CN113943792A - Application of reagent for detecting miRNA expression quantity in preparation of reagent or kit for diagnosing or prognosing Kazakh hypertension - Google Patents

Application of reagent for detecting miRNA expression quantity in preparation of reagent or kit for diagnosing or prognosing Kazakh hypertension Download PDF

Info

Publication number
CN113943792A
CN113943792A CN202111288617.4A CN202111288617A CN113943792A CN 113943792 A CN113943792 A CN 113943792A CN 202111288617 A CN202111288617 A CN 202111288617A CN 113943792 A CN113943792 A CN 113943792A
Authority
CN
China
Prior art keywords
mir
hsa
hypertension
reagent
mirna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202111288617.4A
Other languages
Chinese (zh)
Inventor
马克涛
李新芝
王彦
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shihezi University
Original Assignee
Shihezi University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shihezi University filed Critical Shihezi University
Priority to CN202111288617.4A priority Critical patent/CN113943792A/en
Publication of CN113943792A publication Critical patent/CN113943792A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Abstract

The invention provides an application of a reagent or a kit for detecting miRNA expression quantity in preparing a reagent or a kit for diagnosing or prognosing Kazakh hypertension, belonging to the technical field of molecular biological diagnosis; the miRNA comprises one or more of hsa-miR-100-5p, hsa-miR-299-3p, hsa-miR-196b-5p, hsa-miR-503-5p, hsa-miR-628-5p, hsa-miR-543, hsa-miR-150-5p, hsa-miR-296-5p, hsa-miR-874-3p and hsa-miR-940. The 11 miRNAs can be used as biomarkers for early diagnosis and prognosis evaluation of clinical Kazakh hypertension, and provide a new idea for drug targets of hypertension treatment.

