CN109234389A - A kind of hsa-miR-146a-5p gene PCR detection kit and application - Google Patents
A kind of hsa-miR-146a-5p gene PCR detection kit and application Download PDFInfo
- Publication number
- CN109234389A CN109234389A CN201811009554.2A CN201811009554A CN109234389A CN 109234389 A CN109234389 A CN 109234389A CN 201811009554 A CN201811009554 A CN 201811009554A CN 109234389 A CN109234389 A CN 109234389A
- Authority
- CN
- China
- Prior art keywords
- mir
- hsa
- gene
- kit
- pcr reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The invention discloses a kind of hsa-miR-146a-5p gene PCR detection kit and application, the kit includes hsa-miR-146a-5p gene inverse transcription reaction liquid, MMLV reverse transcriptase, RNase inhibitor, PCR reaction solution, Taq enzyme, hsa-miR-146a-5p gene-specific primer, probe, positive quality control product and negative quality-control product；Judge that drug resistance accuracy rate not can achieve 80% or more to leukemia cell line using the best critical value of hsa-miR-146a-5p provided by the invention, great convenience is provided for drug-resistant cell strain screening in experimental study, reagent used in the present invention, including enzyme, buffer, primer and probe etc. by carefully design and optimization, the accuracy of gene expression detection is greatly improved.
Description
Technical field
The invention belongs to life sciences and field of biotechnology, and in particular to leukemia cell drug-resistance related gene hsa-
The detection probe and coherent detection kit of miR-146a-5p, and in particular to a kind of hsa-miR-146a-5p gene it is special
Property probe prepare primer, the quick detection kit of hsa-miR-146a-5p gene expression amount detection and for leukaemia cell
The fast evaluation method of strain drug resistance.
Background technique
Leukaemia is a kind of common Malignancy disease in world wide, but its cause of disease is not yet completely bright
Really.China's leukaemia disease incidence occupies the 6th of all kinds of tumor incidences, wherein acute myelocytic leukemia (acute
Myeloid leukemia, AML) and acute lymphoblastic leukemia (acute lymphoblastic leukemia, ALL)
Disease incidence is higher, chronic myelocytic leukemia (chronic myeloid leukemia, CML), and the white blood of chronic lymphocytic
Sick (chronic lymphocyte leukemia, CLL) is then in clinical more rare (acute leukemia and chronic leukemia
The ratio between disease incidence be 5.5: 1).Although having been achieved for incremental advances to the research of leukaemia pathogenesis, therapeutic effect is bright
Aobvious to improve, 5 years survival rates of patient also significantly improve, but still have some patientss to be difficult to cure, and recurrence rate is very high.
Drug resistance is the ultimate challenge for the treatment of of cancer at this stage, and leukaemia is refractory, the main reason of recurrence is exactly
The drug resistance of leukaemia cell.For most leukaemic, generating drug resistance to chemotherapeutics almost can not
It avoids and is also fatefulue.Drug resistance develops drug resistance after referring to tumour cell Who Contact Antitumor Drugss object, it is also possible to
Crossing drug resistant is generated to other anti-tumor drugs of different structure, different mechanisms, be clinically in tumor pharmacother most often
The problem of seeing, and most dangerous reason.Therefore, it explores the resistance mechanism of leukaemia cell and is effectively reversed, it has also become
Improve one of the effective way of leukaemic's long term survival.
Since 21st century, Leukemias MDR gene screening has become whole world leukaemia research, treatment neck
One large focal spot in domain, it has been more than 3000 that it is accumulative, which to retrieve corresponding document, by NCBI pubmed, is had found in more than 100 genes
The mutation more than 5000 kinds may be related to leukemia cell drug-resistance, but mechanism therein is not yet completely understood, especially primary
Cell strain is difficult determining whether there is drug resistance risk at the first time.In recent years, domestic to report drug-resistant leukemia base in succession
Because of the gene diagnosis kit in mutational site or the detection method of related gene expression, such as The People's Hospital of Peking University 2010
" a kind of kit of quantitative detection BCR/ABL mRNA level in-site " (CN101624621A) that year delivers, University Of Suzhou attached first
" method and kit of detection bcr/abl fusion abl kinases area resistant mutational site " (CN that hospital delivers for 2012
102676638 A) etc..In addition, there are also series of articles to have inquired into multidrug resistance gene (mdr1), drug-resistant protein P- glycoprotein
(P-glycoprotein, P-gp), breast drug-resistance protein (breast cancer resistance protein, BCRP),
And relationship of the apoptosis-related protein (BCL-2, BCL-xl, BAX etc.) in drug-resistant leukemia, recurrence.These detection methods
Exploitation greatly pushed the progress of the research of leucocythemia related plinth and clinical medicine exploitation, but single detection method has
Effect property and coverage are also obviously short of；Whole covering, mesh may be implemented using the methods of gene order-checking, the sequencing of full exon
Preceding cost is also relatively high.The present invention is resistance to as leukemia cell line using hsa-miR-146a-5p gene expression for the first time
Medicine evaluation index, devises specific probe, can fast and efficiently be sieved to drug-resistant cell strain using the method for the present invention
It looks into.
