (2010) Science 327, 198-201), and represent a potentially effective means of inactivating pathological miRNAs.
This example describes the therapeutic efficacy in a heart failure model of an antisense oligonucleotide targeting miR-208a. Specifically, we show that systemic delivery of locked nucleic acid (LNA)-modified. antisense oligonucleotides against miR-208a is sufficient to induce specific, potent, and sustained silencing of miR-208a in the heart. Moreover, anti-raiR-208a dose-dependently blunts stress-induced remodeling, functional deterioration, and cardiac myosin switching while improving general health and survival in a rat model of diastolic heart failure (Dahl salt-sensitive rats). Interestingly, we show that the physiological effects of antimiR-208a in hypertensive rats are mirrored by significant changes in plasma levels of circulating miRNAs, suggesting that these circulating miRNAs are surrogate markers of drug efficacy.
To determine the therapeutic potential of mi.R-208a inhibition in vivo, we designed an antimiR targeting bases 2 to 17 of the 5' region of mature miR-208a and containing a combination of LNA and DN A linked by phosphorothioate bonds. The sequence of the antimiR-208a, which is referred to as M-10101 , was 5 '-CTTTTTGCTCGTCTT A-3 ' (SEQ ID NO: 12). To test the therapeutic relevance of miR-208a inhibition, we used Dahl salt- sensitive rats that were either fed a low-salt (LS) diet (0.25% NaCl) or a high-salt (HS) diet (8.0% NaCl) starting at 8 weeks of age. Initiation of an HS diet in Dahl salt-sensitive rats results in chronic hypertension, which progresses to a model of congestive heart failure associated primarily with diastolic dysfunction (Rodenbaugh et al. (2007) Am J Physiol Heart Circ Physiol. 293, H1705-H1713). After one week on the HS diet, rats were administered saline, 25 mg/kg antimiR-208a, or 25 mg/kg scrambled control oligo subcutaneously every two weeks. After 3-4 weeks on the HS diet, the saline- and control- treated animals began to show signs of discomfort and died, whereas subcutaenous delivery of antimiR-208a significantly alleviated these symptoms (Figure 1A). As an indication of health, we monitored body weight during the duration of the study. Dahl rats on the HS diet injected with either saline or the control oligo exhibited significant reductions in weight gain compared with controls on the LS diet. HS/antimiR-208a treated rats, however, showed comparable weight gain (Figure IB). To exclude the possibility antimiR-208a-treated animals were maintaining weight through ingesting less of the 8% HS diet, food intake was monitored, which showed a comparable ingestion between all HS-fed groups (Figure 4).
To obtain additional insight into the basis for the protective effects seen in response to antimiR -208a, subsequent studies were done using a 4.0% NaCl diet, during which the rats received saline, 5 or 25 mg/kg of antimiR-208a, or 25 mg/kg of antimiR control every 2 weeks. Body weight analysis indicated that Dahl rats on the HS diet exhibited significant reductions in weight gain compared with the controls on the LS diet, whereas the HS/antimiR-208a-treated rats maintained their increase in weight gain (Figure IC). Functional assessment using echocardiography indicated that antmriR-208a-treated rats exhibited a significant dose-dependent reduction in isovolumic relaxation time (IV RT) compared to HS/saline controls, as well as a normalization of the mitral valve early to active filling velocity ratio (MY E/A ) compared to HS/saline controls eight weeks after the HS diet (Figure ID). Time-dependent echocardiography performed every 2 weeks after the HS diet showed significant reductions in isovolumic relaxation time in anti-miR-208a-treated rats compared with HS/saline controls (data not shown). Quantification of cardiomyocyte size showed a significant reduction in cardiomyocyte hypertrophy following treatment with antimiR-208a (Figure 1E-F). Additionally, antimiR-208a treatment reduced peri arteriolar fibrosis induced by HS diet as assessed by quantification of Picrosirius Red staining (Figure 1 E-F).
Anti-miR-208a caused a dose-dependent inhibition of miR-208a in both left and right ventricles 2 weeks after the last injection with anti-miR-208a, whereas a control oiigo showed no difference compared with saline (Figure 2A). miR-499 also showed a dose- dependent decrease in expression after sustained inhibition of miR-208a (Figure 2A). miR- 208b was induced in both HS/saline- and HS/control-treated animals, paralleling the upregulation of β-myosin heavy chain; however, anti-miR-208a treatment resulted in a dose- dependent decrease in miR-208b levels (Figure 2A). This regulation of miR-499 and miR- 208b was confirmed by Northern blot analysis (Figure 2B). To assess the regulation of the myosin host genes, we examined Myh6, Myh7, and
Myh7b mRNA levels. Myh7 was significantly increased in response to HS in both the HS/saline and HS/control groups. This increase was dose-dependently blunted in response to anti-miR-208a. Additionally, anti--miR-208a treatment normalized the decreased expression of Myh6 mRNA observed in both the HS/saline and HS/controi groups (Figure 2C). Expression of Myhlh mirrored miR-499 levels, exhibiting a dose-dependent reduction on anti-miR-208a treatment. Furthermore, the dose-dependent regulation of MybJ was confirmed by Western blot (Figure 2D). In addition, anti-mi.R-208a ireatment resulted in a derepression of the previously characterized miR-208a target, ΗΡ Ι β, further suggesting that anti-miR-208a action occurs through miR-208a inhibition (Figure 2E). Detection of miRNAs in plasma during various disease settings is showing increasing diagnostic promise (Cortez MA and Calin GA (2009) Expert Opin Biol Ther. 9, 703-71 1). To determine whether there is a specific miRNA that correlates with antimiR-208a efficacy, we examined a pane! of muscle related miRNAs during H8 treatment. Strikingly, miR-499, although showing only modest increases in plasma detection under high salt, was significantly reduced in antimiR-208a-treated animals, suggesting miR-499 can act as a plasma-based marker for antimiR-208a efficacy (Figure 3). Additionally, miR-423-5p plasma levels, which were previously correlated to human heart failure (Tijsen, A. J., et al. (2010) Circ Res 106, 1035-1039), were found to be reduced in animals treated with antimiR-208a (Figure 3). Other muscle-specific miRNAs did not show significant differences between the groups tested (Figure 5). The results of this study indicate that therapeutic inhibition of miR-208 leads to a reduction in cardiac remodeling, which coincides with a significant improvement in survival and cardiac function during heart disease. The efficacy of miR-208a inhibition in the heart can be monitored by measuring plasma levels of miR-499 and miR-423-5p as the plasma levels of these miRNAs correlated with miR-208a knockdown in heart tissue by an antimiR- 208 oligonucleotide. Specifically plasma miRNA analysis showed that anti-miR-208a treatment results in a diminution of miR-499 and miR-423~5p in blood serum, which parallels the decrease in cardiac expression of Myh7b/miR-499 in response to anti-miR-208a treatment. Given the correlation between plasma-based miR-499/miR-423~5p levels and the efficacy of anti-miR-208a, these data suggest that plasma miR-499 and miR-423-5p levels would serve as biomarkers of effective deliver}? of anfi-miR~2Q8a to the heart when moving into patients.
Specific Methods
Animals and delivery of LNA-modified aniimiRs, The LNA-antimiR oligonucleotides were synthesized at miRagen Therapeutics, Inc. as unconjugated and fully phosphorothiolated oligonucleotides perfectly complementary to the 5' region of the mature miR-208a sequence. The LNA control oligonucleotide consisted of a sequence directed against a C. elegans specific miRNA. Unless otherwise indicated, in vivo delivery of the oligonucleotide chemistries was achieved by low pressure intravenous (i.v.) injections via the tail vein or subcutaneous injections of either adult male C56B16 mice or adult male Dahl Salt-sensitive rats (Harlan, Indianapolis). All chemistries were dissolved and injected in a comparable end volume of saline after which the animals were examined for obvious side effects of the chemistries. Tissue samples were collected at the indicated timepoints for molecular or histological examination. Dahl rats were maintained on 0.25 NaCI or placed on 4% or 8% NaCl diet at 8 weeks of age (Harlan, I dianapolis).
Quantitative real-time PCR analysis. For in vivo real-time PGR analysis, RNA was extracted from cardiac tissue using Trizol (Invitrogen) after which two fig RNA from each tissue sample was used to generate cDNA using Super Script ΪΙ reverse transcriptase per manufacturer's specifications (Invitrogen). To detect the level of miR-208 RT-PCR was performed using the Taqman Micro RNA assay (Applied Biosystems, ABI) according the manufacturer's recommendations, using 10-100 ng of total RNA. The expression of a subset of genes was analyzed by quantitative real time PCR. using Taqman probes purchased from ABI.
Northern blot analysis. Total RNA was isolated from cardiac tissue samples by using Trizol reagent (Gibco/BRL), Northern blots to detect microRNAs were performed as descri bed previously described. A U6 probe served as a loading control (IDT). 10 μ§ of total RNA from cardiomyocytes or heart tissue was loaded on 20% acrylamide denaturing gels and transferred to Zeta-probe GT genomic blotting membranes (Bio-Rad) by electrophoresis. After transfer, the blots were cross-linked and baked at 80°C for 1 hr. To maximize the sensitivity of miRNA detection, oligonucleotide probes were labeled with the Starfire Oligos Kit (IDT, Coralville, IA) and a~j2P dATP (Amersham or Perkm Elmer). Probes were hybridized to the membranes overnight at 39°C in Rapid-hyb buffer (Amersham), after which they were washed twice for 10 minutes at 39°C with 0.5x SSC containing 0.1% SDS. The blots were exposed and quantified by Phosphorlmager analysis (GE HealthCare Life Sciences) and a U6 probe served as a loading control (ABI). The intensity of the radioactive signal was used to quantify the fold change in expression using a phosphorimager and ImageQuant (Bio-Rad). Western blot analysis. For Western blot analysis, Myosin was extracted from cardiac cells or tissue as described (Hamalainen, N. & Pette, D. Patterns of myosin isoforms in mammalian skeletal muscle fibres. Microsc Res Tech 30, 381-389 (1995)). MHC isoforms were detected by loading 0.1 ug protein lysate on a 4-15% gradient gel and separated by SDS PAGE and Western blotting was performed with mouse monoclonal anti-myosin (slow, skeletal 8421 ) (Sigma, MO), which is highly specific for Myh7. Quantitative real-time PGR analysis from plasma. RNA from plasma samples was isolated using Trizol LS Reagent ( Invitrogen), using the manufacturer's protocol. Prior to RNA isolation, 250pmol of two different synthetic C. elegans miRNA sequences were added to serve as internal controls for normalization of target miRNAs. The C. elegans sequences used were cel-miR-2 (UAUCACAGCCAGCUUUGAUGUGC, SEQ ID NO:5), and cel-lin-4 (UCCCUGAGACCUCAAGUGUGA; SEQ ID NO:6) (Dharmacon). The final RNA pellet was re-suspended in a final volume equal to the initial plasma volume and 5μ1 was used for subsequent RT-PCR reactions, as described above.
Statistical analysis. One-way ANOVA and Newman-Keuls Multiple Comparison Post-test were used to determine significance. P < 0.05 was considered statistically significant.
Example 2: Plasma miRNAs are biomarkers of disease progression of heart failure ami therapeutic efficacy of antimiR-208 oligonucleotides.
To evaluate plasma biomarkers over time, surgically implanted catheters were used for non-invasive bi-weekly blood draws in the Dahl salt-sensitive rat model of congestive heart failure described in Example 1. Changes in plasma miRNA biomarkers with disease progression and therapeutic treatment with an LNA-modified antisense oligonucleotide targetmg miR-208a (M-10101; SEQ ID NO: 12) were evaluated. The following experimental groups were tested:
Figure imgf000044_0001
The M-10591 oligonucleotide (SEQ ID NO: 13) targets miR-67 from (1 elegans, which is not expressed in mammalian tissue, and therefore was used as a control. Dahl salt- sensitive rats were implanted with catheters at week zero and baseline blood was taken. Following catheter implant surgery, high-salt diet was initiated. One week following the initiation of the 4.0% NaCl diet, rats were dosed subcutaneously (s.c.) with saline or a imiRs at 25 mg/kg once ever 2 weeks. On alternating weeks (non-injection weeks) 1.5 mis of blood was drawn from the catheter for plasma isolation. Animals were sacrificed 8 weeks after the initial injection. Plasma and tissue molecular endpoints were evaluated using Taqman RT-PCR assays.
Specifically, RNA from plasma samples was isolated using Trizol LS (Invitrogen). Synthetic C. elegans miRNA sequences for iin-4 and miR-2 were added at a constant concentration to each sample to monitor purification efficiency and for normalization. Tissue RNA was isolated using standard Trizol RNA isolation. Standard ABI Taqman miRNA assay protocols were used to determine relative miRNA levels.
To evaluate the efficacy of antimiR-208 treatment, cardiac tissue markers were measured. High-salt diet (HS) resulted in a significant decrease in miR-208a levels. Treatment with the -10101 antimiR-208a oligonucleotide resulted in greater inhibition of miR-208a in cardiac tissue compared to HS/Saline group (Figure 6A). Examination of Myh6 expression, the host gene for miR-208a, revealed a significant decrease in animals on the HS diet receiving either saline or the M- 10591 control oligonucleotide as compared to animals in the low-salt (LS)/saline group (Figure 6B). In contrast, treatment with the antimiR-208a prevented the high-salt diet-induced decrease in Myh6 expression (Figure 6B). Expression of the Myh7geae was significantly increased in animals in the HS/saline and HS/controI oligonucleotide groups as compared to LS/Saline group (Figure 6C). AntimiR-208a treatment blunted the hypertension-induced increase in Myh7 expression (Figure 6C). These results show that the antimiR-208 oligonucleotide treatment was effective at the molecular level in reducing gene expression changes induced by hypertensive conditions.
Changes in levels of various miRNAs in plasma during progression of hypertension in Dahi salt-sensitive rats (low-salt diet/saline vs. high-salt/saline groups) was measured by miRNA Taqman array card analysis and confirmed by real-time PGR analysis after 8 weeks on either the low or high salt diet (Table 1). These plasma miRN As can serve as biomarkers to assess disease severity and heart failure progression over time.
Table 1 : Fold chasige of plasma miRNAs lai Healthy Rats vs. rats with hypertension- induced heart failure (LS-Saline vs. HS-Saline).
Figure imgf000046_0001
Changes in plasma miRNA. levels between rats suffering from hypertension-induced heart fai lure (HS/saline group) and rats treated with an antimi R-208a oligonucleotide (HS/M- 10101) were assessed at 8 weeks by both miRNA Taqman array card analysis (Tables 2 and 3) and real-time PGR analysis (Table 4). Table 2. Fold ehas¾ge of plasma mi NAs that are decreased in response to therapeutic treatment in rats with hypertension-induced heart failure (HS-saline/HS-10101) measured by miRNA Taqman array card analysis.
Figure imgf000047_0001
miRNA Mature miRNA Sequence (5' to 3') Fold-
ID NO Change bsa-mi.R-16 UAGCAGCACGUAAAUAUUGGCG 26 2.04 hsa-miR-18a UAAGGUGCAUCUAGUGCAGAUAG 27 2.01 hsa-m.iR-26b UUCAAGUAAUUCAGGAUAGGU 28 1.98 hsa-miR-192 CUGACCUAUGAAUUGACAGCC 29 1.92 hsa-miR-320a AAAAGCUGG GUUG AG AG GG C G A 30 1.89 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA 4 1.88 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA 31 1.83 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC 32 1 .79 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG 33 1.76 hsa-m.iR-195 UAGCAGCACAGAAAUAUUGGC 34 1.73 hsa-miR-122 UGGAGUGUGACAAUGGUGUUUG 35 1.59 hsa-miR-197 UUCACCACCUUCUCCACCCAGC 36 1.52 hsa-miR-125b-5p UCCCUGAGACCCUAACUUGUGA 37 1.51 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG 38 1.49 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU 39 1 .46 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU 40 1.42 hsa-miR-17 CAAAGUGCUUACAGUGCAGGUAG 41 1.41 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU 42 1.39 bsa-mi.R-182 UUUGGCAAUGGUAGAACUCACACU 43 1.39 miRNA Mature miRNA Sequence (5' to 3') Fold-
ID NO Change hsa-miR-181c AACAUUCAACCUGUCGGUGAGU 44 1.37 hsa-miR-29c UAGCACCAUUUGAAAUCGGUUA 45 1.34 hsa-m.iR-25 CAUUGCACUUGUCUCGGUCUGA 46 1.33 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU 47 1.32 hsa-miR-30a UGUAAAC AUCCUC G ACUG G AAG 8 1.28 hsa-miR-30b UGUAAACAUCCUACACUCAGCU 49 1.21 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU 50 1.20 hsa-miR-34G-5p UUAUAAAGCAAUGAGACUGAUU 51 1 .19 hsa-miR-27b UUCACAGUGGCUAAGUUCUGC 52 1 18 hsa-m.iR-24 UGGCUCAGUUCAGCAGGAACAG 53 1.17 hsa-miR-103a AGCAGCAUUGUACAGGGCUAUGA 54 1.16 hsa-miR-203 GUGAAAUGUUUAGGACCACUAG 55 1.13 hsa-miR-222 AGCUACAUCUGGCUACUGGGU 56 1.1 1 hsa-miR-lOla UACAGUACUGUGAUAACUGAA 57 1.11 hsa-let-7b UG AGGU AGUAGGUU G U G U GGUU 58 1 .09 hsa-miR-335-5p UCAAGAGCAAUAACGAAAAAUGU 59 1.07
Table 3. Fold change of plasma miRNAs that are increased in response to therapeutic treatment in rats with hypertension-induced heart failure (HS-10101/HS-Saline) measured by miRNA Taqmasi array card asialysis. miRNA Mature miRNA Sequence (5' to 3') Fold-
ID NO Change hsa-miR- 142-3p UGUAGUGUUUCCUACUUUAUGGA 60 25,04 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU 61 18.29 hsa-m.iR-125a-3p ACAGGUGAGGUUCUUGGGAGCC 62 12.16 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG 63 11.73 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC 64 8.47 hsa-miR-28 AAGGAGCUCACAGUCUAUUGAG 65 6.61 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA 66 5.54 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA 67 5.34 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU 68 4.61 hsa-miR- 19b UGUGCAAAUCCA.UGCAAAACUGA 69 3.27 hsa-miR- 199a-3p ACAGUAGUCUGCACAUUGGUUA 70 3.14 hsa-let-7g UGAGGUAGUAGUUUGUACAGUU 71 3.02 hsa-miR-181 a AACAUUCAACGCUGUCGGUGAGU 3.00 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU 73 2.99 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU 74 2.67 hsa-miR-487b AAUCGUACAGGGUCAUCCACUU 75 2.67 hsa-m.iR-99b CACCCGUAGAACCGACCUUGCG 76 2.63 hsa-miR- 130a CAGUGCAAUGUUAAAAGGGCAU 77 2.30 hsa-mi.R-574-3p CACGCUCAUGCACACACCCACA 78 2.20 miRNA Mature miRNA Sequence (5' to 3') Fold-
ID NO Change hsa-mi.R-339-5p UCCCUGUCCUCCAGGAGCUCACG 79 2.18 hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA 80 2.10 hsa-m.iR-145 GUCCAGUUUUCCCAGGAAUCCCU 81 2.07 hsa-miR-152 UCAGUGCAUGACAGAACUUGG 82 2.05 hsa-miR-126-5p CAUUAUUACUUUUGGUACGCG 83
(miR-126*) 2.01 hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU 84 1.98 hsa-iet-7d AGAGGUAGUAGGUUGCAUAGUU 85 1.98 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA 86 1.90 hsa-mi.R-340-3p UCCGUCUCAGUUACUUUAUAGC 87 1.86 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCU 88 1.83 hsa-miR-128a UCACAGUGAACCGGUCUCUUU 89 1.75 hsa-miR-155 l]IJAAlJG(: iJAAljC:GlJGAUAGGGGU 90 1 .73 hsa-miR-532-3p CCUCCCACACCCAAGGCUUGCA 91 1.72 hsa-let-7e IJGAGGlJAGGAGGljlJGlJAlJAGlJlJ 92 1.66 hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG 93 1.60 hsa-mi.R-2 4 ACAGCAGGCACAGACAGGCAGU 94 1.57 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU 95 1.54 hsa-miR~331-3p GCCCCUGGGCCUAUCCUAGAA 96 1.53 hsa-miR-31 AGGC A AG AU GCUGGC AU A GC U 97 1 .45 miRNA Mature miRNA Sequence (5' to 3') Fold-
ID NO Change hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU 98 1 .39 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC 99 1.37 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA 100 1.32 hsa-miR-29a UAGCACCAUCUGAAAUCGGUUA 101 1 .31 hsa-miR-30d UGUAAACAUCCCCGACUGGAAG 102 1.29 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG 103 1.27 hsa-miR-130b C AGUGC AAUG AUG AAAG GG C AU 104 1.26 hsa-miR-1 1 CAACGGAA.UCCCAAAAGCAGCUG 105 1 .23 hsa-miR-146a UGAGAACUGAAUUCCAUGGGUU 106 1.17 hsa-m.iR-342-3p UCUCACACAGAAAUCGCACCCGU 107 1.15 hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAG 108 1 .14 hsa-miR-138 AGCUGGUGUUGUGAAUCAGGCCG 109 1.08 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG 1 10 1.07 hsa-miR-30e UGUAAACAUCCUUGACUGGAAG 1 1 1 1.06
Table 4. Fold change of plasma miRNAs in rats with hypertension-induced heart failure vs. treated rats (HS-Saline vs. HS-10101) as confirmed by Real Time PCR analysis.
Figure imgf000052_0001
Figure imgf000053_0001
Figure imgf000054_0001
Interestingly, the results of this study show that there are plasma miRNA biomarkers of heart failure progression and severity, therapeutic efficacy of antimiR-208a treatment, and both. All of the disease progression markers were also markers of therapeutic efficacy of antimiR-208 treatment. However, there were several plasma miRNAs, such as miR-19b, miR-199, miR-145, miR-214, miR-185, miR-140, miR-27a, raiR-20a, miR-122, and raiR- 126, that were solely biomarkers of therapeutic efficacy of the antimiR-208a oligonucleotide. Time courses for miR~423-5p, miR~19b, miR-499, and miR-16 plasma levels over the course of the experiment are shown in Figure 7. The results from these experiments show that plasma levels (e.g. abundance) of specific miRNAs can serve as surrogate markers of efficacy of cardiac therapeutics, particularly antimiR-208 therapeutics, as well as markers of heart fai lure progression and severity.
Example 3: Both Asitimi and Captopril Treatments Affect Circulating miRs The Dahl salt-sensitive rat model of congestive heart failure (see Example 1) was used to evaluate the effects of different therapeutic approaches on plasma miRN A levels. Specifically, rats were treated with a LNA-containmg antimiR-208 oligonucleotide (M- 10101), Captopril (an angiotensin-convertmg enzyme (ACE) inhibitor), or a combination of the two ( -10101 + Captopril). he following experimental groups were evaluated:
Figure imgf000054_0002
Figure imgf000055_0001
One week following the initiation of the 6.0% NaCl diet, rats were dosed subcutaneously (sc) with saline or oligonucleotides (M-10101 , 5 '-CTTTTTGCTCGTCTTA- 3' (SEQ ID NO: 12) or M-I0591, 5 ' -TCCTAGAAAGAGTAGA-3 ' (SEQ ID NO: 13)) at 25 mg kg every 2 weeks. Captopril or water were dosed daily by oral gavage. Echocardiography was performed every 2 weeks starting one week post iv dosing. The Captopril dose for rat was selected to match the standard human dose in man. Plasma and tissue molecular endpoints were evaluated using Taqman RT-PCR assays.
Treatment with the antimiR-208a oligonucleotide (M-10101) partially prevented the body weight loss induced by the high-salt diet (Figure 8 A). In contrast, treatment with the control oligonucleotide (M-10591) had no apparent effect on weight gain. Rats treated with 15 mg/kg Captopril exhibited a lower body weight as compared to animals on a regular, low- salt (LS) diet, but a higher body weight as compared to animals on the high-salt diet (Figure 8B). Thus, Captopril slightly reduced the high-salt (HS) diet-induced decrease in body weight, but not as effectively as antimiR-208a treatment. Body weight graphs were generated by carrying over final body weights of those rats that died prior to the end of the study. As shown in Figure 9, only treatment with antimiR-208a (M-IQ! 01) alone significantly improved survival following placement of the animals on a high-salt diet (* p<0.05; M- 10101, water vs. high-salt diet, saline-treated rats). No mortality was observed in the LS, saline controls or HS, M-l 0101-treated rats.
Real time PCR analysis of the myomiRs (miR-208a, miR-499 and miR-208b) showed that the 6% HS diet reduced cardiac levels of miR-208a, and miR-208a levels were further reduced by miR-208a inhibition with M-10101 (Figure 10A). Treatment with the antimiR - 208a oligonucleotide also resulted in a reduction of cardiac levels of miR-499 and miR-208b (Figures 10B and C). Real time PCR analysis of the myosin genes showed that the 6% HS diet reduced aMHC (Myh6) in the heart, which was normalized by antimiR-208a oligonucleotide (M-10101) treatment, Captopril treatment, or a combination of both antimiR- 208a and Captopril treatment (Figure 1 1 A). Myh7b levels were specifically reduced in animals receiving the antimiR-208a oligonucleotide (Figure 1 1 B). However, Captopri l treatment alone had no apparent effect on MybTb expression. Although both Captopril treatment and antimiR-208a oligonucleotide treatment reduced the increase in pMHC (Myh7) expression induced by the HS diet (e.g. cardiac stressor), antimiR -208a oligonucleotide was more effective (Figure 1 1C). In fact, pMHC levels in antimiR-208a-treated animals were not significantly different from animals on the LS diet. As shown in Figure 12, real time PCR analysis of direct target genes of miR-208a, revealed that treatment of animals with the anitmiR-208a oligonucleotide, M-10101 , produced an increase in expression these genes, indication that M- 10101 effectively inhibited mi.R-208a function.
The results described above demonstrate that both antimiR~208a and the standard of care therapy, Captopril, are effective in reducing both the phyisological and molecular changes produced by hypertension. However, antimiR-208a appears to be more effective than Captopril in treating hypertension-induced heart failure in the Dalt salt-sensitive rat model
Because plasma levels of various miRNAs correlated with the efficacy of antimiR- 208a oligonucleotide treatment (see Example 2), plasma miRNA levels from rats in each of the different treatment groups were measured to determine whether plasma miRNA levels were affected by other cardiac treatments, such as captopril. Plasma levels of several miRNAs appeared to correlate with efficacy of both antimiR-208a oligonucleotide and Captopril therapy (Figure 13A-I), For example, real time PCR analysis showed that miR- 423-5p, mi.R-106b, mi -16, miR-92a, miR-378, mi.R-210, miR-378*, miR-20b, and miR-93 were decreased in response to both antimiR-208a and Captopril treatment. Interestingly, plasma levels of miR-378 and miR-378* appeared to be specifically correlated with the combination therapy of both the antimiR and the ACE inhibitor (Figures 13E and G). Plasma levels of other miRNAs were correlated with either antimiR-208a oligonucleotide therapy or Captopril therapy. For instance, plasma levels of miR-19B were significantly increased in animals that received the antirniR-208a oligonucleotide (Figure 14 A). Although plasma levels of miR-223 were significantly reduced in response to both types of treatment, a more significant decrease was observed in animals receiving the aiitimiR-208a oligonucleotide (Figure 14B). In contrast, levels of miR-21 and miR-150 in plasma were reduced specifically with Captopril treatment (Figures 14C-D).
These results show that there is a panel of niiRNA for which changes in plasma levels can be observed in response to different cardiac therapies. Interestingly, there appear to be specific plasma miRNAs whose levels correlate with a specific type of cardiac therapy (e.g. miR-208a therapy or ACE inhibitor), whereas levels of other plasma miRNAs appear to correlate with both types of therapies. Still another subset of plasma miRNAs appear to be markers of efficacy of the combined therapy only. Thus, plasma miRNA levels can be used to not only monitor efficacy of cardiac therapies in general, but also to monitor the efficacy of specific therapeutic interventions or combined treatments.
Specific Methods
Animals and delivery of LNA-modified antimiRs. The L'NA-antimi oligonucleotides were synthesized at miRagen Therapeutics, Inc. as unconjugated and fully phosphorothioiated oligonucleotides perfectly complementary to the 5' region of the mature miR~208a sequence. The LNA control oligonucleotide consisted of a sequence directed against a C. elegans specific miRNA. Unless else indicated, in vivo deliver}' of the oligonucleotide chemistries was achieved by low pressure intravenous (i.v.) injections via the tail vein or subcutaneous injection of adult male Dahl Salt-sensitive rats (Harlan, Indianapolis). Ail chemistries were dissolved and injected in a comparable end volume of saline after which the animals were examined for obvious side effects of the chemistries. Tissue samples were collected at the indicated timepomts for molecular or histological examination. Dahl rats were maintained on 0.25 NaCl or placed on 4%, 6% or 8% NaCl diet at 8 weeks of age (Harlan, Indianapolis).
Quantitative real-time PCR analysis. For i vivo real-time PCR analysis, RNA was extracted from cardiac tissue using Trizol (Invitrogen) after which two μ§ RNA from each tissue sample was used to generate cDNA using Super Script II reverse transcriptase per manufacturer's specifications (Invitrogen). To detect the level of miR-208 R.T-PCR. was performed using the Taqman MicroRNA assay (Applied Biosystems, ABI) according the manufacturer's recommendations, using 10-100 ng of total RNA. The expression of a subset of genes was analyzed by quantitative real time PCR using Taqman probes purchased from ABL
Quantitative real-time PCR analysis from plasma, RNA from plasma samples was isolated using Trizol LS Reagent (Invitrogen), using the manufacturer's protocol Prior to RNA isolation, 250pmol of two different synthetic C. elegans miRNA sequences were added to serve as internal controls for normalization of target miRNAs, The C. elegans sequences used were cel-miR-2 (UAUCACAGCCAGCUUUGAUGUGC, SEQ ID NO:5), and cel-lin-4 (UCCCUGAGACCUCAAGUGUGA; SEQ ID NO:6) (Dharmacon). The final RNA pellet was re-suspended in a final volume equal to the initial plasma volume and 5μ1 was used for subsequent RT-PCR reactions, as described above.
Statistical analysis. One-way ANOVA and Newman-Keuls Multiple Comparison Post-test were used to determine significance. P < 0.05 was considered statistically significant.
All publications discussed and cited herein are incorporated herein by reference in their entireties. It is understood that the disclosed invention is not limited to the particular methodology, protocols and materials described as these can vary. It is also understood that the terminology used herein is for the purposes of describing particular embodiments only and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the appended claims.

Claims

Claims:
1 , A method for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder comprising:
measuring the level of at least one miRNA in a biological sample from a patient receiving the therapeutic intervention, wherein the measured level of said at least one miRNA is indicative of the therapeutic efficacy of the therapeutic intervention.
2. The method of claim 1, wherein the biological sample is plasma or serum.
3, The method of claim 1, wherein the biological sample is cardiac tissue.
4. The method of claim 1 , wherein said at least one miRNA is selected from an miRNA listed in any one of Tables 2-4.
5. The method of claim 4, wherein a decrease in the measured level of the miRNA relative to the level of the miRNA in the control sample is indicative of the therapeutic efficacy of the therapeutic intervention.
6, The method of claim 5, wherein said at least one miRNA is selected from hsa-miR- 16, hsa-miR-320, hsa-miR-223, hsa-miR-93, hsa-miR- 106b, hsa-miR-423~5p, hsa-miR-185, hsa-miR-92a, hsa-miR-210, hsa-miR- 140, hsa-miR-27a, hsa-miR-20b, hsa-miR-150, hsa- miR-20a, hsa-mi -378, hsa-miR-22, hsa-miR-21, hsa-miR-378*, hsa-miR- 122, hsa-miR- 126, hsa-miR- 133a, and hsa-miR-499.
7. The method of claim 4, wherein an increase in the measured level of the miRNA relative to the level of the miRNA in the control sample is indicative of the therapeutic efficacy of the therapeutic intervention.
8, The method of claim 7, wherein said at least one miRNA is selected from hsa-miR- 19b, hsa-miR- 199b-5p, hsa-miR-204, hsa-miR- 145, hsa-miR- 195, hsa-miR-125a-5p, hsa- miR- 143, and hsa-mi.R-214.
9. The method of claim 1, wherein the therapeutic intervention is a miRNA-based therapeutic.
10. The method of claim 9, wherem the miRNA-based therapeutic is a chemically- modified antisense oligonucleotide targeting a miRNA expressed in heart tissue.
1 1. The method of claim 10, wherein the chemically-modified antisense oligonucleotide targets miR-208a and/or miR-208b.
12. The method of claim 11, wherem said at least one miRNA is selected f om miR- 19b, miR-223, miR-423-5p, miR-106b, miR-16, miR-92a, miR-378, miR-210, miR-378*, miR- 20b, and miR-93.
13. The method of claim 12, wherem said at least one miRNA is miR- 19b or miR-223.
14. The method of claim 12, wherein said at least one miRNA is measured between one and six weeks following administration of the antisense oligonucleotide.
15. The method of claim 11, wherem a change in the measured level of the miRNA relative to a reference level or the level of the miRNA in the control sample is indicative of decreased expression of miR-208a and/or miR-208b in heart tissue.
16. The method of claim 1, wherem the therapeutic intervention is an angiotensin- converting enzyme inhibitor.
17. The method of claim 16, wherein said at least one mi RNA is selected from miR- 150, miR-21, miR-223, miR-423-5p, miR- 106b, miR-16, miR-92a, miR-378, miR-210, miR-378*, miR-20b, and miR-93.
18. The method of claim 17, wherein said at least one miRNA is miR-21 or miR-150.
19. The method of claim 1, wherem the cardiac disorder is myocardial infarction, pathologic cardiac hypertrophy, heart failure, or hypertension.
20. The method of claim 1, wherein the biological sample is obtained from the patient at least one week following the start of the therapeutic intervention,
21. The method of claim 1 , wherein the measured level of said at least one miRNA is compared to the level of said at least one miRNA in a control sample, wherein the comparison is mdicative of the therapeutic efficacy of the therapeutic intervention.
22. The method of claim 1 , wherein the measured level of said at least one miRNA is com pared to a pre-determined reference value, wherein the com parison is indicative of the therapeutic efficacy of the therapeutic intervention.
23. The method of claim I , further comprising altering the therapeutic intervention based on the measured level of said at least one miRNA in said biological sample.
24. A method of pro viding useful information for e valuating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder comprising determining the level of at least one miRNA in a biological sample of a patient and providing the level of the at least one miRNA to an entity that provides a determination of the efficacy based on an increase or decrease in the level of the at least one miRNA.
25. A kit comprising a reagent for measuring at least one miRNA selected from any one of Tables 2-4 in a biological sample and instructions for measuring said at least one miRNA for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder in a patient.
26. The kit of claim 25, wherein the reagent comprises a miRNA-specific primer for reverse transcribing or amplifying a miRNA selected from hsa-miR-16, hsa-miR-320, hsa- miR-223, hsa-miR-93, hsa-miR-106b, hsa~miR-423-5p, hsa-miR-185, hsa-miR-92a, hsa- miR-210, hsa-miR-140, hsa-miR-27a, hsa-rniR-20b, hsa-miR-150, hsa-miR-20a, hsa-miR- 378, hsa-miR-22, hsa-miR-21, hsa-miR-378*, bsa-miR-122, hsa-miR-126, hsa-miR-133a, hsa-miR-499, hsa-miR-19b, hsa-miR-199b-5p, hsa-miR-204, hsa-miR-145, hsa-miR-195, hsa-miR-125a-5p, hsa-miR-143, and hsa-ratR-214 .
27. The kit of claim 25, further comprising one or more normalization controls.
28. The kit of claim 27, wherein the one or more normalization controls are provided as one or more separate reagents for spiking samples or reactions.
29. The kit of claim 28, wherein at least one normalization control is a non-endogenous RNA or miRNA, or a miRNA. not expressed in the sample.
30. The kit of claim 29, wherein at least one normalization control is a C, elegans miRNA.
31. The kit of claim 30, wherein at least one normalization control is cel-miR-2, cel-lin-4 or ath-miR-159a.
32. The kit of any one of claims 25 to 29, further comprising a TaqMan probe specific for each miRNA of the kit.
33. The kit of claim 25, wherein the biological sample is plasma or serum obtained from a patient receiving treatment for a cardiac disorder.
34. The kit of claim 33, wherein the cardiac disorder is myocardial infarction, pathologic cardiac hypertrophy, heart failure, or hypertension.
35. A method of predicting or assessing the level of severity of heart failure or heart failure progression in a patient comprising:
measuring the level of at least one miRNA selected from Table 1 in a biological sample from a patient, wherein the measured level of said at least one miRN A is indicative of the level of severity of heart failure or heart failure progression in the patient.
36. The method of claim 35, wherein said control sample is obtained from a healthy subject not suffering or diagnosed with heart failure.
37. The method of claim 35, wherein the measured level of said at least one miRNA is compared to the level of said at least one miRNA in a control sample, wherein the comparison is indicative of the level of severity of heart failure or heart failure progression in the patient.
38. The method of claim 35, wherein the measured level of said at least one miRNA is compared to a pre-determined reference value, wherein the comparison is indicative of the level of severity of heart failure or heart failure progression in the patient.
39. The method of claim 37 or 38, wherein a decrease in the measured level of the miRNA relative to the level of the miRNA in the control sample or the pre-determined reference value is indicative of the level of severity of heart failure or heart failure progression in the patient.
40. The method of claim 39, wherein said at least one miRNA is selected from hsa-miR- 204, hsa-miR-199b-5p, hsa-miR-125a-5p, hsa-miR-143, and hsa-miR-195.
41. The method of claim 37 or 38, wherein an increase in the measured level of the miRNA relative to the level of the miRNA in the control sample or the pre-determined reference value is indicative of the level of severity of heart failure or heart failure progression in the patient.
42. The method of claim 41, wherein said at least one miRNA is selected from hsa-miR- 16, hsa-miR-223, hsa-miR-320, hsa-miR-150, hsa-miR-378, hsa-miR~92a, hsa-miR-423-5p, hsa-miR-133a, hsa-miR-22, hsa-miR-21, hsa-miR-210, hsa-miR-20b, hsa-miR-499, hsa-miR- 378*, hsa~miR-lQ6b, hsa~miR-155, and hsa~miR~93,
43. The method of claim 35, wherein the biological sample is plasma or serum.
44. A kit comprising a reagent for measuring at least one miRNA selected from Table 1 in a biological sample and instructions for measuring said at least one miRNA for predicting or assessing the level of severity of heart failure or heart failure progression in a patient.
45. The kit of claim 44, wherein the reagent comprises a miRNA-specific primer for reverse transcribing or amplifying a miRNA selected from hsa-miR-204, hsa-miR-199b-5p, hsa-miR-125a-5p, hsa-miR- 143, hsa-miR- 195, hsa-miR- 16, hsa-miR-223, hsa-miR-320, hsa- miR- 150, hsa-miR-378, hsa-miR-92a, hsa-miR-423~5p, hsa-miR- 133a, hsa-miR-22, hsa-miR- 21, hsa-miR-210, hsa-miR-20b, hsa-miR-499, hsa-miR-378*, hsa-miR-106b, hsa-miR- 155, and hsa-miR-93.
46. A method for treating a patient for heart failure, the patient having elevated or low levels of one or more miRNAs listed in Table 1, comprising administering a miR-208(a) inhibitor or miR-208(h) inhibitor to the patient.
47. The method of claim 46, wherein the patient has elevated levels of miR-223, miR-16, miR-93, miR- 106(b) and/or miR-423-5p.
48. The method of claim 46, wherein the levels of miR-223, miR-16, miR-93, miR- 106(b) and/or miR-423-5p are determined prior to treatment for heart failure.
49. The method of any one of claims 46 to 48, wherein the levels of miR- 19(b) are monitored at least once during the course of treatment.
PCT/US2011/065120 2010-12-15 2011-12-15 Blood-borne mirnas as surrogate markers of drug efficacy for cardiac conditions Ceased WO2012083004A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CN2011800675783A CN103370424A (en) 2010-12-15 2011-12-15 Blood-borne miRNAs as surrogate markers of drug efficacy for cardiac conditions
EP11804873.5A EP2652146A2 (en) 2010-12-15 2011-12-15 Blood-borne mirnas as surrogate markers of drug efficacy for cardiac conditions
JP2013544771A JP2014507123A (en) 2010-12-15 2011-12-15 Blood miRNA as a surrogate marker of drug efficacy for heart disease
US13/994,622 US20140024700A1 (en) 2010-12-15 2011-12-15 Blood-borne mirnas as surrogate markers of drug efficacy for cardiac conditions
AU2011343719A AU2011343719A1 (en) 2010-12-15 2011-12-15 Blood-borne miRNAs as surrogate markers of drug efficacy for cardiac conditions
CA2818174A CA2818174A1 (en) 2010-12-15 2011-12-15 Blood-borne mirnas as surrogate markers of drug efficacy for cardiac conditions

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US42345610P 2010-12-15 2010-12-15
US61/423,456 2010-12-15
US201161495220P 2011-06-09 2011-06-09
US61/495,220 2011-06-09
US201161538585P 2011-09-23 2011-09-23
US61/538,585 2011-09-23

Publications (2)

Publication Number Publication Date
WO2012083004A2 true WO2012083004A2 (en) 2012-06-21
WO2012083004A3 WO2012083004A3 (en) 2012-11-29

Family

ID=45444747

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/065120 Ceased WO2012083004A2 (en) 2010-12-15 2011-12-15 Blood-borne mirnas as surrogate markers of drug efficacy for cardiac conditions

Country Status (7)

Country Link
US (1) US20140024700A1 (en)
EP (1) EP2652146A2 (en)
JP (1) JP2014507123A (en)
CN (1) CN103370424A (en)
AU (1) AU2011343719A1 (en)
CA (1) CA2818174A1 (en)
WO (1) WO2012083004A2 (en)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013093870A1 (en) 2011-12-23 2013-06-27 International Centre For Genetic Engineering And Biotechnology - Icgeb microRNAs FOR CARDIAC REGENERATION THROUGH INDUCTION OF CARDIAC MYOCYTE PROLIFERATION
CN103290116A (en) * 2013-05-16 2013-09-11 南京市妇幼保健院 Matrix serum/plasma miRNA (Micro Ribonucleic Acid) marker associated with fetal congenital heart diseases and application of marker
WO2015066611A3 (en) * 2013-11-01 2015-07-02 The Trustees Of Columbia University In The City Of New York Microrna profiles in heart failure: methods and systems for detection and use
EP3034623A1 (en) * 2014-12-18 2016-06-22 Centro de Investigación Biomédica en Red (CIBER) Method for predicting response to continuous positive air pressure treatment
WO2016177776A1 (en) * 2015-05-04 2016-11-10 Academisch Medisch Centrum Biomarkers for the detection of aspirin insensitivity
CN107858419A (en) * 2017-11-10 2018-03-30 青岛大学 Application of miRNA, product using miRNA and detection method
EP4035659A1 (en) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes for delivery of therapeutic agents
WO2026023774A1 (en) * 2024-07-23 2026-01-29 가톨릭관동대학교산학협력단 Composition for diagnosing myocardial infarction and pharmaceutical composition for preventing or treating myocardial infarction

Families Citing this family (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2925884B1 (en) * 2012-11-27 2018-01-31 Luxembourg Institute of Health Compositions and methods for evaluating heart failure
CN103667459A (en) * 2013-11-26 2014-03-26 上海中医药大学附属岳阳中西医结合医院 Application of micronucleotides in diagnosis of hypertension and preparation of antihypertensive drugs
CN104740648B (en) 2013-12-27 2020-02-14 江苏命码生物科技有限公司 Application of miRNA-214 inhibitor in inhibiting regulatory T cells
CN104031987B (en) * 2014-05-12 2016-08-31 贵州省人民医院 MiRNA application in myocardial fibrosis disease treatment
US10131952B2 (en) 2014-05-14 2018-11-20 Ohio State Innovation Foundation MIRNA biomarkers for monitoring bone marrow reconstitution
CN113186271B (en) * 2015-05-08 2025-06-17 新加坡科技研究局 Methods for the diagnosis and prognosis of chronic heart failure
CN105999302A (en) * 2016-06-13 2016-10-12 上海市东方医院 miRNA-21a inhibitor and application thereof in preparing medicine for delaying myocardial infarction
CN107557464B (en) * 2016-07-02 2021-06-04 上海市公共卫生临床中心 Prediction model and detection kit for early virological response to interferon treatment of chronic hepatitis B
CN106399473B (en) * 2016-08-23 2019-12-06 南京大学 miRNA marker for detecting and evaluating strength training effect or combination thereof and application thereof
CN106729757A (en) * 2017-03-08 2017-05-31 复旦大学附属中山医院 MiR 378 suppresses the purposes of myocardial hypertrophy and myocardial fibrosis and diagnosis of heart failure
CN107881173A (en) * 2017-11-16 2018-04-06 上海市东方医院 A kind of small molecules of miRNA 21 and application thereof
CN108004316A (en) * 2018-01-09 2018-05-08 青岛大学 Kit for predicting acute myocardial infarction risk
CN108866177B (en) * 2018-05-31 2021-05-28 李继承 Application of hsa-miRNA-423-5p and hsa-miRNA-423-5p inhibitor
CN110055322A (en) * 2019-05-12 2019-07-26 青岛大学 Circulating miRNA marker for acute myocardial infarction diagnosis and application thereof
WO2021250969A1 (en) * 2020-06-08 2021-12-16 国立大学法人東海国立大学機構 Use of microrna in chronic-phase cardiac function improving treatment
CN112410414B (en) * 2020-10-09 2022-07-08 嘉兴市妇幼保健院 Application of pregnant woman serum exosome miRNA marker in preparation of early diagnosis product of fetal congenital heart disease and kit
CN113943792A (en) * 2021-11-02 2022-01-18 石河子大学 Application of reagent for detecting miRNA expression quantity in preparation of reagent or kit for diagnosing or prognosing Kazakh hypertension
CN116726038B (en) * 2022-03-04 2026-04-17 南京大学 Application of microRNA or combinations thereof derived from palm charcoal in the preparation of hemostatic drugs

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090306181A1 (en) * 2006-09-29 2009-12-10 Children's Medical Center Corporation Compositions and methods for evaluating and treating heart failure
US20090105174A1 (en) * 2007-04-20 2009-04-23 Amgen Inc. Nucleic acids hybridizable to micro rna and precursors thereof
KR20100049079A (en) * 2007-07-18 2010-05-11 더 리젠트스 오브 더 유니버시티 오브 콜로라도 Differential expression of micrornas in nonfailing versus failing human hearts
US20110166041A1 (en) * 2008-06-27 2011-07-07 Keio University Diagnosis/Therapeutic Strategy For Gynecological Cancer by Utilizing Micro-RNA as Biomarker
AU2010210605B2 (en) * 2009-02-04 2015-08-13 Board Of Regents, The University Of Texas System Dual targeting of miR-208 and miR-499 in the treatment of cardiac disorders
WO2010130351A1 (en) * 2009-05-15 2010-11-18 Bayer Schering Pharma Ag Micrornas as biomarkers and therapeutic targets for heart failure
CN101643791A (en) * 2009-09-04 2010-02-10 哈尔滨医科大学 MicroRNA-328 and application of antisense nucleotide thereof for diagnosing, preventing and curing heart diseases

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013093870A1 (en) 2011-12-23 2013-06-27 International Centre For Genetic Engineering And Biotechnology - Icgeb microRNAs FOR CARDIAC REGENERATION THROUGH INDUCTION OF CARDIAC MYOCYTE PROLIFERATION
CN103290116A (en) * 2013-05-16 2013-09-11 南京市妇幼保健院 Matrix serum/plasma miRNA (Micro Ribonucleic Acid) marker associated with fetal congenital heart diseases and application of marker
WO2015066611A3 (en) * 2013-11-01 2015-07-02 The Trustees Of Columbia University In The City Of New York Microrna profiles in heart failure: methods and systems for detection and use
EP3034623A1 (en) * 2014-12-18 2016-06-22 Centro de Investigación Biomédica en Red (CIBER) Method for predicting response to continuous positive air pressure treatment
WO2016097118A1 (en) * 2014-12-18 2016-06-23 Centro De Investigación Biomédica En Red Method for predicting response to continuous positive air pressure treatment
WO2016177776A1 (en) * 2015-05-04 2016-11-10 Academisch Medisch Centrum Biomarkers for the detection of aspirin insensitivity
EP4035659A1 (en) 2016-11-29 2022-08-03 PureTech LYT, Inc. Exosomes for delivery of therapeutic agents
CN107858419A (en) * 2017-11-10 2018-03-30 青岛大学 Application of miRNA, product using miRNA and detection method
WO2026023774A1 (en) * 2024-07-23 2026-01-29 가톨릭관동대학교산학협력단 Composition for diagnosing myocardial infarction and pharmaceutical composition for preventing or treating myocardial infarction

Also Published As

Publication number Publication date
JP2014507123A (en) 2014-03-27
EP2652146A2 (en) 2013-10-23
AU2011343719A1 (en) 2013-04-11
US20140024700A1 (en) 2014-01-23
CN103370424A (en) 2013-10-23
WO2012083004A3 (en) 2012-11-29
CA2818174A1 (en) 2012-06-21

Similar Documents

Publication Publication Date Title
US20140024700A1 (en) Blood-borne mirnas as surrogate markers of drug efficacy for cardiac conditions
US20160251720A1 (en) MicroRNA PROFILES IN HEART FAILURE: METHODS AND SYSTEMS FOR DETECTION AND USE
US9072765B2 (en) Identification of micro-RNAs involved in post-myocardial infarction remodeling and heart failure
AU2008323652B2 (en) Micro-RNAs of the miR-15 family modulate cardiomyocyte survival and cardiac repair
EP2187896B1 (en) Inhibitors of mir-499 and mir-208b for use in the treatment of pathologic cardiac hypertrophy, heart failure or myocardial infarction
US20130005658A1 (en) Micro-rna regulation in ischemia and ischemia-reperfusion injury
WO2009058818A2 (en) Compositions comprising a micro-rna and methods of their use in regulating cardiac remodeling
JP2014507123A5 (en)
KR20100049079A (en) Differential expression of micrornas in nonfailing versus failing human hearts
US10772974B2 (en) Compositions and methods for cardiac regeneration
US20170081722A1 (en) Polymorphisms in the pde3a gene
US20140274923A1 (en) Mirnas as a prognostic biomarker in pediatric heart failure
WO2012027557A1 (en) SELECTIVE INHIBITION OF β 1- ADRENERGIC RECEPTORS FOR THE TREATMENT OF PEDIATRIC HEART FAILURE
US10246711B2 (en) RNAi inhibitors of glucose-6-phosphate dehydrogenase for treating cardiovascular and pulmonary conditions
WO2010117860A2 (en) Microrna signature to predict prognosis in heart failure
WO2015054045A1 (en) Prediction and treatment of heart failure
HK1143948B (en) Inhibitors of mir-499 and mir-208b for use in the treatment of pathologic cardiac hypertrophy, heart failure or myocardial infarction

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11804873

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2011343719

Country of ref document: AU

Date of ref document: 20111215

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2818174

Country of ref document: CA

REEP Request for entry into the european phase

Ref document number: 2011804873

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011804873

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2013544771

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 13994622

Country of ref document: US