CN104031987B - MiRNA application in myocardial fibrosis disease treatment - Google Patents
MiRNA application in myocardial fibrosis disease treatment Download PDFInfo
- Publication number
- CN104031987B CN104031987B CN201410196658.4A CN201410196658A CN104031987B CN 104031987 B CN104031987 B CN 104031987B CN 201410196658 A CN201410196658 A CN 201410196658A CN 104031987 B CN104031987 B CN 104031987B
- Authority
- CN
- China
- Prior art keywords
- seq
- mirna
- sequence
- expression
- mir
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Veterinary Medicine (AREA)
- Microbiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
It is an object of the invention to provide a kind of miRNA application in treatment or diagnosis myocardial fibrosis disease, described miRNA sequence is SEQ ID1, SEQ ID2, SEQ ID3, SEQ ID4, SEQ ID5 or SEQID6.Especially different people miRNAs 19b sequence is mixed application with non-human miRNAs 19b, will human miRNAs 19b sequence SEQ ID1 or SEQ ID2, mix with one or more in non-human miRNAs 19b sequence SEQ ID3, SEQ ID4, SEQ ID5 and SEQ ID6, for the application in treatment myocardial fibrosis disease, achieve significant effect.
Description
Technical field
The invention belongs to biomedical professional field, relate to the precursor RNA of miRNA, miRNA, miRNA antisense oligonucleotide
Sequence and expression vector thereof, and the application in diagnosis and treatment myocardial fibrosis disease.
Background technology
Cardiovascular disease is the serious disease of harm human health, is murderous one of the main reasons.At present, at me
In the death notation of state resident, cardiovascular disease has become as No. second killer being only second to malignant tumor, and separately has number every year
People in terms of ten thousand causes deformity because suffering from this disease.This disease is of a great variety, the cause of disease is complicated.Wherein, by, the coronary artery medicated porridge sample of severe
Cardiac muscle fiber persistence caused by sclerostenosis and/or the hypoxic-ischemic repeatedly increased the weight of will cause myocardial fibrosis disease.?
The early stage of this disease, left ventricular diastolic function is impaired.Develop as one pleases and will lose, finally owing to Ventricular Remodeling causes cardiac muscle normal configuration
Make ventricular systolic function the most impaired, thus cause cardiac insufficiency.In myocardial fibrosis disease progression, myocardial tissue structure
In middle collagen fiber excess accumulation, heart tissue, collagen concentration significantly raises or collagen component changes.This pathological change
Multiple cardiovascular disease exists, now thinks that myocardial fibrosis is close with arrhythmia, cardiac dysfunction even sudden cardiac death
[Jessup M and Brozena S:Heart fai lure.N Engl J Med2003 is closed in cut；348:2007-2018；
Swynghedauw B:Molecular mechanisms of myocardial remodeling.Physiol Rev1999；
79:215-262.].
The extracellular matrix protein (ECM) accumulation in cardiac muscular tissue is the principal character of myocardial fibrosis, and connective group
Knit somatomedin (CTGF) and be confirmed as strength inducible factor [Koitabashi N, the et al:Increased of ECM
connective tissue growth factor relative to brain natriuretic peptide as a
determinant of myocardial fibrosis.[J]Hypertension2007；49:1120-1127；Tsoutsman
T, et al:CCN2plays a key role in extracellular matrix gene expression in
severe hypertrophic cardiomyopathy and heart failure.[J]J Mol Cell
Cardiol.2013；62C:164-178；Chen MM, et al:CTGF expression is induced by TGF-beta
In cardiac fibroblasts and cardiac myocytes:a potentiai role in heart
fibrosis.[J]J Mol Cell Cardiol2000；32:1805-1819.].Multinomial result of study shows, heart failure
Cheng Zhong, CTGF have played an active part in the myocardial fibrosis process that Angiotensin II (Ang II) is induced.Therefore, the expression of CTGF exists
The multiple cardiovascular disease that myocardial fibrosis is caused rises and important function [Finckenberg P, et al:
Angiotensin II induces connective tissue growth factor gene expression via
calcineurin-dependent pathways.[J]Am J Pathol2003；163:355-366；Ahmed MS, et al:
Connective tissue growth factor--a novel mediator of angiotens in II-
stimulated cardiac fibroblast activation in heart failure in rats.[J]J Mol
Cell Cardiol2004；36:393-404；Sopel MJ, et al:Treatment with activated protein C
(aPC) is protective during the development of myocardial fibrosis:an
angiotensin II infusion model in mice.[J]PloS one2012；7:e45663；Matsui Y and
Sadoshima J:Rapid upregulation of CTGF in cardiac myocytes by hypertrophic
Stimuli:implication for cardiac fibrosis and hypertrophy. [J] J Mol Cell
Cardiol2004；37:477-481；He Z, et al:Differentiai regulation of angiotensin II-
induced expression of connective tissue growth factor by protein kinase C
isoforms in the myocardium.[J]J Biol Chem2005；280:15719-15726.].