Summary of the invention
It is an object of the present invention to provide a kind of hsa-miR-146a-5p genetic test probes with quick, high covering
And coherent detection kit, be conducive to the rapid evaluation that drug-resistant leukemia cell strain screens in laboratory research, and clinical
Leukaemic's drug resistance risk assessment.
The technical solution adopted by the present invention is that:
The present invention provides a kind of hsa-miR-146a-5p gene (Gene ID:406938) PCR detection kit, described
Kit include hsa-miR-146a-5p gene inverse transcription reaction liquid, MMLV reverse transcriptase, RNase inhibitor, PCR reaction solution,
Taq enzyme, hsa-miR-146a-5p gene-specific primer, probe, positive quality control product and negative quality-control product；
Hsa-miR-146a-5p gene specific upstream primer sequence:
CCGATGTGTATCCTCAGCTTT；
Hsa-miR-146a-5p gene specific downstream primer sequence:
ATCCCAGCTGAAGAACTGAA；
Hsa-miR-146a-5p gene probe sequence:
AGGTCTGACACTGACACAACCCATGG；
The positive quality control product is artificial synthesized hsa-miR-146a-5p gene standard items (100nM), negative Quality Control
Product are volumetric concentration 0.1%DEPC water (removing ribozyme water).
Further, hsa-miR-146a-5p gene inverse transcription reaction liquid composition are as follows: 10mMdNTP mixed liquor, 5 ×
RT buffer is (by 250mMTris-HCl, 375mMKCl, 15mM MgCl2, 50mM DTT composition), the MgCl of 10mM2, l μM
Hsa-miR-146a-5p specificity miRNA reverse transcriptase primer；
Hsa-miR-146a-5p specificity miRNA reverse transcriptase primer:
5'–GTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTT TTTTTAACCCA-3'。
Further, PCR reaction solution (each kit the provides 800 μ L) composition: 10mMdNTP mixed liquor (80 μ L),
25mM MgCl2(80 μ L), 10 × Taq buffer (no Mg2+) (80 μ L), volumetric concentration 0.1%DEPC water (560 μ L).
Further, the preferably described kit is by hsa-miR-146a-5p gene inverse transcription reaction liquid, MMLV reverse transcription
Enzyme, RNase inhibitor, Taq enzyme, PCR reaction solution, hsa-miR-146a-5p gene-specific primer and probe, positive quality control
Product, negative quality-control product and volumetric concentration 0.1%DEPC water composition.
It is thin in screening drug-resistant leukemia that the present invention provides a kind of hsa-miR-146a-5p gene PCR detection kit
Application in born of the same parents' strain, the application are to carry out reverse transcription using the kit using leukemia cell line RNA to be measured as template
Reaction obtains reverse transcription product, and then reverse transcription product carries out quantitative fluorescent PCR reaction, if quality-control product testing result can not be same
When meet following two condition: (1) positive quality control product, which detects Ct value, within the scope of 30-33 and has obvious Exponential growth stage；(2)
Negative quality-control product detects value > 45 Ct or without Ct value, then determines that kit fails, and need to repeat to detect, in the effective situation of kit
Under, as sample to be tested Ct value < 24, then there is drug resistance risk.
Reverse transcription reaction method of the present invention are as follows: take hsa-miR-146a-5p gene inverse transcription reaction liquid 4 μ L, MMLV
0.67 μ L of reverse transcriptase, 0.15 μ 5 μ L of L, 6 ng/ μ L sample to be tested RNA of RNase inhibitor, adds 0.1%DEPC water to supply to 15
μ L carries out PCR reaction, obtains sample to be tested reverse transcription product；Simultaneously with 5 μ L positive quality control products and 5 μ L feminine gender quality-control product generations
PCR reaction, which is carried out, for sample to be tested is used as Quality Control；The PCR reaction condition: 16 DEG C of 30min；42℃30min；85℃5min；4
℃2min。
Quantitative PCR reaction method of the present invention are as follows: negate 2 μ L of transcription product, PCR reaction solution 16 μ L, 10 μM of hsa-
1.2 μ L of miR-146a-5p gene specific upstream primer, 10 μM of hsa-miR-146a-5p gene specific downstream primers 1.2
μ L and 10 μM of 1.3 μ L of hsa-miR-146a-5p gene probe, 0.3 μ L of Taq enzyme complement to 25 μ L with 0.1%DEPC water, into
The reaction of row quantitative fluorescent PCR；The quantitative fluorescent PCR reaction condition are as follows: 95 DEG C: 2 minute initial denaturations, 95 DEG C of 8s, 60 DEG C of 30s,
40 circulations.