Description

Application of reagent for detecting miRNA expression quantity in preparation of reagent or kit for diagnosing or prognosing Kazakh hypertension
Technical Field
The invention relates to the technical field of molecular biological diagnosis, in particular to application of a reagent for detecting miRNA expression quantity in preparation of a reagent or a kit for diagnosing or prognosing Kazakh hypertension.
Background
Hypertension is mainly characterized by arterial blood pressure rise, is frequently accompanied by diseases of target organs such as heart, blood vessels, brain, kidney and the like, and is a main risk factor of morbidity and mortality of most of cardiovascular and cerebrovascular diseases and kidney. Hypertension is the result of a combination of genetic and environmental factors. In recent years, scholars at home and abroad explore mechanisms of hypertension for a long time and develop and intervene in the occurrence and progress of hypertension from time to time, and although certain results are obtained, the mechanisms are not completely clarified.
With the research progress in the aspect of accurate medicine for hypertension, the research on the pathogenic mechanism of the gene molecule level also achieves certain results, and the research and development of the hypertension targeted drug are promoted. Among them, the role of micro RNA (miRNA) in the pathogenesis and treatment of hypertension becomes a new research hotspot. Studies have shown that T Cell-Derived miR-214 in mice can mediate pathological vascular Fibrosis in Hypertension by regulating T Cell recruitment and local pro-fibrotic cytokine release (Nosalski R, Siedlinski M, Denby L, et al.T-Cell-Derived miRNA-214 media Perivasca Fibrosis in Hypertension [ J ] C Res,2020,126(8): 988-.
Because the gene, diet, region and medical level of each ethnic group are different, the prevalence rate of hypertension is different among different ethnic groups. Therefore, the accuracy of biomarkers obtained from Han nationality as a subject for hypertension diagnosis in minority nationalities cannot be guaranteed.
Disclosure of Invention
The invention aims to provide application of a reagent for detecting miRNA expression quantity in preparation of a reagent or a kit for diagnosing or prognosing Kazakh hypertension.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides an application of a reagent for detecting miRNA expression quantity in preparing a reagent or a kit for diagnosing or prognosing Kazakh hypertension;
the miRNA comprises one or more of hsa-miR-100-5p, hsa-miR-299-3p, hsa-miR-196b-5p, hsa-miR-503-5p, hsa-miR-628-5p, hsa-miR-543, hsa-miR-150-5p, hsa-miR-296-5p, hsa-miR-874-3p and hsa-miR-940.
Preferably, the Kazakh hypertension comprises Kazakh essential hypertension.
Preferably, the hsa-miR-100-5p, hsa-miR-299-3p, hsa-miR-196b-5p, hsa-miR-503-5p, hsa-miR-628-5p and hsa-miR-543 expression is up-regulated relative to healthy individuals of the Kazakh family; the expression of hsa-miR-150-5p, hsa-miR-296-5p, hsa-miR-874-3p and hsa-miR-940 is reduced.
Preferably, the expression difference multiple of hsa-miR-100-5P, hsa-miR-299-3P, hsa-miR-196b-5P, hsa-miR-503-5P, hsa-miR-628-5P, hsa-miR-543, hsa-miR-150-5P, hsa-miR-296-5P, hsa-miR-874-3P or hsa-miR-940 is more than or equal to 1.5 and P is less than 0.05 relative to healthy individuals of Kazakh.
Preferably, the miRNA comprises one or more of hsa-miR-150-5p, hsa-miR-296-5p, hsa-miR-299-5p, hsa-miR-543, hsa-miR-196b-5p, hsa-miR-100-5p and hsa-miR-628-5 p.
Preferably, the reagent or the kit for detecting the expression amount of miRNA comprises a qRT-PCR detection reagent or a qRT-PCR kit.
Preferably, the detection sample of the reagent for detecting the expression level of miRNA comprises peripheral blood lymphocytes.
The invention provides an application of a reagent or a kit for detecting miRNA expression quantity in preparing a reagent or a kit for diagnosing or prognosing Kazakh hypertension; the miRNA comprises one or more of hsa-miR-100-5p, hsa-miR-299-3p, hsa-miR-196b-5p, hsa-miR-503-5p, hsa-miR-628-5p, hsa-miR-543, hsa-miR-150-5p, hsa-miR-296-5p, hsa-miR-874-3p and hsa-miR-940. The 11 miRNAs are differentially expressed in bodies of Kazakh hypertension patients and Kazakh healthy patients, and participate in differentially regulating and controlling the activity of a plurality of signal transduction pathways, so that the occurrence and development processes of hypertension are regulated and controlled. The 11 miRNAs provide a new idea for clinical biomarkers for early diagnosis and prognosis evaluation of hypertension and drug targets for hypertension treatment.
Drawings
FIG. 1 is a principal component analysis diagram of PCA, wherein Dim1 represents principal component 1; dim2 denotes principal component 2; normal: normal control; hyper tension: hypertension;
FIG. 2A is a heat map of miRNA's, wherein miRNA's are microRNAs representing different miRNA's expressed in lymphocytes of 6 hypertensive patients of the Kazakh family and 6 paired normotensive patients, and red and blue colors in the heat map represent up-regulation and down-regulation;
FIG. 2B is a volcano plot of miRNA, wherein miRNA is microRNA, indicating different miRNA expression in lymphocytes of Kazakh hypertensive patients and paired normotensive patients; red in the volcano indicates up-regulation and green indicates down-regulation;
FIG. 3 shows the results of miRNA GSEA analysis; wherein GSEA is gene set enrichment analysis; the peak in the line graph is the enrichment fraction of the gene set, and the gene before the peak is the core gene under the gene set;
FIG. 4 is a diagram of the interaction network of the target gene;
FIG. 5 is the KEGG analysis results; the abscissa position refers to the ratio of the number of genes positioned in the KEGG entry in the differentially expressed genes to the total number of transcripts positioned in the KEGG entry in all annotated genes, the color represents the P value of the pathway, and the size of the circle represents the number of the differential genes contained in the pathway; KEGG is Kyoto encyclopedia of genes and genomes;