Cardiovascular disease incidence rate is high, disability rate is high, mortality rate is high, relapse rate is high, complication is many, the serious threat mankind's
Life and health.Therefore, countries in the world to the research of cardiovascular and cerebrovascular disease, prevent and treat all to attach great importance to.In cardiac fibers
Change in the therapeutic process of disease, how to effectively reduce CTGF expression in myocardial tissue structure, so reduce ECM
Accumulation in cardiac muscular tissue, reduce collagen concentration in heart tissue, the multiple painstaking effort that treatment cardiac fibrosis is caused will be become
The key of pipe disease.
Microrna (miRNA or microRNA) is the endogenous non-coding of a kind of a length of 18～25 nucleotide single-chains
Property tiny RNA, is to be generated under the processing of enzyme by precursor, and the sequence of precursor is generally 70～120 nucleotide.By with target gene
Sequence-specific interacts and expresses in transcriptional level regulator gene, participates in various biological process, and evolutionary process is guarded.Initially
The endogenous miRNA found is lin24 and let27, and they regulate after participating in gene expression transcription, by the 3 ' ends with said target mrna
Noncoding region or coding region (3 '-UTR) combine and play negativity regulation effect.Identify more than 400 kinds
MiRNA, but still have and a variety of be not yet found [Berezikov E, Thuemmler F, van Laake LW, et
Al.Diversity of microRNAs in human and chimpanzee brain [J] .Nat Genet, 2006,38
(12): 1375-1377.].Showing the Systematic Analysis of miRNA space expression, a lot of miRNAs are with tissue specific way table
Reach [Wienholds E, KloostermanWP, Miska E, et al.MicroRNA expression in zebrafish
Embryonic development [J] .Science, 2005,309 (5732): 310-311.].Each miRNA can position
In a variety of mRNA so that it is Transcription inhibition or degraded, the most a variety of transcriptons may be fine-tuned by miRNA, makes to turn
Record-translation system effectively operates, and then cell is rapidly and efficiently controlled the dependent cell event of threshold value.The most universal
Think that the function of miRNA is some basic processes such as growth promoter, orga-nogenesis, hemopoietic, the cell proliferation of participation life and withers
Die, stress and tumor generation etc..
Initially scientists finds that miRNA has extremely close relation with the canceration of cell, plays tumor suppressor gene
The miRNA of effect declines or disappearance can lead oncogenic generation.Have been found that miRNA and pulmonary carcinoma, breast carcinoma, colon cancer,
The kinds cancers such as chronic lymphocytic leukemia are closely related.At the end of 2006, scientist starts to notice that miRNA is at heart disease
There is important function [Van Rooij E, Sutherland LB, L iu N, the et a1.A played in evolution
signature pattern of stress-responsive microRNAs that can evoke cardiac
Hypertrophy and heart failure [J] .PNAS, 2006,103:18255-18260.], and at arrhythmia, the heart
The research of the diseases such as force failure achieves a series of impressive progress, makes miRNA become the focus of international cardiovascular research field.
What cardiovascular disease was correlated with miRNA has found that it is likely that the treatment of the related gene on this disease produces great impact.Logical
Cross the miRNA Differential expression analysis to cardiovascular patient and normal population, the sensitive miRNA obtaining being correlated with can be identified,
And then suppress or by viral vector or plasmid vector process LAN by introducing antisense nucleotide complementary for specific miRNA
Method, the relevant miRNA of regulation and control or the expression of its precursor, thus reach to treat the purpose of cardiovascular disease.Thus, it is found that it is special
The miRNA that the opposite sex is expressed has very important significance for diagnosis and the treatment of cardiovascular disease.
Summary of the invention
It is an object of the invention to be found a kind of new application of miRNA-19b by experiment in vitro.
The present invention provides miRNA-19b as the Drug therapy application of preparation treatment myocardial fibrosis disease.
Specifically, human miRNAs-19b (has-miR-19b) provided by the present invention and Mus miRNAs-19b (mmu-
MiR-19b and rno-miR-19b) all comprise following sequence:
5’-UGUGCAAAUCCAUGCAAAACUGA-3’(SEQ ID7)。
The precursor RNA of human miRNAs-19b provided by the present invention has 2 kinds, comprises following sequence:
Hsa-mir-19b-1 (MI0000074):
5’-CACUGUUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUGUGAUAUUCUGCUGUGCAAAUCCAU
GCAAAACUGACUGUGGUAGUG-3’(SEQ ID1)
Hsa-mir-19b-2 (MI0000075):
5’-ACAUUGCUACUUACAAUUAGUUUUGCAGGUUUGCAUUUCAGCGUAUAUAUGUAUAUGUGGCUGUGC
AAAUCCAUGCAAAACUGAUUGUGAUAAUGU-3’(SEQ ID 2)
The precursor RNA of mice Mus miRNAs-19b provided by the present invention has 2 kinds, comprises following sequence:
Mmu-mir-19b-1 (MI0000718):
5’-CACUGGUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUAUAAUAUUCUGCUGUGCAAAUCCAU
GCAAAACUGACUGUGGUGGUG-3’(SEQ ID3)
mmu-mir-19b-2(MI0000546)
5’-ACUUACGAUUAGUUUUGCAGAUUUGCAGUUCAGCGUAUAUGUGAAUAUAUGGCUGUGCAAAUCCAU
GCAAAACUGAUUGUGGGA-3’(SEQ ID4)
The precursor RNA of rat miRNAs-19b provided by the present invention has 2 kinds, comprises following sequence:
rno-mir-19b-1(MI0000847)
5’-CACUGGUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUAUAAUAUUCUGCUGUGCAAAUCCAU
GCAAAACUGACUGUGGUGGUG-3’(SEQ ID5)
rno-mir-19b-2(MI0000848)
5’-ACAUUGCUACUUACGGUUAGUUUUGCAGAUUUGCAGUUCAGCGUAUAUGUGGAUAUAUGGCUGUGC
AAAUCCAUGCAAAACUGAUUGUGAUGAUGU-3’(SEQ I D6)
Human miRNAs-19b (has-miRNA-19b) provided by the present invention, Mus miRNAs-19b (mmu-miR-19b
And rno-miR-19b) antisense oligonucleotide all comprise following sequence:
5’-UCAGUUUUGCAUGGAUUUGCACA-3’(SEQ ID8)
The precursor hsa-mir-19b-1 of human miRNAs-19b provided by the present invention is positioned on human chromosome
13q31.3, precursor hsa-mir-19b-2 are positioned human chromosome Xq26.2.
The present invention carries out the clonal analysis of miRNA molecule with the myocardial cell of newborn SD rat for material.Use routine point
Sub-biology techniques, extracts total serum IgE from cell and tissue, carries out reverse transcription and PCR amplification through Non-specific primer.Fluorescence
Real-time quantitative PCR (qRT-PCR) testing result shows, the myocardial fibrosis pathology shape that miRNA-19b induces at angiotensin
Under state, its expression substantially reduces；The miRNA-19b precursor RNA using specificity synthesis increases the table of intracellular miRNA-19b
Reach, Connective Tissue Growth Factor (CTGF) expression in myocardial tissue structure can be effectively reduced.
Suffer from the patient of myocardial fibrosis disease, owing to CTGF expression in myocardial tissue structure increases, heart tissue
Middle collagen concentration content is high.This disease early stage, left ventricular diastolic function is impaired.Develop as one pleases and will finally make ventricular systole
Function is the most impaired, thus causes cardiac insufficiency.Under the myocardial fibrosis pathological state of angiotensin induction, miRNA-
19b expression in myocardial cell substantially reduces, can be as diagnosis myocardial fibrosis with this distinctive performance
Indication；Owing to miRNA-19b has obvious regulation effect for the expression of CTGF in myocardial tissue structure, therefore, it is possible to
Use viral vector or the method for plasmid vector process LAN, the miRNA-19b expression in patient's myocardial cell is increased, by energy
Effective suppression CTGF expression in myocardial cell, and then reduce collagen concentration in heart tissue, this will effectively delay the heart
The pathogenesis of myofibrosis, controls the development of the myocardial fibrosis state of an illness, thus reaches therapeutic purposes.This merit of miRNA-19b
The discovery of energy suffers from extremely important meaning for diagnosis and the treatment of the cardiovascular disease such as myocardial fibrosis.
The present invention is by human miRNAs-19b sequence SEQ ID1 and SEQ ID2, or non-human miRNAs-19b sequence SEQ
ID3, SEQ ID4, SEQ ID5 and SEQ ID6, the cardiac muscle that independent or mixing makes an addition to containing angiotensin (AngII) is thin
In born of the same parents' culture fluid, the sequence of the present invention can significantly inhibit the Connective Tissue Growth Factor (CTGF) expression in myocardial cell,
Especially preferably different people miRNAs-19b sequence will be mixed with non-human miRNAs-19b application, achieve surprising especially
Effect.
According to the present invention, it is provided that a kind of miRNA application in treatment or diagnosis myocardial fibrosis disease, its feature exists
In, described miRNA is miRNA-19b.
A kind of miRNA as above application in treatment or diagnosis myocardial fibrosis disease, the most described miRNA's
Derive from people, mice or rat.
A kind of miRNA as above application in treatment or diagnosis myocardial fibrosis disease, the most described miRNA sequence
It is classified as SEQID1, SEQ ID2, SEQ ID3, SEQ ID4, SEQ ID5 or SEQ ID6.