In addition, the present invention also provides a kind of made comparisons using people's U6 snRNA reference gene to carry out the reagent of PCR detection
Box, the kit is by hsa-miR-146a-5p gene inverse transcription reaction liquid, MMLV reverse transcriptase, RNase inhibitor, Taq
Enzyme, PCR reaction solution, hsa-miR-146a-5p gene-specific primer and probe, people's U6 snRNA reference gene (Gene
ID:79650) specific primer and probe sequence, people's U6 snRNA reference gene inverse transcription reaction liquid, positive quality control product, feminine gender
Quality-control product and volumetric concentration 0.1%DEPC water composition；
People's U6 snRNA reference gene specific forward primer:
CTCGCTTCGGCAGCACATATACT；
People's U6 snRNA reference gene specific downstream primer:
ACGCTTCACGAATTTGCGTGTC；
People's U6 snRNA reference gene probe:
AAAATATGGAACGCTTCACGAATTTG；
People U6 snRNA reference gene inverse transcription reaction liquid composition: 10mMdNTP mixed liquor, 5 × RT buffer, 10mM
MgCl2, l μM of people's U6 specificity miRNA reverse transcriptase primer；5 × RT buffer by 250mMTris-HCl,
375mMKCl, 15mM MgCl2,50mM DTT composition；
People's U6 specificity miRNA reverse transcriptase primer:
5'–GTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTT TTTTTAGTCAG-3'。
The present invention also provides the detections of the hsa-miR-146a-5p gene PCR of the snRNA reference gene of U6 containing people described in one kind
Application of the kit in screening drug-resistant leukemia cell strain, the application is using leukemia cell line RNA to be measured as mould
Plate carries out reverse transcription reaction using the kit and obtains reverse transcription product, and then reverse transcription product carries out quantitative fluorescent PCR
Reaction, detects hsa-miR-146a-5p gene expression amount in leukaemia cell to be measured, when hsa-miR-146a-5p gene expression
When amount is 1.2 times of expression quantity of people U6 snRNA reference gene or more, then judge the leukemia cell line there are drug resistance risk,
His situation then judges the leukemia cell line, and there is no drug resistance risks.
Drug-resistant leukemia cell strain of the present invention refers to the acute myeloid of tolerance chemotherapeutics cytarabine Ara-C
Leukemia cell line OCI-AML3.
Compared with prior art, the beneficial effects are mainly reflected as follows: it is white that the present invention can cover different genotype
Blood disease cell improves sample coverage under the premise of not increase expense；Utilize hsa-miR-146a-5p provided by the invention
Best critical value judges that drug resistance accuracy rate not can achieve 80% or more to leukemia cell line, thin for drug resistance in experimental study
Born of the same parents' strain screening provides great convenience；Clinically still lack at present effectively, efficiently drug resistance methods of risk assessment, and often at present
The drug-resistant leukemia mutational site detection method of rule is (such as the bcr/abl fusion resistant mutational site inspection of Chinese mugwort Dicon AS
Survey, TP53 detection in Gene Mutation etc.) term single gene mutational site can only be assessed, coverage rate is 20% hereinafter, originally
The application of invention will provide great directive significance for the treatment of Clinical Acute myelocytic leukemia patient and medication；The present invention
Reagent used, including enzyme, buffer, primer and probe etc. by carefully design and optimization, greatly improve gene table
Up to the accuracy of detection.
Detailed description of the invention
Fig. 1 is the amplification curve diagram that qPCR reaction is carried out using the present invention.
Fig. 2 is that embodiment 2 analyzes expression quantity of the hsa-miR-146a-5p gene in OCI-AML3 subclone, Suo Younai
The hsa-miR-146a-5p gene expression amount of medicine cell strain (Resistant) is more than U6snRNA reference gene expression quantity 1.2
Times.
Fig. 3 is 3 alleviation group of embodiment and drug resistance group leukaemia cell's hsa-miR-146a-5p gene expression amount.
Specific embodiment
The present invention is described further combined with specific embodiments below, but protection scope of the present invention and not only limits
In this:
Embodiment 1:hsa-miR-146a-5p gene PCR detection kit
1 hsa-miR-146a-5p gene detecting kit of table composition:
Wherein, specific miRNA reverse transcriptase primer is hsa-miR-146a-5p specificity miRNA reverse transcriptase primer and U6
Specific miRNA reverse transcriptase primer, sequence are shown in Table 2.
Table 2
| Name | Sequence |
| hsa-miR-146a-5p | 5'–GTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTTTTTTTAACCCA-3' |
| U6 | 5'–GTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTTTTTTTAGTCAG-3' |
3 hsa-miR-146a-5p gene-specific primer (L1, R1) of table and probe (P1) sequence
| Name | Sequence | Strand | Tm | Purity | Modification |
| L1 | CCGATGTGTATCCTCAGCTTT | forward | 54.7 | GAP | |
| R1 | ATCCCAGCTGAAGAACTGAA | reverse | 53.4 | GAP | |
| P1 | AGGTCTGACACTGACACAACCCATGG | reverse | 62.6 | HPLC | 5'Fam-3'Tamra |
4 people's U6 snRNA reference gene specific primer (L2, R2) of table and probe (P2) sequence
The application of embodiment 2:hsa-miR-146a-5p gene PCR detection kit
Using the hsa-miR-146a-5p gene PCR detection kit of embodiment 1, using fluorescence RT-PCR method to acute
The subclone sample of 61 different drug resistances of myeloid leukemia cell line OCI-AML3 (being purchased from ATCC) is studied, really
Determine the best critical value of hsa-miR-146a-5p in the assessment of Acute Myeloid Leukemia Cells Contributing resistance analysis.
1, the preparation of the subclone sample of different drug resistances
The culture of OCI-AML3 cell routine is in 37 degree of 5%CO2In incubator, cell is addition 10% with normal incubation medium
The RPMI1640 of fetal calf serum, changes liquid for every 72 hours, and inoculum density is 0.2 × 106A/mL；
The OCI-AML3 cell for being in increased logarithmic phase is collected, according to 1 × 106A/mL density be seeded in containing
It is cultivated 48 hours in the normal incubation medium of 1mMAraC (cytarabine), then changes cell normal culture solution culture 48 hours into；
After handling 3 times repeatedly, cell is diluted to the density inoculation 96 orifice plates (every 100 μ L of hole) of 10/mL with normal culture solution, is expanded
61 OCI-AML3 subcloned cells strains are obtained after increasing；These cell strains show the different drug resistances to AraC: parent
OCI-AML3 cell 1mMAraC handle 48 hours after apoptosis ratio be 23.4 ± 1.2% (detection method utilize Annexin
V-FITC Apoptosis Staining/Detection Kit kit, article No. Abcamab14085), and same treatment feelings
The apoptotic cell ratio of subcloned cells strain under condition is distributed between 11.1%-26.4%, wherein 22 subclone apoptosis ratios
Substantially less than parent OCI-AML3 cell (p < 0.01), shows as drug resistance.
2, kit test method
(1) RNA is extracted: each OCI-AML3 subcloned cells sample (1,000,000 cells of each sample) are collected by centrifugation,
Total RNA (QIAamp RNA Mini kit) is extracted according to conventional method.
(2) reagent prepares: the kit of embodiment 1 is taken out from -20 DEG C of refrigerators, 4 DEG C melt and are mixed by inversion, are of short duration
It is stand-by after centrifugation；
(3) reverse transcription mixed liquor dispenses: calculating detection sample number, (n+4, n represent sample to be examined number, and 4 refer to 3 hsa-
MiR-146a-5p positive quality control product+1 negative quality-control product), every part of operation is as follows: hsa-miR-146a-5p gene being taken to invert
Recording reaction solution, (10mMdNTP mixed liquor, 5 × RT buffer are (by 250mMTris-HCl, 375mMKCl, 15mM MgCl2、
50mM DTT composition), the MgCl of 10mM2, l μM of hsa-miR-146a-5p gene specific miRNA reverse transcriptase primer) 4.2 μ
0.67 μ L, RNA enzyme inhibitor of L, MMLV reverse transcriptase, 0.15 μ L is dispensed after mixing by 5 μ L/ samples dedicated to new fluorescent PCR
In PCR plate.
(4) it is loaded: the RNA that step (1) is extracted being spent into ribozyme water and is diluted to 6ng/ μ L, 5 μ L is taken to be added to step (3)
PCR plate in, and 5 μ L hsa-miR-146a-5p positive quality control products and 5 μ L feminine gender quality-control products is taken to be added to PCR plate phase respectively
Ying Kongzhong adds ribozyme water to supply volume to 15 μ L, covers tightly pipe lid and be placed in PCR after centrifugation in 1000rpm30 seconds as Quality Control
On instrument sample well.
(5) PCR instrument reverse transcription condition setting: 16 DEG C of 30min；42℃30min；85℃ 5min；4℃2min.Reverse transcription journey
After sort run, reverse transcription product is used for subsequent PCR amplification.
(6) fluorescent PCR amplifing reagent prepares: the kit of embodiment 1 is taken out from -20 DEG C of refrigerators, 4 DEG C melt and run
It mixes, is stand-by after of short duration centrifugation.
(7) PCR mixed liquor dispenses: detection sample number (n+4) is calculated, every part of operation is as follows: taking 16 μ L of PCR reaction solution,
1.2 μ L of hsa-miR-146a-5p gene specific upstream primer (10 μM), 1.2 μ L of downstream primer (10 μM) and probe (10 μM)
1.3 μ L, 0.3 μ L of Taq enzyme remove 3 μ L of ribozyme water, are added in a clean centrifuge tube, by 23 μ L/ reaction packing to one after mixing
In eight new unions.
(8) it is loaded: taking 2 μ L of step (5) reverse transcription product to be added to step (7) equipped in the PCR plate of PCR mixed liquor, go
Ribozyme water complements to 25 μ L, and lid upper tube cap is placed on fluorescent PCR instrument sample well after centrifugation in 1000rpm30 seconds.In U6 snRNA
Join gene specific upstream primer, downstream primer and probe replacement hsa-miR-146a-5p gene carry out identical reaction.
(9) fluorescent PCR instrument PCR reaction condition is arranged:
Table 5
It is provided with rear save routine and the program that brings into operation, end of run post analysis testing result.
(10) Analysis of test results:
Kit availability deciding method are as follows: 1) positive quality control product detection Ct value within the scope of 30-33 and has obvious index
Rise period；2) negative quality-control product: value > 45 Ct are detected or without Ct value；It just can determine that this experiment when result above need to meet simultaneously
Testing result is significant；Otherwise, detection should be repeated.In the effective situation of kit, as sample to be tested Ct value < 24, then deposit
In drug resistance risk.As shown in Figure 1, compareing 18S (Gene ID:100008588 with qPCR Classic Experiments；Rule of origin article No. is
ThermoFisher AM1716,QuantumRNATMClassic 18S Internal Standard) as reference, it is seen that benefit
The slope consistency of the qPCR amplification curve of hsa-miR-146a-5p and U6 gene expression is detected well, again with this kit
Renaturation height (less than 0.15 cycle of three repeating hole testing result differences), reflects detection kit of the present invention and has Gao Ling
Sensitivity and high specific.
3, critical value
To the subclone sample hsa-miR-146a-5p gene expression institute for detecting 61 OCI-AML3 using this kit
It obtains result to be analyzed, allows instrument that baseline is set automatically every time, statistical result is as shown in Fig. 2, determine that acute myeloid is white
The best critical value of hsa-miR-146a-5p is as follows in the analysis assessment of blood disease cells resistance:
1) positive findings: " the hsa-miR-146a-5p gene expression amount/reference gene expression quantity > 1.2 " of sample to be tested
When, be judged as drug-resistant cell strain (conventional chemotherapeutic drugs cytarabine AraC1mM concentration handle 48 hours after, persister apoptosis ratio
Example is substantially less than parent OCI-AML3 cell, p < 0.01)；
2) negative findings: " the hsa-miR-146a-5p gene expression amount/reference gene expression quantity≤1.2 " of sample to be tested
When, be judged as non-drug-resistant cell strain (conventional chemotherapeutic drugs cytarabine AraC1mM concentration handle 48 hours after, persister apoptosis
Ratio and parent OCI-AML3 cell do not have significant difference, p > 0.05).
Embodiment 3: the best critical value of hsa-miR-146a-5p gene PCR detection kit of the present invention is in clinical sample
Certificate authenticity
1, experimental method
(1) sample is detected: according to comprehensive cancer network (NCCN) clinical practice guideline of American National: acute myelogenous white blood
Sick diagnostic criteria (2015.V1), the acute myelocytic leukemia head of acquisition examine 28, patient's anticoagulation cirumferential blood sample (before treatment)
(head examines September in July, 2015-time).Whether long-term remission is obtained in 24 months after receiving treatment according to leukaemic,
It will test sample and be divided into two groups: alleviation group (15) and drug resistance recurrence group (13)；
(2) the standard declaration program that conventionally (QIAamp RNA Blood Mini kit kit) provides mentions
Take cell total rna, -80 DEG C of preservations after Nano drop detectable concentration；
(3) it takes 100ngRNA to carry out reverse transcription reaction according to 2 method of embodiment with 1 kit of embodiment, obtains cDNA；
(4) PCR reacts: with embodiment 2.
(5) PCR reaction condition are as follows:
2, Analysis of test results:
As shown in figure 3, firstly, alleviation group leukaemia cell's hsa-miR-146a-5p gene expression amount is substantially less than drug resistance
Recurrence group.
It is for statistical analysis using the best critical value 1.2 of hsa-miR-146a-5p provided by the invention, judge not drug resistance
Accuracy rate be 93.3% (14/15), judge drug resistant accuracy rate for 84.6% (11/13)；As control, we utilize mesh
Preceding conventional drug-resistant leukemia mutational site detection method carries out TP53 mutation, IDH2 mutation and CEBPA mutation to cell and carries out
Analysis, judges that drug resistant accuracy rate is only 23.1% (3/13).
These results suggest that the method for the present invention may be implemented simply and effectively to carry out drug-resistant leukemia risk assessment, accurately
Rate is apparently higher than better than existing drug-resistant leukemia mutational site detection method.
Sequence table
<110>Zhejiang University
<120>a kind of hsa-miR-146a-5p gene PCR detection kit and application
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>unknown (Unknown)
<400> 1
ccgatgtgta tcctcagctt t 21
<210> 2
<211> 20
<212> DNA
<213>unknown (Unknown)
<400> 2
atcccagctg aagaactgaa 20
<210> 3
<211> 26
<212> DNA
<213>unknown (Unknown)
<400> 3
aggtctgaca ctgacacaac ccatgg 26
<210> 4
<211> 50
<212> DNA
<213>unknown (Unknown)
<400> 4
gtgcagggtc cgaggtcaga gccacctggg caattttttt ttttaaccca 50
<210> 5
<211> 23
<212> DNA
<213>unknown (Unknown)
<400> 5
ctcgcttcgg cagcacatat act 23
<210> 6
<211> 22
<212> DNA
<213>unknown (Unknown)
<400> 6
acgcttcacg aatttgcgtg tc 22
<210> 7
<211> 26
<212> DNA
<213>unknown (Unknown)
<400> 7
aaaatatgga acgcttcacg aatttg 26
<210> 8
<211> 50
<212> DNA
<213>unknown (Unknown)
<400> 8
gtgcagggtc cgaggtcaga gccacctggg caattttttt ttttagtcag 50
Claims (10)
1. a kind of hsa-miR-146a-5p gene PCR detection kit, it is characterised in that the kit includes hsa-miR-
146a-5p gene inverse transcription reaction liquid, MMLV reverse transcriptase, RNase inhibitor, Taq enzyme, PCR reaction solution, hsa-miR-
146a-5p gene-specific primer and probe, positive quality control product and negative quality-control product；
Hsa-miR-146a-5p gene specific upstream primer: CCGATGTGTATCCTCAGCTTT；
Hsa-miR-146a-5p gene specific downstream primer: ATCCCAGCTGAAGAACTGAA；
Hsa-miR-146a-5p gene probe: AGGTCTGACACTGACACAACCCATGG；
The positive quality control product is hsa-miR-146a-5p gene, and negative quality-control product is volumetric concentration 0.1%DEPC water.
2. kit as described in claim 1, it is characterised in that the hsa-miR-146a-5p gene inverse transcription reaction liquid composition
Are as follows: 10mM dNTP mixed liquor, 5 × RT buffer, 10mM MgCl2, l μM hsa-miR-146a-5p specificity miRNA it is inverse
Transcription primers；5 × RT buffer is by 250mM Tris-HCl, 375mM KCl, 15mM MgCl2, 50mM DTT composition；
Hsa-miR-146a-5p specificity miRNA reverse transcriptase primer:
5'–GTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTTTTTTTAACCCA-3'。
3. kit as described in claim 1, it is characterised in that the PCR reaction solution composition: 10mMdNTP mixed liquor, 25mM
MgCl2, without Mg2+10 × Taq buffer, volumetric concentration 0.1%DEPC water.
4. kit as described in claim 1, it is characterised in that the kit is anti-by hsa-miR-146a-5p gene reverse transcription
Answer liquid, MMLV reverse transcriptase, RNase inhibitor, Taq enzyme, PCR reaction solution, hsa-miR-146a-5p gene-specific primer and
Probe, positive quality control product, negative quality-control product and volumetric concentration 0.1%DEPC water composition.
5. hsa-miR-146a-5p gene PCR detection kit described in a kind of claim 1 is in screening drug-resistant leukemia cell strain
In application.
6. application as claimed in claim 5, it is characterised in that the application is to be with sample to be tested leukemia cell line RNA
Template carries out reverse transcription reaction using the kit and obtains reverse transcription product, and then reverse transcription product carries out quantitative fluorescent PCR
Reaction；If quality-control product testing result can not meet simultaneously following two condition: (1) positive quality control product detects Ct value in 30-33 model
In enclosing and there is obvious Exponential growth stage；(2) negative quality-control product detects value > 45 Ct or without Ct value, then determines that kit fails, need weight
Reinspection is surveyed, and in the effective situation of kit, as sample to be tested Ct value < 24, then there is drug resistance risk.
7. application as claimed in claim 6, it is characterised in that the reverse transcription reaction method are as follows: take hsa-miR-146a-5p
5 μ of 4 μ L, MMLV reverse transcriptase of gene inverse transcription reaction liquid, 0.67 μ L, 0.15 μ L, 6ng/ μ L sample to be tested RNA of RNase inhibitor
L adds 0.1%DEPC water to supply to 15 μ L, carries out PCR reaction, obtains sample to be tested reverse transcription product；Simultaneously with 5 μ L positive matter
Control product and 5 μ L feminine gender quality-control products replace sample to be tested to carry out PCR reaction and are used as Quality Control；The PCR reaction condition: 16 DEG C of 30min；
42℃30min；85℃5min；4℃2min.
8. application as claimed in claim 6, it is characterised in that the quantitative fluorescent PCR reaction method are as follows: negate transcription product 2
μ L, PCR reaction solution 16 μ L, 10 μM of hsa-miR-146a-5p gene specific upstream primers 1.2 μ L, 10 μM of hsa-miR-
1.2 μ L of 146a-5p gene specific downstream primer and 10 μM of 1.3 μ L of hsa-miR-146a-5p gene probe, 0.3 μ L of Taq enzyme,
25 μ L are complemented to 0.1%DEPC water, carry out quantitative fluorescent PCR reaction；The quantitative fluorescent PCR reaction condition are as follows: 95 DEG C: 2
Minute initial denaturation, 95 DEG C of 8s, 60 DEG C of 30s, 40 circulations.
9. hsa-miR-146a-5p gene PCR detection kit as described in claim 1, it is characterised in that the kit is also
Include people's U6snRNA reference gene specific primer and probe sequence；
People's U6snRNA reference gene specific forward primer:
CTCGCTTCGGCAGCACATATACT；
People's U6snRNA reference gene specific downstream primer:
ACGCTTCACGAATTTGCGTGTC；
Probe: AAAATATGGAACGCTTCACGAATTTG.
10. hsa-miR-146a-5p gene PCR detection kit described in a kind of claim 9 is in screening drug-resistant leukemia cell
Application in strain, it is characterised in that the described application be using leukemia cell line RNA to be measured as template, using the kit into
Row reverse transcription reaction obtains reverse transcription product, and then reverse transcription product carries out quantitative fluorescent PCR reaction, and it is thin to detect leukaemia to be measured
Hsa-miR-146a-5p gene expression amount in born of the same parents, when hsa-miR-146a-5p gene expression amount behaviour U6snRNA reference gene
At 1.2 times of expression quantity or more, then the leukemia cell line is judged there are drug resistance risk, other situations then judge the leukaemia cell
Drug resistance risk is not present in strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811009554.2A CN109234389A (en) | 2018-08-31 | 2018-08-31 | A kind of hsa-miR-146a-5p gene PCR detection kit and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811009554.2A CN109234389A (en) | 2018-08-31 | 2018-08-31 | A kind of hsa-miR-146a-5p gene PCR detection kit and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109234389A true CN109234389A (en) | 2019-01-18 |
Family
ID=65068873
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811009554.2A Pending CN109234389A (en) | 2018-08-31 | 2018-08-31 | A kind of hsa-miR-146a-5p gene PCR detection kit and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109234389A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112410414A (en) * | 2020-10-09 | 2021-02-26 | 嘉兴市妇幼保健院 | Application of pregnant woman serum exosome miRNA marker in preparation of early diagnosis product of fetal congenital heart disease and kit |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2563936A2 (en) * | 2010-04-29 | 2013-03-06 | Medical Prognosis Institute A/S | Methods and devices for predicting treatment efficacy |
| CN106282239A (en) * | 2015-06-24 | 2017-01-04 | 广东药学院 | MiR-21 is at the regulation and control CML stem cell research method to imatinib mesylate primary drug resistance |
| CN108251518A (en) * | 2018-04-01 | 2018-07-06 | 南京千年健干细胞基因工程有限公司 | A kind of gene detecting kit of the identification umbilical cord mesenchymal stem cells passage number based on Microrna |
-
2018
- 2018-08-31 CN CN201811009554.2A patent/CN109234389A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2563936A2 (en) * | 2010-04-29 | 2013-03-06 | Medical Prognosis Institute A/S | Methods and devices for predicting treatment efficacy |
| CN106282239A (en) * | 2015-06-24 | 2017-01-04 | 广东药学院 | MiR-21 is at the regulation and control CML stem cell research method to imatinib mesylate primary drug resistance |
| CN108251518A (en) * | 2018-04-01 | 2018-07-06 | 南京千年健干细胞基因工程有限公司 | A kind of gene detecting kit of the identification umbilical cord mesenchymal stem cells passage number based on Microrna |
Non-Patent Citations (9)
| Title |
|---|
| CHIEN-HUNG YEH第: "Clinical significance of microRNAs in chronic and acute human leukemia", 《MOL CANCER.》 * |
| E YAP等: "MicroRNAs that affect the Fanconi Anemia/BRCA pathway are downregulated in imatinib-resistant chronic myeloid leukemia patients without detectable BCR-ABL kinase domain mutations", 《LEUKEMIA RESEARCH》 * |
| HUA ZHONG等: "Up-Regulated Mir-146a Expression in Leukemia Cells Induced By G-CSF Correlates with Enhanced Sensitivity to Cytarabine Treatment: A Putative Novel Predictive Biomarker for Chemotherapy", 《BLOOD》 * |
| XIANFU SHENG等: "Granulocyte colony-stimulating factor inhibits CXCR4/SDF-1α signaling and overcomes stromal-mediated drug resistance in the HL-60 cell line", 《EXP THER MED.》 * |
| 夏邦顺编: "《临床分子诊断学》", 31 July 2012, 中山大学出版社 * |
| 曾佑炜等: "《基因工程技术》", 31 July 2010, 中国轻工业出版社 * |
| 杨清玲等: "《分子生物学实验指导》", 31 December 2016, 中国科学技术大学出版社 * |
| 罗正曜主编: "《休克学》", 31 January 2001, 天津科学技术出版社 * |
| 陈宏主编: "《基因工程实验技术》", 31 August 2005, 中国农业出版社 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112410414A (en) * | 2020-10-09 | 2021-02-26 | 嘉兴市妇幼保健院 | Application of pregnant woman serum exosome miRNA marker in preparation of early diagnosis product of fetal congenital heart disease and kit |
| CN112410414B (en) * | 2020-10-09 | 2022-07-08 | 嘉兴市妇幼保健院 | Application of pregnant woman serum exosome miRNA marker in preparation of early diagnosis product of fetal congenital heart disease and kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Deffenbacher et al. | Molecular distinctions between pediatric and adult mature B-cell non-Hodgkin lymphomas identified through genomic profiling | |
| Gorovets et al. | IDH mutation and neuroglial developmental features define clinically distinct subclasses of lower grade diffuse astrocytic glioma | |
| de Leeuw et al. | MicroRNA profiling can classify acute leukemias of ambiguous lineage as either acute myeloid leukemia or acute lymphoid leukemia | |
| WO2013138237A9 (en) | Methods and compositions for the diagnosis, prognosis and treatment of acute myeloid leukemia | |
| CN111518886B (en) | MicroRNA related to sorafenib drug resistance of tumor cells and application thereof | |
| Li et al. | Dissecting LncRNA roles in renal cell carcinoma metastasis and characterizing genomic heterogeneity by single-cell RNA-seq | |
| CN108467891A (en) | Applications of the SNHG5 in breast cancer diagnosis and assessment and outcome prediction | |
| CN101684488B (en) | Small RNA and application thereof | |
| CN107475363A (en) | Biomarker combination, the screening and its application of biomarker combination of a kind of non-small cell lung cancer | |
| Courtois et al. | IL-7 receptor expression is frequent in T-cell acute lymphoblastic leukemia and predicts sensitivity to JAK inhibition | |
| CN109234389A (en) | A kind of hsa-miR-146a-5p gene PCR detection kit and application | |
| CN103074431A (en) | Special primer, kit and method for testing minRNA-128 in colorectal cancer serum | |
| CN107604069A (en) | People's JAK2 V617F mutation detection kits and method based on Taqman MGB probes | |
| Yang et al. | The impact of TIMM17A on aggressiveness of human breast cancer cells | |
| CN107385038A (en) | Detect oligonucleotides, method and the kit of ZNF198 FGFR1 fusions in sample | |
| Samaratunga et al. | LOT and HOT… or not. The proliferation of clinically insignificant and poorly characterised types of renal neoplasia | |
| CN107815494B (en) | Method, kit and oligonucleotide for detecting relative expression amount of PCM1-JAK2 | |
| Meloni-Ehrig | The cytogenetics of hematologic neoplasms | |
| CN107937526A (en) | A kind of relevant tumor markers of neuroblastoma and its application | |
| CN107354214A (en) | The gene mRNA kit for detecting nucleic acid of CA15 3（PCR fluorescence probe methods） | |
| EP4193145A1 (en) | Characterising macrophages and methods thereof | |
| Song et al. | A higher percentage of leukemic blasts with vacuoles predicts unfavorable outcomes in patients with acute myeloid leukemia | |
| Krigstein et al. | Applying molecular measurable residual disease testing in acute myeloid leukaemia | |
| Koo et al. | Prognostic value of the mutation types and dynamics of FLT3‐ITD in acute myeloid leukemia | |
| CN104561257A (en) | Myasthenia gravis detection kit with non-coding RNA Tmevpg1 as detection or diagnosis screening marker and application of kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190118 |