WO2016177776A1

WO2016177776A1 - Biomarkers for the detection of aspirin insensitivity

Info

Publication number: WO2016177776A1
Application number: PCT/EP2016/059991
Authority: WO
Inventors: Sara Johanna Pinto-Sietsma; Esther Elisa Johanna Maria Creemers; Josephus Cornelis Maria Meijers; Maayke Guda Maria KOK
Original assignee: Academisch Medisch Centrum
Priority date: 2015-05-04
Filing date: 2016-05-04
Publication date: 2016-11-10
Also published as: EP3292213A1

Abstract

The invention provides a method for determining whether a patient is sensitive or insensitive to a treatment with a thromboxane A2 inhibitor or a selective COX-1 inhibitor for use in a platelet inhibition treatment comprising the steps of: a. determining the expression level of one or more mi RNA(s) selected from the group consisting of miR-19b-1-5p, miR-1271, and miR-1537-5p, in a sample comprising platelet derived nucleic acids, b. comparing said expression level with a reference level, and c. determining the sensitivity or insensitivity of said subject for a treatment with said thromboxane A2 inhibitor or said selective COX-1 inhibitor based on the information obtained in step b.

Description

BIOMARKERS FOR THE DETECTION OF ASPIRIN INSENSITIVITY

TECHNICAL FIELD

The present invention relates to the field of diagnostics. In particular, the invention relates to a method for determining whether a patient is insensitive to a treatment with aspirin for use in a platelet inhibition treatment.

BACKGROUND

As used in this patent application the terms "anti-platelet" and "platelet inhibiting" shall mean any inhibition of platelet activation and/or platelet aggregation and/or platelet adhesion.

Platelet activation, aggregation and/or adhesion are believed to play significant roles in the pathogenesis of many vaso-occlusive disorders such as unstable angina, acute myocardial infarction, reocclusion of vessels following balloon angioplasty, transient ischemic attacks and strokes. Generally speaking, when a blood vessel becomes damaged, chemical agonists bind with certain binding sites on circulating platelets, causing the platelets to become activated. The types of blood vessel wall damage that can trigger platelet activation include perforation or injury to the vessel wall, progression of atherosclerotic plaque, the performance of some interventional procedure (e.g., angioplasty, atherectomy or stenting), which stretches the vessel wall or causes intimal tearing, or other causes. When activated, platelets interact with fibrinogen, fibronectin and other clotting factors causing them to adhere to the affected blood vessel wall and to aggregate with one another and with other blood cells (e.g., leukocytes). This activation, adherence and aggregation of platelets leads to the formation of a thrombus or blood clot.

Aspirin is the most commonly prescribed platelet inhibitor for secondary prevention after a cardiovascular event, but other thromboxane A2 inhibitors or a selective COX-1 inhibitors could also be used. It is known that long-term treatment with aspirin significantly reduces the risk of myocardial infarction (Ml), stroke and vascular death. However, 10 to 20% of treated patients develop recurrent vascular events. A relatively high incidence of recurrent events is due to insensitivity to aspirin treatment. Indeed, it is known that there are large inter-individual differences in aspirin response and in some individuals platelet function is not decreased by aspirin treatment. Being able to predict which patients respond insufficiently to aspirin therapy and therefore are more prone to develop recurrent events, would be an important step in ongoing efforts to develop more personalized secondary prevention schemes. Currently, there are few options available to detect aspirin insensitivity in patients. Although different groups have found associations between gene polymorphisms involved in platelet function and aspirin insensitivity (Li X et al., Clin Appl Thromb Hemost [Internet], 2013 [cited 2014 Apr 10];19:513-21 and Papp E et al., Ann Pharmacother [Internet], 2005 [cited 2014 Apr 10];39:1013-8), these findings must be interpreted with caution, because of small sample sizes and differences in ethnic origin of the studied populations (Weng Z et al., PLoS One [Internet], 2013 [cited 2014 Apr 10];8:e78093). Therefore, these polymorphisms are unlikely to be suitable for the identification of subjects susceptible to aspirin insensitivity in a general population. Also platelet function tests fail to correctly measure the antiplatelet effect of aspirin. Comparison of six different platelet function tests revealed that these assays are only moderately concordant and that, based on established cut-off values, the prevalence of aspirin insensitivity varied according to the platelet function test that was used (Lordkipanidze M et al. Eur Heart J

[Internet]. 2007 [cited 2014 Apr 10];28:1702-8). Therefore, there is a need in the art for reliable biomarkers which determine or predict insensitivity to treatment with a thromboxane A2 inhibitor or a selective COX-1 inhibitor, in particular of aspirin. Other objects of the present invention are to provide a kit for diagnosing or monitoring insensitivity treatment with a thromboxane A2 inhibitor or a selective COX-1 inhibitor, in particular of aspirin based upon the miRNA levels according to the invention, and to use said miRNA levels in the diagnosis of insensitivity to treatment with a thromboxane A2 inhibitor or a selective COX-1 inhibitor.

SUMMARY

The invention is based on the surprising finding that in healthy individuals, lower expression of miR- 19b-l-5p after aspirin use is associated with the insensitivity of platelets for aspirin.

The inventors demonstrated that in vivo miRNA expression in isolated platelets, and in particular the expression of miR-19b-l-5p, shows a heterogeneous response to medication use in healthy individuals. The inventors showed that lower miR-19b-l-5p expression after aspirin use is associated with platelet insensitivity to indomethacin in vitro.

Multiple studies have focused on possible explanations and diagnostic tools for aspirin insensitivity. By analysing the correlation between platelet aggregation data and miRNA expression, the inventors avoided the choice of a cut-off value. The inventors showed that miR-19b-l-5p is a suitable marker to determine which patients show a decreased reduction in platelet function after aspirin use and might therefore be more prone to develop recurrent events.

The extent of reduction of platelet aggregation was significantly correlated with changes in platelet miR-19b-l-5p expression. Since the time between the baseline miRNA expression measurement and measurement of miRNA expression after two weeks of aspirin use was exactly the same for all individuals, the inventors concluded that this is an aspirin-induced correlation. Thus, lower miR-19b- l-5p expression in platelets after aspirin use is associated with aspirin insensitivity and is therefore a suitable marker for the identification of patients that are less sensitive to aspirin treatment and prone to re-events. The inventors have also identified further miRNAs which are correlated with insensitivity for aspirin treatment.

It is an object of the invention to provide a reliable method for determining whether a patient is insensitive to treatment with a thromboxane A2 inhibitor or a selective COX-1 inhibitor for use in a platelet inhibition treatment. Other objects of the present invention are to provide a kit for diagnosing or monitoring insensitivity of a patient for the treatment with thromboxane A2 inhibitor or a selective COX-1 inhibitor based upon the miRNA levels according to the invention, and to use said miRNA levels in the diagnosis of insensitivity to treatment with thromboxane A2 inhibitor or a selective COX-1 inhibitor.

These objects are solved by the subject matter of the attached claims.

The invention provides a method for determining whether a patient is insensitive to a treatment with a thromboxane A2 inhibitor or a selective COX-1 inhibitor for use in a platelet inhibition treatment comprising the steps of determining the expression level of one or more miRNA(s) selected from the group consisting of miR-19b-l-5p, miR-1271, and miR-1537-5p, in a sample comprising platelet derived nucleic acids; comparing said expression level with a reference level, and determining the aspirin insensitivity of said subject based on the information obtained in the previous step. In a preferred embodiment, upregulation of said miRNA is indicative for insensitivity to treatment with a a thromboxane A2 inhibitor or a selective COX-1 inhibitor.

In a preferred embodiment, upregulation of said miRNA is indicative for insensitivity to treatment with said thromboxane A2 inhibitor or said selective COX-1 inhibitor.

Preferably, said thromboxane A2 inhibitor or a selective COX-1 inhibitor is selected from the group consisting of aspirin and indomethacin.

In a preferred embodiment, the method according to the invention comprises the step of determining the expression level of said miRNA in a sample before, during and/or after treatment with said thromboxane A2 inhibitor or said selective COX-1 inhibitor.

Preferably, the method of the invention comprises the step of determining the expression level of said miRNA in a sample after at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 , 13 or 14 days after the first doses of said thromboxane A2 inhibitor or said selective COX-1 inhibitor treatment.

Preferably, said one or more miRNA(s) comprises miR-19b-l-5p.

Preferably, said sample comprises a platelet sample.

In a preferred embodiment, said expression level of said miRNA is normalized using one or more reference miRNAs. Preferably, said one or more reference miRNAs is selected from the group consisting of consisting of miR-151-3p, miR-28-5p, miR-331-3p, miR-29c, miR-148b-3p and miR-18a. Preferably, the detecting said one or more miRNA(s) is performed by reverse amplification of said miRNA and real time detection of amplified products. The invention further provides a kit for diagnosing or monitoring aspirin insensitivity comprising a nucleic acid capable of hybridizing under stringent conditions with miR-19b-l-5p, miR-1271, and miR- 1537-5p. Preferably, said kit further comprises one or more reference miRNAs selected from the group consisting of miR-151-3p, miR-28-5p, miR-331-3p, miR-29c, miR-148b-3p and miR-18a.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the inter-individual heterogeneity of medication-induced changes in miRNA microarray expression.

For each individual and for each miRNA the difference in log2 expression after and before medication use was calculated. A) Standard deviation of the resulting changes in miRNA expression across all 468 detected miRNAs showed large inter-individual heterogeneity, B) Bland-Altman plot of the change in expression versus the average expression for each miRNA in the individual with highest overall standard deviation (rightmost symbol in panel A), C) Bland-Altman plot of the change in expression versus the average expression for each miRNA in the individual with lowest overall standard deviation (leftmost symbol in panel A)

Figure 2 shows the correlation between the in vivo changes in miRNA expression after aspirin use and in vitro platelet aggregation after indomethacin incubation. Correlation between the change in A) miR-19b-l-5p expression, B) miR-1537-5p expression and C) miR-1271 expression (log fold change of normalised RT-PCR expression after and before medication use) and the sensitivity of the platelets to aspirin as measured by the reduction in platelet aggregation.

Figure 3 shows that the percentage of serum TXB2 reduction after two weeks of aspirin therapy varied among individuals.

DETAILED DESCRIPTION

Definitions

In accordance with the invention and as used herein, the following terms are defined with the following meanings, unless explicitly stated otherwise. The article "a" and "an" as used herein refers to one or to more than one (i.e., at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element. "Thromboxane inhibitors" include compounds that inhibit thromboxane synthase and compounds that inhibit, prevent or otherwise interfere with the binding of thromboxane to its receptor

(thromboxane antagonists), as well as compounds that are both thromboxane synthase inhibitors and thromboxane receptor antagonists. Thromboxane synthase inhibitors and thromboxane receptor antagonists can be identified using assays described in Tai, H.-H. Assay of thromboxane A synthase inhibitors. Methods in Enzymology Vol 86, 1982 pp. 110-113 and references contained within Hall, S. E. Thromboxane A2 Receptor Antagonists. Medicinal Research Reviews, 11, 503-579 (1991) and Coleman, R. A., Smith, W. L, Narumiya, S. International Union of Pharmacology classification of prostanoid receptors: properties, distribution and structure of the receptors and their subtypes. Pharmacol. Rev. 46, 205-229 (1994). The characteristics of the preferred thromboxane inhibitor should include suppression of thromboxane A2 formation (thromboxane synthase inhibitors) and/or blockade of thromboxane A2 and prostaglandin H2 on platelets and vessel wall (thromboxane receptor antagonists). The effects should block platelet activation and therefore platelet function. Thromboxane synthase inhibitors may also increase the synthesis of antiaggregatory prostaglandins including prostacyclin and prostaglandin D2.

COX-2 Selective Inhibitors

As explained in J. Talley, Exp. Opin. Ther. Patents (1997), 7(1), pp. 55-62, three distinct structural classes of selective COX-2 inhibitor compounds have been identified. One class is the methane sulfonanilide class of inhibitors, of which NS-398, flosulide, nimesulide and (i) are example members.

A second class is the tricyclic inhibitor class, which can be further divided into the sub-classes of tricyclic inhibitors with a central carbocyclic ring (examples include SC-57666, 1, and 2); those with a central monocyclic heterocyclic ring (examples include DuP 697, SC-58125, SC-58635, and 3, 4 and 5; and those with a central bicyclic heterocyclic ring (examples include 6, 7, 8, 9 and 10). Compounds 3, 4 and 5 are described in U.S. Patent No. 5,474,995.

SC-57666

10

The third identified class can be referred to as those which are structurally modified NSAIDs, and includes 11a and structure 11 as example members.

In addition to the structural classes, sub-classes, specific COX-2 selective inhibitor compound examples, and reference journal and patent publications described in the Talley publication which are all herein incorporated by reference, examples of compounds which selectively inhibit cyclooxygenase-2 have also been described in the following patent publications, all of which are herein incorporated by reference: U.S. Patent No.'s 5,344,991, 5,380,738, 5,393,790, 5,409,944, 5,434,178, 5,436,265, 5,466,823, 5,474,995, 5,510,368, 5,536,752, 5,550,142, . 5,552,422, 5,604,253, 5,604,260, 5,639,780; and International Patent Specification Nos. 94/13635, 94/15932, 94/20480, 94/26731, 94/27980, 95/00501, 95/15316, 96/03387, 96/03388, 96/06840; and International Publication Nos. WO 94/20480, WO 96/21667, WO 96/31509, WO 96/36623, WO 97/14691, WO

97/16435.

The term "aspirin" or "ASA" refers to ortho-acetylsalicylic acid and the pharmaceutically acceptable formulations thereof.

The term "aspirin insensitivity" or "aspirin resistance" refers to an inability to effectively inhibit the biosynthesis of thromboxane A2 after taking a thromboxane A2 inhibitor or a selective COX-1 inhibitor, most preferably aspirin by standard antiplatelet doses of 75-300 mg/day. It is believed that as a result thereof, aspirin loses its protective effect on cardiovascular and cerebrovascular system. In the majority of patients, aspirin can reduce the risk of cardiovascular and cerebrovascular diseases by 25%. However, for patients with aspirin resistance, treatment of cardiovascular and cerebrovascular diseases with aspirin cannot prevent them from the cardiovascular and cerebrovascular events, but instead, can increase the risk of myocardial infarction and stroke.

As used herein "determining the level of a certain mi NAs in a sample" means assaying a test sample, e.g. a platelet sample from a patient, in vitro to determine the concentration or amount of the miRNAs in the sample. Any convenient qualitative, semi-quantitative or, preferably, quantitative detection method for determining nucleic acids can be used to determine the concentration or amount of the miRNAs in the sample. A variety of methods for determining nucleic acids are well known to those of skill in the art, e.g. determination by nucleic acid hybridization and/or nucleic acid amplification. Exemplary methods to determine the concentration or amount of the miRNAs in the sample are provided below.

The term "sample comprising platelet derived nucleic acids" refers to any type of biological sample from a patient which comprises platelet derived nucleic acids, preferably RNA, in a detectable amount.

miRNAs are small non-coding RNAs (17-24 nucleotides) that regulate gene expression by binding to partly complementary sequences in messenger RNA transcripts (mRNAs) thereby preventing the mRNAs from being translated into protein. Due to their function as regulators of gene expression they play a critical role in fundamental biological processes, including hematopoietic differentiation, cell cycle regulation, metabolism, cardiovascular biology, and immune function, and have been suggested to be involved in pathological processes. It has been found that the expression level (or expression pattern) of miRNAs varies over time and between tissues/cells.

The terms "miR-19b-l-5p, miR-1271, miR-1537-5p, miR-1280, miR-1260a, miR-718, miR-484, MiR- 130b-3p, miR-342-3p miR-151-3p, miR-28-5p, miR-331-3p, miR-29c-3p, miR-148b-3p, miR-18a-5p" and so on as used herein refer to the miRNAs as retrieved in miRBase version 21. Exemplary sequences of the miRNAs are listed in Table 1.

Table. 1: Overview of the miRNAs and their sequences

1. miR-1260a AUCCCACCUCUGCCACCA

2. miR-1280 UCCCACCGCUGCCACCC

3. miR-130b-3p CAGUGCAAUGAUGAAAGGGCAU

4. miR-29c-3p UAGCACCAUUUGAAAUCGGUUA

5. miR-148b-3p UCAGUGCAUCACAGAACUUUGU

6. miR-18a-5p UAAGGUGCAUCUAGUGCAGAUAG

7. miR-548e-3p AAAAACUGAGACUACUUUUGCA

8. miR-19b-l-5p: AGUUUUGCAGGUUUGCAUCCAGC

9. miR-1271: CUUGGCACCUAGCAAGCACUCA

10. miR-1537-5p: AGCUGUAAUUAGUCAGUUUUCU

11. miR-151-3p: CUAGACUGAAGCUCCUUGAGG

12. miR-28-5p: AAGGAGCUCACAGUCUAUUGAG

13. miR-331-3p: GCCCCUGGGCCUAUCCUAGAA

14. miR-29c: UAGCACCAUUUGAAAUCGGUUA

15. miR-1225-3p: UGAGCCCCUGUGCCGCCCCCAG 16. miR-587: UUUCCAUAGGUGAUGAGUCAC

17. miR-718: CUUCCGCCCCGCCGGGCGUCG

18. miR-484: UCAGGCUCAGUCCCCUCCCGAU

19. miR-342-3p: UCUCACACAGAAAUCGCACCCGU

Embodiments

The concentration or amount of the miRNAs in the sample may be directly determined in the sample, that is, without an RNA extraction step. Alternatively, RNA may be extracted from the sample prior to miRNA processing for detection. RNA may be purified using a variety of standard procedures as described, for example, in RNA Methodologies, A laboratory guide for isolation and characterization, 2nd edition; 1998, Robert E. Farrell, Jr., Ed., Academic Press. In addition, there are various processes as well as products commercially available for isolation of small molecular weight RNAs, including miRNeasy™ kit (Qiagen), MagMAX™ kit (Life Technologies), Pure Link™ kit (Life Technologies), and mirVANA™ miRNA Isolation Kit (Ambion). For example, small molecular weight RNAs may be isolated by organic extraction followed by purification on a glass fiber filter. Alternative methods for isolating miRNAs include hybridization to magnetic beads.

The determination of aspirin insensitivity is based on comparing the expression level(s) of the miRNAs in the patient's sample with those obtained using relevant controls, e.g. internal standards, samples of purified platelets from subjects known to be sensitive to aspirin treatment. In cases where the method is being used to monitor a patient with aspirin insensitivity, the "control" may be test results obtained from the same patient at an earlier time, i.e., the patient may be examined for changes in microRNA levels before and after aspirin treatment.

It will be understood that it is not absolutely essential that an actual control sample be run at the same time that assays are being performed on a test sample. Once "normal," i.e., control, levels of the miRNAs (or of miRNA ratios) have been established, these levels can provide a basis for comparison without the need to rerun a new control sample with each assay.

The step of determining whether a subject is sensitive or insensitive to aspirin treatment is based on the information obtained by comparison between the expression level with a reference level. The expression level(s) of the analysed miRNA(s) when statistically analysed will have a threshold whereby expression levels of the individual miRNAs below or above the threshold are indicative for respectively the presence or absence of aspirin insensitivity. Threshold miRNA levels for each of the analysed miRNAs can be determined by any suitable algorithm. Such an algorithm may involve classifying a sample between aspirin insensitive and aspirin sensitive groups. For example, samples may be classified on the basis of threshold values, or based upon Mean and/or Median miRNA levels in aspirin insensitive patients versus aspirin sensitive (e.g., a cohort from the general population or a patient cohort with diseases unrelated to aspirin insensitivity). Various classification schemes are known for classifying samples between two or more groups, including Decision Trees, Logistic Regression, Principal Components Analysis, Naive Bayes model, Support Vector Machine model, and Nearest Neighbour model. In addition, the predictions from multiple models can be combined to generate an overall prediction.

The miRNA expression level (miRNA signature, level, or miRNA concentration) is generated

(determined) from (in) the biological-sample using any of various methods known in the art for quantifying miRNA levels. Such methods include polymerase-based assays, such as Real-Time PCR (e.g., Taqman™), hybridization-based assays, for example using microarrays (e.g. miRNome microRNA Profilers QuantiMir Human PCR array (Biocat)), nucleic acid sequence based amplification (NASBA), flap endonuclease-based assays, as well as direct RNA capture with branched DNA

(QuantiGene™), Hybrid Capture™ (Digene), or nCounter™ miRNA detection (nanostring). The assay format, in addition to determining the miRNA levels will also allow for the control of, inter alia, intrinsic signal intensity variation. Such controls may include, for example, controls for background signal intensity and/or sample processing, and/or hybridization efficiency, as well as other desirable controls for quantifying miRNA levels across samples (e.g., collectively referred to as "controls"). Many of the assay formats for amplifying and quantitating miRNA sequences, and thus for generating miRNA levels are commercially available and/or have been described, e.g. in WO 2008/153692, WO 2010/139810, and WO 2011/163214, or references cited therein.

The specific platelet-based miRNAs that are tested for in the present invention include hsa-miR-19b- l-5p (miRBAse, version 21), hsa-miR-1225-3p (miRBAse, version 21), hsa-miR-1271 (miRBAse, version 21), hsa-miR-1537-5p (miRBAse, version 21), hsa-miR-548e-3p (miRBAse, version 21), and hsa-miR- 587 (miRBAse, version 21). The designations provided are standard in the art and are associated with specific sequences that can be found at the microRNA registry (http://www.mirbase.org/).

In all cases, unless otherwise explicitly specified, they refer to human sequences, which may be indicated with the prefix "hsa" (Homo sapiens), i.e. hsa-miR-19b-l-5p, hsa-miR-1271, hsa-miR-1537- 5p, under the standard nomenclature system. Although the miRNAs tested for are indicated as RNA sequences, it will be understood that, when referring to hybridizations or other assays,

corresponding DNA sequences can be used as well. For example, RNA sequences may be reverse transcribed and amplified using the polymerase chain reaction (PCR) in order to facilitate detection. In these cases, it will actually be DNA and not RNA that is directly quantitated. It will also be understood that the complement of the reverse transcribed DNA sequences can be analysed instead of the sequence itself. In this context, the term "complement" refers to an oligonucleotide that has an exactly complementary sequence, i.e. for each adenine there is a thymine, etc. Although assays may be performed for the miRNAs individually, it is generally preferable to assay several miRNAs or to compare the ratio of two or more of the miRNAs.

The method of the invention can comprise differentiating between patients with aspirin insensitivity and patients who are sensitive to aspirin treatment, wherein any of the miRNAs of the invention up- regulated (increased concentration) in the biological sample from a patient compared to a normal control.

Preferably, the method of the invention can further comprise determining the expression level of hsa-miR-19b-l-5p in the sample from the patient. Said sample may be any sample from said patient comprising platelet RNA. Examples include for instance, platelet rich plasma, whole blood,

Preferably, said sample is a sample of isolated platelets or enriched for platelets. Preferably, said sample comprises a high concentration of platelets, preferably more than 99% of all cell particles in said sample is a platelet, preferably more than 99.5%, 99.6% or 99.7% as determined by FACS analysis.

Also preferred, the method of the invention can further comprise determining the level of one or more normalization control(s) in the sample. Preferably, the sample can be spiked with the normalization control(s).

Preferred according to the invention, the normalization control can be a non-endogenous RNA or miRNA, or a miRNA not expressed in the sample. For example, the normalization control may be one or more exogenously added RNA(s) or miRNA(s) that are not naturally present in the biological sample, e.g. an RNA or miRNA from another organism, and/or one or more human miRNAs not expressed in the sample-sample undergoing analysis. In a highly preferred embodiment, said level of the miRNA of the invention is normalized using one or more reference miRNAs which are stably expressed in platelets. Preferably, said one or more reference miRNAs is selected from the group consisting of miR-151-3p, miR-28-5p, miR-331-3p, miR-29c, miR-148b-3p and miR-18a-5p. The normalization may suitably be performed as described herein and as described in European patent application EP15166257.

The invention further provides a kit for quantifying the amount of a target miRNA in a biological sample comprising an amplification primer set, comprising at least one primer comprising a sequence that is complementary to a portion of said first reference miRNA as defined above.

Preferably, said amplification primer set further comprises a sequence that is complementary to a portion of said second reference miRNA as defined above. Preferably, the kit of the invention further comprises a second amplification primer set, wherein at least one primer comprises a sequence that is complementary to a portion of a target miRNA. Preferably, the kit according to the invention further comprises a first probe comprising a sequence that is complementary to a portion of the target miRNA and a second probe comprising a sequence that is complementary to a portion of the reference miRNA, wherein the first and second probes are distinguishably detectable.

In the method of the invention, the miRNA level (or miRNA concentration) is preferably determined by an amplification-and/or hybridization-based assay. The amplification- and/or hybridization-based assay can be quantitative miRNA real-time polymerase chain reaction (RT-PCR), e.g. TaqMan. The miRNA level may also be determined by preparing cDNA, followed by RT-PCR.

The miRNA level may be determined with the use of a custom kit or array, e.g., to allow particularly for the profiling of the platelet-based miRNAs of the invention. Accordingly, the present invention further provides a kit (or test) for diagnosing or monitoring insensitivity for aspirin treatment based upon the miRNA levels in the biological samples as described herein.

The kit for diagnosing or monitoring aspirin insensitivity of the invention may comprise means for determining the concentration (expression level) of miR-19b-l-5p, miR-1225-3p, miR-1271, miR- 1537-5p, miR-548e-3p, and miR-587; in a platelet sample from a subject. The means for determining the concentration of miR-19b-l-5p, miR-1225-3p, miR-1271, miR-1537-5p, miR-548e-3p, and miR- 587 can be oligonucleotide probes specific for miR-19b-l-5p, miR-1225-3p, miR-1271, miR-1537-5p, miR-548e-3p, and miR-587; or miRNA-specific primers for reverse transcribing or amplifying each of miR-19b-l-5p, miR-1225-3p, miR-1271, miR-1537-5p, miR-548e-3p, and miR-587. For example, the means for determining the concentration of miR-19b-l-5p, miR-1225-3p, miR-1271, miR-1537-5p, miR-548e-3p, and miR-587 may be TaqMan probes specific for each miRNA of the kit.

The design of oligonucleotide probes specific for miR-19b-l-5p, miR-1225-3p, miR-1271, miR-1537- 5p, miR-548e-3p, and miR-587; or miRNA-specific primers for reverse transcribing or amplifying each of miR-19b-l-5p, miR-1225-3p, miR-1271, miR-1537-5p, miR-548e-3p, and miR-587 to detect their expression levels (concentrations) in accordance with suitable assay formats is well known to those of skill in the art, and appropriate probes and/or primers can be commercially purchased.

Further, the kit may comprise an enzyme for cDNA preparation (e.g. , reverse transcriptase) and/or PCR amplification (e.g., Taq polymerase), and/or a reagent for detecting and/or quantifying miRNA. Additionally, the kit may further comprise include a reagent for miRNA isolation from samples. The kit can also comprise one or more normalization control(s). The normalization control(s) can, for example, be provided as one or more separate reagent(s) for spiking samples or reactions.

Preferably, the normalization control(s) is/are selected from non-endogenous RNA or miRNA, or a miRNA not expressed in the sample. In a preferred embodiment, said kit comprises a specific primer for reverse transcribing or amplifying one or more reference miRNAs is selected from the group consisting of miR-151-3p, miR-28-5p, miR-148b-3p and miR-18a.

It is especially preferred to combine the preferred embodiments of the present invention in any possible manner. EXAMPLE

Background Worldwide, aspirin is the most commonly prescribed platelet inhibitor after a cardiovascular event. Many patients, however, suffer from re-events that are thought to be due to platelet insensitivity to aspirin. The aim of this study was to identify a biomarker which could be used as a suitable marker for aspirin insensitivity.

Methods and results The inventors included 15 healthy men between the age of 35 and 65 years and determined mi NA microarray expression levels in isolated platelets before and after 2 weeks of aspirin use. MiRNA expression levels were compared with in vitro platelet function measured in the same individuals. Aspirin-induced changes in expression of six miRNAs in vivo correlated strongly with the reduction in platelet aggregation after indomethacin incubation as an in vitro measure for aspirin insensitivity.

This finding was validated by qPCR in an extended cohort of 25 healthy individuals, which showed a significant positive correlation (p = 0.68; p<0.001) between the change in expression of miR-19b-l-5p and reduction of platelet aggregation.

Conclusions In healthy volunteers, lower expression of miR-19b-l-5p after aspirin use is associated with the insensitivity of platelets for aspirin.

Methods

Study population

Microarray cohort. For the miRNA microarray experiments the inventors recruited 15 healthy Caucasian male volunteers. This group was part of a previously reported study (Sondermeijer BM et al. , PLoS One [Internet]. 2011 [cited 2013 Aug 12];6:e25946.), in which healthy controls were matched to patients with coronary artery disease (CAD). The original cohort consisted of 40 healthy controls, of which 24 individuals completed the medication regimen described below. Of these, 15 individuals additionally completed the platelet aggregation assays and were therefore included in the microarray cohort. Healthy volunteers were eligible for participation if they were between the age of 35 and 65 years, did not have a personal or family history of cardiovascular disease (CVD) and did not use any medication.

To study the effect of medication on miRNA expression levels, the inventors administered 100 mg of acetyl salicylic acid, once daily, for two weeks. Since this cohort was intended as a control group for a group of subjects with CAD, all subjects were also asked to use statins. The inventors administered simvastatin 40 mg, once daily, for 6 weeks, of which the last 2 weeks in combination with the administration of acetyl salicylic acid. Blood samples including isolated platelets were collected at baseline in the absence of aspirin and statins and after six weeks of medication use.

PCR cohort. The PC cohort consisted of the 15 healthy volunteers from the microarray cohort and 10 additional healthy volunteers. Additional participants were selected in a similar manner to the controls in the microarray cohort, using identical inclusion and exclusion criteria. The subjects were also treated with simvastatin 40 mg, once daily, for 6 weeks, of which the last 2 weeks in

combination with the administration of acetyl salicylic acid. Peripheral blood collection

Venous blood samples were drawn without stasis, using an open system with a 19-gauge needle. Blood samples for platelet isolation were collected in trisodium citrate (each 5 ml containing 0.5 ml 0.105M trisodium citrate). The first sample was discarded. Blood samples for platelet aggregation test were collected in citrate tubes. Samples for the serum thromboxane A2 assay were collected in glass serum tubes.

Platelet isolation

Platelets were isolated as described previously (Sondermeijer BM et al. , PLoS One [Internet]. 2011 [cited 2013 Aug 12];6:e25946.). In short, immediately after withdrawal the samples were centrifuged (180g, 15 min, room temperature) to obtain platelet-rich plasma (PRP). The upper layer of PRP was transferred to a plastic tube to avoid leukocyte contamination. One part of acid-citrate-dextrose (ACD) buffer (0.085 M trisodium citrate, 0.11 M glucose, 0.071 M citric acid) was added to five parts of PRP and then the PRP was centrifuged (800 g, 20 min, room temperature). The platelet-poor plasma was discarded and the platelet pellet carefully resuspended in Tyrode buffer (136.9 mM NaCI, 2.61 mM KCI, 11.9 mM NaHC03, 5.55 mM Glucose, 2 mM EDTA, pH 6.5). The platelet suspension was centrifuged (800 g, 20 min, room temperature). The supernatant was discarded and the platelet pellet was resuspended in 50 ml sterile phosphate buffered saline (PBS) and stored at -80^QC prior to RNA isolation. The isolated platelets were investigated by fluorescence-activated cell sorting (FACS) using monoclonal antibodies against CD45 (BD Biosciences), CD235a (DAKO) and CD61 (BD

Biosciences) to identify leukocytes, erythrocytes and platelets. The purity of the isolated platelets was 99.72% by FACS analysis.

RNA isolation The inventors isolated platelet RNA using the mirVana PARIS kit (Ambion, Inc.), according to the manufacturer's protocol for liquid samples. The protocol was modified such that samples were extracted twice with an equal volume of acid-phenol chloroform. MiRNA microarray

The integrity of total RNA including microRNAs from platelets was investigated with the BioAnalyzer (Agilent Technologies) using the RNA 6000 Pico kit (Agilent Technologies) and Small RNA kit (Agilent Technologies) according to the manufacturer's instructions.

100 ng of total RNA including microRNAs was dried down in a Centrivap concentrator (Labconco) and dissolved in 2 μΙ RNase-free water. Sample labeling with Cy3 was performed as described in the miRNA Microarray System with miRNA Complete Labeling and Hyb Kit manual version 2.2 (Agilent Technologies) with the inclusion of spike-ins and the optional desalting step with spin columns (Micro Bio-Spin 6, Bio-Rad). Labeled samples were hybridized on Human 8x15k miRNA microarrays based on Sanger miRBase release 12.0 containing 866 human and 89 human viral miRNAs (G4470C, Agilent Technologies) at 55°C and 20 rpm for 20 hours. After washing, the arrays were scanned using the Agilent DNA microarray scanner (G2565CA, Agilent Technologies). Data was extracted with Feature Extraction software (vlO.7.3.1, Agilent Technologies) with the miRNA_107_Sep09 protocol for miRNA microarrays miRNA microarray pre-processing and analysis

A two-step normalisation approach was taken. In the first step, the inventors corrected for systematic technical effects in the raw probe-level data as extracted via the Agilent Feature

Extraction software. For this purpose, the inventors fitted a linear mixed-effects model with coefficients for three technical effects (hybridisation block, slide, and slide position, that is, upper or lower half), and patient status using the R/MAANOVA package. Residuals after correcting for the three technical effects were further pre-processed and summarized using a modified version of the robust multi-array average (RMA) method with background correction, as implemented in the AgiMicroRna R package. This pre-processing method has been shown to have better precision than the pre-processing method recommended by Agilent¹¹. Quality control was performed using the arrayQualityMetrics R package. Based on arrayQualityMetrics outlier detection and visual inspection of heatmaps, MA-plots, and intensity distributions, 11 arrays were excluded from further analysis. 2 control subjects after medication were excluded because of missing microarray data. Data from the remaining arrays (33 CAD, 37 control without medication and 24 control after medication) were renormalized using the two-stage procedure describing above. Only non-control miRNAs detected on at least one array according to Agilent Feature Extraction software were included in the further analysis. To find miRNAs differentially expressed between healthy controls before and after medication, the inventors employed a paired moderated t-test using the limma R package. Resulting p-values were adjusted to correct for multiple hypothesis testing using the Benjamin-Hochberg false discovery rate. Expression data have been deposited in NCBI Gene Expression Omnibus in a MIAME compliant format and are accessible under GEO Series accession number GSE59421. qPCR

qPCR was performed with RNA of isolated platelets as previously described (Tijsen AJ et al., Ore Res [Internet]. 2010 [cited 2013 Jun 24];106:1035-9). A fixed volume of 8 μΙ of total RNA was used as input in the reverse transcription reaction. Input RNA was reverse transcribed using the miScript reverse transcription kit (Qiagen) according to the manufacturer's protocol. The real-time qPCR was performed using High Resolution Melting Master (Roche). MgCI₂ was used in final concentration of 2.5mmol/L and 2 μΙ of 8 times diluted cDNA was used in a total volume of 10 μΙ. The forward primers had the same sequence as the mature miRNA sequence with all U's changed into T's. The reverse sequence was GAATCGAGCACCAGTTACGC (SEQ ID NO:21), which is complementary to the adapter sequence of the RT-primer used to create cDNA. qPCR reactions were performed on a LightCycler480 system II (Roche). The candidate miRNAs were normalized to the geometric mean of a previously established miRNA normalization panel for platelet samples consisting of miR-151-3p, miR-28-5p, miR-148b-3p and miR-18a. These normalization miRNAs were selected from independent microarray experiments and were further validated on PCR data using the geNorm and Normfinder algorithms. The original platelet normalization panel consists of 6 miRNAs selected by both algorithms. However, since the inventors did not have enough material to perform PCR on all 6 miRNAs the inventors choose to select the 2 miRNAs that were considered the best normalization panel by the geNorm algorithm and the 2 miRNAs that were selected by Normfinder. Data were analyzed using LinRegPCR quantitative PCR data analysis software, version 11.3 (Ruijter JM et al. Nucleic Acids Res [Internet]. 2009 [cited 2013 May 28];37:e45).

Multipe electrode aggregometry

The inventors assessed platelet function using the Multiplate^® Analyzer (Roche) in the absence of aspirin and statin use according to the manufacturer's instructions. Adenosine diphosphate (ADP) was used in this assay to initiate platelet aggregation, since ADP most sensitively initiated platelet aggregation in this assay. In short, 300 μΙ whole blood was diluted with 300 μΙ 0.9% saline and stirred for 3 minutes at 37 ⁵C. ADP was added in a final concentration of 2.5 μιτιοΙ/L. to initiate platelet aggregation. Aggregation was measured for 6 minutes and was reported in arbitrary aggregation units plotted against time. Also, the area under the aggregation curve (AUC) was measured. All samples were measured in the absence and presence of 200 μιτιοΙ/L. indomethacin (20 min incubation with blood) to mimic the effect of aspirin use. The inventors calculated the percentage reduction in AUC after incubation with indomethacin as an in vitro measure of the effect of aspirin use on whole blood platelet aggregation.

Serum thromboxane B2 assay

Serum thromboxane B2 (TXB2) was measured at baseline and after 2 weeks aspirin use to check compliance to the therapy. TBX2 was measured in duplicate by an enzyme-linked immunosorbent assay (R&D Systems) according to the manufacturer's instructions. The inventors calculated the TBX2 concentration by performing a logistic four-parameter fit of the standard concentrations versus the ratio of absorbance of a particular sample to that of the maximum binding sample.

Statistical analyses

Student's t-tests and Chi-square tests were used to test for differences in baseline characteristics between the microarray cohort and the 10 additional subjects in the PCR cohort.

Normalized miRNA expression levels from both the microarray and the PCR experiment were log- transformed. Changes in miRNA expression were calculated by subtracting the (log-transformed) expression level of a specific miRNA before aspirin use from its expression level after aspirin use. Spearman's rank correlation of these aspirin-induced expression changes with the percentage of AUC reduction after indomethacin incubation was calculated for both the microarray and the PCR experiment. All analyses were performed using SPSS for Windows 19.0 and the statistical software package R. A p-value < 0.05 (Bonferroni corrected in case of multiple testing) was considered statistically significant. Results

Study population

Microarray cohort. Clinical characteristics of the 15 healthy volunteers included in the microarray cohort are reported in Table 1. The results of the serum TBX2 assay showed that all subjects complied to aspirin therapy.

PCR cohort. This cohort consisted of the 15 subjects of the microarray cohort and 10 additional healthy volunteers recruited in the same manner as the controls in the microarray cohort (Table 1). Clinical characteristics of these 10 healthy volunteers did not differ from those of the microarray cohort. Detailed characteristics of the PCR cohort are listed in Table 1. Also for these 10 healthy volunteers, compliance to aspirin therapy was good, as shown by the serum TBX2 assay.

MiRNA profiling

The miRNA microarray experiment was performed on platelet RNA samples obtained at baseline and after 6 weeks medication use for all 15 subjects included in the microarray cohort. Each microarray contained 866 human miRNAs as annotated in miRBase 12.0. In total 468 miRNAs were detected in at least one platelet sample.

Only few miRNAs were significantly differentially expressed between healthy controls before and after medication use with modest fold changes at best (Supplementary Table SI). However, investigating the medication-induced changes in expression across all detected miRNAs revealed that some of the healthy individuals showed marked changes in miRNA profiles after medication use, whereas others did not (Figure 1). Since aspirin has a direct effect on platelet function, the inventors believe that the observed inter- individual heterogeneity of the changes in miRNA expression after medication use are due to a difference in response to aspirin. The inventors therefore performed a platelet aggregation study on whole blood at baseline for each of the 15 individuals included in the microarray cohort. Medication- induced changes in expression of each miRNA on the microarray were correlated with the reduction in platelet aggregation after incubation with indomethacin. Changes in expression of six miRNAs correlated strongly with the extent of platelet aggregation reduction (Table 2)

To validate these findings, the inventors performed RT-qPCR on isolated platelets in an extended cohort (n=25) and correlated RT-qPCR expression levels to the results of the platelet aggregation assay. The inventors were able to perform RT- qPCR on 3 out of 6 candidate miRNAs (miR-1271, miR- 1537-5p and miR-19b-l-5p). The expression levels of the other 3 miRNAs were below the detection limit of their PCR system. Of the detected miRNAs, miR-19b-l-5p showed a significant positive correlation (p = 0.68; p<0.001, Bonferroni corrected) between its change in expression and reduction of platelet aggregation (Figure 2A). This means that lower platelet miR-19b-l-5p expression after aspirin use was significantly associated with aspirin insensitivity.

No significant correlation with platelet aggregation could be observed for miR-1537-5p (p = 0.36; p=0.25, Bonferroni corrected) and miR-1271 (p = 0.25; p=0.69, Bonferroni corrected) (Figure 2B-C). Separate analysis of the RT-qPCR data of the microarray cohort (n=15) and the 10 additional healthy volunteers showed similar results.

Table 1. Baseline characteristics Microarray cohort PCR cohort n 15 25

Age, years ± SD 51.4 ± 4.6 53.1 ± 4.6

Gender, male n (%) 15 (100) 25 (100)

Smoking, n (%) 4 (27) 6 (24)

Hypercholesterolemia, n (%) 0 0

Hypertension, n (%) 0 0

Diabetes, n (%) 0 0

BMI, kg/m2± SD 25.5 ±2.5 25.7 ± 2.7

Systolic blood pressure, mmHg ± SD 128 ± 13 128 ±12

Diastolic blood pressure, mmHg ± SD 84 ± 8 84 ± 7

Glucose, mmol/L ± SD 5.3 ± 0.6 5.4 ±0.6

Total cholesterol, mmol/L ± SD 5.4 ±0.7 5.4 ±0.7

HDL cholesterol, mmol/L ± SD 1.4 ±0.4 1.4 ±0.4

LDL cholesterol, mmol/L ± SD 3.6 ±0.8 3.5 ±0.8

Triglycerides, mmol/L ± SD 1.0 ±0.5 1.2 ± 0.7

Continuous data are expressed as mean ± SD, categorical data as absolute number with

(percentages).

BMI, body mass index; HDL, high density lipoprotein; LDL, low density lipoprotein, n, number; SD, standard deviation.

Table 2. Overview of the microarray results. mi NA Medication-induced change in Expression after medication expression use

Correlation P-value Correlation P-value miR-1225-3p 0.796 0.001 0.618 0.016 miR-1271 0.682 0.007 0.893 <0.001 miR-1537-5p 0.525 0.047 0.539 0.041 miR-19b-l-5p 0.743 0.002 0.689 0.006 miR-548e-3p 0.657 0.010 0.611 0.018 miR-587 0.593 0.022 0.796 0.001 Overview of the mi NAs that showed a strong correlation (Spearman correlation, nominal p- value<0.05) between the reduction in platelet aggregation after indomethacin incubation in vitro and both the medication-induced change in expression (left hand side) and the expression after medication (right hand side).

Serum thromboxane B2 assay

Since the observed differences could be due to differences in compliance to aspirin use, we analysed serum TXB2 levels in all individuals. In both the microarray and the PCR cohort serum TXB2 levels were analysed in samples taken at baseline and after two weeks of aspirin therapy. At these time points the samples for the miRNA expression analyses were also taken. The percentage of serum TXB2 reduction after two weeks of aspirin therapy varied among individuals, but all participants had at least a 30% reduction, indicating good compliance of all individuals. When comparing the serum TXB2 levels after aspirin use to the inter-individual differences in platelet aggregation a similar trend was seen (Figure 3).

Example 2 miR-19b-l-5p in platelet rich plasma

Methods

Non-fasting venous blood was drawn in CTAD citrate 5,4 ml tubes (Becton Dickinson, Alphen aan de Rijn, the Netherlands) and centrifuged for 10 minutes at 158 g at 20°C without brake to obtain platelet rich plasma (PRP).

PCR

MiR-19b-l-5p specific reverse transcription was performed on lOOng of purified total RNA, using the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Gent, Belgium). RT-qPCR reactions were carried out in duplicate, on a LightCycler 480 system II (Roche, Basel,

Switzerland). Data were analysed using LinRegPCR quantitative PCR data analysis software, version ll(Ruijter, Ramakers et al. 2009).

Results

MiR-19b-l-5p was detectable in all PRP samples.

Table 3: NO values (expression) of miR-19b-l-5p in PRP samples per sample.

sample nr.

References Ruijter, J. M., et al. (2009). "Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data." Nucleic Acids Res 37(6): e45.

Claims

1. A method for determining whether a patient is sensitive or insensitive to a treatment with a thromboxane A2 inhibitor or a selective COX-1 inhibitor for use in a platelet inhibition treatment comprising the steps of:

a. determining the expression level of one or more miRNA(s) selected from the group consisting of miR-19b-l-5p, miR-1271, and miR-1537-5p, in a sample comprising platelet derived nucleic acids,

b. comparing said expression level with a reference level, and

c. determining the sensitivity or insensitivity of said subject for a treatment with said thromboxane A2 inhibitor or said selective COX-1 inhibitor based on the information obtained in step b.

2. The method according to claim 1, wherein upregulation of said miRNA is indicative for

insensitivity to treatment with said thromboxane A2 inhibitor or said selective COX-1 inhibitor.

3. The method according to claim 1 or 2, wherein said thromboxane A2 inhibitor or a selective

COX-1 inhibitor is selected from the group consisting of aspirin and indomethacin.

4. A method according to any one of claims 1-3, comprising the step of determining the

expression level of said miRNA in a sample before, during and/or after treatment with said thromboxane A2 inhibitor or said selective COX-1 inhibitor.

5. The method according to claim 4, comprising the step of determining the expression level of said miRNA in a sample after at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 , 13 or 14 days after the first doses of said thromboxane A2 inhibitor or said selective COX-1 inhibitor treatment.

6. The method according to any of the previous claims, wherein said one or more miRNA(s) comprises miR-19b-l-5p.

7. The method according to any of the previous claims, wherein said sample comprises a

platelet sample.

8. The method according to any of the previous claims, wherein said expression level of said miRNA is normalized using one or more reference miRNAs.

9. The method according to any of the previous claims, wherein said one or more reference miRNAs is selected from the group consisting of consisting of miR-151-3p, miR-28-5p, miR-

331-3p, miR-29c, miR-148b-3p and miR-18a-5p.

10. The method according to any of previous claims wherein the detecting said one or more miRNA(s) is performed by reverse amplification of said miRNA and real time detection of amplified products.

11. A kit for diagnosing or monitoring aspirin insensitivity comprising a nucleic acid capable of hybridizing under stringent conditions with any of miR-19b-l-5p, miR-1271, and miR-1537- 5p, further comprising one or more reference miRNAs selected from the group consisting of miR-151-3p, miR-28-5p, miR-331-3p, miR-29c, miR-148b-3p and miR-18a.