A kind of miRNA as above application in treatment or diagnosis myocardial fibrosis disease, preferably by different people source
MiRNA-19b sequence mixes application with non-human miRNAs-19b, will human miRNAs-19b sequence SEQ ID1 or SEQID2,
Mix with one or more in non-human miRNAs-19b sequence SEQ ID3, SEQ ID4, SEQ ID5 and SEQ ID6
Close.
A kind of miRNA as above application in treatment or diagnosis myocardial fibrosis disease, preferably mixes described
Close in miRNA-19b sequence nucleotide sequence, the content ratio of described human miRNAs-19b sequence SEQ ID1 or SEQID2 be 10%～
90%.
A kind of miRNA as above application in treatment or diagnosis myocardial fibrosis disease, more preferably described
In mixing miRNA-19b sequence nucleotide sequence, the content ratio of described human miRNAs-19b sequence SEQ ID1 or SEQ ID2 is 30%
～70%.
Present invention also offers a kind of pharmaceutical composition preparing treatment or diagnosis myocardial fibrosis disease, its feature exists
In, miRNA sequence SEQ ID1 containing pharmaceutically acceptable carrier and effective dose, SEQ ID2, SEQ ID3, SEQID4,
One or more in SEQ ID5 and SEQ ID6.
A kind of pharmaceutical composition preparing treatment or diagnosis myocardial fibrosis disease, preferably by human miRNAs-19b sequence
In SEQ ID1 or SEQ ID2, with non-human miRNAs-19b sequence SEQ ID3, SEQ ID4, SEQ ID5 and SEQ ID6
One or more mix.
Present invention also offers treatment or the probe of diagnosis myocardial fibrosis disease, it is characterised in that the sequence of described probe
For SEQ ID1, SEQ ID2, SEQ ID3, SEQ ID4, SEQ ID5 or the complementary series of SEQ ID6.
The present invention also provides for a kind for the treatment of or the test kit of diagnosis myocardial fibrosis disease, it is characterised in that its feature exists
In be SEQ ID1 containing sequence, SEQ ID2, SEQ ID3, SEQ ID4, SEQ ID5 or the probe of SEQ ID6.
Accompanying drawing explanation
Fig. 1. during angiotensin (AngII) inducing cardiomyocytes is Fibrotic, the expression of miR-19b is substantially dropped
Low；Angiotensin inhibitor telmisartan (Telmisartan) can block AngII effect, maintains miR-19b to express water
Flat.*: p < 0.05, statistically significant compared with matched group
During Fig. 2 .AngII inducing cardiomyocytes is Fibrotic, the mrna expression of CTGF substantially increases.AngII suppresses
Agent Telmisartan can block AngII effect, maintains the mrna expression level of CTGF.The mRNA of A qRT-PCR detection CTGF
Expression；The mrna expression amount of B agarose gel electrophoresis detection CTGF.*: p < 0.05, statistically significant compared with matched group
During Fig. 3 .AngII inducing cardiomyocytes is Fibrotic, the protein expression level of CTGF substantially increases.AngII
Inhibitor Telmisartan can block AngII effect, maintains the protein expression level of CTGF.A.Western-blot detects
The protein expression of CTGF in myocardial cell；B. the quantitative Western-blot of gray analysis detects CTGF result.*: p < 0.05, with right
Compare statistically significant according to group
3 ' noncoding regions (3 '-UTR) bindingsite assay of Fig. 4 .A.miR-19b and CTGF mRNA.B. miR-is transfected
19b precursor (pre-miR-19b) can substantially increase the expression of miR-19b in myocardial cell.*: p < 0.05, with matched group
Compare statistically significant
Fig. 5. transfection miR-19b precursor (pre-miR-19b) can substantially reduce the expression of CTGF mRNA in myocardial cell
Level.The mrna expression amount of A.qRT-PCR detection CTGF；B. the mrna expression amount of agarose gel electrophoresis detection CTGF.*: D <
0.05, statistically significant compared with matched group
In Fig. 6 .AngII inducing cardiomyocytes fibrotic processes, pre-miR-19b can effectively reduce in myocardial cell
The mrna expression level of CTGF.*: p < 0.05, statistically significant compared with matched group
In Fig. 7 .AngII inducing cardiomyocytes fibrotic processes, pre-miR-19b can effectively reduce the albumen of CTGF
Expression.The expressing quantity of CTGF in myocardial cell under A.Western-blot detection different conditions；B. gray analysis is fixed
Amount Western-biot detects CTGF expression of results.*: p < 0.05, statistically significant compared with matched group
Detailed description of the invention
The present invention is further elaborated by the following examples.
RNA sequence disclosed in this invention all can obtain with the method for synthetic or other biological method.
Embodiment 1
Neonatal cardiac myocytes cultivation and myocardial cell total serum IgE and total protein extract
L. original cuiture neonatal cardiac myocytes
1.1 take the new life rat heart of 1-3 days is placed in the Hanks balanced salt solution (HBSS, Invitrogen) of pre-cooling.
1.2 cardiac muscular tissues separating ventricular lower extremities about 1/3 position, are cut into small pieces it with operating scissors.
Fritter cardiac muscular tissue is put into the digestion that 5mL contains 75U/mL col lagenase II (Worthington) by 1.3
In solution 37 DEG C hatch 20 minutes after collect Digestive system and add fresh digestion solution and continue digestion.This digestion process repeats 6
Secondary.
1.4 cell 283g are centrifuged 5 minutes afterwards with containing 10% hyclone, the DMEM-F12 cell training of 1% antibiotic
Nutrient solution (1: 1, Invitrogen) is resuspended.
1.5 cultivate cell 1 hour on cell culture, use the method separation non-myocardial infarction of differential velocity adherent.No
Adherent cell DMEM-F12 cell culture fluid is cultivated in the culture bottle of pre-coated Gelatin (Invitrogen).
1.6 myocardial cell are adherent by containing at this in DMEM-F12 culture fluid of 0.1% bovine serum albumin in 48 hours.
2. cell total rna extracts (TRIzol method)
2.1. harvesting 1-5 × 107, moving in 1.5ml centrifuge tube, add lml Trizol, mixing, room temperature stands
5min。
2.2. add 0.2ml chloroform, vibrate 15 seconds, stand 2min.
2.3. 12000g is centrifuged 15 minutes in 4 DEG C of centrifuges of pre-cooling.Take supernatant.
2.4. adding 0.5ml isopropanol, mixed gently by liquid in pipe, room temperature stands 10min.
2.5. in 4 DEG C of centrifuges of pre-cooling, 12000g is centrifuged 10 minutes.Abandon supernatant.
2.6. add 1ml75% ethanol, wash precipitation gently.In 4 DEG C of centrifuges of pre-cooling, 7500g is centrifuged 10 minutes,
Abandon supernatant.
2.7. dry, add appropriate DEPC H2O dissolves (65 DEG C of dissolutions 10-15min).Measure 0D260 and 0D280 value,
Tentatively conclude RNA mass.
2.8. Total RNAs extraction uses without the DNA enzymatic I process of RNase, QIAGEN RNeasy kits total serum IgE, in detail
Thin operating principle and method are shown in test kit description.
3. total protein of cell extracts (RIPA cracking process)
3.1. from attached cell culture plate, carefully suck culture fluid.
3.2. the cell that the PBS of pre-cooling is adherent 2 times, carefully sucks PBS.
3.3. the configuration protein extraction agent RIPA lysate containing inhibitor (adds 5 μ l protease to press down in 1ml lysate
Preparation mixed liquor, 5 μ 1PMSF and 5 μ 1 inhibitors of phosphatases mixed liquors).
3.4., Tissue Culture Plate adds the RIPA lysate containing inhibitor of pre-cooling, is placed in 5 minutes on ice.
3.5. scraping with the cell of a pre-cooling and scraped off by attached cell on culture bottle wall, transfer cell suspending liquid is to centrifuge tube
In, under ice bath, shake cracks for 15 minutes.
3.6. lysate 14000g in the centrifuge of pre-cooling, 4 DEG C are centrifuged 15 minutes.Discarding precipitation, supernatant turns at once
Move into new centrifuge tube preserves stand-by.
Embodiment 2
MiR-19b precursor (pre-mir-19b) transfection myocardial cell and angiotensin Ang II stimulate induction cardiac muscle thin
Born of the same parents' fibrosis
Total serum IgE and the extraction of total protein after 1.pre-mir-19b transfection myocardial cell
1.1 cells are inoculated in 24 well culture plates, every porocyte number 4 × 104。
1.2 by transfection reagent siPORT NeoFX (AM4510, Ambion) of 1ul and the OPTI-MEM I culture fluid of 25ul
(Invitrogen) mixing is positioned over incubated at room 10 minutes.
Pre-mir-19b (AMl7100, Ambion) OPTI-MEM I culture fluid (Invitrogen) is diluted by 1.3, and two
It is positioned over incubated at room 10 minutes after person's mixing.Use non-functional miRNA sequence pre-miRTM-Negative Control
(AM17110, Ambion) processes cell (Control) as a control group.
1.4 mix the pre-mir-19b and transfection reagent diluted, and are positioned over incubated at room and form it into transfection in 10 minutes
Complex.
Culture fluid containing transfection composite is added Tissue Culture Plate by 1.5, jointly hatches with cell 48 hours.
1.6 collect cell total rna, and concrete grammar is with reference to embodiment 1.
1.7 collect total protein of cell, and concrete grammar is with reference to embodiment 1.
2. angiotensin Ang II stimulates inducing cardiomyocytes fibrosis
2.1 cells are inoculated in 24 well culture plates, every porocyte number 4 × 104。
2.2 cells add containing 100nM blood with after 10 μm telmisartan (Telmisartan, Abcam) pretreatment 30 minutes
The cell culture fluid of angiotensin AngII (Sigma) is cultivated 48 hours.By thin to non-pretreated group and cellar culture liquid cultivation group
Born of the same parents are as a control group.
2.3 collect cell total rna, and concrete grammar is with reference to part 2 in embodiment 1.
2.4 collect total protein of cell, and concrete grammar is with reference to third portion in embodiment 1.
Embodiment 3
The expression of miRNA-19b and CTGF in analysis myocardial cell
1.qRT-PCR the expression of miRNA-19b and CTGF mRNA in detection myocardial cell.
1.1 using collect myocardial cell total serum IgE as template, with miR-19b specific mirVana qRT-PCR primer
(Ambion) amplification miR-19b gene.Use real-time TaqMan miRNA to analyze detection kit (ABI) and carry out quantitative PCR inspection
Survey the expression of intracellular miR-19b, use U6snRNA gene as the internal reference of detection.Operating principle and method in detail is shown in examination
Agent box description.
1.2, using the myocardial cell total serum IgE of collection as template, expand CTGF's by the PCR primer of CTGF gene specific
MRNA, uses real-time quantitative polymerase chain reaction (qRT-PCR) to detect intracellular CTGF mrna expression amount, uses GAPDH base
Because of as detection internal reference.The product of PCR carries out visualizing and quantitative analysis with the agarose gel electrophoresis of 1%.Operation in detail is former
Reason and method are shown in test kit description.
2.Western-blott ing analyzes CTGF protein expression level in myocardial cell
2.1 carry out Western-biot detection CTGF expressing quantity to collect myocardial cell total protein.Equivalent is about
30 μ g total protein 10% polyacrylamide gel (Bio-Rad) carry out 200 volts, and after the electrophoresis of 2 hours, electricity goes to pvdf membrane
Upper (Millipore).
Close 1 hour under the bovine serum albumin room temperature condition of 2.25%.
2.3 add specific CTGF (1: 500 dilution, Santa Cruz) and GAPDH (1: 5000 dilution, Sigma)
One anti antibody, overnight incubation under the conditions of 4 DEG C.
2.4 wash 3 times by the PBS solution of the Tween-20 containing 1%, each 10 minutes.
2.5 add specificity resists for one anti-two, hatches 1 hour under room temperature condition.
2.6 wash 3 times by the PBS solution of the Tween-20 containing 1%, each 10 minutes.
2.7 add ECL fluorography liquid reagent (Thermo), with the photosensitive development of x ray film.
2.8 use ImageJ software to carry out the gray scale quantitative analysis of image strip.
Embodiment 4
MiRNA bindingsite assay
Utilization bioinformatics TargetScan program (Http:// www.targetscan.org) analyses and prediction miR-
The 3 '-UTR binding sites of 19b Yu CTGF mRNA.
Embodiment 5
Statistical procedures
All data are with mean ± standard deviationRepresent, compare between two samples and check with t, have with p < 0.05
Statistical significance.Each experiment is at least repeated 3 times.
Experimental example
According to the experimental technique in embodiment 2, by replacement pre-mir-19b (AM17100, Ambion) of the present invention, add
Enter in cultivated myocardial cell, experimental example as shown in table 1 and reference examples, measure CTGF protein expression in myocardial cell respectively
Amount, its result is as shown in table 1, wherein, each miR-19b sequence of the present invention is configured to the solution of 10ng/ml, at experimental example 7
To experimental example 46, the total amount of individual mixing miR-19b sequence solutions is 10 μ 1.
Concrete effect acquired by the present invention:
1., during angiotensin AngII inducing cardiomyocytes is Fibrotic, the expression of miR-19b substantially reduces；Blood
Angiotensin inhibitor telmisartan (Telmisartan) can maintain miR-19b expression with part blocks AngII effect
(Fig. 1).This result is pointed out: during myocardial fibrosis, and miR-19b expression will occur significantly to reduce；Block the external world to cause a disease
Factor effect can will effectively maintain the expression of miR-19b.In detection myocardial cell, the method for the expression of miR-19b can
Using the pointer as diagnosis myocardial fibrosis disease.
2., during angiotensin AngII inducing cardiomyocytes is Fibrotic, the expression of CTGF is substantially increased；With
Telmisartan blocks AngII effect can maintain the expression of CTGF.CTGF is either at mRNA level in-site or protein
Level all shows relatively uniform variation tendency (Fig. 2 and Fig. 3).This result shows: the expression of CTGF is increased and cardiac muscle fiber
Change disease and there is a certain degree of dependency.
3. bioinformatics result of study shows: the 3 ' noncoding regions (3 '-UTR) of CTGF mRNA there are specificity
MiR-19b inhibition binding site.Transfection miR-19b precursor (pre-miR-19b) can substantially increase miR-in myocardial cell
The expression of 19b.(Fig. 4).This result shows: change possibly through the expression of miR-19b in regulating cell
The expression of CTGF.
4. can substantially reduce cardiac muscle by the expression of miR-19b in transfection pre-miR-19b increase myocardial cell
The expression of intracellular CTGF.(Fig. 5).
The most either at mRNA level in-site or protein level, the precursor pre-miR-19b of transfection miRNA-19b can
In reduction myocardial cell, the expression of CTGF, effectively suppresses the myocardial cell fibrosis induced by angiotensin AngII,
Eliminate the fibrosis impact on myocardial cell function to a certain extent, reach the effect (Fig. 6 and Fig. 7) for the treatment of.
6., in the myocardial cell cultivated under various different conditions, the expression of CTGF albumen is as shown in table 1, and result shows
The SEQ ID1 of the present invention, SEQ ID2, SEQ ID3, SEQ ID4, SEQ ID5 and SEQ ID6 all can suppress CTGF protein
Express, by human miRNAs-19b sequence SEQ ID1 or SEQ ID2, with non-human miRNAs-19b sequence SEQ ID3, SEQ
One (or more) in ID4, SEQ ID5 and SEQ ID6 mixes, and its inhibition becomes apparent from.
The expression (arbitrary unit) of CTGF albumen in each experimental example of table 1. and reference examples
Claims (4)
1.miRNA application in the medicine of preparation treatment or diagnosis myocardial fibrosis disease, it is characterised in that described miRNA
It is miRNA-19b,
Described miRNA sequence is SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:
Two or more in 5 or SEQ ID NO:6,
Wherein, different human miRNAs-19b sequences is mixed application with non-human miRNAs-19b, i.e.
By human miRNAs-19b sequence SEQ ID NO:1 or SEQ ID NO:2, with non-human miRNAs-19b sequence SEQ ID
One or more in NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6 mix.
Application the most according to claim 1, wherein,
In described mixing miRNA-19b sequence, described human miRNAs-19b sequence SEQ ID NO:1 or SEQ ID NO:2
Content ratio be 10%～90%.
Application the most according to claim 1, wherein,
In described mixing miRNA-19b sequence, described human miRNAs-19b sequence SEQ ID NO:1 or SEQ ID NO:2
Content ratio be 30%～70%.
4. treatment or the pharmaceutical composition of diagnosis myocardial fibrosis disease, it is characterised in that containing pharmaceutically acceptable carrier
With the miRNA sequence SEQ ID NO:1 of effective dose, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:
Two or more in 5 or SEQ ID NO:6, wherein, by human miRNAs-19b sequence SEQ ID NO:1 or SEQ ID NO:2, with
One in non-human miRNAs-19b sequence SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6
Or multiple mix.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410196658.4A CN104031987B (en) | 2014-05-12 | 2014-05-12 | MiRNA application in myocardial fibrosis disease treatment |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410196658.4A CN104031987B (en) | 2014-05-12 | 2014-05-12 | MiRNA application in myocardial fibrosis disease treatment |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104031987A CN104031987A (en) | 2014-09-10 |
| CN104031987B true CN104031987B (en) | 2016-08-31 |
Family
ID=51462981
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410196658.4A Active CN104031987B (en) | 2014-05-12 | 2014-05-12 | MiRNA application in myocardial fibrosis disease treatment |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104031987B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110556158B (en) * | 2019-08-30 | 2022-02-15 | 山西农业大学 | Screening method of anti-myocardial fibrosis drug |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101213213A (en) * | 2005-05-05 | 2008-07-02 | 菲布罗根公司 | Cardiovascular disease therapies |
| CN101400361A (en) * | 2006-01-05 | 2009-04-01 | 俄亥俄州立大学研究基金会 | Microrna-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer |
| CN102115787A (en) * | 2010-11-22 | 2011-07-06 | 中国科学院动物研究所 | MicroRNA (Ribose Nucleic Acid) and application of antisensenucleic acid of microRNA to diagnosis, prevention, treatment and/or prognostic evaluation of heart disease |
| CN102851291A (en) * | 2006-04-03 | 2013-01-02 | 桑塔里斯制药公司 | Pharmaceutical composition comprising anti-mirna antisense oligonucleotides |
| WO2013020044A1 (en) * | 2011-08-03 | 2013-02-07 | The Charlotte-Mecklenburg Hospital Authority D/B/A Carolinas Medical Center | Treatment of fibrosis using microrna-19b |
| CN103316347A (en) * | 2013-06-27 | 2013-09-25 | 上海中医药大学附属岳阳中西医结合医院 | Application of micro nucleotide and antagonist or simulator thereof in preparation of medicines for preventing myocardial damage and fibrosis |
| CN103370424A (en) * | 2010-12-15 | 2013-10-23 | 米拉根医疗公司 | Blood-borne miRNA as surrogate markers of drug efficacy for cardiac conditions |
-
2014
- 2014-05-12 CN CN201410196658.4A patent/CN104031987B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101213213A (en) * | 2005-05-05 | 2008-07-02 | 菲布罗根公司 | Cardiovascular disease therapies |
| CN101400361A (en) * | 2006-01-05 | 2009-04-01 | 俄亥俄州立大学研究基金会 | Microrna-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer |
| CN102851291A (en) * | 2006-04-03 | 2013-01-02 | 桑塔里斯制药公司 | Pharmaceutical composition comprising anti-mirna antisense oligonucleotides |
| CN102115787A (en) * | 2010-11-22 | 2011-07-06 | 中国科学院动物研究所 | MicroRNA (Ribose Nucleic Acid) and application of antisensenucleic acid of microRNA to diagnosis, prevention, treatment and/or prognostic evaluation of heart disease |
| CN103370424A (en) * | 2010-12-15 | 2013-10-23 | 米拉根医疗公司 | Blood-borne miRNA as surrogate markers of drug efficacy for cardiac conditions |
| WO2013020044A1 (en) * | 2011-08-03 | 2013-02-07 | The Charlotte-Mecklenburg Hospital Authority D/B/A Carolinas Medical Center | Treatment of fibrosis using microrna-19b |
| CN103316347A (en) * | 2013-06-27 | 2013-09-25 | 上海中医药大学附属岳阳中西医结合医院 | Application of micro nucleotide and antagonist or simulator thereof in preparation of medicines for preventing myocardial damage and fibrosis |
Non-Patent Citations (1)
| Title |
|---|
| miR-19b转基因小鼠的构建及表型分析;胡晓山等;《南京医科大学学报(自然科学版)》;20130531;第33卷(第5期);第584页左栏最后一段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104031987A (en) | 2014-09-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sayed et al. | MicroRNA-21 targets Sprouty2 and promotes cellular outgrowths | |
| CN102421917B (en) | Means and methods for counteracting, preventing and/or determining heart failure, or a risk of heart failure | |
| Wang et al. | MiR-195-5p promotes cardiomyocyte hypertrophy by targeting MFN2 and FBXW7 | |
| Sayed et al. | Circulating microRNAs: a potential role in diagnosis and prognosis of acute myocardial infarction | |
| Fulzele et al. | MicroRNA-146b-3p regulates retinal inflammation by suppressing adenosine deaminase-2 in diabetes | |
| CN101316935B (en) | Chip for esophagus cancer diagnosis | |
| CA3134991A1 (en) | Pharmaceutical composition for treating cancer comprising microrna as active ingredient | |
| Zhang et al. | MicroRNA-26 was decreased in rat cardiac hypertrophy model and may be a promising therapeutic target | |
| You et al. | HMGA1 is a new target of miR-195 involving isoprenaline-induced cardiomyocyte hypertrophy | |
| Evangelista et al. | miR-222 contributes to sex-dimorphic cardiac eNOS expression via ets-1 | |
| CN104548134A (en) | Application of miR-144 and inhibitor thereof | |
| CN103189511A (en) | Method for producing novel hiPSC by means of siRNA introduction | |
| Ali Sheikh et al. | Diagnostic, prognostic, and therapeutic value of circulating miRNAs in heart failure patients associated with oxidative stress | |
| Tanaka et al. | Tumor suppressive microRNA-138 inhibits metastatic potential via the targeting of focal adhesion kinase in Ewing's sarcoma cells | |
| CN103961706A (en) | Application of microRNA or inhibitor thereof to lipid metabolism regulation | |
| Fang et al. | miR-696 plays a role in hepatic gluconeogenesis in ob/ob mice by targeting PGC-1α | |
| Ren et al. | miR‑144 suppresses proliferation and induces apoptosis of osteosarcoma cells via direct regulation of mTOR expression | |
| Huang et al. | MicroRNA-208a potentiates angiotensin II-triggered cardiac myoblasts apoptosis via inhibiting nemo-like kinase (NLK) | |
| Sun et al. | LncRNA NEAT1 promotes cardiac hypertrophy through microRNA-19a-3p/SMYD2 axis. | |
| Wang et al. | hsa_circ0021347 as a potential target regulated by B7-H3 in modulating the malignant characteristics of osteosarcoma | |
| Shao et al. | MiR-133 inhibits kidney injury in rats with diabetic nephropathy via MAPK/ERK pathway. | |
| US20140045924A1 (en) | Melanoma treatments | |
| Ambrose et al. | Deregulation of microRNAs in blood and skeletal muscles of myotonic dystrophy type 1 patients | |
| Duan et al. | Effect of MicroRNA-766 promotes proliferation, chemoresistance, migration, and invasion of breast cancer cells | |
| CN102399870A (en) | Reagent for determining survival and prognosis of patients with esophagus cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |