CN112410414B

CN112410414B - Application of pregnant woman serum exosome miRNA marker in preparation of early diagnosis product of fetal congenital heart disease and kit

Info

Publication number: CN112410414B
Application number: CN202011075086.6A
Authority: CN
Inventors: 金玉霞; 李素萍; 柴晓俊; 唐萍; 艾玲
Original assignee: Jiaxing Maternity and Child Health Care Hospital
Current assignee: Jiaxing Maternity and Child Health Care Hospital
Priority date: 2020-10-09
Filing date: 2020-10-09
Publication date: 2022-07-08
Anticipated expiration: 2040-10-09
Also published as: CN112410414A

Abstract

The invention provides an application of a pregnant woman serum exosome miRNA marker in preparing a prenatal fetal precordial disease early diagnosis product and a kit, wherein the miRNA marker is hsa-miR-146a-5 p. The serum exosome miRNAs kit is a systematic and comprehensive diagnosis and monitoring kit, can be used for early diagnosis of prenatal fetal congenital heart disease, has high detection sensitivity and specificity and low cost, can meet the detection requirements of most pregnant women, has a wide application range, and provides support for clinicians to quickly and accurately predict the fate of the pregnant women and timely adopt more personalized prevention and treatment schemes.

Description

Application of pregnant woman serum exosome miRNA marker in preparation of early diagnosis product of fetal congenital heart disease and kit

Technical Field

The invention relates to the medical field of genetic engineering and prenatal diagnosis, in particular to application of a pregnant woman serum exosome miRNA marker in preparation of a prenatal fetal congenital heart disease auxiliary early diagnosis product and a kit.

Background

Congenital Heart Disease (CHD) is a common birth defect, which is mainly manifested by different degrees of abnormal cardiac structure and function, and in recent years, it is the first of the birth defects. Around 135 ten thousand of the congenital heart disease infants are born every year worldwide, with the incidence rate accounting for 8 per thousand of live infants and 10% of spontaneous abortion. Since 2005 in China, CHD surpasses the first birth defect of China, accounting for 26.7% of all birth defect detection cases (2014), and more than 13 million CHD patients are newly added every year. The late treatment cost of the patients is about billions, which brings heavy burden to families and society. The disadvantages of the current prenatal diagnosis mode of congenital heart diseases are also the main reasons for this burden. At present, the prenatal CHD diagnosis at home and abroad is mainly based on echocardiogram, but the diagnosis of the echocardiogram on the CHD is influenced by the gestational week, the body position of a fetus, the abdominal wall thickness of a pregnant woman, the amniotic fluid volume and the professional technical level of an ultrasonic doctor to obtain a final detection result. More importantly, prenatal diagnostic echocardiography diagnoses CHD by weeks 24 to 28 of pregnancy. At the moment, the pregnancy of the fetus is large, selective abortion brings great physical and psychological damage to the pregnant woman, and huge social and ethical problems are caused. However, the cardiovascular system defect is formed early in the development of the heart, and the early diagnosis cannot be performed only because of the limitation of the detection means. Therefore, how to carry out early diagnosis of the congenital heart disease is a great scientific problem, and has important significance for reducing birth defects and improving population quality.

Exosomes (Exosomes) are derived from vesicles of late endosomes (also known as multivesicular bodies) with molecular diameters of about 30-200 nm. Almost all types of cells secrete exosomes and are widely distributed in samples such as serum, plasma, urine, ascites fluid, and cell supernatant. The Exosomes contain proteins, RNA and lipids, can participate in regulating important cell physiological activities, are reported in immune response, apoptosis, angiogenesis, inflammatory reaction, coagulation and other processes, become potential targets for treating various diseases, early diagnosis markers, targeted drug carriers and the like, and are important research hotspots in the life science and medical field in recent years.

MicroRNAs (i.e., miRNAs) are a hotspot in the field of molecular biology research in recent years, and the mature state of the MicroRNAs is a small single-stranded RNA molecule with the length of about 19-23 nucleotides and has high conservation in evolution. The main function of MiRNA is to regulate the expression of genes related to the growth, development and disease development process of organisms. Since the discovery of lin-4 and let-7, which are involved in the regulation of nematode timing development, mirnas were introduced in the Science journal of the ten-year major scientific breakthrough in 2002 and 2003, respectively. miRNAs were predicted to regulate 5300 human genes, at least 30% of all genes, in 2005. As research progresses, more and more miRNAs are continuously discovered. In recent years, the relation of miRNA to disease has become a hot spot and a focus of research, and it has been found that the expression of miRNA through negative regulatory genes is highly correlated with the onset of congenital disease.

Studies have demonstrated the presence of hundreds of miRNAs in serum exosomes, with these small molecular RNAs being stable in nature, abundant in content, easily detectable quantitatively, and with significant disease specificity. At present, no stable biomarker for prenatal fetal precordial disease auxiliary early diagnosis is reported, and if specific or abnormally expressed serum miRNAs can be screened out from pregnant woman serum exosomes to be used as the biomarker and a corresponding auxiliary early diagnosis kit is developed, the screening and diagnosis of prenatal fetal precordial disease in China can be effectively promoted.

Disclosure of Invention

Aiming at the defects in the prior art, the invention aims to provide an application of a pregnant woman serum exosome miRNA marker in preparing a prenatal fetal heart disease early diagnosis product and a kit.

The purpose of the invention is realized by the following scheme:

the first aspect of the invention provides application of a pregnant woman serum exosome miRNA marker in preparing prenatal fetal precordial disease auxiliary early diagnosis products, wherein the miRNA marker is hsa-miR-146a-5 p.

Wherein, when the pregnant woman is pregnant with a prenatal fetal precordial disease fetus, the expression level of the pregnant woman serum exosome miRNA marker hsa-miR-146a-5p is reduced.

The second aspect of the invention provides a prenatal fetal precordial disease auxiliary early diagnosis kit, which comprises a primer of a miRNA marker hsa-miR-146a-5p and an internal reference primer.

Preferably, the primers of the miRNA marker hsa-miR-146a-5p comprise an upstream primer of hsa-miR-146a-5p and a downstream primer of hsa-miR-146a-5 p; the upstream primer of the hsa-miR-146a-5p is shown as SEQ ID NO: 1, the downstream primer is shown as SEQ ID NO: 2, respectively.

Preferably, the internal reference RNA for detecting the expression quantity of the miRNA marker hsa-miR-146a-5p is cel-miR-39-3p, and an upstream primer of the cel-miR-39-3p is shown in SEQ ID NO: 9 is shown in the figure; the downstream primer is shown as SEQ ID NO: shown at 10.

In the technical scheme of the invention, the screening method of the miRNA marker hsa-miR-146a-5p specifically comprises the following steps:

the method comprises the following steps: extracting the pregnant woman serum exosomes;

step two: extracting RNA in the pregnant woman serum exosome, and using the pregnant woman serum exosome after quality inspection is qualified;

step three: constructing a miRNA library for RNA qualified by quality inspection, and then preliminarily screening exosome miRNAs which have high miRNA expression quantity, obvious expression difference and are related to cardiac phylogeny; after primary screening, the expression quantity difference of 4 miRNAs of hsa-miR-146a-5p, hsa-miR-199a-3p, hsa-miR-181a-5p and hsa-miR-186-5p in the serum samples of the case group and the healthy control group is obvious.

Step four: and (3) rescreening 4 miRNAs obtained by primary screening, and finding that the expression quantity difference of the marker hsa-miR-146a-5p in serum samples of a case group and a healthy control group is most obvious. The internal reference RNA used for screening is cel-miR-39-3p, and the upstream primer of the cel-miR-39-3p is shown in SEQ ID NO: 9 is shown in the figure; the downstream primer is shown as SEQ ID NO: shown at 10.

Preferably, the upstream primer of hsa-miR-146a-5p is shown in SEQ ID NO: 1, the downstream primer is shown as SEQ ID NO: 2 is shown in the specification; the upstream primer of the hsa-miR-199a-3p is shown as SEQ ID NO: 3, the downstream primer is shown as SEQ ID NO: 4 is shown in the specification; the upstream primer of the hsa-miR-181a-5p is shown in SEQ ID NO: 5, the downstream primer is shown as SEQ ID NO: 6 is shown in the specification; the upstream primer of the hsa-miR-186-5p is shown as SEQ ID NO: 7, the downstream primer is shown as SEQ ID NO: shown in fig. 8.

The preparation process of the pregnant woman serum exosome miRNA marker screening and diagnosis kit comprises the following steps:

(1) establishing a unified specimen library and a database: serum samples meeting the standards were collected by Standard Operating Procedure (SOP) and the system collected complete demographic and clinical data. (2) Differential expression profiling analysis of serum exosome miRNA: selecting prenatal fetal congenital heart disease (ventricular septal defect) pregnant women as a case group, selecting healthy pregnant women matched with the age and the gestational period of the case as a control group, detecting the expression spectrums and the contents of miRNA of serum exosomes of 17-18 gestational periods of the case group and the control group, screening miRNAs differentially expressed by the case group and the control group, and further verifying the screened miRNAs. (3) Screening disease specific serum exosome miRNAs, carrying out quantitative analysis on the screened serum exosome differential expression miRNAs in a large sample group, and determining the prenatal fetal precordial disease (ventricular septal defect) specific serum exosome miRNAs. (4) The development of a pregnant woman serum exosome miRNA screening and auxiliary early diagnosis kit: miRNAs diagnostic kit is developed according to specific serum exosome miRNA of prenatal fetal congenital heart disease (ventricular septal defect) case group and healthy pregnant woman serum control group.

Compared with the prior art, the invention has the following beneficial effects:

(1) the serum exosome miRNAs are novel biomarkers, are different from the traditional biomarkers, are stable, minimally invasive, easy to detect and accurate in quantification, and can greatly improve the sensitivity and specificity of disease diagnosis.

(2) The serum exosome miRNAs kit is a systematic and comprehensive diagnosis and monitoring kit, can be used for early diagnosis of prenatal fetal congenital heart disease (ventricular septal defect), has high detection sensitivity and specificity and low cost, can meet the detection requirements of most pregnant women, has wide application range, and provides support for clinicians to quickly and accurately predict the fate of the pregnant women and timely adopt more personalized prevention and treatment schemes.

(3) By adopting a strict design and evaluation system, the invention adopts a high-throughput sequencing technology to detect and obtain the expression profile of serum miRNAs with disease specificity and abnormal expression at the initial stage, and adopts a qRT-PCR (stem-loop method) method to carry out verification in a large sample; ensures the application of exosome serum miRNAs biomarkers and a diagnosis kit, and provides a method and a reference for the strategy for the development of other disease biomarkers.

Drawings

Other features, objects and advantages of the invention will become more apparent upon reading of the detailed description of non-limiting embodiments with reference to the following drawings:

FIG. 1 is a bar graph of relative expression amounts of four miRNAs of miR-146a-5p, miR-181a-5p, miR-186-5p and miR-199a-3p in a case-control group;

FIG. 2 shows that miR-146a-5p and miR-199a-3p predict the diagnostic value of ventricular septal defect through ROC curve;

FIG. 3 is a graph showing the amplification curve and dissolution curve of the quantitative PCR amplification process for 55 cases in example 4;

FIG. 4 is a graph showing the amplification curve and dissolution curve of the quantitative PCR amplification process for 55 control samples in example 4.

Detailed Description

The present invention will be described in detail with reference to specific examples. The following examples will assist those skilled in the art in further understanding the invention, but are not intended to limit the invention in any way. It should be noted that it would be obvious to those skilled in the art that various changes and modifications can be made without departing from the spirit of the invention. All falling within the scope of the present invention.

The invention researches the application prospect of diagnosing the antenatal fetal heart disease (ventricular septal defect VSD) of serum miRNA in the middle pregnancy (17-18 weeks of pregnancy), and compared with the traditional antenatal fetal echocardiogram (24-28 weeks of pregnancy), the diagnosis of the pregnancy is advanced. Therefore, the invention obtains a prenatal fetal precordial disease (ventricular septal defect) specific exosome serum miRNAs expression database and specific markers; through the development and application of the pregnant woman serum exosome miRNAs biomarkers and the diagnosis kit, the early diagnosis of prenatal fetal heart disease is more convenient and feasible, and a foundation is laid for a clinician to quickly and accurately master the state of illness of a patient and for clinical treatment effect evaluation.

The inventor collects blood samples meeting the standard by a Standard Operation Procedure (SOP), systematically collects complete demographic data, clinical data and the like, and adopts a qRT-PCR method, high-throughput sequencing detection and the like.

Example 1 sample Collection and sample data interpretation

The inventor collects a large number of peripheral blood serum samples of pregnant women of 17-18 gestational weeks from a woman healthcare institution in Jiaxing city to date in 2017 (samples for research are collected at the same period, and the sampling, subpackaging and storing conditions are uniform), and the system collects the conditions of demographic data, clinical data and the like of the samples, and by sorting the sample data, the inventor selects 182 samples meeting the following standards as experimental samples for high-throughput sequencing batch detection and subsequent series of qRT-PCR verification:

1.1, during blood sampling, the pregnant woman is 17-18 pregnant weeks;

1.2, the subjects confirmed fetal congenital heart disease (ventricular septal defect) by the prenatal echocardiogram at 24-28 gestational weeks and no other ultrasound abnormality was defined as a case;

1.3, the subjects confirmed by prenatal echocardiography at 24-28 gestational weeks without fetal congenital heart disease and without other ultrasound abnormalities, and healthy pregnant women matched with the age of the case and the gestational week were defined as controls.

Example 2 extraction of miRNA from serum exosomes

36 cases of antenatal echocardiography which meet the conditions are diagnosed as cases of congenital heart disease (ventricular septal defect) and 36 healthy controls are subjected to sequencing detection to obtain related results.

The serum of each 4 cases of the 36 cases was mixed into one group, and the total group was 9 groups (A1-A9); serum from 4 of 36 healthy control samples was pooled into one group, and a total of 9 groups (CK1-CK9) were collected, and serum exosomes were extracted.

2.1 extracting serum Exosome (Ribo TM Exosome Isolation Reagent kit is selected from Ruibo's kit)

2.1.1 serum sample pretreatment

(1) Taking out the serum sample from the low-temperature storage environment and placing the serum sample on ice;

(2) centrifuging at 2000 Xg for 20min at room temperature to remove residual cells and debris;

(3) transfer supernatant to a new tube and place on ice until use.

2.1.2 exosome isolation

(1) Transfer the serum sample from the previous step of pretreatment to a new tube and add 1/3 volumes of Ribo^TM exosome isolation reagent(for plasma or serum)；

(2) Reverse mixing or pipette mixing until the sample is completely mixed;

(3) standing in a refrigerator at 4 deg.C for 30 min;

(4) centrifuging at 15000 Xg for 2min at 4 deg.C;

(5) carefully aspirate the supernatant with a pipette;

(6) the obtained serum exosomes (exosomes) were centrifuged and subjected to the subsequent experimental procedure.

2.2 extracting Serum exosome RNA (selected from Liquid miRNA Kit/HiPure Serum/Plasma miRNA Kit of magenta company)

a) Adding 750 mu L of Trizol solution into the 250 mu L of serum exosome sample extracted in the previous step, and incubating for 5min at room temperature;

b) adding 0.2 volume (0.2mL/1mL Trizol) of chloroform, shaking by votex for 15s, and standing at room temperature for 5 min;

c) centrifuging at 12000rpm for 15min at 4 deg.C to separate layers, and carefully sucking the upper water phase into a new 1.5mL centrifuge tube;

d) adding isopropanol (about 0.6mL) with the same volume as the supernatant, and uniformly mixing by reversing the upper part and the lower part, and precipitating at-20 ℃ for more than 1 h;

e) centrifuging at 4 deg.C and 12000rpm for 30min to obtain white precipitate at the bottom of the tube, and removing the supernatant;

f) adding 75% ethanol 1mL to make the precipitate float, centrifuging at 12000rpm for 5min at 4 deg.C;

g) repeating the step f;

h) and removing the supernatant, centrifuging for a short time, sucking the residual liquid by using a liquid-transferring gun, opening a centrifugal tube cover for drying, and adding a proper amount of sterilized water for dissolving after the precipitate is dried to be semitransparent so as to obtain the serum exosome RNA.

2.3 exosome RNA quality inspection

Qubit was selected to detect RNA concentration for library construction as shown in Table 1. (Agilent 2200TapeStation is selected to detect fragment distribution, in quality inspection report, if there is no large fragment, total amount of RNA exceeds 50ng, database can be continuously built, more than 10ng, less than 50ng, risk database building)

TABLE 1 Qubit test results

Example 3 construction of miRNA library and high throughput sequencing of miRNA

Selecting a library building kit: neb Corp, USA

Multiplex Small RNA Library Prep Set for

Randomly breaking the total RNA of the 9 groups of healthy control samples and the total RNA of the 9 groups of case samples after the quality inspection, respectively adding joints at the 3 'end and the 5' end, carrying out reverse transcription, and synthesizing cDNA. And carrying out PCR amplification on the cDNA, and obtaining a cDNA fragment with the length range of about 200bp from the amplified PCR product by an electrophoresis gel cutting method for constructing a miRNA library. After completion of the library construction, the purity of the library was checked using an Agilent 2100Bioanalyzer (Agilent Technologies Inc, USA). In the step, the reverse transcription and the PCR amplification adopt a conventional experimental method, and a PCR instrument adopts C1000 Touch, American Bio-Rad company;

after the purity is detected to be qualified, the cDNA is purified to generate a Cluster on an illumina's Cluster Station, and then the purified cDNA can be added into a sequencer (illumina HiSeq 2500) to sequence to determine the name of the miRNA (shown in Table 2). Sequencing adopts a HiSeq 2500 platform SE50 sequencing mode, and sequencing reagents: HiSeq Rapid SBS Kit V2(50 cycles), HiSeq Rapid SR Cluster Kit V2, Illumina USA.

Differences in the distribution of mean miRNA expression levels between study subject control and case groups were compared using the χ 2 test (for categorical variables) or student t test (for continuity variables).

TABLE 2 differential expression of miRNA in serum exosomes of case group (A) and healthy control group (CK)

The 15 exosome mirnas differentially expressing significantly were selected from table 1 according to the following criteria: (1) miRNA expression reading > 100; (2) | log2FoldChange | > 2; (3) p value < 1.00E-05.

The 15 exosome mirnas were: hsa-miR-221-3p, hsa-miR-186-5p, hsa-miR-27a-3p, hsa-miR-181a-5p, hsa-miR-199a-3p, hsa-miR-199b-3p, hsa-miR-29a-3p, hsa-miR-30e-5p, hsa-miR-107, hsa-miR-16-2-3p, hsa-miR-146a-5p, hsa-miR-532-5p, hsa-miR-22-3p, hsa-miR-181b-5p and hsa-miR-363-3 p.

Then, miRNA related to cardiac phylogeny are screened according to a Gene Ontology (GO) belief analysis database and a Kyoto encyclopedia of genes and genes database (KEGG) belief analysis database, and four exosome miRNAs (hsa-miR-186-5p, hsa-miR-199a-3p, hsa-miR-146a-5p, hsa-miR-181a-5p), hsa-miR-146a-5p, hsa-miR-199a-3p, hsa-miR-181a-5p and 4 miRNAs in case group (A) and healthy control group (CK) serum samples are remarkably different in expression quantity.

Example 4 further validation of qRT-RCR experiments on serum mirnas

The 55 samples of ventricular septal defect cases and the 55 samples of healthy controls collected in example 1 were used as subjects, and for the four screened exosome miRNAs (hsa-miR-186-5p, hsa-miR-199a-3p, hsa-miR-146a-5p, hsa-miR-181a-5p), the stem-loop method was used to perform qRT-PCR detection of miRNAs, and strict quality control was performed in the whole study process, and each sample was continuously detected three times. All measurements were done blindly, i.e. without the sample background being clear, to avoid bias.

4.1 design of primers

Primer sequences of miRNA of table 3 and 4 exosomes

4.2, qRT-RCR Experimental procedure as follows:

(1) serum exosomes were extracted from the subjects in the same manner as in step 2.1 of example 2.

(2) Serum exosome total RNA was extracted from the subject in the same manner as in step 2.2 in example 2.

(3) Obtaining a cDNA sample through RNA reverse transcription reaction;

a) the following reaction system was established using total RNA extracted from serum exosomes of the subject as a template:

reagent	Amount of addition
		RT Master Mix	4μL
RNA template	1μg
		ddH₂O	Make up to 10 mu L
Total amount of	10μL

b) Mixing the above systems, centrifuging to collect liquid to tube bottom, at 42 deg.C for 60min, at 72 deg.C for 10 min; the product is the cDNA template.

4.3 quantitative PCR

Instruments and materials: selecting a quantitative PCR instrument CFX96, and carrying out fluorescent quantitative PCR by the American Bio-Rad company; Bulge-LoopTM miRNA qRT-PCR Starter Kit, Ribobio-Tech, Guangzhou.

(1) And (3) establishing a PCR reaction system for the cDNA template obtained by the reverse transcription in the previous step by using the primers designed in the step 4.1 according to the following table, and carrying out PCR amplification according to the following procedures: 95 ℃ 10min → 95 ℃ 10s → 60 ℃ 20s → 70 ℃ 10 s; reading a plate; return to 95 ℃ for 10s for a total of 40 cycles.

Reagent	Amount of addition
		RNase-Free H₂O	2.2μL
Forward primer(10μM)	0.4μL
		Reverse primer(10μM)	0.4μL
SYBR Green Mix	5μL
		cDNA template	2μL
Total amount of	10μL

Preparing a melting curve: the results are shown in FIG. 3 and FIG. 4, in which the plate reading was carried out at 70 ℃ to 95 ℃ every 0.5 ℃ for 5 seconds, and the specificity of the amplification products was good in the case group and the control group.

(2) And detecting the change of the expression quantity of the miRNA in the serum samples of the fetal congenital heart disease (ventricular septal defect) case group and the healthy control group. (as shown in FIG. 1)

(3) Analyzing the detection result by adopting a relative quantitative method, and using equation 2 to obtain the expression quantity ratio of the miRNAs in the serum of the sample and the internal reference sample^-ΔCtDenotes that Δ Ct ═ C_{T sample}-C_{Internal reference of T}We added RNA of cel-miR-39-3p at the time of extraction of each sample as a reference, and calculated the relative expression amount (with cel-miR-39-3p as an internal reference)

cel-miR-39-3p forward primer (SEQ ID NO: 9): acactccagctgggtcaccgggtgtaaatc, reverse primer (SEQ ID NO: 10): ctcaactggtgtcgtggagtcggcaattcagttgagcaagctga are provided. The stem-loop method qRT-PCR results show that in 110 samples, 1 miRNAs (hsa-miR-146a-5p) have significant difference in expression between a case group and a control group, and the detection results are shown in Table 4 and figure 2.

Table 4, Cut-off values and diagnostic efficiencies of miR-146a-5p and miR-199a-3p for ventricular septal defect detection

Name of miRNA	AUC		95％CI	P value	Cut-off	Degree of specificity	Sensitivity of the probe	Accuracy of
									miR-146a-5p	0.997	0.9918-1	<0.001	0.49086	0.981818	0.981818	0.981818
miR-199a-3p	0.6717	0.56-0.7834	<0.05	0.55403	1	0.581818	0.790909

As shown in FIG. 2, the areas under the ROC curves (AUC) were 0.99(miR-146a-5p) and 067(miR-199a-3p), the sensitivities (Sensitivity) were 98% (miR-146a-5p) and 58% (miR-199a-3p), and the specificities were 98% (miR-146a-5p) and 99% (miR-199a-3p), respectively. When the area under the ROC curve (AUC) is below 0.8, the diagnosis efficiency is low, so that the miR-146a-5p has a better diagnosis value.

Example 5 preparation of miRNA kit for assisted early diagnosis of prenatal fetal heart disease (ventricular septal defect).

The high-throughput sequencing method comprehensively determines miRNA with expression difference in fetal congenital heart disease (ventricular septal defect) cases and healthy controls, and a group of exosome serum miRNA with large expression amount and difference degree in case groups and healthy control groups is screened by qRT-PCR technology to be used as an index (hsa-miR-146a-5p) for early diagnosis of fetal congenital heart disease (ventricular septal defect). Finally, the selected serum exosome miRNA related to the onset of prenatal fetal congenital heart disease (ventricular septal defect) constitutes a diagnostic kit. The kit comprises an exosome extraction reagent, a serum miRNA primer (primer cel-miR-39-3p of hsa-miR-146a-5p), and common enzymes and/or reagents required by corresponding PCR reaction, such as: (ii) a reverse transcriptase enzyme, wherein,buffers, dNTPs, MgCl₂Enucleated enzyme water, fluorescent dyes or probes, Taq enzyme, Universal reverse primer (URP: TGGTGTCGTGGAGTCG), etc., can be selected according to the particular assay employed, these common enzymes and/or reagents are well known to those skilled in the art, and there can be standards and controls (e.g., a quantitatively labeled nematode mir-39 sample, etc.) as well as normal reference values. The kit has the value that only serum is needed without other tissue samples, the change trend of miRNA is detected by the most simplified fluorescent quantitative PCR method, and the prenatal fetal heart disease is diagnosed in an early assisted manner by the trend, so that the kit is stable, convenient to detect and accurate in quantification, and the sensitivity and specificity of disease diagnosis are greatly improved, and the kit can help to guide clinical accurate diagnosis.

In conclusion, the invention searches a group of serum exosome miRNAs with high specificity and sensitivity highly related to prenatal fetal precordial disease by separating and researching miRNAs in the pregnant women with prenatal fetal precordial disease and healthy pregnant women matched with the pregnant women with age, develops a prenatal fetal precordial disease (ventricular septal defect) auxiliary early diagnosis kit convenient for clinical application, provides data support for screening and early diagnosis of prenatal fetal precordial disease (ventricular septal defect), and provides data support for intervention.

The foregoing description has described specific embodiments of the present invention. It is to be understood that the present invention is not limited to the specific embodiments described above, and that various changes or modifications may be made by one skilled in the art within the scope of the appended claims without departing from the spirit of the invention. The embodiments and features of the embodiments of the present application may be combined with each other arbitrarily without conflict.

Sequence listing

<110> Jiaxing city women and children health care hospital

<130> DD10104

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcagtgagaa ctgaattcca 20

<210> 2

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggtccagttt tttttttttt ttaacc 26

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cagacagtag tctgcacatt g 21

<210> 4

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ggtccagttt tttttttttt ttaacc 26

<210> 5

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cattcaacgc tgtcggt 17

<210> 6

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggtccagttt tttttttttt ttactca 27

<210> 7

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cgcagcaaag aattctcct 19

<210> 8

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ccagtttttt ttttttttta gcccaa 26

<210> 9

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

acactccagc tgggtcaccg ggtgtaaatc 30

<210> 10

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctcaactggt gtcgtggagt cggcaattca gttgagcaag ctga 44

Claims

1. An application of a pregnant woman serum exosome miRNA marker in preparation of a fetal ventricular septal defect early diagnosis product is characterized in that the miRNA marker is hsa-miR-146a-5 p.

2. The use of the maternal serum exosome miRNA marker according to claim 1 in the preparation of a fetal ventricular septal defect early diagnosis product, wherein the maternal serum exosome miRNA marker hsa-miR-146a-5p expression level is down-regulated when the pregnant woman is pregnant with a prenatal fetal precordial disease fetus.

3. The application of the pregnant woman serum exosome miRNA marker in preparing a fetal ventricular septal defect early diagnosis product according to claim 1, wherein the early diagnosis product is a diagnosis kit, and the diagnosis kit comprises a primer of a miRNA marker hsa-miR-146a-5p and an internal reference primer.

4. The application of the miRNA marker of the maternal serum exosome in the preparation of products for early diagnosis of fetal ventricular septal defect according to claim 3, wherein the primers of the miRNA marker hsa-miR-146a-5p comprise an upstream primer of hsa-miR-146a-5p and a downstream primer of hsa-miR-146a-5 p; the upstream primer of the hsa-miR-146a-5p is shown as SEQ ID NO: 1, the downstream primer is shown as SEQ ID NO: 2, respectively.

5. The application of the maternal serum exosome miRNA marker in preparing a fetal ventricular septal defect early diagnosis product according to claim 3, wherein an internal reference RNA for detecting the expression quantity of the miRNA marker hsa-miR-146a-5p is cel-miR-39-3p, and an upstream primer of the internal reference cel-miR-39-3p is shown in SEQ ID NO: 9 is shown in the figure; the downstream primer is shown as SEQ ID NO: shown at 10.