fig. 6 is a miRNA-core gene-signal pathway control network, in which red nodes represent up-regulated mirnas, green nodes represent down-regulated mirnas, yellow nodes represent KEGG-enriched signal pathways, and purple nodes represent core genes;
FIG. 7 shows the validation of differential miRNA by qRT-PCR, which is a real-time fluorescent quantitation-polymerase chain reaction.
Detailed Description
The invention provides an application of a reagent for detecting miRNA expression quantity in preparing a reagent or a kit for diagnosing or prognosing Kazakh hypertension;
the miRNA comprises one or more of hsa-miR-100-5p, hsa-miR-299-3p, hsa-miR-196b-5p, hsa-miR-503-5p, hsa-miR-628-5p, hsa-miR-543, hsa-miR-150-5p, hsa-miR-296-5p, hsa-miR-874-3p and hsa-miR-940; the nucleotide sequences of hsa-miR-100-5p, hsa-miR-299-3p, hsa-miR-196b-5p, hsa-miR-503-5p, hsa-miR-628-5p, hsa-miR-543, hsa-miR-150-5p, hsa-miR-296-5p, hsa-miR-874-3p and hsa-miR-940 are shown in Table 1.
TABLE 1 nucleotide sequences of miRNA
miRNA Nucleotide sequence
hsa-miR-100-5p aacccguagauccgaacuugug is shown as SEQ ID NO. 1
hsa-miR-299-5p ugguuuaccgucccacauacau is shown as SEQ ID NO. 2
hsa-miR-299-3p uaugugggaugguaaaccgcuu is shown as SEQ ID NO. 3
hsa-miR-196b-5p uagguaguuuccuguuguuggg is shown in SEQ ID NO. 4
hsa-miR-503-5p uagcagcgggaacaguucugcag is shown as SEQ ID NO. 5
hsa-miR-628-5p augcugacauauuuacuagagg is shown as SEQ ID NO. 6
hsa-miR-543 aaacauucgcggugcacuucuu is shown as SEQ ID NO. 7
hsa-miR-150-5p ucucccaacccuuguaccagug is shown as SEQ ID NO. 8
hsa-miR-296-5p agggcccccccucaauccugu is shown as SEQ ID NO. 9
hsa-miR-874-3p cugcccuggcccgagggaccga is shown as SEQ ID NO. 10
hsa-miR-940 aaggcagggcccccgcucccc is shown in SEQ ID NO. 11
In the present invention, the Kazakh hypertension preferably includes Kazakh essential hypertension.
In the invention, the expression of hsa-miR-100-5p, hsa-miR-299-3p, hsa-miR-196b-5p, hsa-miR-503-5p, hsa-miR-628-5p and hsa-miR-543 is up-regulated relative to healthy individuals of the Kazakh family; the expression of hsa-miR-150-5p, hsa-miR-296-5p, hsa-miR-874-3p and hsa-miR-940 is reduced.
In the invention, compared with healthy individuals of Kazakh, the expression quantity difference multiple of hsa-miR-100-5P, hsa-miR-299-3P, hsa-miR-196b-5P, hsa-miR-503-5P, hsa-miR-628-5P, hsa-miR-543, hsa-miR-150-5P, hsa-miR-296-5P, hsa-miR-874-3P and hsa-miR-940 is more than or equal to 1.5 and P is less than 0.05 in a Kazakh hypertensive patient.
In the invention, the miRNA preferably comprises one or more of hsa-miR-150-5p, hsa-miR-296-5p, hsa-miR-299-5p, hsa-miR-543, hsa-miR-196b-5p, hsa-miR-100-5p and hsa-miR-628-5p, and compared with the single miRNA, the combined miRNA can improve the sensitivity and specificity of diagnosis.
In the present invention, the detection sample of the reagent for detecting an expression level of miRNA preferably includes peripheral blood lymphocytes, and more preferably total RNA derived from peripheral blood lymphocytes.
In the invention, the reagent or the kit for detecting the miRNA expression level comprises a qRT-PCR detection reagent or a kit, the qRT-PCR detection reagent or the kit comprises a primer group for detecting the expression level of hsa-miR-100-5p, hsa-miR-299-3p, hsa-miR-196b-5p, hsa-miR-503-5p, hsa-miR-628-5p, hsa-miR-543, hsa-miR-150-5p, hsa-miR-296-5p, hsa-miR-874-3p and hsa-miR-940, and the nucleotide sequence of the primer group is shown in Table 2. Reaction system: by using
Figure BDA0003333795550000051
Premix Ex TaqTMII (Tli RNaseH plus), the experimental procedures were performed according to the product instructions, and the specific system is shown in Table 3. The reaction conditions are as follows: pre-denaturation at 95 ℃ for 30 s; 95 ℃ 5s → 60 ℃ 34s, 40 cycles; the dissolution curves were 95 ℃ 10sec, 60 ℃ 1min, 95 ℃ 15sec, 60 ℃ 15 sec.
TABLE 2 primer sequences for miRNA
Figure BDA0003333795550000052
Figure BDA0003333795550000061
TABLE 3 reaction System
Figure BDA0003333795550000062
The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. It is to be understood that the described embodiments are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1
The research screens differential miRNA and enrichment signal paths based on a bioinformatics method, combines a plurality of databases to predict target genes, observes miRNA expression profiles of Xinjiang Kazak essential hypertension patients, and the obtained results suggest that 11 miRNAs have differential expression in the bodies of Kazak essential hypertension patients and Kazak healthy patients, and identifies the targets of the miRNAs, so that the deep understanding of the interaction relationship between miRNA-mRNA is a key point for clarifying the action mechanism of miRNA, and further research is needed.
1 data and method
1.1 clinical data 30 Kazakh essential hypertension patients in department of cardiology, department of residence and outpatient clinic of the first subsidiary hospital of Xinjiang rock river university medical school of 4-2019, 5-month Xinjiang rock river, 2016, were used as the observation group, and 30 Kazakh healthy patients were used as the control group. The blood pressure of the study subject was measured according to the standard measurement method established in the guideline for prevention and treatment of hypertension of china 2018, and the average of the two measurement results was taken as the final blood pressure value.
Wherein the hypertension diagnosis and grading standard is as follows: systolic Blood Pressure (SBP) is not less than 140mmHg (1mmHg ═ 0.133kPa) and/or Diastolic Blood Pressure (DBP) is not less than 90mmHg without antihypertensive, normal blood pressure value: SBP 120-139 mmHg and/or DBP 80-89 mmHg; inclusion criteria were: the age is more than or equal to 38 years old, and the patient is diagnosed with primary hypertension for the first time or is stopped taking antihypertensive drugs for more than or equal to 2 weeks by inquiring medical history before admission; the history of hypertension and the history of antihypertensive treatment do not exist.
Exclusion criteria: secondary hypertension, serious cardiovascular and cerebrovascular diseases, excessive drinking history, rheumatic diseases, inflammatory bowel diseases, chronic obstructive pulmonary diseases, hepatic and renal insufficiency, patients who have a recent history of operation or trauma or have multi-organ function failure and malignant tumor, patients with acute and chronic infectious diseases, patients who have a recent contraceptive or other drug-induced diseases possibly affecting blood pressure, patients with white coat hypertension, patients with mental diseases and cognitive dysfunction, and patients with diabetes or abnormal sugar tolerance.
All subjects signed informed consent.
1.2 sample Collection
5ml of fresh peripheral blood of 6 cases of Kazakh essential hypertension patients and healthy patients are randomly extracted by adopting an EDTA anticoagulant blood collection tube, and the fresh peripheral blood is slightly reversed and mixed left and right. Then separating peripheral blood lymphocytes by adopting a Ficoll-Hypaque density gradient centrifugation method, adding a Trizol reagent into the separated peripheral blood lymphocytes, and storing the obtained mixture in a refrigerator at the temperature of-80 ℃ for later use.
1.3 extraction and quality detection of Total RNA from peripheral blood lymphocytes
Extracting total RNA of a cell sample by adopting a Trizol method, quantifying by using a spectrophotometer, and detecting the quality of the total RNA by using formaldehyde denatured gel electrophoresis. Using mirVanaTMThe total RNA was purified by miRNA Isolation Kit (AM1561) and then re-quantified.
1.4 Gene chip for detecting miRNA expression profile difference in different samples
Total RNA was subjected to Poly (A) tailing, and biotin-labeled signal molecules were ligated to total RNA according to the instructions of the biomarker Kit (miRNA Complete Labeling and Hyb Kit). At room temperature, 81.7. mu.L of the hybridization solution was mixed with the total RNA sample labeled with biotin, treated according to the instructions, added to the miRNA chip, and hybridized for 16h at constant temperature (48 ℃) in a hybridization oven. After the hybridization solution is removed, the chip is washed by adding a buffer solution, and after the chip is dried, scanning is carried out (Wuguang, Tianyingjie, Yingchun, and the like. difference analysis of hypertension risk factors of Mongolian and Han nationality residents in inner Mongolia part region [ J ]. China cardiovascular journal 2020,25(04): 361-. The samples were subjected to principal component analysis using the "factextra" R package to detect the reproducibility of the samples and the variability between different groups. Screening differential expression miRNA related to hypertension in two groups of chips by using a 'Limma' R package, wherein the screening standard is as follows: the difference multiple is more than 1.5 times, and P is less than 0.05, and visualization processing is carried out by using 'pheatmap', so that the drawing of the heat map and volcano map of the difference gene is completed.
1.5 GSEA enrichment analysis of differential miRNAs
GSEA Enrichment Analysis (Gene Set Analysis) can evaluate the distribution trend of genes in a predefined Gene Set in a Gene table ordered with phenotype relevance, and miRNA related to functions can be screened out through the GSEA Enrichment Analysis. The miEAA (https:// ccb-computer 2.cs. uni-sarland. de/miEAA2/) online database is used for enriching the diseases of differential expression miRNA, and miRNA related to hypertension is obtained as target miRNA.
1.6 target Gene prediction of target MiRNAs
MiRwalk (http:// miRwalk. umm. uni-heidelberg. de /), miRanda (http:// www.microrna.org/microrna/home. do), TargetScanHuman (http:// www.targetscan.org) and mirDB (http:// miRDB. org) online databases predict and screen target genes of target miRNAs. And taking intersection of the target genes predicted in the online databases of miRwalk, mirranda, targetScanHuman and mirDB as candidate target genes. Uploading the predicted miRNA target genes to a string database (https:// string-db.org /), and predicting the interaction relation among the target genes.
1.7 bioinformatic analysis of candidate target genes
And (3) carrying out KEGG channel enrichment analysis on the target gene of the target miRNA by utilizing an omicshare platform (https:// www.omicshare.com /). KEGG can simply and clearly describe various metabolic pathways and relations, screen signal paths related to hypertension, and analyze and make a visual map by using cytoscape software.
1.8qRT-PCR validation of candidate miRNA expression levels
The study uses a qRT-PCR method to verify 7 candidate miRNAs (hsa-miR-100-5p, hsa-miR-299-5p, hsa-miR-196b-5p, hsa-miR-628-5p, hsa-miR-543, hsa-miR-150-5p and hsa-miR-296-5 p). According to the qRT-PCR reverse transcription kit instruction, 3.75. mu.l of total RNA is sucked into a clean 200. mu.l centrifuge tube, 5. mu.l of 2 XmRQ Buffer and 1.25. mu.l of mRQ Enzyme are respectively added, the temperature is 37 ℃ for 1H, the temperature is 85 ℃ for 5min, and then 90. mu.l of dd H is added2O to a total volume of 100. mu.l. By using
Figure BDA0003333795550000081
Premix Ex TaqTMII (Tli RNaseH plus), the experimental procedures were performed according to the instructions of the product using ABI 7900HT type fluorescent quantitative PCR instrument with 2-△△CTMethod for relative quantification of dataAnalyzing and detecting miRNA expression in lymphocytes. The detection primers were synthesized by Tiangen Biochemical technology. The primer sequences of hsa-miR-100-5p, hsa-miR-299-5p, hsa-miR-196b-5p, hsa-miR-628-5p, hsa-miR-543, hsa-miR-150-5p and hsa-miR-296-5p are shown in Table 2.
1.9 statistical treatment
Analyzing the hybridization pictures by using Agilent Feature Extraction (v10.7) software and extracting data; the data were then normalized using Agilent GeneSpring software. All statistical analyses were performed using SPSS21.0 software and graphpadprism8.0.2 software, with a P value <0.05 indicating statistical significance.
2 results
2.1 general clinical information
The gender, mean age, Body Mass Index (BMI), smoking history, drinking history, fasting plasma glucose, total cholesterol, triacylglycerols, high density lipoprotein cholesterol (HDL-C) and low density lipoprotein cholesterol (LDL-C) levels in both groups were not significantly different (P >0.05) between the hypertension group of the Kazakh group and the normal control group of the Kazakh group. There was a significant difference in systolic and diastolic blood pressure compared to the control group (P <0.05, table 4).
TABLE 4 general clinical information
Figure BDA0003333795550000091
Figure BDA0003333795550000092
Figure BDA0003333795550000101
Note: BMI: a body mass index; HDL-C: high density lipoprotein cholesterol; LDL-C: low density lipoprotein cholesterol; compared with the normal control group,aP<0.05。
2.2PCA principal Components analysis
By performing PCA analysis on the samples, the data may be reduced in dimension to extract some common portions, which are then analyzed and processed. The result shows that the accumulated contribution rate of the first two main components reaches 97.6 percent, and the other main component can be omitted, so that the purpose of reducing the dimension is achieved. As can be seen from FIG. 1, the PCA plot can represent the difference between the two sets of data well, and the difference between the two sets of samples is significant.
2.3 differential expression analysis of miRNA
As shown in FIG. 2A and FIG. 2B, the difference analysis of miRNA is carried out by using a Limma software package written in R language, the difference screening standard is that the difference multiple is more than or equal to 1.5, and P is less than 0.05. Compared with the normal blood pressure patients of the Kazakh family, the peripheral blood lymphocytes of the hypertension patients of the Kazakh family have 73 differential expression miRNAs, wherein the expression of 39 miRNAs is up-regulated, and hsa-miR-3907 is up-regulated by 12.5 times; the expression of 34 miRNAs is reduced, and hsa-miR-4299 is reduced by 2.1 times.
2.4 prediction of target miRNA
145 miRNA-related diseases are obtained in total through GSEA enrichment analysis, wherein 11 miRNA related to hypertension are hsa-miR-100-5p, hsa-miR-150-5p, hsa-miR-299-3p, hsa-miR-296-5p, hsa-miR-196b-5p, hsa-miR-503-5p, hsa-miR-628-5p, hsa-miR-874-3p, hsa-miR-543, hsa-miR-940, hsa-miR-100-5p, hsa-miR-299-5p, hsa-miR-3 p, hsa-miR-196b-5p, hsa-miR-503-5p, hsa-miR-100-5p, hsa-miR-299-5p, hsa-miR-503-5p, The expression of hsa-miR-628-5p and hsa-miR-543 is up-regulated, and the expression of hsa-miR-150-5p, hsa-miR-296-5p, hsa-miR-874-3p and hsa-miR-940 is down-regulated. These 11 mirnas were used as target mirnas for subsequent analysis (figure 3).
2.5 prediction of miRNA target genes
And predicting a target gene of the target miRNA by using the miRwalk, the mirranda, the targetScanHuman and the mirDB databases, screening the obtained target gene and taking intersection. A total of 1647 target genes were predicted from 11 mirnas. By constructing a Protein-Protein interaction network (PPInetwork, Protein-Protein interaction network) among target genes, total 1640 proteins are incorporated into the interaction network, and a complex network containing 1640 nodes and 9131 pairs of correlation relationships is formed. And (3) importing the prediction result of the string database into cytoscape software, and analyzing the node connectivity (degree) to obtain 1601 core genes with interaction relation (figure 4).
2.6 KEGG enrichment analysis of differential genes
And performing KEGG channel enrichment analysis and visual display on 1601 core genes by using an omicshare platform (https:// www.omicshare.com /). The results of KEGG enrichment analysis (figure 5) show that important signal pathways such as a p53 signal pathway, adrenergic signals in cardiac muscle cells, a cAMP signal pathway, calcium reabsorption regulated by endocrine and other factors, an mTOR signal pathway, sodium reabsorption regulated by aldosterone, a TGF-beta signal pathway and the like responding to hypertension are remarkably enriched, and the important signal pathways have interaction and can synergistically influence the generation and development of hypertension. 96 core genes related to the screening signal pathway are extracted (table 5), and miRNA-core gene-signal pathway interaction networks are constructed by using cytoscape software in combination with miRNA and core gene interaction data (figure 6).
TABLE 5 core Gene List
Figure BDA0003333795550000111
Figure BDA0003333795550000121
2.7qRT-PCR validation of differential miRNAs
From the 11 target mirnas, 7 mirnas were randomly selected for validation (fig. 7). The results of qRT-PCR amplification show that the expression of hsa-miR-150-5p, hsa-miR-296-5p is reduced, the expression of hsa-miR-299-5p, hsa-miR-543, hsa-miR-196b-5p, hsa-miR-100-5p and hsa-miR-628-5p is increased, and the results are consistent with the results of high-throughput sequencing analysis. The primer sequences of hsa-miR-100-5p, hsa-miR-299-5p, hsa-miR-196b-5p, hsa-miR-628-5p, hsa-miR-543, hsa-miR-150-5p and hsa-miR-296-5p are shown in Table 6.
TABLE 6 primer sequences for miRNA
miRNA Primer sequences Multiple of difference
hsa-miR-100-5p aacccguagauccgaacuugug 3.94
hsa-miR-299-5p ugguuuaccgucccacauacau 9.97
hsa-miR-196b-5p uagguaguuuccuguuguuggg 3.77
hsa-miR-628-5p augcugacauauuuacuagagg 3.37
hsa-miR-543 aaacauucgcggugcacuucuu 8.39
hsa-miR-150-5p ucucccaacccuuguaccagug 1.58
hsa-miR-296-5p agggcccccccucaauccugu 1.70
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Claims (7)

1. The application of the reagent for detecting the miRNA expression quantity in the preparation of a reagent or a kit for diagnosing or prognosing Kazakh hypertension;
the miRNA comprises one or more of hsa-miR-100-5p, hsa-miR-299-3p, hsa-miR-196b-5p, hsa-miR-503-5p, hsa-miR-628-5p, hsa-miR-543, hsa-miR-150-5p, hsa-miR-296-5p, hsa-miR-874-3p and hsa-miR-940.
2. The use of claim 1, wherein the Kazakh hypertension comprises Kazakh essential hypertension.
3. The use of claim 1, wherein hsa-miR-100-5p, hsa-miR-299-3p, hsa-miR-196b-5p, hsa-miR-503-5p, hsa-miR-628-5p, and hsa-miR-543 expression is up-regulated relative to healthy individuals of the saxaka family; the expression of hsa-miR-150-5p, hsa-miR-296-5p, hsa-miR-874-3p and hsa-miR-940 is reduced.
4. The use according to claim 3, wherein the expression of hsa-miR-100-5P, hsa-miR-299-3P, hsa-miR-196b-5P, hsa-miR-503-5P, hsa-miR-628-5P, hsa-miR-543, hsa-miR-150-5P, hsa-miR-296-5P, hsa-miR-874-3P or hsa-miR-940 is at least 1.5 fold different from that of a healthy individual of the Kazakh family, and P is < 0.05.
5. The use of any one of claims 1, 3 and 4, wherein the miRNA comprises one or more of hsa-miR-150-5p, hsa-miR-296-5p, hsa-miR-299-5p, hsa-miR-543, hsa-miR-196b-5p, hsa-miR-100-5p and hsa-miR-628-5 p.
6. The use of claim 1, wherein the reagent or kit for detecting the expression level of miRNA comprises qRT-PCR detection reagent or qRT-PCR kit.
7. The use according to claim 1, wherein the test sample of the reagent for detecting the expression level of miRNA comprises peripheral blood lymphocytes.
CN202111288617.4A 2021-11-02 2021-11-02 Application of reagent for detecting miRNA expression quantity in preparation of reagent or kit for diagnosing or prognosing Kazakh hypertension Pending CN113943792A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111288617.4A CN113943792A (en) 2021-11-02 2021-11-02 Application of reagent for detecting miRNA expression quantity in preparation of reagent or kit for diagnosing or prognosing Kazakh hypertension

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111288617.4A CN113943792A (en) 2021-11-02 2021-11-02 Application of reagent for detecting miRNA expression quantity in preparation of reagent or kit for diagnosing or prognosing Kazakh hypertension

Publications (1)

Publication Number Publication Date
CN113943792A true CN113943792A (en) 2022-01-18

Family

ID=79337402

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111288617.4A Pending CN113943792A (en) 2021-11-02 2021-11-02 Application of reagent for detecting miRNA expression quantity in preparation of reagent or kit for diagnosing or prognosing Kazakh hypertension

Country Status (1)

Country Link
CN (1) CN113943792A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110144914A1 (en) * 2009-12-09 2011-06-16 Doug Harrington Biomarker assay for diagnosis and classification of cardiovascular disease
CN103370424A (en) * 2010-12-15 2013-10-23 米拉根医疗公司 Blood-borne miRNA as surrogate markers of drug efficacy for cardiac conditions
WO2020088704A1 (en) * 2018-10-31 2020-05-07 Univerzita Karlova, 3.Lekarska Fakulta Postpartum epigenetic profile of cardiovascular micrornas in women exposed to pregnancy-related complications
CN111705125A (en) * 2020-07-30 2020-09-25 武汉舒特尔生物科技有限公司 MiR-299-5p as noninvasive pulmonary hypertension diagnosis marker and detection kit

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110144914A1 (en) * 2009-12-09 2011-06-16 Doug Harrington Biomarker assay for diagnosis and classification of cardiovascular disease
CN103370424A (en) * 2010-12-15 2013-10-23 米拉根医疗公司 Blood-borne miRNA as surrogate markers of drug efficacy for cardiac conditions
US20140024700A1 (en) * 2010-12-15 2014-01-23 MiRagen Therapeutics, Inc. Blood-borne mirnas as surrogate markers of drug efficacy for cardiac conditions
WO2020088704A1 (en) * 2018-10-31 2020-05-07 Univerzita Karlova, 3.Lekarska Fakulta Postpartum epigenetic profile of cardiovascular micrornas in women exposed to pregnancy-related complications
CN111705125A (en) * 2020-07-30 2020-09-25 武汉舒特尔生物科技有限公司 MiR-299-5p as noninvasive pulmonary hypertension diagnosis marker and detection kit

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ILONA, HROMADNIKOVA等: "Gestational hypertension, preeclampsia and intrauterine growth restriction induce dysregulation of cardiovascular and cerebrovascular disease associated microRNAs in maternal whole peripheral blood.", THROMB RES ., vol. 137, 31 December 2016 (2016-12-31), pages 126 - 140, XP029385202, DOI: 10.1016/j.thromres.2015.11.032 *
张萍等: "OSAHS与心血管疾病的研究进展", 临床耳鼻咽喉头颈外科杂志, vol. 30, no. 06, 31 December 2016 (2016-12-31), pages 442 - 445 *

Similar Documents

Publication Publication Date Title
Ipson et al. Identifying exosome-derived MicroRNAs as candidate biomarkers of frailty
Gui et al. Serum microRNA characterization identifies miR-885-5p as a potential marker for detecting liver pathologies
CN108441552B (en) One kind serum/plasma miRNA marker relevant to intrahepatic cholestasis of pregnancy auxiliary diagnosis and its application
CN109295204B (en) Peripheral blood mononuclear cell annular RNAs for diagnosing coronary heart disease and related application
Backes et al. Blood born miRNAs signatures that can serve as disease specific biomarkers are not significantly affected by overall fitness and exercise
Zhang et al. Identification and validation of microRNAs as endogenous controls for quantitative polymerase chain reaction in plasma for stable coronary artery disease
Li et al. Comprehensive analyses of miRNA-mRNA network and potential drugs in idiopathic pulmonary arterial hypertension
CN111455044A (en) Exosome miRNA marker for early pregnancy diagnosis of ewes and application thereof
Zhuo et al. Plasma microRNAs can be a potential diagnostic biomarker for endometriosis
CN115418397B (en) Biomarker for auxiliary diagnosis of dilated cardiomyopathy and application thereof
CN110951870A (en) Application of miRNA expression quantity in predicting therapeutic effect of clopidogrel
CN113943792A (en) Application of reagent for detecting miRNA expression quantity in preparation of reagent or kit for diagnosing or prognosing Kazakh hypertension
CN112522391B (en) Application of hsa_circ_0008961 as gout diagnosis marker
CN112410414B (en) Application of pregnant woman serum exosome miRNA marker in preparation of early diagnosis product of fetal congenital heart disease and kit
CN112266955B (en) Ankylosing spondylitis diagnostic marker and application thereof
Zhong et al. Long non-coding RNA expression profiles in peripheral blood mononuclear cells of patients with coronary artery disease
CN111718988B (en) Application of long-chain non-coding RNA in plasma in coronary heart disease screening
CN108220423A (en) Acute myocardial infarction fast diagnosis reagent based on blood plasma miRNA and its application in diagnostic kit, appraisal procedure
Sambashivaiah et al. Detection of differentially expressed circulating micro-RNA among Indians with Type 2 Diabetes using a global expression profile and systematic analysis
CN110042161B (en) MicroRNA molecular marker for screening acute altitude stress susceptible and application thereof
CN107523641B (en) Serum miRNAs biomarkers and application thereof
CN111286532A (en) Application of circulating nucleic acid as marker of hypertension and coronary heart disease
KR102555309B1 (en) Method of providing information for diagnosing early progression of cervical cancer
CN111286531B (en) Application of circulating nucleic acid as marker of hypertension, diabetes and hyperlipidemia
CN108220427B (en) Plasma microRNA marker for differential diagnosis of BHD syndrome and primary spontaneous pneumothorax and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination