WO2012056441A1 - Compositions and methods for specific cleavage of exogenous rna in a cell - Google Patents
Compositions and methods for specific cleavage of exogenous rna in a cell Download PDFInfo
- Publication number
- WO2012056441A1 WO2012056441A1 PCT/IL2010/000895 IL2010000895W WO2012056441A1 WO 2012056441 A1 WO2012056441 A1 WO 2012056441A1 IL 2010000895 W IL2010000895 W IL 2010000895W WO 2012056441 A1 WO2012056441 A1 WO 2012056441A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- rna
- interest
- nucleotides
- exogenous
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
Definitions
- the present invention relates to compositions for cleaving an exogenous RNA of interest only in the presence of an endogenous signal RNA sequence, thereby activating expression of a polynucleotide of interest only in the presence of the endogenous signal RNA sequence.
- the invention further relates to uses of the compositions in treatment and diagnosis of various conditions and disorders, as exemplified by selectively activating expression of a toxin only in target cell populations.
- RNA interference is a phenomenon in which dsRNA, composed of sense RNA and antisense RNA homologous to a certain region of a target gene effects cleavage of the homologous region of the target gene transcript, thereby inhibiting expression of the gene.
- the dsRNA In mammals, the dsRNA should be shorter than 31 base pairs to avoid induction of an interferon response that can cause cell death by apoptosis.
- RNAi technology is based on a natural mechanism that utilizes microRNAs (miRNAs) to regulate posttranscriptional gene expression [1]. miRNAs are very small RNA molecules of about 21 nucleotides in length that appear to be derived from 70-90 nucleotide precursors that form a predicted RNA stem-loop structure. miRNAs are expressed in organisms as diverse as nematodes, fruit flies, humans and plants.
- miRNAs are generally transcribed by RNA polymerase II and the resulting primary transcripts (pri-miRNAs) contain local stem-loop structures that are cleaved by the Drosha-DGCR8 complex.
- the product of this cleavage is one or more (in case of clusters) precursor miRNA (pre-miRNA).
- Pre-miRNAs are usually 70-90 nucleotides long with a strong stem-loop structure, and they usually contain 2 nucleotides overhang at the 3' end [2].
- the pre- miRNA is transported to the cytoplasm by Exportin-5.
- the Dicer enzyme which is an endoribonuclease of the RNase III family, recognizes the stem in the pre-miRNA as dsRNA and cleaves and releases a 21 bp dsRNA (miRNA duplex) from the 3' and 5' end of the pre-miRNA.
- the two strands of the duplex are separated from each other by the Dicer-TRBP complex and the strand that has thermodynamically weaker 5' end is incorporated into the RNA induced silencing complex (RISC) [3].
- RISC RNA induced silencing complex
- the mature miRNA guides RISC to a target site within mRNAs. If the target site is near perfect complementarity to the mature miRNA, the mRNA will be cleaved at a position that is located about 10 nucleotides upstream from the 3' end of the target site [3]. After the cleavage, the RISC-mature miRNA strand complex is recycled for another round of activity [4]. If the target site has lower complementarity to the mature miRNA the mRNA will not be cleaved at the target site but the translation of the mRNA will be suppressed. Although about 530 miRNAs have been identified so far in humans, it is estimated that vertebrate genomes encode up to 1 ,000 unique miRNAs, which are predicted to regulate expression of at least 30% of the genes [5]. See FIG. 1.
- RNA transcripts of about 23 nucleotides in length which have a complementary region of about 19 nucleotides in length at the 5' end, are hybridized with each other in the mammalian cell and are capable of directing target specific RNA interference [7].
- ds double stranded
- RNA polymerase III U6 promoter is a very strong promoter for transcribing small RNA (sRNA)
- RNA polymerase II CMV promoter is a strong promoter for transcribing protein-coding genes.
- H2ac human HIST1H2AC
- Transcripts from this gene lack poly(A) tails but instead contain a palindromic termination element (5'-GGCUCUUUUCAGAGCC-3') that forms a conserved stem-loop structure at the 3'-UTR, which plays an important role in mRNA processing and stability [1 1].
- Ribosome inactivating proteins are protein toxins that are of plant or microbial origin. RIPs inhibit protein synthesis by inactivating ribosomes. Recent studies suggest that RIPs are also capable of inducing cell death by apoptosis.
- Type II RIPs contain a toxic A-chain and a lectin like subunit (B-chain) linked together by a disulfide bond. The B chain is catalytically inactive, but serves to mediate entry of the A-B protein complex into the cytosol.
- Ricin, Abrin and Diphtheria toxin are very potent Type II RIPs. It has been reported that a single molecule of Ricin or Abrin reaching the cytosol can kill the cell [12, 13]. In addition, a single molecule of Diphtheria toxin fragment A introduced into a cell can kill the cell [14].
- Viruses may be oncogenic due to an oncogene in their genome. Retroviruses may also be oncogenic due to integration at a site which truncates a gene or which places a gene under control of the strong viral cis-acting regulatory element.
- KSHV Korean sarcoma-associated herpesvirus
- SV40 Sonic vacuolating virus 40
- EBV Epstein-Barr virus
- each tumor contains mutations in about 90 protein-coding genes [16].
- Each tumor is initiated from a single founder cell [38]. It is most probable that at least one of these mutant genes is transcribed to mRNA. Therefore, it is highly probable that each cell of a specific tumor or each cell that is infected by a specific virus includes an RNA molecule, which comprises a specific RNA sequence (signal sequence) that is unique to the mutated or infected cell and that is not present in other normal cells of the same organism.
- the signal sequence can be from viral origin or from the mutated gene, that is unique to the specific tumor.
- compositions for the selective killing of only those cells that contain a specific signal sequence have been proposed.
- One approach, developed by Intronn Company, is to build an inactive Toxin that is activated by trans-splicing between the inactive Toxin to the signal sequence [17, 18 and 19].
- This approach has several inherent problems: The first problem is that the RNA molecule that comprises the signal sequence must be present in the cell at very high copy number, since trans-splicing events are very rare. The second problem is that in most cases this approach is not suitable for a signal sequence that is of cancer origin, since in cancer, mutations spread over a short region. The third problem is that the trans- splicing events can also occur at random and may thus cause harmful side effects.
- RNA molecule that comprises the signal sequence must include an intron at a very specific site.
- Another approach which won the 2004 World Technology Award in Biotechnology, suggested using small dsDNA, ssDNA, hairpin DNA and restriction enzyme, however this approach can work only in cell extracts under very unique and not under physiological conditions in living cells [20].
- Other approach such as disclosed, for example, in WO 07/00068 are directed to a gene vector and comprising a miRNA sequence target and its use to prevent or reduce expression of transgene in a cell which comprises a corresponding miRNA.
- a gene vector adapted for transient expression of a transgene in a peripheral organ cell comprising a regulatory sequence operably linked to a transgene wherein the regulatory sequence prevents or reduces expression of said transgene in hematopoietic lineage cells.
- compositions that are capable of selectively kill only cells that contain a signal sequence, wherein the compositions should be potent, reliable and specific as compared to compositions used in the prior are. Since that the development of these compositions can be a very complex multi-step process there is also a need for developing compositions for activating genes of interest in cells, only in the presence of a signal sequence, and for cleaving exogenous RNA of interest only in the presence of a signal sequence.
- the present invention provides compositions and methods for selectively cleaving an exogenous RNA of interest in response to the presence of an endogenous signal RNA in a cell.
- the exogenous RNA of interest is encoded by the composition.
- the endogenous signal RNA is an RNA molecule which comprises a predetermined signal sequence that is a sequence of 18-25 nucleotides long. Subsequent to specific cleavage of the exogenous RNA in the presence of the endogenous signal sequence transcription of a polynucleotide of interest may be activated.
- the polynucleotide activated may encode a toxin thereby providing means to kill target cell populations selectively.
- compositions of the invention comprise or, encode:
- an exogenous RNA of interest which is an RNA sequence that comprises a specific sequence that is of sufficient complementarity to the predetermined signal sequence.
- a carrier RNA that is an RNA molecule that is capable of binding to the cleaved signal RNA portion that comprises the predetermined signal sequence at the predetermined signal sequence end, in such a way that the RNA duplex that formed is 14-31 nucleotides long and it comprises 3' or 5' overhang of 0-5 nucleotides, such that the RNA duplex is a substrate for a Dicer.
- the functional RNA effects the cleavage of the endogenous signal RNA at the 5' or 3' end of the predetermined signal sequence and then the carrier RNA is hybridized to the cleaved signal RNA portion comprising the predetermined signal sequence at the predetermined signal sequence end and directs the processing of the predetermined signal sequence by Dicer and Rise and then the Rise-signal sequence complex directs the cleavage of the exogenous RNA of interest at a specific target/cleavage site.
- the Dicer or Rise processing may involve additional proteins.
- the carrier RNA may also be generated from a second exogenous RNA molecule.
- the predetermined signal sequence may be selected from, but is not limited to: a viral RNA sequence, and a sequence that is unique to neoplastic cells.
- the functional RNA may be selected from, but is not limited to: microRNA (miRNA), lariat- form RNA, short-hairpin RNA (shRNA), siRNA expression domain, ribozyme, or the like.
- the composition of the invention may also comprise or encode an additional functional RNA that is capable of effecting the cleavage of the endogenous signal RNA at the opposite end of the predetermined signal sequence to that cleaved by the first functional RNA.
- the carrier RNA that is encoded by the composition may be driven by a polymerase I based promoter or polymerase III based promoter.
- the exogenous RNA of interest may further comprise:
- the exogenous RNA of interest may be transcribed and cleaved at the specific cleavage/target site so that the inhibitory sequence is detached from the sequence encoding the exogenous protein of interest and the exogenous protein of interest is capable of being expressed.
- the exogenous protein of interest may be selected from, but is not limited to: the protein toxins Ricin, Abrin, Diphtheria toxin, or the like. A single molecule of any one of these may be sufficient to kill the cell in which any of these molecules is expressed.
- the inhibitory sequence can be located downstream or upstream from the specific target/cleavage site.
- the inhibitory sequence that is located upstream from the specific target/cleavage site may include, but is not limited to a plurality of initiation codons, wherein each of the initiation codons is located within a Kozak consensus sequence, or any other translation initiation motif, wherein each of the initiation codons and the sequence encoding the protein of interest are not in the same reading frame.
- the predetermined signal sequence may be located at the 5' or 3' end of the endogenous signal RNA and the composition of the invention does not necessarily encode the functional RNA.
- the components of the composition may be encoded by the same or different polynucleotide molecules.
- one or more components of the composition may be on the same RNA molecule.
- the present invention provides a composition for expressing an exogenous protein of interest only in the presence of an endogenous signal RNA in a cell, the exogenous protein of interest being encoded from the composition, the endogenous signal RNA being an RNA molecule which comprises a predetermined signal sequence, the predetermined signal sequence being a predetermined sequence that is at least 18 nucleotides in length and the composition comprising one or more polynucleotide molecules that comprise:
- a first sequence which is of sufficient complementarity to an edge sequence to hybridize therewith, the edge sequence being located 0-5 nucleotides upstream from the predetermined cleavage site and extending upstream in the signal RNA, wherein the first sequence comprises one or more initiation codon(s), wherein each of the initiation codons consists essentially of 5'-AUG-3';
- the exogenous RNA of interest molecule comprises a sequence encoding an exogenous protein of interest at least 21 nucleotides downstream from the 5' end of said exogenous RNA of interest molecule; whereby following introduction of the composition into a cell comprising the endogenous signal RNA, the functional RNA effects the cleavage, directly or indirectly, of the endogenous signal RNA at the 3' end of the predetermined signal sequence and thereby the exogenous RNA of interest molecule is hybridized to the edge sequence at the cleaved endogenous signal RNA and may direct the predetermined signal sequence to a Dicer processing that may cleave the exogenous RNA of interest molecule, whereby each of the initiation codon(s) is detached from the sequence encoding the exogenous protein of interest and the exogenous protein of interest is capable of being expressed.
- the edge sequence may be 25-30 nucleotides in length and may be located 2 nucleotides upstream from the predetermined cleavage site and extends upstream in the endogenous signal RNA, wherein the second sequences is 0 nucleotides in length.
- each of the initiation codon(s) may be located 0-21 nucleotides downstream from the 5' end of the exogenous RNA of interest molecule, such that each of the initiation codon(s) and the sequence encoding the exogenous protein of interest are not in the same reading frame.
- initiation codon(s) may be located within a Kozak consensus sequence or any other translation initiation motif/element.
- the functional RNA may be selected from, but is not limited to: microRNA (miRNA), short-hairpin RNA (shRNA), small-interfering RNA (siRNA) and/or ribozyme.
- miRNA microRNA
- shRNA short-hairpin RNA
- siRNA small-interfering RNA
- the exogenous protein of interest may include, but is not limited to Diphtheria toxin A chain, RIP protein, and any other protein toxin.
- compositions of the invention may be used in various methods and applications, such as, for example, but not limited to: regulation of gene expression, targeted cell death, treatment of a disease or a condition including, for example, proliferative disorders (such as cancer), infectious diseases, and the like, diagnosis of a disease or a condition, formation of transgenic organisms, suicide gene therapy, and the like.
- composition comprising one or more polynucleotides for directing specific cleavage of an exogenous RNA of interest at a specific target site, the cleavage taking place only in the presence of an endogenous signal RNA in a cell, the endogenous signal RNA being an RNA molecule which comprises a signal sequence, the signal sequence being any predetermined sequence of from 18 to 25 nucleotides in length,
- the one or more polynucleotides may include a first polynucleotide sequence encoding said exogenous RNA of interest; a second polynucleotide sequence encoding a functional RNA capable of mediating the cleavage of the endogenous signal RNA at a predetermined cleavage site; and a third polynucleotide sequence encoding a carrier RNA.
- the carrier RNA is an RNA molecule that is at least about 18 nucleotides in length and is consisting essentially of: a first sequence of from 14 to 31 nucleotides in length which is of sufficient complementarity to an edge sequence to hybridize therewith, said edge sequence is 14-31 nucleotides in length and is located 0-5 nucleotides downstream from said predetermined cleavage site and extends downstream in said endogenous signal RNA; a second sequence downstream from said first sequence, wherein said second sequence is a random sequence that is 0-5 nucleotides in length; a third sequence upstream from said first sequence, wherein said third sequence is 0-7000 nucleotides in length; and the predetermined cleavage site is the 5' end of said predetermined signal sequence.
- the edge sequence is 23-28 nucleotides in length and is located starting from the predetermined cleavage site to about 23-28 nucleotides downstream, wherein the second sequence is 2 nucleotides in length and wherein said third sequence is 0 nucleotides in length.
- the carrier RNA is an RNA molecule that is at least about 18 nucleotides in length and is consisting essentially of: a first sequence of from 14 to 31 nucleotides in length which is of sufficient complementarity to an edge sequence to hybridize therewith, said edge sequence is 14-31 nucleotides in length and is located 0-5 nucleotides upstream from said predetermined cleavage site and extends upstream in said endogenous signal RNA; a second sequence upstream from the first sequence, wherein said second sequence is a random sequence that is 0-5 nucleotides in length; a third sequence downstream from the first sequence, wherein said third sequence is 0-7000 nucleotides in length; and the predetermined cleavage site is the 3' end of said predetermined signal sequence.
- the edge sequence is 25-30 nucleotides in length and is located 2 nucleotides upstream from the predetermined cleavage site and extends upstream in said endogenous signal RNA, wherein said second sequence is 0 nucleotides in length and wherein said third sequence is 0 nucleotides in length.
- the carrier RNA may be processed from a polynucleotide sequence comprising a carrier sequence that is at least about 18 nucleotides in length, said carrier sequence consisting essentially of: a first sequence of from 14 to 31 nucleotides in length which is of sufficient complementarity to an edge sequence to hybridize therewith, said edge sequence is 14-31 nucleotides in length and is located 0-5 nucleotides downstream from said predetermined cleavage site and extends downstream in said endogenous signal RNA; a second sequence downstream from said first sequence, wherein said second sequence is a random sequence that is 0-5 nucleotides in length; and a third sequence upstream from said first sequence, wherein said third sequence is 0-7000 nucleotides in length; wherein the polynucleotide sequence is cleaved within the cell at a carrier cleavage site that is a 3' end of said carrier sequence; wherein the cleavage at the carrier cleavage site is effected
- the carrier RNA may be processed from a polynucleotide sequence comprising a carrier sequence that is at least about 18 nucleotides in length, said carrier sequence consisting essentially of: a first sequence of from 14 to 31 nucleotides in length which is of sufficient complementarity to an edge sequence to hybridize therewith, said edge sequence is 14-31 nucleotides in length and is located 0-5 nucleotides upstream from said predetermined cleavage site and extends upstream in said endogenous signal RNA; a second sequence upstream from the first sequence, wherein said second sequence is a random sequence that is 0-5 nucleotides in length; and a third sequence downstream from said first sequence, wherein said third sequence is 0-7000 nucleotides in length; wherein the polynucleotide sequence is cleaved within the cell at a carrier cleavage site that is 5' end of said carrier sequence; the cleavage at the carrier cleavage site is effected by
- the endogenous signal RNA is a cellular mRNA, viral
- the predetermined signal sequence is unique to neoplastic cells, viral infected cells, or both.
- sufficient complementarity is at least 30% complementarity. In further embodiments, sufficient complementarity is at least 90%.
- the one or more polynucleotide may include one or more DNA molecules, one or more RNA molecules or combinations thereof.
- the functional RNA may be selected from the group consisting of: microRNA (miRNA), lariat-form RNA, short-hairpin RNA (shRNA), siRNA expression domain, antisense RNA, double-stranded RNA (dsRNA), small-interfering RNA (siRNA) and ribozyme.
- miRNA microRNA
- shRNA short-hairpin RNA
- siRNA expression domain siRNA expression domain
- antisense RNA double-stranded RNA
- dsRNA double-stranded RNA
- siRNA small-interfering RNA
- ribozyme ribozyme
- the exogenous RNA of interest may further include a sequence encoding an exogenous protein of interest; and an inhibitory sequence that is capable of inhibiting the expression of the exogenous protein of interest; wherein the specific target site is located between the inhibitory sequence and the sequence encoding an exogenous protein of interest, whereby following introduction of said composition into a cell comprising the endogenous signal RNA, the exogenous RNA of interest is transcribed and cleaved at the specific target site, whereby the inhibitory sequence is detached from the sequence encoding the exogenous protein of interest and the exogenous protein of interest is capable of being expressed.
- the exogenous protein of interest is a toxin. In some embodiments, the exogenous protein of interest is selected from the group consisting of: Ricin, Ricin A chain, Abrin, Abrin A chain, Diphtheria toxin A chain and modified forms thereof.
- the exogenous protein of interest is selected from the group consisting of: alpha toxin, saporin, maize RIP, barley RIP, wheat RIP, corn RIP, rye RIP, flax RIP, Shiga toxin, Shiga-like RIP, momordin, thymidine kinase, pokeweed antiviral protein, gelonin, Pseudomonas exotoxin, Pseudomonas exotoxin A, Escherichia coli cytosine deaminase and modified forms thereof.
- the inhibitory sequence in the exogenous RNA of interest sequence is located upstream from the specific target site.
- the inhibitory sequence comprise one or more initiation codons, wherein each of the initiation codons and the sequence encoding the exogenous protein of interest are not in the same reading frame, and wherein said inhibitory sequence, directly or indirectly, reduces the efficiency of translation of said exogenous protein of interest.
- the one or more initiation codons is consisting essentially of 5'-AUG-3'
- the exogenous RNA of interest may further comprise a stop codon that is located between the initiation codon and the start codon of the sequence encoding the exogenous protein of interest, wherein the stop codon and the initiation codon are in the same reading frame.
- the stop codon may be selected from the group consisting of: 5'-UAA-3', 5'-UAG-3' and 5'-UGA-3'.
- the inhibitory sequence may further include a nucleotide sequence downstream from the initiation codon, wherein said nucleotide sequence and said initiation codon are in the same reading frame, and wherein the nucleotide sequence encodes a sorting signal for subcellular localization.
- the subcellular localization may be selected from the group consisting of: mitochondria, nucleus, endosome, lysosome, peroxisome and endoplastic reticulum (ER).
- the inhibitory sequence may further comprise a nucleotide sequence downstream from the initiation codon, wherein the nucleotide sequence and the initiation codon are in the same reading frame; and wherein said nucleotide sequence encodes a protein degradation signal.
- the inhibitory sequence may further comprise a nucleotide sequence downstream from the initiation codon, wherein the nucleotide sequence and the initiation codon are in the same reading frame; wherein said nucleotide sequence and said sequence encoding the exogenous protein of interest are in the same reading frame; and wherein said nucleotide sequence encodes an amino acid sequence; whereby when the amino acid sequence is fused to the exogenous protein of interest the biological function of the exogenous protein of interest is inhibited.
- the RNA of interest may further include a stop codon downstream from the initiation codon, wherein the stop codon and the initiation codon are in the same reading frame and wherein the exogenous RNA of interest further comprises an intron downstream from the stop codon, whereby the exogenous RNA of interest is a target for nonsense-mediated decay (NMD).
- NMD nonsense-mediated decay
- the inhibitory sequence may be located downstream from the sequence encoding the exogenous protein of interest and the inhibitory sequence comprises an RNA localization signal for subcellular localization or an endogenous miRNA binding site.
- the inhibitory sequence may be located upstream from the sequence encoding the exogenous protein of interest, wherein the inhibitory sequence is capable of forming a secondary structure, having a folding free energy of lower than -30 kcal/mol, whereby said secondary structure is sufficient to block scanning ribosomes from reaching the start codon of said exogenous protein of interest.
- the exogenous RNA of interest may further include an internal ribosome entry site (IRES) sequence downstream from the specific cleavage site and upstream from the sequence encoding the exogenous protein of interest, wherein the IRES sequence is more functional within the cleaved exogenous RNA of interest than within the intact exogenous RNA of interest.
- IRES internal ribosome entry site
- the exogenous RNA of interest may include a nucleotide sequence immediately upstream from the sequence encoding the exogenous protein of interest, wherein the nucleotide sequence comprises an internal ribosome entry site (IRES) sequence, which increases the efficiency of translation of said exogenous protein of interest in the cleaved exogenous RNA of interest.
- IRS internal ribosome entry site
- the RNA of interest may further include a nucleotide sequence comprising a cytoplasmic polyadenylation element, located immediately downstream from said sequence encoding the exogenous protein of interest, wherein said cytoplasmic polyadenylation element increases the efficiency of translation of said exogenous protein of interest in the cleaved exogenous RNA of interest.
- the composition may further include an additional polynucleotide sequence that encodes for an additional RNA molecule, said additional RNA molecule comprises at the 3' end a nucleotide sequence that is capable of binding to a sequence that is located upstream of said specific target site and downstream from the sequence encoding the exogenous protein of interest, wherein the additional RNA molecule, directly or indirectly, increases the efficiency of translation of said exogenous protein of interest in the cleaved exogenous RNA of interest.
- the composition may further comprise an additional polynucleotide sequence that encodes a cleaving component that is capable of effecting the cleavage, of said exogenous RNA of interest at a position that is located upstream from the inhibitory sequence, wherein said cleaving component(s) is selected from the group consisting of: a) a nucleic acid sequence that is located within said exogenous RNA of interest, wherein said nucleic acid sequence is selected from the group consisting of: a) endonuclease recognition site, endogenous miRNA binding site, cis acting ribozyme and miRNA sequence, wherein said nucleic acid sequence, directly or indirectly, reduces the efficiency of translation of said exogenous protein of interest in the exogenous RNA of interest; and b) an inhibitory RNA, wherein said inhibitory RNA is selected from the group consisting of: microRNA (miRNA), lariat-form RNA, short-hairpin RNA (shRNA), siRNA expression
- miRNA micro
- the exogenous RNA of interest and said functional RNA are capable of being located on the same or different polynucleotide molecules. In some embodiments, the exogenous RNA of interest, the functional RNA and the functional nucleic acid are capable of being located on one or more polynucleotide molecules.
- the one or more polynucleotides of the composition may be integrated into the cell genome.
- the cell may be selected from a group consisting of: human cell, animal cell, cultured cell and plant cell. In some embodiments, the cell may be present in an organism.
- a composition comprising one or more polynucleotides for directing specific expression of an exogenous protein of interest in a cell, wherein the exogenous protein of interest is expressed only in the presence of an endogenous signal RNA in a cell, the endogenous signal RNA being an RNA molecule which comprises a signal sequence, the signal sequence being any predetermined sequence of from 18 to 25 nucleotides in length, whereby introduction of said composition into a cell comprising said endogenous signal RNA directs the cleavage of an exogenous RNA of interest at a specific target site that is located within a specific sequence, which is of sufficient complementarity to hybridize with the predetermined signal sequence, wherein only after the cleavage of said exogenous RNA of interest in the cell, the exogenous protein of interest, which is encoded by said cleaved exogenous RNA of interest is capable of being expressed in the cell.
- the one or more polynucleotides includes a first polynucleotide sequence encoding said exogenous RNA of interest; a second polynucleotide sequence encoding a functional RNA capable of mediating the cleavage of the endogenous signal RNA at a predetermined cleavage site; and a third polynucleotide sequence encoding a carrier RNA.
- a method for killing a specific cell population which comprises an endogenous signal RNA
- the method comprises: introducing the cell with a composition comprising one or more polynucleotides for directing specific cleavage of an exogenous RNA of interest at a specific target site that is located within a specific sequence, which is of sufficient complementarity to hybridize with the endogenous signal RNA, the endogenous signal RNA being an RNA molecule which comprises a signal sequence, the signal sequence being any predetermined sequence of from 18 to 25 nucleotides in length; and wherein the cleavage of the exogenous RNA of interest in the cell, enables the expression of an exogenous protein of interest, capable of killing the cell population.
- the one or more polynucleotides comprises: a first polynucleotide sequence encoding said exogenous RNA of interest; a second polynucleotide sequence encoding a functional RNA capable of mediating the cleavage of the endogenous signal RNA at a predetermined cleavage site; and a third polynucleotide sequence encoding a carrier RNA.
- the endogenous signal RNA is a cellular mRNA, viral RNA, or both.
- the cell population may be is selected from a group consisting of: human cell, animal cell, cultured cell and plant cell. In some embodiments, the cell population is a neoplastic cell population. In some embodiments, the cell population is present in an organism.
- FIG. 1 is a general scheme of a model for biogenesis and activity of microRNAs (miRNAs) in a cell.
- miRNAs microRNAs
- FIG. 2 is a schematic drawing showing an example for cleaving exogenous RNA of interest in response to the presence of an endogenous signal RNA in a cell, according to some embodiments.
- the composition encodes for: a carrier RNA of 27 nucleotides; an exogenous RNA of interest that comprises a specific sequence which is complementary to a predetermined signal sequence of the endogenous signal RNA; and a functional RNA which is shRNA that is capable of effecting the cleavage of the endogenous signal RNA at the 5' end of the predetermined signal sequence.
- FIG. 3 is a schematic drawing showing an example for cleaving exogenous RNA of interest in response to the presence of an endogenous signal RNA in a cell, according to some embodiments.
- the composition of the invention encodes for:: a carrier RNA of 27 nucleotides, an exogenous RNA of interest that comprises a specific sequence which is complementary to the predetermined signal sequence of the endogenous signal RNA; and a functional RNA which is shRNA that is capable of effecting the cleavage of the endogenous signal RNA at the 3' end of the predetermined signal sequence.
- FIG. 1 is a schematic drawing showing an example for cleaving exogenous RNA of interest in response to the presence of an endogenous signal RNA in a cell, according to some embodiments.
- the composition of the invention encodes for:: a carrier RNA of 27 nucleotides, an exogenous RNA of interest that comprises a specific sequence which is complementary to the predetermined signal sequence of the endogenous signal RNA; and a
- the composition of the invention encodes for: an exogenous RNA of interest that comprises a specific sequence which is complementary to the predetermined signal sequence of the endogenous signal RNA, a functional RNA which is shRNA that is capable of effecting the cleavage of the endogenous signal RNA at the 5' end of the predetermined signal sequence, a carrier sequence that is of 27 nucleotides long and a functional nucleic acid which is cis acting ribozyme that is capable of effecting the cleavage of the carrier RNA at the 3' end of the carrier sequence.
- FIG. 5 is a schematic drawing showing an example for cleaving exogenous RNA of interest in response to the presence of an endogenous signal RNA in a cell, according to some embodiments.
- the composition of the invention encodes for: an exogenous RNA of interest that comprises a specific sequence which is complementary to the predetermined signal sequence of the endogenous signal RNA, a functional RNA which is shRNA that is capable of effecting the cleavage of the endogenous signal RNA at the 3' end of the predetermined signal sequence, a carrier sequence that is of 27 nucleotides long and a functional nucleic acid which is cis acting ribozyme that is capable of effecting the cleavage of the carrier RNA at the 5' end of the carrier sequence.
- FIG. 6A is a schematic drawing showing an example for inhibitory RNA that is capable of effecting the cleavage of the endogenous signal RNA at the 5' end of the predetermined signal sequence, according to some embodiments.
- FIG. 6B is a schematic drawing showing an example for inhibitory RNA that is capable of effecting the cleavage of the endogenous signal RNA at the 3' end of the predetermined signal sequence, according to some embodiments.
- FIG. 7A is a schematic drawing showing an example for inhibitory RNA that is capable of effecting the cleavage of the carrier RNA at the 3' end of the carrier sequence, according to some embodiments.
- FIG. 7B is a schematic drawing showing an example for inhibitory RNA that is capable of effecting the cleavage of the carrier RNA at the 5' end of the carrier sequence, according to some embodiments.
- FIG. 8A is a schematic drawing showing an example for inhibitory RNA which, according to some embodiments, is an RNA duplex that may be a substrate for Dicer.
- FIG. 8B is a schematic drawing showing an example for inhibitory RNA which, according to some embodiments, is an RNA duplex that may be a substrate for Dicer.
- FIG. 9A is a schematic drawing showing an example, according to some embodiments, for hammerhead-type ribozyme that is capable of effecting the cleavage of the endogenous signal RNA or the carrier RNA at the predetermined cleavage site or at the carrier cleavage site of, respectively.
- FIG. 9B is a schematic drawing showing an example, according to some embodiments, for hairpin-type ribozyme that is capable of effecting the cleavage of the endogenous signal RNA or the carrier RNA at the predetermined cleavage site or at the carrier cleavage site, respectively.
- FIG. 10 is a schematic drawing showing an example, according to some embodiments, of a functional nucleic acid that is the very efficient cis-acting hammerhead ribozyme - snorbozyme [22], which is capable of effecting the cleavage of the carrier RNA at the 3' end of the carrier sequence.
- FIG. 1 1 is a schematic drawing showing an example, according to some embodiments, of a functional nucleic acid that is the very efficient cis-acting hammerhead ribozyme - N1 17 [23] which is capable of effecting the cleavage of the carrier RNA at the 5' end of the carrier sequence.
- FIG. 12A is a schematic drawing showing an example, according to some embodiments, of a functional nucleic acid that is an endonuclease recognition site or an endogenous miRNA binding site, such that the functional nucleic acid is capable of effecting the cleavage of the carrier RNA at the 3' end of the carrier sequence.
- FIG. 12B is a schematic drawing showing an example, according to some embodiments, of a functional nucleic acid that is an endonuclease recognition site or an endogenous miRNA binding site, such that the functional nucleic acid is capable of effecting the cleavage of the carrier RNA at the 5' end of the carrier sequence.
- FIG. 12C is a schematic drawing showing an example, according to some embodiments, of a functional nucleic acid that is a miRNA sequence, such that the miRNA sequence is capable of effecting the cleavage of the carrier RNA at the 3' end of the carrier sequence.
- FIG. 12D is a schematic drawing showing an example, according to some embodiments, of a functional nucleic acid that is a miRNA sequence, such that the miRNA sequence is capable of effecting the cleavage of the carrier RNA at the 5' end of the carrier sequence.
- FIG. 13A is a schematic drawing showing an example, according to some embodiments, of a functional nucleic acid which is capable of forming stem loop structure with the carrier sequence, such that the stem loop structure is capable of effecting the cleavage of the carrier RNA at the 3' end of the carrier sequence.
- FIG. 13B is a schematic drawing showing an example, according to some embodiments, for functional nucleic acid which is capable of forming stem loop structure with the carrier sequence, such that the stem loop structure is capable of effecting the cleavage of the carrier RNA at the 5' end of the carrier sequence.
- FIG. 14A is a schematic drawing showing an example, according to some embodiments, for functional nucleic acid that is a stem loop structure, such that the loop comprises the carrier sequence and such that when the stem loop structure is processed by Drosha and Dicer the carrier sequence is detached from the stem loop structure and the siRNA duplex that formed is the functional RNA and is capable of effecting the cleavage of the endogenous signal RNA at the predetermined cleavage site.
- FIG. 14B is a schematic drawing showing an example, according to some embodiments, of a functional nucleic acid that is a stem loop structure, such that the loop comprises the carrier sequence and such that the expression of the stem loop structure is driven by polymerase I or III based promoter and such that when the stem loop structure is processed by Dicer the carrier sequence is detached from the stem loop structure and the siRNA duplex that is formed is the functional RNA and is capable of effecting the cleavage of the endogenous signal RNA at the predetermined cleavage site.
- FIG. 15 A is a schematic drawing showing an example, according to some embodiments, of a carrier sequence that is located in the same RNA duplex with the functional RNA, such that the double strand region is located downstream from the carrier sequence and such that when the double strand region is processed by Dicer the carrier sequence is detached from the RNA duplex and the siRNA duplex that is formed is the functional RNA and is capable of effecting the cleavage of the endogenous signal RNA at the predetermined cleavage site.
- FIG. 15B is a schematic drawing showing an example, according to some embodiments, for a carrier sequence that is located in the same RNA duplex with the functional RNA, such that the double strand region is located upstream from the carrier sequence and such that when the double strand region is processed by Dicer the carrier sequence is detached from the RNA duplex and the siRNA duplex that is formed is the functional RNA which is capable of effecting the cleavage of the endogenous signal RNA at the predetermined cleavage site.
- FIG. 15B is a schematic drawing showing an example, according to some embodiments, for a carrier sequence that is located in the same RNA duplex with the functional RNA, such that the double strand region is located upstream from the carrier sequence and such that when the double strand region is processed by Dicer the carrier sequence is detached from the RNA duplex and the siRNA duplex that is formed is the functional RNA which is capable of effecting the cleavage of the endogenous signal RNA at the predetermined cleavage site.
- FIG. 15B
- 16A is a schematic drawing showing an example, according to some embodiments, for a carrier RNA that is located in the same RNA duplex with the functional RNA, such that the double strand region is located at the 5' end of the carrier RNA and such that when the double strand region is processed by Dicer, the sequence that is located at the 3' end of the carrier RNA is detached from the RNA duplex and the siRNA duplex that is formed is the functional RNA, which is capable of effecting the cleavage of the endogenous signal RNA at the predetermined cleavage site.
- FIG. 16B is a schematic drawing showing an example, according to some embodiments, of a carrier RNA that is located in the same RNA duplex with the functional RNA, such that the double strand region is located at the 3' end of the carrier RNA and such that when the double strand region is processed by Dicer, the sequence that is located at the 5' end of the carrier RNA is detached from the RNA duplex and the siRNA duplex that is formed is the functional RNA, which is capable of effecting the cleavage of the endogenous signal RNA at the predetermined cleavage site.
- FIG. 17A is a schematic drawing showing an example, according to some embodiments, for the carrier sequence that is located in the same RNA duplex with the functional RNA, such that the double strand region is located upstream from the carrier sequence and such that when the double strand region is processed by Dicer, the siRNA duplex that is formed is the functional RNA, which is capable of effecting the cleavage of the endogenous signal RNA at the predetermined cleavage site.
- FIG. 17B is a schematic drawing showing an example, according to some embodiments, of a carrier sequence that is located in the same RNA duplex with the functional RNA, such that the double strand region is located downstream from the carrier sequence and such that when the double strand region is processed by Dicer, the siRNA duplex that is formed is the functional RNA, which is capable of effecting the cleavage of the endogenous signal RNA at the predetermined cleavage site.
- FIG. 18A is a schematic drawing showing an example, according to some embodiments, of a carrier sequence that is located in the same RNA duplex with the functional nucleic acid, such that the double strand region is located upstream from the carrier sequence and such that when the double strand region is processed by Dicer, the siRNA duplex that is formed is the functional nucleic acid which is capable of effecting the cleavage of the carrier RNA at the carrier cleavage site.
- FIG. 18A is a schematic drawing showing an example, according to some embodiments, of a carrier sequence that is located in the same RNA duplex with the functional nucleic acid, such that the double strand region is located upstream from the carrier sequence and such that when the double strand region is processed by Dicer, the siRNA duplex that is formed is the functional nucleic acid which is capable of effecting the cleavage of the carrier RNA at the carrier cleavage site.
- 18B is a schematic drawing showing an example, according to some embodiments, for carrier sequence that is located in the same RNA duplex with the functional nucleic acid, such that the double strand region is located downstream from the carrier sequence and such that when the double strand region is processed by Dicer, the siRNA duplex that is formed is the functional nucleic acid, which and is capable of effecting the cleavage of the carrier RNA at the carrier cleavage site.
- FIG. 19A is a schematic drawing illustrating an example, according to some embodiments, of a carrier sequence that is located in the same RNA duplex with the functional nucleic acid and with the functional RNA, such that the double strand region is located upstream from the carrier sequence, and such that when the double strand region is processed by Dicer, the siRNA duplexes that are formed are the functional nucleic acid and the functional RNA.
- FIG. 19B is a schematic drawing illustrating an example, according to some embodiments, of a carrier sequence that is located in the same RNA duplex with the functional nucleic acid and with the functional RNA, such that the double strand region is located downstream from the carrier sequence and such that when the double strand region is processed by Dicer the siRNA duplexes that are formed are the functional nucleic acid and the functional RNA.
- FIG. 20A is a schematic drawing showing an example, according to some embodiments, of a carrier RNA that comprises 3 contiguous carrier sequences downstream from the carrier sequence, such that the functional nucleic acid is capable of effecting the cleavage of the carrier RNA at the 3' end of the carrier sequence.
- FIG. 20B is a schematic drawing showing an example, according to some embodiments, for carrier RNA that comprises 3 contiguous carrier sequences upstream from the carrier sequence, such that the functional nucleic acid is capable of effecting the cleavage of the carrier RNA at the 5' end of the carrier sequence.
- FIG. 21 A is a schematic drawing showing an example, according to some embodiments, for polynucleotide molecule(s) of the composition that, in addition to the functional RNA that cleaves the 5' end of the predetermined signal sequence, further transcribes an additional functional RNA that cleaves the 3' end of the predetermined signal sequence.
- FIG. 21 B is a schematic drawing showing an example, according to some embodiments, for polynucleotide molecule(s) of the composition that, in addition to the functional RNA that cleaves the 3' end of the predetermined signal sequence, further transcribes an additional functional RNA that cleaves the 5' end of the predetermined signal sequence.
- FIG. 22A is a schematic drawing showing an example, according to some embodiments, of the schematic structure of an exogenous RNA of interest that is activated by its cleavage, such that the specific sequence is located downstream from the inhibitory sequence and upstream from the sequence encoding the exogenous protein of interest.
- FIG. 22B is a schematic drawing showing an example, according to some embodiments, of the schematic structure exogenous RNA of interest that is activated by its cleavage, such that the specific sequence is located upstream from the inhibitory sequence and downstream from the sequence encoding the exogenous protein of interest.
- FIG. 23A is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest, and comprises an AUG that is not in the same reading frame with the sequence encoding exogenous protein of interest.
- FIG. 23B is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest, and comprises a Kozak consensus sequence (5'-ACCAUGG-3') that is not in the same reading frame with the sequence encoding exogenous protein of interest.
- FIG. 23C is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest, and comprises 2 Kozak consensus sequences that are not in the same reading frame with the sequence encoding exogenous protein of interest.
- FIG. 24A is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest, and comprises an AUG and a downstream stop codon that are in the same reading frame.
- FIG. 24B is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest, and comprises an AUG and a downstream: sorting signal for subcellular localization or protein degradation signal.
- FIG. 24C is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest, and comprises an AUG and a downstream sequence encoding amino acids that are capable of inhibiting the biological function of the downstream protein of interest.
- FIG. 24D is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest, and comprises an AUG, a downstream stop codon that is in the same reading frame with the AUG and a downstream intron, such that the exogenous RNA of interest is a target for nonsense-mediated decay (NMD).
- NMD nonsense-mediated decay
- FIG. 25A is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest and comprises a binding site for translation repressor.
- FIG. 25B is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest and comprises an RNA localization signal for subcellular localization.
- FIG. 25C is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest and comprises an RNA destabilizing element that is an AU-rich element or an endonuclease recognition site.
- FIG. 25D is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest, and comprises a secondary structure.
- FIG. 26 is a schematic drawing showing an example, according to some embodiments, for the activation of the exogenous RNA of interest by its cleavage, such that the inhibitory sequence creates a secondary structure that blocks translation and such that the cleavage creates an IRES (Internal ribosome entry site).
- IRES Internal ribosome entry site
- FIG. 27A is a schematic drawing showing an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest, that is cleaved at the 5' end, wherein the additional structure is an IRES (Internal ribosome entry site).
- IRES Internal ribosome entry site
- FIG. 27B is a schematic drawing showing an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest that is cleaved at the 5' end, wherein the additional structure is a stem loop structure.
- FIG. 27C is a schematic drawing showing an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest, that is cleaved at the 5' end, wherein the additional structure is a cytoplasmic polyadenylation element.
- FIG. 27D is a schematic drawing showing an example, according to some embodiments, of additional structures that may increase the efficiency of translation of the exogenous RNA of interest, which is cleaved at the 5' end, wherein the additional structures are nucleotide sequences that are capable of binding to each other and by this force the exogenous RNA of interest to form a circular structure, particularly when the exogenous RNA of interest is cleaved at the specific target/cleavage site.
- FIG. 28A is a schematic drawing showing an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest, that is cleaved at the 5' end, such that the additional structure is a polypeptide that is encoded from the composition of the invention, wherein the polypeptide is capable of binding to the poly-A tail of the exogenous RNA of interest, and to a sequence within the exogenous RNA of interest of the invention and by this force the exogenous RNA of interest to form a circular structure, particularly when the exogenous RNA of interest is cleaved at the specific target/cleavage site.
- additional structure is a polypeptide that is encoded from the composition of the invention, wherein the polypeptide is capable of binding to the poly-A tail of the exogenous RNA of interest, and to a sequence within the exogenous RNA of interest of the invention and by this force the exogenous RNA of interest to form a circular structure, particularly when the exogenous RNA of
- FIG. 28B is a schematic drawing illustrating an example, according to some embodiments, of additional structure that may reduce the efficiency of translation of the intact exogenous RNA of interest, such that the additional structure is a cis acting ribozyme that removes the CAP structure from the intact exogenous RNA of interest.
- FIG. 29A is a schematic drawing illustrating an example, according to some embodiments, of inhibitory sequence that is located downstream from the specific target/cleavage site and comprises an intron, such that the exogenous RNA of interest is a target for nonsense-mediated decay (NMD).
- NMD nonsense-mediated decay
- FIG. 29B is a schematic drawing illustrating an example, according to some embodiments, of inhibitory sequence that is located downstream from the specific target/cleavage site and comprises a binding site for translation repressor.
- FIG. 29C is a schematic drawing illustrating an example, according to some embodiments, of inhibitory sequence that is located downstream from the specific target/cleavage site and comprises an RNA localization signal for subcellular localization.
- FIG. 29D is a schematic drawing illustrating an example, according to some embodiments, of an inhibitory sequence that is located downstream from the specific target/cleavage site and comprises an RNA destabilizing element that is an AU-rich element or an endonuclease recognition site.
- FIG. 29E is a schematic drawing illustrating an example, according to some embodiments, of an inhibitory sequence that is located downstream from the specific target/cleavage site and comprises a secondary structure.
- FIG. 30A is a schematic drawing illustrating an example, according to some embodiments, for inhibitory sequence that is located downstream from the sequence encoding exogenous protein of interest, such that the inhibitory sequence creates a secondary structure that may block translation.
- FIG. SOB is a schematic drawing illustrating an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest that is cleaved at the 3' end, such that the additional structure is IRES (Internal ribosome entry site).
- IRES Internal ribosome entry site
- FIG. 30C is a schematic drawing illustrating an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest, that is cleaved at the 3' end, such that the additional structure is a stem loop structure.
- FIG. 30D is a schematic drawing illustrating an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest that is cleaved at the 3 ' end, such that the additional structure is a cytoplasmic polyadenylation element.
- FIG. 31 A is a schematic drawing illustrating an example, according to some embodiments, of additional structures that may increase the efficiency of translation of the exogenous RNA of interest, that is cleaved at the 3 ' end, such that the additional structures are nucleotide sequences that are capable of binding to each other and consequently force the exogenous RNA of interest to form a circular structure, particularly when the exogenous RNA of interest is cleaved at the specific target/cleavage site.
- FIG. 31 B is a schematic drawing illustrating an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest, that is cleaved at the 3' end, such that the additional structure is a polypeptide that is encoded from the composition, wherein the polypeptide is capable of binding to the CAP and to a sequence within the exogenous RNA of interest and consequently force the exogenous RNA of interest to form a circular structure, particularly when the exogenous RNA of interest is cleaved at the specific target/cleavage site.
- FIG. 31 C is a schematic drawing illustrating an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest that is cleaved at the 3' end, such that the additional structure is an additional RNA molecule that is encoded from the composition and is capable of binding to the exogenous RNA of interest an consequently provide it with a poly-A tail, particularly when the exogenous RNA of interest is cleaved at the specific target/cleavage site.
- FIG. 3 ID is a schematic drawing illustrating an example, according to some embodiments, of additional structure that may reduce the efficiency of translation of the intact exogenous RNA of interest, such that the additional structure is a cis acting ribozyme that removes the poly-A from the intact exogenous RNA of interest.
- FIG. 32A is a schematic drawing illustrating an example, according to some embodiments, of the structure of the exogenous RNA of interest, which comprises 2 specific sequences, such that the inhibitory sequence is located upstream from the specific target/cleavage sites.
- FIG. 32B is a schematic drawing illustrating an example, according to some embodiments, of the structure of the exogenous RNA of interest that comprises 2 specific sequences, such that the inhibitory sequence is located downstream from the specific target/cleavage sites.
- FIG. 32C is a schematic drawing illustrating an example, according to some embodiments, of an exogenous RNA of interest, which comprises a sequence encoding an exogenous protein of interest, between 2 sequences that are complementary to the predetermined signal sequence and 2 inhibitory sequences, one at the 5' end and other at the 3 ' end of the exogenous RNA of interest.
- FIG. 33 is a schematic drawing illustrating an example, according to some embodiments, for expressing exogenous protein of interest in response to the presence of an endogenous signal RNA in a cell.
- the composition includes polynucleotide molecule/s that encode for an exogenous RNA of interest molecule that comprises a first sequence of 27 nucleotides at the 5' end that is 100% complementary to the predetermined signal sequence and to a sequence that is upstream from the predetermined signal sequence, the first sequence also comprises an 5'-AUG-3' sequence that is not in the same reading frame with the downstream sequence encoding the exogenous protein of interest and the composition further encodes a functional RNA which is shRNA that is capable of effecting the cleavage of the endogenous signal RNA at the 3' end of the predetermined signal sequence.
- the composition includes polynucleotide molecule/s that encode for an exogenous RNA of interest molecule that comprises at the 5' end a miRNA that is capable of effecting the cleavage of the endogenous signal RNA at the 3' end of the predetermined signal sequence and a first sequence of 27 nucleotides that is complementary to the predetermined signal sequence and to the sequence that is upstream from the predetermined signal sequence, the first sequence also comprises an 5'-AUG-3' sequence that is not in the same reading frame with the downstream sequence encoding the exogenous protein of interest and such that the 5'- AUG-3' is located within a Kozak consensus sequence.
- FIG. 35 is a schematic drawing illustrating an example, according to some embodiments, for expressing an exogenous protein of interest in response to the presence of an endogenous signal RNA in a cell.
- the composition encodes for an exogenous RNA of interest molecule that comprises at the 5 ' end a first strand of siRNA, such that composition further transcribes the second strand of the siRNA by polymerase I or III based promoter.
- the first sequence of the exogenous RNA of interest molecule is 27 nucleotides in length and is complementary to the predetermined signal sequence and to the sequence that is upstream from the predetermined signal sequence, the first sequence also comprises an 5' -AUG-3' sequence that is not in the same reading frame with the downstream sequence encoding the exogenous protein of interest, such that the 5'-AUG-3' is located within a Kozak consensus sequence.
- FIG. 36A is a schematic drawing illustrating an example, according to some embodiments, of an exogenous RNA of interest that comprises a cis acting ribozyme at the 5' end, which removes the CAP structure from the exogenous RNA of interest. This removal reduces the efficiency of translation of the exogenous protein of interest in the intact exogenous RNA of interest molecule.
- FIG. 36B is a schematic drawing illustrating an exemplary exogenous RNA of interest that comprises two nucleotide sequences that are capable of binding to each other and by this force the exogenous RNA of interest to form a circular structure that increases the efficiency of translation of the protein of interest particularly in the cleaved RNA of interest.
- FIG. 37A is a schematic drawing illustrating an example, according to some embodiments, for cleaving exogenous RNA of interest in the presence of an endogenous signal RNA in a cell.
- the composition encodes for: a carrier RNA of 27 nucleotides and an exogenous RNA of interest that comprises a specific sequence which is complementary to the predetermined signal sequence.
- FIG. 37B is a schematic drawing illustrating an example, according to some embodiments, for cleaving exogenous RNA of interest in the presence of an endogenous signal RNA in a cell.
- the composition encodes for: an exogenous RNA of interest that comprises a specific sequence which is complementary to the predetermined signal sequence; a carrier sequence that is of 27 nucleotides long and a functional nucleic acid which is a cis acting ribozyme that is capable of effecting the cleavage of the carrier RNA sequence at the 3' end of the carrier sequence.
- FIG. 38A is a schematic drawing illustrating an example, according to some embodiments, for cleaving exogenous RNA of interest in the presence of an endogenous signal RNA in a cell.
- the composition of the invention encodes for a carrier RNA of 27 nucleotides and an exogenous RNA of interest that comprises a specific sequence which is complementary to the predetermined signal sequence.
- FIG. 38B is a schematic drawing illustrating an example, according to some embodiments, for cleaving exogenous RNA of interest in the presence of an endogenous signal RNA in a cell.
- the composition encodes for: an exogenous RNA of interest that includes a specific sequence which is 100% complementary to the predetermined signal sequence, a carrier sequence that is of 27 nucleotides long and a functional nucleic acid which is a cis acting ribozyme that is capable of effecting the cleavage of the carrier RNA sequence at the 5' end of the carrier sequence.
- FIG. 39A is a schematic drawing illustrating an example, according to some embodiments, of an exogenous RNA of interest having its inhibitory sequence located downstream from the specific target/cleavage site and theinhibitory sequence is capable of inhibiting the function of an RNA localization signal for subcellular localization.
- FIG. 39B is a schematic drawing illustrating an example, according to some embodiments, of an exogenous RNA of interest having its inhibitory sequence located upstream from the specific target/cleavage site and it's the inhibitory sequence is capable of inhibiting the function of an RNA localization signal for subcellular localization.
- FIG. 39C is a schematic drawing illustrating an example, according to some embodiments, of an exogenous RNA of interest, having its inhibitory sequence located upstream from the specific target/cleavage site, and comprises an AUG and a downstream sequence that encodes for amino acids that are capable of inhibiting the function of the sorting signal for subcellular localization of the exogenous protein of interest, encoded from the exogenous protein of interest.
- FIG. 39D is a schematic drawing illustrating an example, according to some embodiments, of inhibitory sequence that is located downstream from the specific sequence, such that the exogenous RNA of interest does not comprise a stop codon downstream from the start codon of the sequence encoding the exogenous protein of interest, and such that the inhibitory sequence encodes an amino acid sequence that is capable of inhibiting the cleavage of a peptide sequence that is encoded upstream, wherein the peptide sequence is capable of being cleaved by a protease in a mammalian cell.
- FIG. 40 is a schematic drawing illustrating an example for using the composition of the invention to kill cancer cells of a specific patient, according to some embodiments.
- FIG. 41 is a schematic drawing illustrating an example for using the composition of the invention to kill cancer cells of Burkitt's lymphomas, Hodgkin's lymphomas, gastric carcinoma and nasopharyngeal carcinoma, which are latently infected with EBV by using the LMP1 mRNA as the endogenous signal RNA, , according to some embodiments .
- FIG. 42 is a schematic drawing illustrating an example for using the composition of the invention to kill HIV-1 infected cells, according to some embodiments.
- FIG. 43 is a schematic drawing illustrating an example for using the composition of the invention to kill HSV-1 infected cells, according to some embodiments.
- FIG. 44 is a schematic drawing illustrating an example for using the composition of the invention to kill cancer cells of a specific patient, according to some embodiments.
- polynucleotide molecules As referred to herein, the terms “polynucleotide molecules”, “oligonucleotide”, “polynucleotide”, “nucleic acid” and “nucleotide” sequences may interchangeably be used herein.
- the terms are directed to polymers of deoxyribonucleotides (DNA), ribonucleotides (RNA), and modified forms thereof in the form of a separate fragment or as a component of a larger construct, linear or branched, single stranded, double stranded, triple stranded, or hybrids thereof.
- the term also encompasses RNA/DNA hybrids.
- the polynucleotides may include sense and antisense oligonucleotide or polynucleotide sequences of DNA or RNA.
- the DNA or RNA molecules may be, for example, but not limited to: complementary DNA (cDNA), genomic DNA, synthesized DNA, recombinant DNA, or a hybrid thereof or an RNA molecule such as, for example, mRNA, shRNA, siRNA, miRNA, and the like.
- cDNA complementary DNA
- RNA molecules such as, for example, mRNA, shRNA, siRNA, miRNA, and the like.
- the terms "polynucleotide molecules”, “oligonucleotide”, “polynucleotide”, “nucleic acid” and “nucleotide” sequences are meant to refer to both DNA and RNA molecules.
- the terms further include oligonucleotides composed of naturally occurring bases, sugars, and covalent internucleoside linkages, as well as oligonucle
- polypeptide peptide
- protein protein
- amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
- the term "complementarity" is directed to base pairing between strands of nucleic acids.
- each strand of a nucleic acid may be complementary to another strand in that the base pairs between the strands are non-covalently connected via two or three hydrogen bonds.
- Two nucleotides on opposite complementary nucleic acid strands that are connected by hydrogen bonds are called a base pair.
- adenine (A) forms a base pair with thymine (T) and guanine (G) with cytosine (C).
- thymine is replaced by uracil (U).
- the degree of complementarity between two strands of nucleic acid may vary, according to the number (or percentage) of nucleotides that form base pairs between the strands. For example, “ 100% complementarity” indicates that all the nucleotides in each strand form base pairs with the complement strand. For example, “95% complementarity” indicates that 95% of the nucleotides in each strand from base pair with the complement strand.
- the term sufficient complementarity may include any percentage of complementarity from about 30% to about 100%.
- construct refers to an artificially assembled or isolated nucleic acid molecule which may include one or more nucleic acid sequences, wherein the nucleic acid sequences may include coding sequences (that is, sequence which encodes an end product), regulatory sequences, non-coding sequences, or any combination thereof.
- construct includes, for example, vector but should not be seen as being limited thereto.
- Expression vector refers to vectors that have the ability to incorporate and express heterologous nucleic acid fragments (such as, for example, DNA), in a foreign cell.
- an expression vector comprises nucleic acid sequences/fragments (such as DNA, mRNA, tRNA, rRNA), capable of being transcribed.
- nucleic acid sequences/fragments such as DNA, mRNA, tRNA, rRNA
- Many prokaryotic and eukaryotic expression vectors are known and/or commercially available. Selection of appropriate expression vectors is within the knowledge of those having skill in the art.
- Upstream and Downstream refers to a relative position in a nucleotide sequence, such as, for example, a DNA sequence or an RNA sequence.
- a nucleotide sequence has a 5' end and a 3' end, so called for the carbons on the sugar (deoxyribose or ribose) ring of the nucleotide backbone.
- downstream relates to the region towards the 3' end of the sequence.
- upstream relates to the region towards the 5' end of the strand.
- promoter element refers to a nucleotide sequence that is generally located at the 5' end (that is, precedes, located upstream) of the coding sequence and functions as a switch, activating the expression of a coding sequence. If the coding sequence is activated, it is said to be transcribed. Transcription generally involves the synthesis of an RNA molecule (such as, for example, a mRNA) from a coding sequence.
- the promoter therefore, serves as a transcriptional regulatory element and also provides a site for initiation of transcription of the coding sequence into mRNA.
- Promoters may be derived in their entirety from a native source, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic nucleotide segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions, or at various expression levels. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”. Promoters that derive gene expression in a specific tissue are called “tissue specific promoters”. As referred to herein, the terms "RNA of interest”, “exogenous RNA of interest”, and “ROI” may interchangeably be used. The terms refer to a nucleotide sequence which is introduced into a target cell and may encode for an RNA molecule within the target cell.
- protein of interest As referred to herein, the terms “protein of interest”, “exogenous protein of interest”, and “POI” may interchangeably be used.
- the terms refer to a peptide sequence which is translated from the exogenous RNA of interest.
- the terms “signal RNA” and “endogenous signal RNA” may interchangeably be used.
- the terms refer to an intracellular RNA molecule/sequence which comprises a predetermined signal sequence.
- the endogenous RNA molecule may be encoded by the genome of the cell, and/or from a foreign genome residing within the cell, such as, for example, from a virus residing within the cell.
- the endogenous signal RNA is a mature mRNA molecule.
- the endogenous signal RNA is a viral RNA. The signal RNA is present within the target cell prior to introduction of an exogenous RNA of interest into the cell.
- predetermined signal sequence As referred to herein, the terms “predetermined signal sequence” and “signal sequence” may interchangeably be used.
- predetermined cleavage site and “an additional cleavage site”, refer to a cleavage site within the sequence of the endogenous signal RNA.
- telomere sequence As referred to herein, the terms “specific target site”, “specific cleavage site” and “specific target/cleavage sites” may interchangeably be used. The terms relate to one or more cleavage sites within the sequence of the exogenous RNA of interest.
- the term "expression”, as used herein, refers to the production of a desired end-product molecule in a target cell.
- the end-product molecule may include, for example an RNA molecule (such as, for example, a mRNA molecule, siRNA molecule, and the like); a peptide or a protein; and the like; or combinations thereof.
- ORF Open Reading Frame
- Kozak sequence is well known in the art and is directed to a sequence on an mRNA molecule that is recognized by the ribosome as the translational start site.
- the terms "Kozak consensus sequence”, “Kozak consensus” or “Kozak sequence” is a sequence which occurs on eukaryotic mRNA and has the consensus (gcc)gccRccAUGG, where R is a purine (adenine or guanine), three bases upstream of the start codon (AUG), which is followed by another 'G'.
- introducing and “transfection” may interchangeably be used and refer to the transfer of molecules, such as, for example, nucleic acids, polynucleotide molecules, vectors, and the like into a target cell(s), and more specifically into the interior of a membrane-enclosed space of a target cell(s).
- the molecules can be "introduced” into the target cell(s) by any means known to those of skill in the art, for example as taught by Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York (2001), the contents of which are incorporated by reference herein.
- Means of "introducing" molecules into a cell include, for example, but are not limited to: heat shock, calcium phosphate transfection, PEI transfection, electroporation, lipofection, transfection reagent(s), viral- mediated transfer, and the like, or combinations thereof.
- the transfection of the cell may be performed on any type of cell, of any origin, such as, for example, human cells, animal cells, plant cells, and the like.
- the cells may include isolated cells, tissue cultured cells, cell lines, cells present within an organism body, and the like.
- the term "Kill" with respect to a cell/cell population is directed to include any type of manipulation that will lead to the death of that cell/cell population.
- Treating a disease or “treating a condition” is directed to administering a composition, which includes at least one reagent (which may include, for example, one or more polynucleotide molecules, one or more expression vectors, one or more substance/ingredient, and the like), effective to ameliorate symptoms associated with a disease, to lessen the severity or cure the disease, or to prevent the disease from occurring.
- Administration may include any administration route.
- Detection refers to methods of detection of a disease, symptom, disorder, pathological or normal condition; classifying a disease, symptom, disorder, pathological condition; determining a severity of a disease, symptom, disorder, pathological condition; monitoring disease, symptom, disorder, pathological condition progression; forecasting an outcome and/or prospects of recovery thereof.
- a composition for directing cleavage of exogenous RNA of interest in response to the presence of an endogenous signal RNA in a cell is provided.
- the exogenous RNA of interest is encoded from the composition.
- the endogenous signal RNA is an RNA molecule which comprises a predetermined signal sequence, such that the predetermined signal sequence is a random sequence of from 18 to 25 nucleotides in length.
- the composition comprises one or more polynucleotide molecules that comprise:
- RNA sequence (a) a polynucleotide sequence encoding the exogenous RNA of interest, such that the exogenous RNA of interest is an RNA sequence that comprises a specific sequence which is of sufficient complementarity to the predetermined signal sequence to direct target-specific RNA interference;
- RNA RNA molecule that is at least about 18 nucleotides in length and is consisting essentially of:
- the functional RNA effects the cleavage, directly or indirectly, of the endogenous signal RNA at the 5' end of the predetermined signal sequence and then the carrier RNA is hybridized to the edge sequence at the cleaved endogenous signal RNA and directs the processing of the predetermined signal sequence and then the processed predetermined signal sequence directs the cleavage of the exogenous RNA of interest at a specific target/cleavage site that is located within the specific sequence.
- the composition comprises one or more polynucleotide molecules that comprise:
- RNA sequence (a) a polynucleotide sequence encoding the exogenous RNA of interest, such that the exogenous RNA of interest is an RNA sequence that comprises a specific sequence which is of sufficient complementarity to the predetermined signal sequence to direct target-specific RNA interference;
- RNA RNA molecule that is at least about 18 nucleotides in length and is consisting essentially of:
- the functional RNA effects the cleavage, directly or indirectly, of the endogenous signal RNA at the 3' end of the predetermined signal sequence and then the carrier RNA is hybridized to the edge sequence at the cleaved endogenous signal RNA and directs the processing of the predetermined signal sequence and then the processed signal sequence directs the cleavage of the exogenous RNA of interest at a specific target/cleavage site that is located within the specific sequence. For example, see FIG. 3.
- composition comprises one or more polynucleotide molecules that comprise:
- RNA sequence (a) a polynucleotide sequence encoding the exogenous RNA of interest, such that the exogenous RNA of interest is an RNA sequence that comprises a specific sequence which is of sufficient complementarity to the predetermined signal sequence to direct target-specific RNA interference;
- RNA carrier sequence comprising a carrier sequence that is at least about 18 nucleotides in length and is consisting essentially of:
- the functional RNA effects the cleavage, directly or indirectly, of the endogenous signal RNA at the 5' end of the predetermined signal sequence and the functional nucleic acid effects the cleavage, directly or indirectly, of the carrier RNA at the 3' end of the carrier sequence.
- the cleaved carrier RNA sequence is hybridized to the edge sequence at the cleaved endogenous signal RNA and directs the processing of the predetermined signal sequence.
- the processed signal sequence may direct the cleavage of the exogenous RNA of interest at a specific target/cleavage site that is located within the specific sequence. For example, see FIG. 4.
- the composition comprises one or more polynucleotide molecules that comprise: (a) a polynucleotide sequence encoding the exogenous RNA of interest, such that the exogenous RNA of interest is an RNA sequence that comprises a specific sequence which is of sufficient complementarity to the predetermined signal sequence to direct target-specific RNA interference;
- the functional RNA effects the cleavage, directly or indirectly, of the endogenous signal RNA at the 3' end of the predetermined signal sequence and the functional nucleic acid effects the cleavage, directly or indirectly, of the carrier RNA sequence at the 5' end of the carrier sequence.
- the cleaved carrier RNA sequence may then hybridize to the edge sequence at the cleaved endogenous signal RNA and direct the processing of the predetermined signal sequence.
- the processed predetermined signal sequence may direct the cleavage of the exogenous RNA of interest at a specific target/cleavage site that is located within the specific sequence. For example, see FIG. 5.
- the predetermined signal sequence may be chosen due to its presence within specific target cells, thereby providing a mechanism for targeting the cleavage of the exogenous RNA of interest in selected cells.
- the specific target cells may include any type of cells.
- the specific target cells may include such cells as, but not limited to: benign or malignant neoplasms.
- each tumor comprises mutations in 90 protein-coding genes [16].
- Each tumor is initiated from a single founder cell [38], thus it is most probable that at least one of these mutant genes is transcribed into mRNA.
- the specific cells may also include, but are not limited to viral infected cells. Specificity may be achieved by modification of the sequences that encode the functional RNA, carrier RNA and/or the specific sequence in the exogenous RNA of interest.
- the predetermined signal sequence may include an endogenous miRNA
- the predetermined signal sequence of the present invention does not include an endogenous cellular miRNA molecule or any other type of endogenous RNA molecule (such as, for example, shRNA, ribozyme, stRNA, and the like), that is able to direct or effect cleavage of an RNA molecule within the cell.
- an endogenous cellular miRNA molecule or any other type of endogenous RNA molecule (such as, for example, shRNA, ribozyme, stRNA, and the like), that is able to direct or effect cleavage of an RNA molecule within the cell.
- the predetermined signal sequence cannot induce/effect cleavage in the absence of one or more components of the composition of the invention.
- the carrier RN A/sequence of embodiments of the may be hybridized to the cleaved endogenous signal RNA portion that includes the predetermined signal sequence. It has been reported that in a cell, two RNA transcripts of about 23 nucleotides in length that have a complementary region of about 19 nucleotides in length at the 5' end are hybridized to each other and are capable of directing target specific RNA interference [7].
- the duplex that comprises the carrier RNA and the cleaved endogenous signal RNA portion that includes the predetermined signal sequence may be a substrate for Dicer and thereafter for Rise. It has been reported that a dsRNA of 52 nucleotides long that further comprises 20 nucleotides long ssRNA at one of the 3' ends is a substrate for a Dicer at the blunt end [8]. It has also been reported that in mammalian cells, Rise is coupled to Dicer [9].
- the functional RNA described in previous embodiments above (section 1) is:
- an inhibitory RNA comprising a sequence of from 18 to 25 nucleotides in length which is of sufficient complementarity to a target sequence for the inhibitory RNA to direct cleavage of the endogenous signal RNA at the predetermined cleavage site via, for example, RNA interference, such that the target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a region within the endogenous signal RNA, such that the region is located from about 25 nucleotides downstream from the predetermined cleavage site to about 25 nucleotides upstream from the predetermined cleavage site; or
- a ribozyme capable of binding to the region of (i) and effecting the cleavage of the endogenous signal RNA at the predetermined cleavage site).
- the region of (i) that is described in the former embodiment may be located from about 1 1 nucleotides downstream from the predetermined cleavage site to about 12 nucleotides upstream from the predetermined cleavage site. In one embodiment, the region of (i) that is located from about 10 nucleotides downstream from the predetermined cleavage site to about 1 1 nucleotides upstream from the predetermined cleavage site. For example, see FIG 6A, 6B.
- (section 1 ) is: (i) an inhibitory RNA comprising a sequence of from 18 to 25 nucleotides in length which is of sufficient complementarity to a target sequence for the inhibitory RNA to direct cleavage of the carrier RNA sequence at the carrier cleavage site via, for example, RNA interference, whereby the target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a region within the carrier RNA and wherein the region is located from about 25 nucleotides downstream from the carrier cleavage site to about 25 nucleotides upstream from the carrier cleavage site; or
- the region of (i) that is described in the former embodiment is located from about 1 1 nucleotides downstream from the carrier cleavage site to about 12 nucleotides upstream from the carrier cleavage site. In another embodiment, the region of (i) is located from about 10 nucleotides downstream from the carrier cleavage site to about 1 1 nucleotides upstream from the carrier cleavage site. For example, see FIG 7A, 7B.
- the inhibitory RNA of (i), described above may include, but is not limited to: antisense RNA, double-stranded RNA (dsRNA) and/or small- interfering RNA (siRNA).
- the inhibitory RNA of (i) may include, but is not limited to: microRNA (miRNA), lariat-form RNA, short-hairpin RNA (shRNA) and/or siRNA expression domain.
- the inhibitory RNA of (i) that comprises:
- RNA molecule that comprises a nucleic acid sequence at the 5' or 3' end, such that the nucleic acid sequence is of sufficient complementarity to the target sequence of (i) to direct target-specific RNA interference;
- RNA molecule that comprises a nucleotide sequence that is capable of binding to the nucleic acid sequence, such that the nucleotide sequence is 18-25 nucleotides in length and such that the nucleotide sequence is located at the 5' or 3' end of the second RNA molecule.
- the first and second RNA molecule form 3'-overhang or 5'-overhang of 0-5 nucleotides on the active end of the duplex formed when each of the first and second RNA molecules is hybridized with the other whereby such that the active end of the duplex formed is the end that comprises the nucleic acid sequence and the nucleotide sequence.
- the first RNA molecule that is described in the former embodiment is about 25 to 30 nucleotides long and the second RNA molecule is about 25 to 30 nucleotides long, such that the first and second RNA molecules form 3'-overhang of 2 nucleotides on the active end of the duplex formed when each of the first and second RNA molecules is hybridized with the other and such that the duplex may be a substrate for a Dicer.
- the duplex may be a substrate for a Dicer.
- the ribozyme of (ii) may include, but is not limited to: hammerhead-type ribozyme, hairpin ribozyme and/or tetrahymena-type ribozyme.
- the ribozyme of (ii) is a hammerhead-type ribozyme [21] that comprises at the 3' end a first sequence of 7 nucleotides in length that is complementary to a sequence that is located 26 nucleotides upstream from the 3' end of the region of (i) and extends upstream in the region of (i), furthermore the hammerhead-type ribozyme comprises at the 5' end a second sequence of 7 nucleotides in length that is complementary to a sequence that is located 18 nucleotides upstream from the 3' end of the region of (i) and extends upstream in the region of (i) [21].
- FIG 9A see FIG 9A.
- the ribozyme of (ii) is a hairpin ribozyme [21] that comprises at the 5' end a nucleic acid sequence of 16 nucleotides in length, such that the nucleic acid sequence comprises at the 5' end a sequence of 8 nucleotides in length that is complementary to a sequence that is located 28 nucleotides downstream from the 5' end of the region of (i) and extends downstream in the region of (i) and such that the nucleic acid sequence comprises at the 3' end a sequence of 4 nucleotides in length that is complementary to a sequence that is located 26 nucleotides upstream from the 3' end of the region of (i) and extends upstream in the region of (i) [21 ].
- FIG 9B see FIG 9B.
- ribozyme will not retain/use up, and consequently dilute, the cellular the components of the RNA interference pathway.
- the functional nucleic acid, described in embodiments in section 1 is a cis acting ribozyme that is located within the earner RNA sequence and effects the cleavage of the carrier RNA at the carrier cleavage site.
- the cis acting ribozyme may include, but is not limited to the very efficient cis-acting hammerhead ribozyme: snorbozyme [22] and/or Nl 17 [23]. For example, see FIG 10, 1 1.
- the carrier sequence that comprises it may be cleaved by itself [22], which may yield preferred results.
- the functional nucleic acid described in the embodiments in section 1 is an endonuclease recognition site or an endogenous miRNA binding site, such that the functional nucleic acid is located within the carrier RNA and is capable of effecting the cleavage, directly or indirectly, of the carrier RNA at the carrier cleavage site.
- FIG 12A, 12B see FIG. 12A, 12B.
- the functional nucleic acid that is described in embodiments of section 1 may include, but is not limited to, a stem loop structure or miRNA structure. Whereby the functional nucleic acid directs the cleavage of the carrier sequence at the carrier cleavage site.
- This section describes embodiments of the structure of this functional nucleic acid that has a stem loop structure or miRNA structure.
- the functional nucleic acid described in embodiments in section 1 is a miRNA sequence that is located within the carrier RNA sequence, such that following introduction of the composition into a cell, the miRNA sequence is processed, such that the processing of the miRNA sequence is capable of effecting the cleavage, directly or indirectly, of the carrier RNA at the carrier cleavage site and such that the processing of the miRNA sequence comprises Drosha processing.
- the miRNA sequence that is described in the former embodiment comprises a sequence corresponding to a naturally occurring miRNA, or a sequence substantially identical thereto. For example, see FIG 12C, 12D.
- the functional nucleic acid, described in section 1 has a nucleotide sequence that is located immediately upstream from the 5' end of the carrier sequence in the carrier RNA sequence, such that the third sequence is 0 nucleotides in length and such that the nucleotide sequence is capable of binding to the carrier sequence, whereby the carrier sequence and the nucleotide sequence are capable of forming a stem loop structure that is a substrate for a Drosha.
- the stem loop structure may be processed and the processing of the stem loop structure is capable of effecting the cleavage, directly or indirectly, of the carrier RNA at the 3' end of the carrier sequence.
- the stem loop structure that is described in the former embodiment is a maximum of about 150 nucleotides long and the processed stem loop structure is not a substrate for Dicer. For example, see FIG 13 A.
- the functional nucleic acid, described in section 1 has a nucleotide sequence that is located immediately downstream from the 3' end of the carrier sequence in the carrier RNA, such that the third sequence is 0 nucleotides in length and such that the nucleotide sequence is capable of binding to the carrier sequence.
- the carrier sequence and the nucleotide sequence are capable of forming a stem loop structure that is a substrate for Drosha. Following introduction of the composition into a cell, the stem loop structure may be processed, and the processing of the stem loop structure is capable of effecting the cleavage, directly or indirectly, of the carrier RNA at the 5' end of the carrier sequence.
- the stem loop structure that is described in the former embodiment has a maximum of about 150 nucleotides long and the processed stem loop structure is not a substrate for Dicer. For example, see FIG 13B.
- the use of miRNA sequence or stem loop structure may provide enhanced results since the carrier sequence may be cleaved independently by Drosha.
- the functional nucleic acid described in embodiments of section 1 comprises:
- the stem loop structure is processed, wherein the processing of the stem loop structure is capable of effecting the cleavage, directly or indirectly, of the carrier RNA at the carrier cleavage site and such that the processing of the stem loop structure is capable of forming one or more RNA duplex(es).
- the processing of the stem loop structure may include, for example, Dicer processing and the RNA duplex(es) may be siRNA duplex(es) and/or miRNA duplex(es).
- the functional RNA described in the former embodiment is a nucleic acid sequence of from 18 to 25 nucleotides in length which is of sufficient complementarity to a target sequence to direct target-specific RNA interference, such that the target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a region within the endogenous signal RNA.
- the region is located from about 25 nucleotides downstream from the predetermined cleavage site to about 25 nucleotides upstream from the predetermined cleavage site, such that the nucleic acid sequence is located within the first nucleotide sequence or within the second nucleotide sequence.
- At least one RNA duplex from the one or more RNA duplex(es) comprises the nucleic acid sequence and the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the endogenous signal RNA at the predetermined cleavage site via RNA interference. For example, see FIG. 14A.
- the first nucleotide sequence or the second nucleotide sequence described in the former embodiment is the nucleic acid sequence, such that the carrier RNA sequence is consisting essentially of: the first nucleotide sequence and the second nucleotide sequence and the carrier sequence.
- the first nucleotide sequence is 18-25 nucleotides in length and the second nucleotide sequence is 1 8-25 nucleotides in length.
- the stem loop structure forms 3'-overhang of 2 nucleotides and may be a substrate for a Dicer and such that the expression of the carrier RNA polynucleotide sequence is driven by polymerase I based promoter or polymerase III based promoter. For example, see FIG. 14B.
- the region described in any of the previous 2 embodiments is located from about 1 1 nucleotides downstream from the predetermined cleavage site to about 12 nucleotides upstream from the predetermined cleavage site. In another embodiment, the region described in the former embodiment is located from about 10 nucleotides downstream from the predetermined cleavage site to about 1 1 nucleotides upstream from the predetermined cleavage site.
- RNA and a carrier sequence that are located in the same RNA molecule may require less transcriptional units, which may yield advantageous results. Additional advantage of the proximity of the functional RNA and the carrier sequence is that they are synthesized in the same location in the cell at the same time and at a constant ratio. 4. STRUCTURE OF A CARRIER SEQUENCE/RNA AND FUNCTIONAL RN A/NUCLEIC
- the functional nucleic acid described in embodiments of section 1 may include:
- nucleotide sequence that is located immediately downstream from the 3' end of the carrier sequence in carrier RNA, such that the carrier RNA is consisting essentially of the carrier sequence and the nucleotide sequence; and (ii) one or more RNA molecule(s) that are capable of binding to the nucleotide sequence; such that the nucleotide sequence and at least one of the RNA molecules form 3'-overhang or 5'-overhang of 0-5 nucleotides on one end of the duplex, which is formed when each of the nucleotide sequence and the at least one RNA molecule is hybridized to the other.
- the nucleotide sequence and the one or more RNA molecule(s) are hybridized with each other and the nucleotide sequence is processed, such that the processing of the nucleotide sequence is capable of effecting the cleavage, directly or indirectly, carrier RNA at the carrier cleavage site and such that the processing of the nucleotide sequence is capable of forming one or more RNA duplex(es).
- the processing of the nucleotide sequence may include Dicer processing and the RNA duplex(es) may be siRNA duplex(es) and/or miRNA duplex(es).
- the functional nucleic acid described in embodiments in section 1 may include:
- nucleotide sequence that is located immediately upstream from the 5' end of the carrier sequence in the carrier RNA, such that the carrier RNA is consisting essentially of: the carrier sequence and the nucleotide sequence; and (ii) one or more RNA molecule(s) that are capable of binding to the nucleotide sequence; such that the nucleotide sequence and at least one of the RNA molecules from the one or more RNA molecule(s) form 3'-overhang or 5'-overhang of 0-5 nucleotides on one end of the duplex formed when each of the nucleotide sequence and the one RNA molecule is hybridized with the other.
- the nucleotide sequence and the one or more RNA molecule(s) are hybridized with the other and the nucleotide sequence is processed.
- the processing of the nucleotide sequence may be capable of effecting the cleavage, directly or indirectly, of the carrier RNA at the carrier cleavage site and the processing of the nucleotide sequence is capable of forming one or more RNA duplex(es), such that the processing of the nucleotide sequence may include Dicer processing and the RNA duplex(es) may include siRNA duplex(es) and/or miRNA duplex(es).
- the functional RNA described in any of the previous 2 embodiments is a nucleic acid sequence of from 18 to 25 nucleotides in length which is of sufficient complementarity to a target sequence to direct target-specific RNA interference.
- the target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a region within the endogenous signal RNA, such that the region is located from about 25 nucleotides downstream from the predetermined cleavage site to about 25 nucleotides upstream from the predetermined cleavage site, such that the nucleic acid sequence is located within the nucleotide sequence or within at least one RNA molecule from the one or more RNA molecule(s).
- At least one RNA duplex of the one or more RNA duplex(es) comprises the nucleic acid sequence, and the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the endogenous signal RNA at the predetermined cleavage site via, for example, RNA interference.
- the region described in the former embodiment is located from about 1 1 nucleotides downstream from the predetermined cleavage site to about 12 nucleotides upstream from the predetermined cleavage site.
- the one or more RNA molecule(s) that are described in any of the previous 2 embodiments is one RNA molecule, consisting essentially of the nucleic acid sequence, such that the nucleotide sequence is 18-25 nucleotides in length and the one RNA molecule is 18-25 nucleotides in length.
- the nucleotide sequence and the one RNA molecule form 3'-overhang of 2 nucleotides on one end of the duplex formed when each of the nucleotide sequence and the one RNA molecule is hybridized with the other, the expressions of the carrier RNA and the one RNA molecule are driven by polymerase I or III based promoter. For example, see FIG. 15A and 15B.
- the carrier sequence may bring the functional RNA into proximity with the predetermined signal sequence of the endogenous signal RNA and may further bring also the components of the RNA interference pathway (for example, Dicer and Rise) into proximity with the predetermined signal sequence.
- the RNA interference pathway for example, Dicer and Rise
- the functional RNA described in embodiments in section 1 comprises: (i) a nucleotide sequence that is located at the 5' end of the earner RNA; and (ii) one or more RNA molecule(s) that are capable of binding to the nucleotide sequence; such that the nucleotide sequence and at least one RNA molecule form 3'-overhang or 5'-overhang of 0-5 nucleotides on one end of the duplex, which is formed when each of the nucleotide sequence and the at least one RNA molecule is hybridized with the other.
- the nucleotide sequence or at least one RNA molecule include a nucleic acid sequence of from 18 to 25 nucleotides in length that is of sufficient complementarity to a target sequence to direct target-specific RNA interference, such that the target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a region within the endogenous signal RNA, such that the region is located from about 25 nucleotides downstream from the predetermined cleavage site to about 25 nucleotides upstream from the predetermined cleavage site.
- the nucleotide sequence and the one or more RNA molecule(s) may be hybridized with the other and the nucleotide sequence may be processed, such that the processing of the nucleotide sequence is capable of forming one or more RNA duplex(es).
- the processing of the nucleotide sequence may include Dicer processing and the RNA duplex(es) may be siRNA duplex(es) and/or miRNA duplex(es), such that at least one RNA duplex from the one or more RNA duplex(es) comprises the nucleic acid sequence and such that the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the endogenous signal RNA at the predetermined cleavage site via RNA interference.
- the functional RNA described in embodiments section 1 may include:
- nucleotide sequence that is located at the 3' end of the carrier RNA; and (ii) one or more RNA molecule(s) that are capable of binding to the nucleotide sequence; such that the nucleotide sequence and at least one RNA molecule form 3'-overhang or 5'-overhang of 0-5 nucleotides on one end of the duplex which is formed when each of the nucleotide sequence and the one RNA molecule is hybridized with the other.
- the nucleotide sequence or at least one RNA molecule from the one or more RNA molecule(s) comprises a nucleic acid sequence of from 18 to 25 nucleotides in length that is of sufficient complementarity to a target sequence to direct target-specific RNA interference, such that the target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a region within the endogenous signal RNA, wherein the region is located from about 25 nucleotides downstream from the predetermined cleavage site to about 25 nucleotides upstream from the predetermined cleavage site.
- the nucleotide sequence and the one or more RNA molecule(s) are hybridized with each other and the nucleotide sequence is processed, such that the processing of the nucleotide sequence is capable of forming one or more RNA duplex(es).
- the processing of the nucleotide sequence may include Dicer processing and the RNA duplex(es) may be siRNA duplex(es) and/or miRNA duplex(es), such that at least one RNA duplex from the one or more RNA duplex(es) comprises the nucleic acid sequence and such that the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the endogenous signal RNA at the predetermined cleavage site via RNA interference.
- the region that is described in any of the previous 2 embodiments is located from about 1 1 nucleotides downstream from the predetermined cleavage site to about 12 nucleotides upstream from the predetermined cleavage site.
- the one or more RNA molecule(s) that is described in any of the previous 3 embodiments is one RNA molecule, such that the nucleotide sequence or the one RNA molecule is consisting essentially of the nucleic acid sequence.
- the nucleotide sequence is 18- 25 nucleotides in length and the one RNA molecule is 18-25 nucleotides in length, such that the nucleotide sequence and the RNA molecule form 3'-overhang of 2 nucleotides on one end of the duplex, which is formed when each of the nucleotide sequence and the one RNA molecule is hybridized with the other.
- the expression of the carrier RNA and the one RNA molecule are driven by polymerase I or III based promoter. For example, see FIG. 16A and 16B.
- the carrier RNA may bring the functional RNA into proximity with the predetermined signal sequence of the endogenous signal RNA and by this may also bring the components of the RNA interference pathway (for example, Dicer and Rise) into proximity with the predetermined signal sequence.
- the RNA interference pathway for example, Dicer and Rise
- the functional RNA described in embodiments in section 1 may include:
- nucleotide sequence that is located at the 5' end of the carrier RNA; and; (ii) one or more RNA molecule(s) that are capable of binding to the nucleotide sequence; such that the nucleotide sequence and at least one RNA molecule form 3'-overhang or 5'-overhang of 0-5 nucleotides on one end of the duplex formed, when each of the nucleotide sequence and the RNA molecule is hybridized with each other.
- the nucleotide sequence or at least one RNA molecule may include a nucleic acid sequence of from 18 to 25 nucleotides in length, such that the nucleic acid sequence is of sufficient complementarity to a target sequence to direct target-specific RNA interference.
- the target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a region within the endogenous signal RNA, such that the region is located from about 25 nucleotides downstream from the predetermined cleavage site to about 25 nucleotides upstream from the predetermined cleavage site.
- the nucleotide sequence and the RNA molecule are hybridized with each other and the nucleotide sequence is processed, such that the processing of the nucleotide sequence is capable of forming one or more RNA duplex(es).
- the processing of the nucleotide sequence may include Dicer processing and the RNA duplex(es) may be siRNA duplex(es) and/or miRNA duplex(es), such that at least one RNA duplex from the one or more RNA duplex(es) includes the nucleic acid sequence and such that the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the endogenous signal RNA at the predetermined cleavage site via RNA interference.
- the functional RNA described in embodiments section 1 may include:
- nucleotide sequence that is located at the 3' end of the carrier RNA sequence; and; (ii) one or more RNA molecule(s) that are capable of binding to the nucleotide sequence; such that the nucleotide sequence and at least one RNA molecule form 3'-overhang or 5'-overhang of 0-5 nucleotides on one end of the duplex, which is formed when each of the nucleotide sequence and the one RNA molecule is hybridized with each other.
- the nucleotide sequence or the at least one RNA molecule may include a nucleic acid sequence of from 1 8 to 25 nucleotides in length, such that the nucleic acid sequence is of sufficient complementarity to a target sequence to direct target-specific RNA interference.
- the target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a region within the endogenous signal RNA, such that the region is located from about 25 nucleotides downstream from the predetermined cleavage site to about 25 nucleotides upstream from the predetermined cleavage site.
- the nucleotide sequence and the one or more RNA molecule(s) are hybridized with each other and the nucleotide sequence is processed, such that the processing of the nucleotide sequence is capable of forming one or more RNA duplex(es).
- the processing of the nucleotide sequence may include Dicer processing and the RNA duplex(es) may be siRNA duplex(es) and/or miRNA duplex(es), such that at least one RNA duplex from the one or more RNA duplex(es) may include the nucleic acid sequence and such that the RNA duplex that includes the nucleic acid sequence may direct the cleavage of the endogenous signal RNA at the predetermined cleavage site via RNA interference.
- the region that described in any of the previous two embodiments may be located from about 11 nucleotides downstream from the predetermined cleavage site to about 12 nucleotides upstream from the predetermined cleavage site.
- the one or more RNA molecule(s) that are described in any of the previous 3 embodiments is one RNA molecule, such that the nucleotide sequence or the one RNA molecule is consisting essentially of the nucleic acid sequence.
- the nucleotide sequence may be 18-25 nucleotides in length and the one RNA molecule is 18-25 nucleotides in length.
- the nucleotide sequence and the one RNA molecule form 3'-overhang of 2 nucleotides on one end of the duplex, which is formed when each of the nucleotide sequence and the one RNA molecule is hybridized with each other.
- the expression of the earner RNA and the one RNA molecule are driven by polymerase I or III based promoter. For example, see FIG. 17A and 1 7B.
- 1 may include:
- nucleotide sequence that is located at the 5' end of the carrier RNA sequence; and; (ii) one or more RNA molecule(s) that are capable of binding to the nucleotide sequence; such that the nucleotide sequence and one RNA molecule from the one or more RNA molecule(s) form 3'-overhang or 5'-overhang of 0-5 nucleotides on one end of the duplex, which is formed when each of the nucleotide sequence and the one RNA molecule is hybridized with the other.
- the nucleotide sequence or at least one RNA molecule from the one or more RNA molecule(s) comprises a nucleic acid sequence of from 18 to 25 nucleotides in length, such that the nucleic acid sequence is of sufficient complementarity to a target sequence to direct target-specific RNA interference, such that the target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a region within the carrier RNA and such that the region is located from about 25 nucleotides downstream from the carrier cleavage site to about 25 nucleotides upstream from the carrier cleavage site.
- the nucleotide sequence and the one or more RNA molecule(s) are hybridized with the other and the nucleotide sequence is processed, such that the processing of the nucleotide sequence is capable of forming one or more RNA duplex(es).
- the processing of the nucleotide sequence may include Dicer processing and the RNA duplex(es) may include siRNA duplex(es) and/or miRNA duplex(es), such that at least one RNA duplex from the one or more RNA duplex(es) comprises the nucleic acid sequence and such that the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the carrier RNA at the carrier cleavage site via RNA interference.
- the functional nucleic acid described in embodiments in section 1 comprises:
- RNA molecule(s) that are capable of binding to the nucleotide sequence, such that the nucleotide sequence and one RNA molecule from the one or more RNA molecule(s) form 3'-overhang or 5'-overhang of 0-5 nucleotides on one end of the duplex formed when each of the nucleotide sequence and the one RNA molecule is hybridized with the other.
- the nucleotide sequence or at least one RNA molecule from the one or more RNA molecule(s) comprises a nucleic acid sequence of from 18 to 25 nucleotides in length, wherein the nucleic acid sequence is of sufficient complementarity to a target sequence to direct target-specific RNA interference, such that the target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a region within the carrier RNA sequence and such that the region is located from about 25 nucleotides downstream from the carrier cleavage site to about 25 nucleotides upstream from the carrier cleavage site.
- the nucleotide sequence and the one or more RNA molecule(s) are hybridized with each other and the nucleotide sequence is processed, such that the processing of the nucleotide sequence is capable of forming one or more RNA duplex(es).
- the processing of the nucleotide sequence may include Dicer processing and the RNA duplex(es) may include siRNA duplex(es) and/or miRNA duplex(es), such that at least one RNA duplex from the one or more RNA duplex(es) comprises the nucleic acid sequence and such that the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the carrier RNA at the carrier cleavage site via RNA interference.
- the region described in any of the previous 2 embodiments may be located from about 1 1 nucleotides downstream from the carrier cleavage site to about 12 nucleotides upstream from the carrier cleavage site.
- the one or more RNA molecule(s) described in any of the previous 3 embodiments is one RNA molecule, such that the nucleotide sequence or the one RNA molecule is consisting essentially of the nucleic acid sequence.
- the nucleotide sequence is 18-25 nucleotides in length, such that the one RNA molecule is 18-25 nucleotides in length, and the nucleotide sequence and the one RNA molecule form 3'-overhang of 2 nucleotides on one end of the duplex formed, when each of the nucleotide sequence and the one RNA molecule is hybridized with the other.
- the expression of the carrier RNA and the one RNA molecule may be driven by polymerase I or III based promoter. For example, see FIG. 18A and 18B.
- the functional RNA is a specific nucleotide sequence of from 18 to 25 nucleotides in length which is of sufficient complementarity to a specific target sequence to direct target-specific RNA interference.
- the specific target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a specific region within the endogenous signal RNA, such that the specific region is located from about 25 nucleotides downstream from the predetermined cleavage site to about 25 nucleotides upstream from the predetermined cleavage site.
- the specific nucleotide sequence is located within the nucleotide sequence or within at least one RNA molecule from the one or more RNA molecule(s).
- At least one RNA duplex from the one or more RNA duplex(es) include the specific nucleotide sequence and such that the RNA duplex that comprises the specific nucleotide sequence directs the cleavage of the endogenous signal RNA at the predetermined cleavage site via RNA interference.
- RNA interference see FIG. 19A and 19B.
- This section describes the structure of the carrier RNA described in section 1 , such that the carrier RNA comprises at least 3 contiguous carrier sequences.
- the carrier RNA described in the embodiments in section 1 may further include at least 2 contiguous carrier sequences immediately downstream from the described carrier sequence. For example, see FIG. 20A.
- the carrier RNA described in embodiments of section 1 may further include 100 contiguous carrier sequences (that may be identical or different) immediately downstream from the carrier sequence described therein, such that the edge sequence is 23-28 nucleotides in length and is located from the predetermined cleavage site to about 23-28 nucleotides downstream; the second sequence is 2 nucleotides in length; the third sequence is 0 nucleotides in length and the expression of the polynucleotide sequence the carrier RNA is driven by CMV-IE promoter.
- the carrier RNA described in the embodiments in section 1 may further include at least 2 contiguous carrier sequences immediately upstream from the carrier sequence. For example, see FIG. 20B.
- the carrier RNA may further include 100 contiguous carrier sequences, that may be identical or different, immediately upstream from the carrier sequence, such that the edge sequence is 25-30 nucleotides in length and is located 2 nucleotides upstream from the predetermined cleavage site and extends upstream in the endogenous signal RNA; the second sequence is 0 nucleotides in length; the third sequence is 0 nucleotides in length; and such that the expression of the polynucleotide sequence the carrier RNA is driven by CMV-IE promoter.
- the functional nucleic acid is, for example, microRNA (miRNA), lariat-form RNA, short-hairpin RNA (shRNA), siRNA expression domain, small-interfering RNA (siRNA) and/or trans acting ribozyme, since with such functional nucleic acids, many carrier sequences can be generated from one carrier RNA and from one functional nucleic acid.
- miRNA microRNA
- shRNA short-hairpin RNA
- siRNA expression domain siRNA expression domain
- siRNA small-interfering RNA
- trans acting ribozyme since with such functional nucleic acids, many carrier sequences can be generated from one carrier RNA and from one functional nucleic acid.
- This section describes embodiments of the structure of the polynucleotide molecule(s) (such as, for example, DNA molecules), described in embodiments of section 1, such that the polynucleotide molecule(s) together further transcribe an additional functional RNA that is capable of effecting the cleavage of the endogenous signal RNA at the opposite end of the predetermined signal sequence, which is not cleaved.
- the polynucleotide molecule(s) such as, for example, DNA molecules
- the polynucleotide molecule(s) described in some embodiments of section 1 further comprise a polynucleotide sequence encoding an additional functional RNA that is capable of effecting the cleavage, directly or indirectly, of the endogenous signal RNA at an additional cleavage site, such that the additional cleavage site may be located 0-1000 nucleotides downstream from the 3' end of the predetermined signal sequence.
- the additional cleavage site may be located 0-5 nucleotides downstream from the 3' end of the predetermined signal sequence. For example, see FIG. 21 A.
- the polynucleotide molecule(s) described in some embodiments in section 1 may further comprise a polynucleotide sequence encoding an additional functional RNA that is capable of effecting the cleavage, directly or indirectly, of the endogenous signal RNA at an additional cleavage site, such that the additional cleavage site may be located 0-1000 nucleotides upstream from the 5' end of the predete rmined signal sequence.
- the additional cleavage site may be located 0-5 nucleotides upstream from the 5' end of the predetermined signal sequence. For example, see FIG. 2 IB.
- the previous 4 embodiments may be advantageous since in these embodiments the predetermined signal sequence may be cleaved at both of its ends and thus with the carrier RNA/sequence it may be a better substrate for endogenous enzymes, such as, for example, Dicer and/or Rise.
- the exogenous RNA of interest described in embodiments in section 1 may further include:
- an inhibitory sequence that is capable of inhibiting the expression of the exogenous protein of interest
- the specific target/cleavage site is located between the inhibitory sequence and the sequence encoding the exogenous protein of interest.
- the exogenous RNA of interest is transcribed and cleaved at the specific target/cleavage site whereby the inhibitory sequence is detached from the sequence encoding the exogenous protein of interest and the exogenous protein of interest is capable of being expressed.
- FIG. 22A and 22B Accordingly, cleaving of the exogenous RNA of interest may lead to the expression of an active exogenous protein of interest within the cell.
- the exogenous RNA of interest molecule may further include a carrier RNA sequence and/or a Functional RNA sequence.
- mRNAs without cap or poly A tail are still capable of translating proteins.
- an addition of a cap increases the translation of an mRNA by 35- 50 fold and an addition of a poly(A) tail increases the translation of an mRNA by 1 14-155- fold [10].
- the poly(A) tail in mammalian cells increases the functional mR A half-life only by 2.6- fo!d and the cap increases the functional mRNA half-life only by 1.7-fold [10].
- the exogenous protein of interest of the invention can be any protein or peptide.
- the exogenous protein of interest may be any type of toxin (such as, for example, Ricin, Abrin, Diphtheria toxin, botulinium toxin); an enzyme; a reporter gene; a structural gene, and the like. 7.1. STRUCTURE OF AN EXOGENOUS RNA OF INTEREST HAVING AN INHIBITORY SEQUENCE LOCATED UPSTREAM FROM THE SPECIFIC TARGET/CLEAVAGE SITE
- the inhibitory sequence in the exogenous RNA of interest described in embodiments of Section 7 may be located upstream or downstream from the specific target/cleavage site.
- This section describes the structure of the inhibitory sequence that is located upstream from the specific target/cleavage site in the exogenous RNA of interest, according to some embodiments. For example, see FIG. 22A.
- the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in embodiments in section 7 may include, but is not limited to an initiation codon, whereby the initiation codon and the sequence encoding for the exogenous protein of interest are not in the same reading frame, such that the initiation codon causes a frameshift mutation to the protein of interest that is encoded downstream.
- the initiation codon is located within a Kozak consensus sequence.
- modified Kozak consensus sequences that maintain the ability to function as initiator of translation may be also used.
- any initiator of translation element may be used. For example, see FIG. 23B.
- the Kozak consensus sequence in human is 5'-ACCAUGG-3' and the initiation codon is 5'-AUG-3'.
- the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 comprises a plurality of initiation codons, whereby each of the initiation codons and the sequence encoding exogenous protein of interest are not in the same reading frame, such that the initiation codons cause a frameshift mutation to the exogenous protein of interest that is encoded downstream.
- each of the initiation codons is located within a Kozak consensus sequence or a modified Kozak consensus sequences that maintain the ability to function as initiator of translation. For example, see FIG. 23 C.
- the initiation codon may be located within or may include one or more TISU motifs.
- a TISU (Translation Initiator of Short 5'UTR) motif is distinguished from a Kozak consensus in its unique ability to direct efficient and accurate translation initiation from mRNAs with a very short 5'UTR.
- the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in the specific embodiment in section 7 comprises an initiation codon and the exogenous RNA of interest further comprises a stop codon located between the initiation codon and the start codon of the sequence encoding the exogenous protein of interest, such that the stop codon and the initiation codon are in the same reading frame.
- uORF upstream open reading frame
- the stop codon may be, for example, 5'-UAA-3' or 5'-UAG-3' or 5'-UGA-3'.
- the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in the specific embodiment in section 7 comprises an initiation codon and a nucleotide sequence downstream from the initiation codon that encodes a sorting/localization/targeting signal for subcellular localization, such that the nucleotide sequence and the initiation codon are in the same reading frame and such that the subcellular localization of the protein of interest inhibits its biological function.
- the sorting/localization signal for the subcellular localization includes, but is not limited to sorting localization signal for mitochondria, nucleus, endosome, lysosome, peroxisome, ER, or any subcellular localization or organelle.
- the sorting signal for the subcellular localization may include, for example, but is not limited to: a peroxisomal targeting signal 2 [(R7K)(L/V/I)X5(Q/H)(L/A)] or H2N-— RLRVLSGHL (of human alkyl dihydroxyacetonephosphate synthase) [30].
- a peroxisomal targeting signal 2 [(R7K)(L/V/I)X5(Q/H)(L/A)] or H2N-— RLRVLSGHL (of human alkyl dihydroxyacetonephosphate synthase) [30].
- a peroxisomal targeting signal 2 [(R7K)(L/V/I)X5(Q/H)(L/A)
- H2N-— RLRVLSGHL of human alkyl dihydroxyacetonephosphate synthase
- the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in the specific embodiment in section 7 comprises an initiation codon and a nucleotide sequence downstream from the initiation codon that encodes a protein degradation signal, such that the nucleotide sequence and the initiation codon are in the same reading frame.
- the protein degradation signal includes, but is not limited to ubiquitin degradation signal. For example, see FIG. 24B.
- the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 is designed to comprise an initiation codon and a nucleotide sequence downstream from the initiation codon that is in the same reading frame with the initiation codon and with the sequence encoding the exogenous protein of interest, such that when the amino acid sequence, which is encoded by the nucleotide sequence, is fused to the protein of interest the biological function of the protein of interest is inhibited. For example, see FIG. 24C.
- the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 comprises an initiation codon
- the exogenous RNA of interest further comprises a stop codon downstream from the initiation codon, such that the stop codon and the initiation codon are in the same reading frame.
- the exogenous RNA of interest may further include an intron downstream from the stop codon, such that the exogenous RNA of interest is a target for nonsense-mediated decay (NMD) that degrades the exogenous RNA of interest. For example, see FIG. 24D.
- NMD nonsense-mediated decay
- the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 comprises a sequence that is capable of binding to a translation repressor protein, such that the translation repressor protein is an endogenous translation repressor protein or is encoded from the composition and such that the translation repressor protein, directly or indirectly, reduces the efficiency of translation of the protein of interest within the exogenous RNA of interest [26].
- sequence that is capable of binding to a translation repressor protein includes, for example, but is not limited to a sequence that binds the smaug repressor protein (5'- UGGAGCAGAGGCUCUGGCAGCUUUUGCAGCG-3') [27], For example, see FIG. 25A.
- the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 comprises an RNA localization signal for subcellular localization (including cotranslational import) or an endogenous miRNA binding site, such that the subcellular localization of the exogenous RNA of interest of the invention inhibits the translation of the protein of interest and decreases the exogenous RNA of interest half-life.
- the RNA localization signal may include, for example, but is not limited to RNA localization signal for: myelinating periphery, mitochondria, myelin compartment, leading edge of the lamella or Perinuclear cytoplasm [24].
- the RNA localization signal for myelinating periphery is 5'-GCC AAGGAGCCAGAGAGCAUG-3 * or 5'-GCCAAGGAGCC-3' [29].
- FIG. 25B see FIG. 25B.
- the inhibitory sequence that is located upstream from the speci fic target/cleavage site and that is described in section 7 comprises an RNA destabilizing element that stimulates degradation of the exogenous RNA of interest, such that the RNA destabilizing element is an AU-rich element (ARE) or an endonuclease recognition site.
- the AU-rich element may include, for example, but is not limited to AU-rich elements that are at least about 35 nucleotides long.
- the AU-rich element may include, for example, but is not limited to: 5'-AUUUA-3', 5'-UUAUUUA(U/A)(U/A)-3' or 5'-AUUU-3' [28]. For example, see FIG. 25C.
- the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 comprises a sequence that is capable of forming a secondary structure that reduces the efficiency of translation of the downstream exogenous protein of interest.
- the free energy of folding of the secondary structure that described in the former embodiment may be lower than -30 kcal/mol (for example,. -50 kcal/mol, -80 kcal/mol) and thus the secondary structure is sufficient to block scanning ribosomes to reach the start codon of the downstream protein of interest. For example, see FIG. 25D.
- the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 comprises a sequence immediately upstream from the specific target/cleavage site that is capable of binding to the nucleotide sequence that is located immediately downstream from the specific target/cleavage site for the formation of a secondary structure, such that the secondary structure, directly or indirectly, reduces the efficiency of translation of the downstream exogenous protein of interest.
- the free energy of the folding of the secondary structure that is described in the former embodiment may be lower than -30 kcal/mol (for example, -50 kcal/mol and -80 kcal/mol) and thus this secondary structure is sufficient to block scanning ribosomes to reach the start codon of the protein of interest.
- the specific target/cleavage site is located within the single stranded region or within the loop region in the secondary structure that is described in the former embodiment, such that the single stranded region or the loop region includes, but is not limited to region that is at least about 15 nucleotides long.
- the exogenous RNA of interest in another embodiment, comprises an internal ribosome entry site (IRES) sequence downstream from the specific target/cleavage site and upstream from the sequence encoding protein of interest, such that the IRES sequence is more functional within the cleaved exogenous RNA of interest than within the intact exogenous RNA of interest.
- IRES internal ribosome entry site
- at least part of the IRES sequence is located within the nucleotide sequence that is located immediately downstream from the specific target/cleavage site. For example, see FIG. 26.
- the IRES sequence includes, for example, but is not limited to a picornavirus IRES, a foot-and-mouth disease virus IRES, an encephalomyocarditis virus IRES, a hepatitis A virus IRES, a hepatitis C virus IRES, a human rhinovirus IRES, a poliovirus IRES, a swine vesicular disease virus IRES, a turnip mosaic potyvirus IRES, a human fibroblast growth factor 2 mRNA IRES, a pestivirus IRES, a Leishmania RNA virus IRES, a Moloney murine leukemia virus IRES a human rhinovirus 14 IRES, an aphthovirus IRES, a human immunoglobulin heavy chain binding protein mRNA IRES, a Drosophila Antennapedia mRNA IRES, a human fibroblast growth factor 2 mRNA IRES, a hepatitis G virus IRES, a tob
- This section describes further embodiments of additional structures of the composition of the invention that are described in embodiments in section 7, such that the additional structures may increase the efficiency of translation of the cleaved exogenous RNA of interest, wherein the cleaved exogenous RNA of interest is cleaved at the specific target/cleavage site at the 5' end.
- the exogenous RNA of interest described in section 7 may include, for example, a sequence that comprises a unique internal ribosome entry site (IRES) sequence immediately upstream from the sequence encoding the exogenous protein of interest, such that the unique IRES sequence increases the efficiency of translation of the protein of interest in the cleaved exogenous RNA of interest.
- IRES internal ribosome entry site
- the exogenous RNA of interest that is described in section 7 may include a unique nucleotide sequence immediately downstream from the sequence encoding the protein of interest, such that the unique nucleotide sequence comprises a unique stem loop structure and such that the unique stem loop structure, directly or indirectly, increases the efficiency of translation of the protein of interest and the cleaved exogenous RNA of interest half-life.
- the unique stem loop structure may include, for example, but is not limited to the conserved stem loop structure of the human histone gene 3'-UTR or a functional derivative thereof.
- the conserved stem loop structure of the human histone gene 3'- UTR is 5'-GGCUCUUUUCAGAGCC-3'. For example, see FIG. 27B.
- the exogenous RNA of interest that is described in the specific embodiment in section 7 may include a unique nucleotide sequence immediately downstream from the sequence encoding the protein of interest, such that the unique nucleotide sequence comprises a cytoplasmic polyadenylation element that, directly or indirectly, increases the efficiency of translation of the protein of interest and the half-life of the cleaved exogenous RNA of interest.
- the cytoplasmic polyadenylation element may include, for example, but is not limited to 5'-UUUUAU-3', 5'-UUUUAU-3', 5'-UUUUAAU-3', 5 '- UUUUUUAUU-3 ', 5'-UUUUAUU-3' or 5'-UUUUUAUAAAG-3' [25].
- the composition of the invention may also include, for example, a polynucleotide sequence that encodes a human cytoplasmic polyadenylation element binding protein (hCPEB), and/or a homologue thereof, for expressing hCPEB in any cell. For example, see FIG. 27C.
- hCPEB human cytoplasmic polyadenylation element binding protein
- the exogenous RNA of interest that is described in section 7 comprises a unique nucleotide sequence that is located downstream from the specific target/cleavage site and upstream from the sequence encoding the protein of interest, such that the unique nucleotide sequence is capable of binding to a sequence that is located downstream from the sequence encoding protein of interest.
- the cleaved exogenous RNA of interest may create a circular structure that increases the efficiency of translation of the protein of interest in the cleaved exogenous RNA of interest. For example, see FIG. 27D.
- the exogenous RNA of interest that is described in section 7 comprises a unique nucleotide sequence that is located downstream from the specific target/cleavage site and upstream from the sequence encoding protein of interest.
- the unique nucleotide sequence may be capable of binding to a unique polypeptide that is, directly or indirectly, capable of binding to the poly(A) tail in the cleaved exogenous RNA of interest, and the unique polypeptide may be encoded from the composition of the invention.
- the unique polypeptide and the cleaved exogenous RNA of interest may create a circular structure that increases the efficiency of translation of the protein of interest in the cleaved exogenous RNA of interest. For example, see FIG. 28A.
- This section describes further embodiments of additional structures of the composition of the invention, described in section 7, such that these additional structures may reduce the efficiency of translation of the exogenous RNA of interest of the invention before it is cleaved (that is, an intact exogenous RNA of interest).
- composition that is described in section 7 may further include a particular cleaving component(s) that is capable of effecting the cleavage, directly or indirectly, of the exogenous RNA of interest of the invention at a position that is located upstream from the inhibitory sequence, wherein the inhibitory sequence is located upstream from the specific target/cleavage site.
- the particular cleaving component(s) may include:
- nucleic acid sequence that is located within the exogenous RNA of interest, such that the particular nucleic acid sequence may include, for example, but is not limited to: endonuclease recognition site, endogenous miRNA binding site, cis acting ribozyme and/or miRNA sequence; or
- RNA a particular inhibitory RNA that is encoded from the composition of the invention
- the particular inhibitory RNA may include, for example, but is not limited to: microRNA (miRNA), lariat-form RNA, short-hairpin RNA (shRNA), siRNA expression domain, antisense RNA, double-stranded RNA (dsRNA), small-interfering RNA (siRNA) and/or ribozyme.
- miRNA microRNA
- shRNA short-hairpin RNA
- siRNA expression domain siRNA expression domain
- antisense RNA antisense RNA
- dsRNA double-stranded RNA
- siRNA small-interfering RNA
- ribozyme ribozyme
- the particular cleaving component(s) may remove the CAP structure from the intact exogenous RNA of interest of the invention for reducing the efficiency of translation of the protein of interest in the intact exogenous RNA of interest. For example, see FIG. 28B.
- cis acting ribozyme may be advantageous because the exogenous RNA of interest that comprises it may be cleaved by itself [22].
- the cis acting ribozyme may include, for example, but is not limited to cis-acting hammerhead ribozymes: snorbozyme [22] or Nl 17
- the inhibitory sequence in the exogenous RNA of interest that is described in embodiments of section 7 can be located upstream or downstream from the specific target/cleavage site. In some embodiments, the inhibitory sequence may be located downstream from the specific target/cleavage site in the exogenous RNA of interest. For example, see FIG. 22B.
- the inhibitory sequence that is located downstream from the specific target/cleavage site that is described in section 7 may include, but is not limited to an intron.
- the exogenous RNA of interest is a target for nonsense- mediated decay (NMD) that degrades the exogenous RNA of interest [31].
- NMD nonsense- mediated decay
- the inhibitory sequence that is located downstream from the specific target/cleavage site and that is described in section 7 includes a sequence that is capable of binding to a translation repressor protein, such that the translation repressor protein is an endogenous translation repressor protein or is encoded from the composition and such that the translation repressor protein, directly or indirectly, reduces the efficiency of translation of the protein of interest within the exogenous RNA of interest [26].
- the sequence that is capable of binding to a translation repressor protein may include, for example, the binding sequence of smaug repressor protein (5'- UGGAGCAGAGGCUCUGGCAGCUUUUGCAGCG-3') [27]. For example, see FIG. 29B.
- the inhibitory sequence that is located downstream from the specific target/cleavage site and that is described in section 7 comprises an RNA localization signal for subcellular localization (including cotranslational import) or an endogenous miRNA binding site, such that the subcellular localization of the exogenous RNA of interest of the invention inhibits the translation of the protein of interest and decreases the exogenous RNA of interest half-life.
- the RNA localization signal may include, for example,, but is not limited to RNA localization signal for: myelinating periphery, mitochondria, myelin compartment, leading edge of the lamella and/or Perinuclear cytoplasm [24].
- the RNA local ization signal may include, for example, RNA localization signal for myelinating periphery 5'-GCCAAGGAGCCAGAGAGCAUG-3' or 5'-GCCAAGGAGCC-3' [29]. For example, see FIG. 29C.
- the inhibitory sequence that is located downstream from the specific target/cleavage site and that is described in section 7 may include, for example, an RNA destabilizing element that stimulates degradation of the exogenous RNA of interest, such that the RNA destabilizing element is an AU-rich element (ARE) or an endonuclease recognition site.
- the AU-rich element may include, for example, AU-rich elements that are at least about 35 nucleotides long.
- the AU-rich element may include, for example, 5'-AUUUA-3', 5'-UUAUUUA(U/A)(U/A)-3' or 5'-AUUU-3' [28]. For example, see FIG. 29D.
- the inhibitory sequence that is located downstream from the specific target/cleavage site and that is described in section 7 comprises a sequence that is capable of forming a secondary structure that reduces the efficiency of translation of the upstream protein of interest.
- the inhibitory sequence that is located downstream from the specific target/cleavage site and that is described in section 7 comprises a sequence immediately downstream from the specific target/cleavage site that is capable of binding to the nucleotide sequence that is located immediately upstream from the specific target/cleavage site for the formation of a secondary structure, such that the secondary structure, directly or indirectly, reduces the efficiency of translation of the upstream protein of interest.
- the free energy of the folding of the secondary structure that is described in the former embodiment may be lower than -30 kcal/mol (for example, -50 kcal/mol, -80 kcal/mol) and hence this secondary structure may be sufficient to block scanning ribosomes from reaching the stop codon of the protein of interest.
- the specific target/cleavage site is located within the single stranded region or within the loop region in the secondary structure that is described in the former embodiment, such that the single stranded region or the loop region include, for example, but is not limited to a region that is at least about 15 nucleotides long. For example, see FIG. 30A. 7.2.2.
- This section describes further embodiments of additional structures of the composition of the invention described in various embodiments of section 7, such that these additional structures may increase the efficiency of translation of the cleaved exogenous RNA of interest, wherein the cleaved exogenous RNA of interest is cleaved at the specific target/cleavage site at the 3' end.
- the exogenous RNA of interest of the invention may include a sequence that comprises a unique internal ribosome entry site (IRES) sequence immediately upstream from the sequence encoding protein of interest, such that the unique IRES sequence may increase the efficiency of translation of the protein of interest in the cleaved exogenous RNA of interest.
- IRES internal ribosome entry site
- the exogenous RNA of interest that is described in section 7 may include a unique nucleotide sequence immediately downstream from the sequence encoding protein of interest, such that the unique nucleotide sequence comprises a unique stem loop structure and such that the unique stem loop structure, directly or indirectly, increases the efficiency of translation of the protein of interest and the cleaved exogenous RNA of interest half-life.
- the unique stem loop structure may include such structures as, but not limited to: a conserved stem loop structure of the human histone gene 3'-UTR or a functional derivative thereof.
- the conserved stem loop structure of the human histone gene 3'-UTR is 5'-GGCUCUUUUCAGAGCC-3'. For example, see FIG. 30C.
- the exogenous RNA of interest that is described in section 7 may include a unique nucleotide sequence immediately downstream from the sequence encoding protein of interest, such that the unique nucleotide sequence comprises a cytoplasmic polyadenylation element that, directly or indirectly, may increase the efficiency of translation of the protein of interest and the cleaved exogenous RNA of interest half-life.
- the cytoplasmic polyadenylation element may include, for example, such elements as: 5'- UUUUAU-3', 5'-UUUUAU-3', 5'-UUUUAAU-3', 5'-UUUUUUAUU-3', 5'-UUUUAUU-3' or 5'-UUUUUAUAAAG-3' [25].
- the composition of the invention may also include, for example, a polynucleotide sequence that encodes a human cytoplasmic polyadenylation element binding protein (hCPEB), or a homologue thereof for expressing hCPEB in any cell. For example, see FIG. 30D.
- hCPEB human cytoplasmic polyadenylation element binding protein
- the exogenous RNA of interest that is described in section 7 may include a unique nucleotide sequence that is located upstream from the specific target/cleavage site and downstream from the sequence encoding protein of interest, such that the unique nucleotide sequence is capable of binding to a sequence that is located upstream from the sequence encoding protein of interest.
- the cleaved exogenous RNA of interest may create a circular structure that may increase the efficiency of translation of the protein of interest in the cleaved exogenous RNA of interest. For example, see FIG. 31 A.
- the exogenous RNA of interest that is described in section 7 may include a unique nucleotide sequence that is located upstream from the specific target/cleavage site and downstream from the sequence encoding protein of interest, the unique nucleotide sequence may be capable of binding to a unique polypeptide that is, directly or indirectly, capable of binding to the CAP structure in the cleaved exogenous RNA of interest, wherein the unique polypeptide is encoded from the composition of the invention.
- the unique polypeptide and the cleaved exogenous RNA of interest may create a circular structure that may increase the efficiency of translation of the protein of interest in the cleaved exogenous RNA of interest.
- composition of the invention that is described in section 7 may include an additional polynucleotide sequence, which may encode an additional RNA molecule that comprises at the 3' end a nucleotide sequence that is capable of binding to a sequence that is located upstream from the specific target/cleavage site and downstream from the sequence encoding protein of interest, such that the expression of the additional polynucleotide sequence is driven by polymerase II based promoter.
- an additional polynucleotide sequence which may encode an additional RNA molecule that comprises at the 3' end a nucleotide sequence that is capable of binding to a sequence that is located upstream from the specific target/cleavage site and downstream from the sequence encoding protein of interest, such that the expression of the additional polynucleotide sequence is driven by polymerase II based promoter.
- the additional RNA molecule is capable of binding to the cleaved exogenous RNA of interest and provide him poly-A which may increase the efficiency of translation of the exogenous protein of interest in the cleaved exogenous RNA of interest. For example, see FIG. 3 1 C.
- This section describes further embodiments of additional structures of the composition of the invention that is described in embodiments of section 7, such that these additional structures reduce the efficiency of translation of the exogenous RNA of interest of the invention before it is cleaved.
- the composition that is described in section 7 may include a particular cleaving component(s) that is capable of effecting the cleavage, directly or indirectly, of the exogenous RNA of interest of embodiments of the invention at a position that is located downstream from the inhibitory sequence, wherein the inhibitory sequence is located downstream from the specific target cleavage site.
- the particular cleaving component(s) is:
- nucleic acid sequence that is located within the exogenous RNA of interest, such that the particular nucleic acid sequence may include, for example: endonuclease recognition site, endogenous miRNA binding site, cis acting ribozyme, miRNA sequence and the like; or
- RNA a particular inhibitory RNA that is encoded from the composition of the invention, such that the particular inhibitory RNA may include, for example, microRNA (miRNA), lariat- form RNA, short-hairpin RNA (shRNA), siRNA expression domain, antisense RNA, double- stranded RNA (dsRNA), small-interfering RNA (siRNA) or ribozyme.
- miRNA microRNA
- shRNA short-hairpin RNA
- siRNA expression domain siRNA expression domain
- antisense RNA antisense RNA
- dsRNA double- stranded RNA
- siRNA small-interfering RNA
- ribozyme ribozyme
- the particular cleaving component(s) may remove the poly-A from the intact exogenous RNA of interest of the invention and may thus reduce the efficiency of translation of the protein of interest in the intact exogenous RNA of interest. For example, see FIG. 3 ID.
- cis acting ribozyme may be advantageous because the exogenous RNA of interest that comprises it may be cleaved by itself [22].
- the cis acting ribozyme may include, for example, cis-acting hammerhead ribozymes: snorbozyme [22] or Nl 17 [23].
- an exogenous protein of interest may be expressed in response to the presence of an endogenous signal RNA in a cell without the involvement of Rise (RNA-induced silencing complex) mechanism.
- a composition for expressing an exogenous protein of interest in response to the presence of endogenous signal RNA in a cell the exogenous protein of interest is encoded from the composition
- the endogenous signal RNA is an RNA molecule which comprises a predetermined signal sequence
- the predetermined signal sequence is a predetermined sequence that is at least 18 nucleotides in length
- the composition may include one or more polynucleotide molecule(s), such as. for example, DNA molecules, that comprise:
- RNA of interest molecule (b) a polynucleotide sequence encoding an exogenous RNA of interest molecule, which is an RNA molecule that is consisting essentially of:
- a first sequence which is of sufficient complementarity to an edge sequence to hybridize therewith the edge sequence is located 0-5 nucleotides upstream from the predetermined cleavage site and extends upstream in the endogenous signal RNA, such that the first sequence comprises one or more initiation codon(s), such that each of the initiation codons is consisting essentially of 5'-AUG-3';
- the exogenous RNA of interest molecule comprises a sequence encoding exogenous protein of interest at least 21 nucleotides downstream from the 5' end of the exogenous RNA of interest molecule; and such that, following introduction of the composition into a cell comprising the endogenous signal RNA, the functional RNA effects the cleavage, directly or indirectly, of the endogenous signal RNA at the 3' end of the predetermined signal sequence.
- the exogenous RNA of interest molecule is hybridized to the edge sequence at the cleaved endogenous signal RNA and directs the predetermined signal sequence to Dicer processing that may cleave the exogenous RNA of interest molecule, such that each of the initiation codon(s) is detached from the sequence encoding the exogenous protein of interest and the exogenous protein of interest is capable of being expressed. For example, see FIG. 33.
- the edge sequence is 25-30 nucleotides in length and is located 2 nucleotides upstream from the predetermined cleavage site and extends upstream in the endogenous signal RNA and such that the second sequence is 0 nucleotides in length, such as shown, for example in FIG. 33.
- At least one of the initiation codon(s) is located within a Kozak consensus sequence, such as, for example, Kozak consensus sequence 5'- ACCAUGG-3', demonstrated for example in FIG. 34.
- each of the initiation codon(s) is located 0-
- RNA of interest molecule 21 nucleotides downstream from the 5' end of the exogenous RNA of interest molecule, such that each of the initiation codon(s) and the sequence encoding the exogenous protein of interest are not in the same reading frame.
- at least one of the initiation codon(s) described above is located within a Kozak consensus sequence such as, for example, Kozak consensus sequence 5'-ACCAUGG-3'.
- the functional RNA may include, but is not limited to: microRNA (miRNA), lariat-form RNA, short-hairpin RNA (shRNA), siRNA expression domain, antisense RNA, double-stranded RNA (dsRNA), small-interfering RNA (siRNA). ribozyme, or combinations thereof.
- miRNA microRNA
- shRNA short-hairpin RNA
- siRNA expression domain siRNA expression domain
- antisense RNA antisense RNA
- dsRNA double-stranded RNA
- siRNA small-interfering RNA
- ribozyme or combinations thereof.
- the functional RNA may be, for example, a microRNA (miRNA), such that the miRNA and the exogenous RNA of interest molecule are capable of being located on the same or different RNA molecules.
- the miRNA may be located upstream from the second sequence at the exogenous RNA of interest molecule, as demonstrated, for example, in FIG. 34.
- the previous embodiment may be advantageous since in such embodiment, the 5 CAP structure may be removed from the exogenous RNA of interest molecule and since in this embodiment the composition encodes for only one RNA molecule.
- the functional RNA may be, for example, a small- interfering RNA (siRNA), such that one RNA strand of the siRNA is located at the 5' end of the exogenous RNA of interest molecule and the other strand of the siRNA is transcribed from 10 the composition by, for example, polymerase I or polymerase III based promoter(s) and such that following introduction of the composition into a cell, both of the siRNA strands are hybridized and detached from the exogenous RNA of interest molecule, for example, by Dicer. This is demonstrated, for example, in FIG. 35.
- siRNA small- interfering RNA
- the previous embodiment may be advantageous since in such embodiment the functional RNA and the exogenous RNA of interest molecule are located in the same RNA duplex, thus the exogenous RNA of interest molecule brings the functional RNA into proximity with the predetermined signal sequence of the endogenous signal RNA and by this may also bring also the components of the RNA interference pathway (such as, for example, Dicer) into 0 proximity with the predetermined signal sequence.
- Another advantage may include the removal of the CAP structure from the exogenous RNA of interest molecule by Dicer.
- the exogenous RNA of interest molecule may further include a nucleotide sequence located upstream from the sequence encoding the protein of interest and downstream from each of the initiation codons, such that this nucleotide 5 sequence is of sufficient complementarity to the predetermined signal sequence or to the sequence that is located at the 5' end of the exogenous RNA of interest molecule, and is able to direct target-specific RNA interference.
- the Rise processing that follows the Dicer processing can be used for activating more exogenous RNA of interest molecule molecules.
- the composition further comprises one or more 0 polynucleotide sequence(s) encoding a functional nucleic acid that is capable of effecting the cleavage, directly or indirectly, of the exogenous RNA of interest molecule upstream from the second sequence, such that the functional nucleic acid is: (a) a specific nucleic acid sequence that is located within the exogenous RNA of interest molecule, such that the specific nucleic acid sequence is: endonuclease recognition site, endogenous miRNA binding site, cis acting ribozyme or miRNA sequence; or
- inhibitory RNA that is encoded from a DNA molecule(s), such that the inhibitory RNA is: microRNA (miRNA), lariat-form RNA, short-hairpin RNA (shRNA), siRNA expression domain, antisense RNA, double-stranded RNA (dsRNA), small-interfering RNA (siRNA) or ribozyme.
- miRNA microRNA
- shRNA short-hairpin RNA
- siRNA expression domain siRNA expression domain
- antisense RNA antisense RNA
- dsRNA double-stranded RNA
- siRNA small-interfering RNA
- ribozyme ribozyme
- the functional nucleic acid may remove the CAP structure from the intact exogenous RNA of interest for reducing the efficiency of translation of the exogenous protein of interest from the non-cleaved (intact) exogenous RNA of interest. For example, see FIG. 36A.
- the third sequence described above includes a nucleotide sequence upstream from the sequence encoding protein of interest, such that the nucleotide sequence is capable of binding to a sequence that is located downstream from the sequence encoding protein of interest.
- the cleaved exogenous RNA of interest molecule creates a circular structure that may increase the efficiency of translation of the protein of interest in the cleaved exogenous RNA of interest molecule. For example, see FIG. 36B.
- the polynucleotide molecule(s) that is described above together further comprise a polynucleotide sequence encoding an additional functional RNA that is capable of effecting the cleavage, directly or indirectly, of the endogenous signal RNA at an additional cleavage site, such that the additional cleavage site is located 0-1000 nucleotides upstream from the 5' end of the predetermined signal sequence.
- the additional cleavage site that described in the former embodiment is located 0-5 nucleotides upstream from the 5' end of the predetermined signal sequence. For example, see FIG. 2 IB.
- This section describes additional embodiments of the invention that are directed to the cleavage of the exogenous RNA of interest in response to the presence of an endogenous signal RNA in a cell, without the cleaving the endogenous signal RNA.
- Such embodiments may be useful, for example, for endogenous signal RNA of a viral origin.
- a composition for cleaving an exogenous RNA of interest in response to the presence of an endogenous signal RNA in a cell the exogenous RNA of interest is encoded from the composition
- the endogenous signal RNA is an RNA molecule which comprises a predetermined signal sequence at the 5' end
- the predetermined signal sequence is a predetermined sequence of from 18 to 25 nucleotides in length
- the composition comprises one or more polynucleotides molecules (such as, for example, DNA and/or RNA molecules), that comprise:
- RNA sequence (a) a polynucleotide sequence encoding the exogenous RNA of interest, such that the exogenous RNA of interest is an RNA sequence that comprises a specific sequence which is of sufficient complementarity to the predetermined signal sequence to direct, for example, target-specific RNA interference;
- a polynucleotide sequence encoding a carrier RNA such that expression of the polynucleotide sequence the carrier RAN sequence is driven by a promoter selected from the group consisting of: polymerase I based promoter and polymerase III based promoter, such that the carrier RNA is an RNA molecule that is at least about 18 nucleotides in length and is consisting essentially of:
- (1 ) a first sequence of from 14 to 31 nucleotides in length which is of sufficient complementarity to an edge sequence to hybridize therewith, the edge sequence is 14-31 nucleotides in length and is located 0-5 nucleotides downstream from the 5' end of the endogenous signal RNA and extends downstream in the endogenous signal RNA;
- the carrier RNA is hybridized to the edge sequence and directs the processing of the predetermined signal sequence, and then the processed predetermined signal sequence may direct the cleavage of the exogenous RNA of interest at a specific target (cleavage) site that is located within the specific sequence. For example, see FIG. 37A.
- a composition for cleaving exogenous RNA of interest in response to the presence of an endogenous signal RNA in a cell the exogenous RNA of interest is encoded from the composition
- the endogenous signal RNA is an RNA molecule which comprises a predetermined signal sequence at the 5' end
- the signal sequence is a predetermined sequence of from 18 to 25 nucleotides in length
- the composition comprises one or more polynucleotide molecules (such as, for example, DNA molecules and/or RNA molecule), the polynucleotide molecules together comprise:
- RNA sequence (a) a polynucleotide sequence encoding the exogenous RNA of interest, such that the exogenous RNA of interest is an RNA sequence that comprises a specific sequence which is of sufficient complementarity to the predetermined signal sequence to direct cleavage, for example, by target-specific RNA interference;
- RNA sequence that comprises a carrier sequence that is at least about 18 nucleotides in length, the carrier sequence consisting essentially of:
- the functional nucleic acid effects the cleavage, directly or indirectly, of the carrier RNA sequence at the 3' end of the carrier sequence and then the cleaved carrier sequence is hybridized to the edge sequence and directs the processing of the predetermined signal sequence and then the processed predetermined signal sequence directs the cleavage of the exogenous RNA of interest at a specific cleavage/target site that is located within the specific sequence.
- the functional nucleic acid effects the cleavage, directly or indirectly, of the carrier RNA sequence at the 3' end of the carrier sequence and then the cleaved carrier sequence is hybridized to the edge sequence and directs the processing of the predetermined signal sequence and then the processed predetermined signal sequence directs the cleavage of the exogenous RNA of interest at a specific cleavage/target site that is located within the specific sequence.
- FIG. 37B see FIG. 37B.
- the edge sequence, described above is 23-29 nucleotides in length and may be located from the 5' end of the endogenous signal RNA to about 23-29 nucleotides downstream, such that the second sequence may be 2 nucleotides in length and such that the third sequence may be 0 nucleotides in length. For example, see FIG. 37A, 37B.
- a composition for cleaving exogenous RNA of interest in response to the presence of an endogenous signal RNA in a cell the exogenous RNA of interest is encoded from the composition
- the endogenous signal RNA is an RNA molecule which comprises a predetermined signal sequence at the 3' end, the predetermined signal sequence is a random sequence of from 18 to 25 nucleotides in length
- the composition comprises one or more polynucleotide molecules (such as, for example, DNA or RNA molecules), the polynucleotide molecules together comprise:
- RNA sequence (a) a polynucleotide sequence encoding the exogenous RNA of interest, such that the exogenous RNA of interest is an RNA sequence that comprises a specific sequence which is of sufficient complementarity to the predetermined signal sequence to direct cleavage, for example, by target-specific RNA interference;
- RNA RNA molecule that is at least about 1 8 nucleotides in length and is consisting essentially of:
- (1 ) a first sequence of from 14 to 31 nucleotides in length which is of sufficient complementarity to an edge sequence to hybridize therewith, the edge sequence is 14-31 nucleotides in length and is located 0-5 nucleotides upstream from the 3' end of the endogenous signal RNA and extends upstream in the endogenous signal RNA;
- the carrier RNA is hybridized to the edge sequence and directs the processing of the predetermined signal sequence and then the processed predetermined signal sequence directs the cleavage of the exogenous RNA of interest at a specific cleavage/target site that is located within the specific sequence. For example, see FIG. 38A.
- a composition for cleaving exogenous RN A of interest in response to the presence of an endogenous signal RNA in a cell the exogenous RNA of interest is encoded from the composition
- the endogenous signal RNA is an RNA molecule which comprises a predetermined signal sequence at the 3' end
- the predetermined signal sequence is a random/predetermined sequence of from 18 to 25 nucleotides in length
- the composition comprises one or more polynucleotide molecules (such as. for example, DNA molecules and/or RNA molecules), the polynucleotide molecules together comprise:
- RNA sequence (a) a polynucleotide sequence encoding the exogenous RNA of interest, such that the exogenous RNA of interest is an RNA sequence that comprises a specific sequence which is of sufficient complementarity to the predetermined signal sequence to direct cleavage, for example, by target-specific RNA interference;
- RNA sequence that comprises a carrier sequence that is at least about 18 nucleotides in length, the carrier sequence consisting essentially of:
- the functional nucleic acid effects the cleavage, directly or indirectly, of the carrier RNA sequence at the 5' end of the carrier sequence and then the cleaved carrier sequence is hybridized to the edge sequence and directs the processing of the predetermined signal sequence and then the processed predetermined signal sequence directs the cleavage of the exogenous RNA of interest at a specific cleavage/target site that is located within the specific sequence.
- the functional nucleic acid effects the cleavage, directly or indirectly, of the carrier RNA sequence at the 5' end of the carrier sequence and then the cleaved carrier sequence is hybridized to the edge sequence and directs the processing of the predetermined signal sequence and then the processed predetermined signal sequence directs the cleavage of the exogenous RNA of interest at a specific cleavage/target site that is located within the specific sequence.
- FIG. 38B see FIG. 38B.
- the edge sequence described above is about 25-30 nucleotides in length and may be located 2 nucleotides upstream from the 3 ' end of the endogenous signal RNA and extends upstream in the endogenous signal RNA, such that the second sequence may be 0 nucleotides in length and such that the third sequence is 0 nucleotides in length.
- the edge sequence described above is about 25-30 nucleotides in length and may be located 2 nucleotides upstream from the 3 ' end of the endogenous signal RNA and extends upstream in the endogenous signal RNA, such that the second sequence may be 0 nucleotides in length and such that the third sequence is 0 nucleotides in length.
- FIG. 38A, 38B see FIG. 38A, 38B.
- the functional nucleic acid described above is:
- a specific nucleic acid sequence that is located within the carrier RNA sequence and such that the specific nucleic acid sequence is, for example, endonuclease recognition site, endogenous iniRNA binding site, cis acting ribozyme, a miRNA sequence, and the like, or combinations thereof; or
- inhibitory RNA that is encoded from the polynucleotide molecule(s), such that the inhibitory RNA is, for example, microRNA (miRNA), lariat-form RNA, short-hairpin RNA (shRNA), siRNA expression domain, antisense RNA, double-stranded RNA (dsRNA), small- interfering RNA (siRNA), ribozyme, and the like, or combinations thereof.
- miRNA microRNA
- shRNA short-hairpin RNA
- siRNA expression domain antisense RNA
- dsRNA double-stranded RNA
- siRNA small- interfering RNA
- ribozyme ribozyme
- the exogenous RNA of interest described above is located at the third sequence.
- the exogenous RNA of interest described above may further comprise:
- the specific target/cleavage site is located between the inhibitory sequence and the sequence encoding the protein of interest, such that, following introduction of the composition into a cell comprising the endogenous signal RNA, the exogenous RNA of interest is transcribed and cleaved at the specific target/cleavage site so that the inhibitory sequence is detached from the sequence encoding the protein of interest and the protein of interest is capable of being expressed.
- the inhibitory sequence described above may be located upstream from the specific target/cleavage site, such that the inhibitory sequence comprises a plurality of initiation codons, such that each of the initiation codons and the sequence encoding the exogenous protein of interest are not in the same reading frame, such that each of the initiation codons is consisting essentially of 5'-AUG-3', such that at least one of the initiation codons is located within a Kozak consensus sequence and such that the Kozak consensus sequence is 5'-ANNAUGG-3' (wherein N is any nucleotide of A, G, C or U).
- the endogenous signal RNA may include, for example, but is not limited to: viral RNA, cellular RNA, such as, for example, mRNA, and the like, that comprises the predetermined signal sequence.
- the predetermined signal sequence may include for example, signal sequence that is unique to neoplastic cells, signal sequence that is from viral origin, and the like, or combinations thereof.
- the predetermined signal sequence does not include any other type of an endogenous RNA molecule (such as, for example, miRNA, shRNA. ribozyine, stRNA, and the like), that is able to direct or effect cleavage of an RNA molecule within the cell.
- the cell that may be used in embodiments of the invention may include, any type of cell from any origin, such as, for example, but not limited to: mammalian cell, avian cell, plant cell, human cell, animal cell, and the like.
- the cell may be a cultured cell (primary cell or a cell line).or any cell that is present in an organism or a plant.
- the duplex that is formed when the canier RNA/sequence is hybridized to the cleaved endogenous signal RNA may be a substrate for a Dicer.
- the edge sequence that is described in embodiments in section 1 is 23-28 nucleotides in length and is located from the predetermined cleavage site to about 23- 28 nucleotides downstream, such that the second sequence is 2 nucleotides in length and such that the third sequence is 0 nucleotides in length.
- the edge sequence that is described in embodiments in section 1 is 25-30 nucleotides in length and is located 2 nucleotides upstream from the predetermined cleavage site and extends upstream in the endogenous signal RNA, such that the second sequence is 0 nucleotides in length and such that the third sequence is 0 nucleotides in length.
- the carrier RNA or the carrier sequence that is described in section 1 or 9 above may be designed such that the duplex that is formed when the predetermined signal sequence is cleaved, for example, by Dicer, is thermodynamically weaker at the 5' end of the predetermined signal sequence than at the 3' end of the predetermined signal sequence. Such that the strand that is loaded into Rise is the strand that comprises the predetermined signal sequence.
- sufficient complementarity may include, but is not limited to: being capable of binding, or at least partially complementary.
- the term sufficient complementarity is in the range of about 30-100%.
- the term sufficient complementarity is at least about 30% complementarity.
- the term sufficient complementarity is at least about 50% complementarity.
- the term sufficient complementarity is at least about 70% complementarity.
- the term sufficient complementarity is at least about 90% complementarity.
- the term sufficient complementarity is about 100% complementarity.
- the expression of the carrier RNA polynucleotide sequence that is described in section 1 may be driven by polymerase I based promoter or polymerase III based promoter.
- the expression of the carrier RNA polynucleotide sequence described in section 1 may be driven by a promoter that may include, but is not limited to: RNA polymerase III 5S promoter, U6 promoter, adenovirus VA1 promoter, Vault promoter, HI promoter, telomerase RNA or tRNA gene promoter or a functional derivative thereof.
- the exogenous protein of interest that is described in any of sections 7, 8 or 9 may include any type of protein or peptide.
- the exogenous protein of interest includes, but is not limited to: alpha toxin, saporin, maize RIP, barley RIP, wheat RIP, corn RIP, rye RIP, flax RIP, Shiga toxin, Shiga-like RIP, momordin, pokeweed antiviral protein, gelonin, Pseudomonas exotoxin, Pseudomonas exotoxin A or modified forms thereof.
- the exogenous protein of interest may include, but is not limited to: Ricin A chain.
- the exogenous protein of interest may include, for example, but is not limited to an enzyme (such as, for example, Luciferase), a fluorescent protein, a structural protein, and the like.
- the exogenous protein of interest may include a toxin that may also effect neighboring cells.
- This toxin may include, but is not limited to, the complete form of: Ricin, Abrin, Diphtheria toxin or modified forms thereof.
- the exogenous protein of interest may include an enzyme that its product can kill also the neighboring cells.
- Such as enzyme may include, but is not limited to: HSV 1 thymidine kinase, such that the composition of the invention further comprises the prodrug - ganciclovir; or Escherichia coli cytosine deaminase, such that the composition of the invention further comprises the prodrug - 5-fluorocytosine (5-FC).
- the exogenous RNA of interest or the intermediate RNA that is described in any of sections 7, 9 or 8 is encoded from a viral vector and the exogenous protein of interest is a product of gene that is necessary for the viral vector reproduction, such that the viral vector reproduces in response to the presence of the endogenous signal RNA in a cell and kills the cell during the process of reproduction.
- This viral vector may also include, but is not limited to a gene that is capable of stopping the viral vector reproduction when a specific molecule is present in the cell (for example, TetR-VP16 / Doxycycline).
- This viral vector may also include, but is not limited to a gene that is capable of killing the cell when a specific prodrug is present (e.g. thymidine kinase / ganciclovir), such that when the viral vector is presumed to accumulate enough mutations for reproduction in cells that do not comprise the endogenous signal RNA the specific prodrug can be administered for killing all the viral vectors in the body and then new viral vectors can be administered again.
- a specific prodrug e.g. thymidine kinase / ganciclovir
- the RNA molecule(s) that are encoded from the compositions of the invention are encoded from a viral vector that is capable of being reproduced in a way that may kill the cel l during the process of reproduction.
- the predetermined signal sequence is not present in, for example, cancer cells, and is present in most of the healthy or nonmetastatic tumourigenic cells of the body of a specific patient and such that the exogenous protein of interest that is described in any of sections 7, 8 or 9 is a toxin that may include, but is not limited to: Ricin A chain, Abrin A chain, Diphtheria toxin fragment A or modified forms thereof.
- This viral vector may also include, but is not limited to a gene that is capable of stopping the viral vector reproduction when a specific molecule is present in the cell (e.g. TetR-VP 16 / Doxycycline).
- This viral vector may also include, but is not limited to a gene that is capable of killing the cell when a specific prodrug is present (e.g. thymidine kinase / ganciclovir), such that when the viral vector is presumed to get enough mutations for reproduction in cells that comprise the endogenous signal RNA the specific prodrug can be administered for killing all the viral vectors in the body and then new viral vectors can be administered again.
- a specific prodrug e.g. thymidine kinase / ganciclovir
- the specific sequence that is located within the exogenous RNA of interest that is described in section 1 or 9 is a plurality of specific sequences and the speci fic target/cleavage site is a plurality of specific target/cleavage sites.
- the exogenous RNA of interest that is described in section 7 wherein said "upstream from the specific cleavage site” also includes upstream from all the cleavage sites and wherein said "downstream from the cleavage site” also includes downstream from all the specific cleavage sites.
- FIG. 32A, 32B see FIG. 32A, 32B.
- the specific sequence that is located within the exogenous RNA of interest that is described in section 1 or 9 is one or more specific sequence(s) and the specific target/cleavage site is one or more specific target/cleavage site(s) and the exogenous RNA of interest further comprises: a sequence encoding protein of interest downstream from the specific target/cleavage site(s), one or more unique sequence(s), such that each of the unique sequence(s) is of sufficient complementarity to the predetermined signal sequence to direct target-specific RNA interference, such that each of the unique sequence(s) is located downstream from the sequence encoding protein of interest and 2 inhibitory sequences one at the 5' end of the exogenous RNA of interest and other at the 3' end of the exogenous RNA of interest, such that each of the inhibitory sequences is capable of inhibiting the expression of the exogenous protein of interest.
- the two inhibitory sequences are detached from the sequence encoding the exogenous protein of interest
- the polynucleotide molecule(s) (such as DNA molecules and/or RNA molecules) of the composition that are described in any of sections 1 , 8 or 9 may further comprise a polynucleotide sequence encoding Dicer, or a homologue thereof.
- the polynucleotide molecule(s) of the composition that are described in section 1 or 9 together further comprise a polynucleotide sequence encoding one or more RISC components, or a homologue thereof.
- the polynucleotide molecule(s) of the composition may further comprise a polynucleotide sequence encoding one or more RNA molecules that are capable of unwinding the secondary structure of the endogenous signal RNA at the predetermined signal sequence.
- the polynucleotide molecule(s) of the composition that are described in any of sections 1 , 8 or 9 may further comprise a polynucleotide sequence encoding a special functional RNA that is capable of inhibiting the expression, directly or indirectly, of an endogenous exonuclease.
- the special functional RNA may include, for example, but is not limited to: microRNA (miRNA), lariat-form RNA, short- hairpin RNA (shRNA), siRNA expression domain, antisense RNA, double-stranded RNA (dsRNA), small-interfering RNA (siRNA) or ribozyme.
- the inhibitory sequence that is described in any of the embodiments above is a sequence or a part of a sequence such that when it is detached from the sequence encoding the exogenous protein of interest, the exogenous protein of interest is capable of being expressed, and when it is not detached from the sequence encoding the exogenous protein of interest, it is capable of inhibiting the expression of the exogenous protein of interest when it is within its specific context in the exogenous RNA of interest.
- the inhibitory sequence may also be, but is not l imited to, only a part of any of the inhibitory sequences that described above within its specific context.
- the inhibitory sequence may also be only the A or the 5'-AU-3' part in the context of — UG-3' or --G-3' respectively (in other words, the exogenous RNA of interest comprises an out of reading frame 5'-AUG-3 ' at the 5' end, however the sequence that will be detached is only the 5'-AU-3' part).
- the carrier RNA that is described in section 1 can also be 14- 18 nucleotides long.
- the first sequence and the edge sequence that are described in any of sections 1 , 8 or 9 can also be 29-200 nucleotides long, as long as the duplex that is formed when they are hybridized does not activate the PKR in the cell.
- the cells that are described in any of the previous embodiments in any of the previous sections to which the composition of the invention is inserted may further include, but is not limited to: cells extract or in vitro mixture that comprises cellular proteins (such as, for example, Dicer, Rise).
- the exogenous RNA of interest that is described in section 7 may further comprise an RNA localization signal for subcellular localization (including cotranslational import) between the specific target/cleavage site and the sequence encoding for the exogenous protein of interest, such that the inhibitory sequence is capable of inhibiting the function of the RNA localization signal for subcellular localization such that the subcellular localization of the exogenous RNA of interest is necessary for the proper expression of the protein of interest.
- an RNA localization signal for subcellular localization including cotranslational import
- the inhibitory sequence that is described in section 7 comprises an initiation codon upstream from the specific target/cleavage site, such that the initiation codon is consisting essentially of 5'-AUG-3', such that the inhibitory sequence further comprises a nucleotide sequence encoding an amino acid sequence immediately downstream from the initiation codon, such that the nucleotide sequence and the sequence encoding the exogenous protein of interest are in the same reading frame, such that the amino acid sequence is capable of inhibiting the function of the sorting signal for subcellular localization of the exogenous protein of interest and such that the subcellular localization of the exogenous protein of interest is necessary for its proper expression.
- FIG. 39C see FIG. 39C.
- the exogenous RNA of interest that is described in section 7 does not comprise a stop codon downstream from the start codon of the sequence encoding the exogenous protein of interest, such that the inhibitory sequence is located downstream from the sequence encoding the exogenous protein of interest within the exogenous RNA of interest, such that the inhibitory sequence and the sequence encoding the exogenous protein of interest are in the same reading frame, such that the inhibitory sequence encodes an amino acid sequence that is selected from the group consisting of:
- an amino acid sequence that is a sorting signal for subcellular localization (b) an amino acid sequence that is a sorting signal for subcellular localization; (c) an amino acid sequence that is a protein degradation signal; (d) an amino acid sequence that is capable of inhibiting the function of the sorting signal for subcellular local ization of the protein of interest; and
- an amino acid sequence that is capable of inhibiting the cleavage of a peptide sequence that is encoded by a nucleotide sequence that is located between the specific target/cleavage site and the start codon of the sequence encoding the exogenous protein of interest, such that the nucleotide sequence and the sequence encoding the exogenous protein of interest are in the same reading frame and such that the peptide sequence is capable of being cleaved by a protease in a mammalian cell.
- the exogenous RNA of interest and the functional RNA, that are described in embodiments in section 1 are capable of being located on the same or different RNA molecules.
- the exogenous RNA of interest and/or the functional RNA, that are described in embodiments in section 1 are capable of being located within a third sequence.
- the exogenous RNA of interest the functional
- RNA, the carrier RNA and the functional nucleic acid, that are described in embodiments in section 1 are capable of being located on one or more RNA molecules.
- the one or more polynucleotide molecule(s) that described in any of the previous embodiments in any of the previous sections includes one or more DNA molecule.
- the one or more DNA molecule(s) are present in one or more DNA vectors (such as, for example, expression vectors), and/or viral vectors.
- the polynucleotide molecule(s) (such as DNA molecules and/or RNA molecules) of the composition of the invention may be recombinantly engineered, by any of the methods known in the art, into a variety of host vector systems that may also provide for replication of the polynucleotide molecule(s) in large scale and which contain the necessary elements for directing the transcription of the RNA molecule(s) that are encoded from the composition of the invention.
- the use of such vectors to transfect target cells in the patient may result in the transcription of sufficient amounts of the RNA molecule(s) that are encoded from the composition of the invention.
- a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of these RNA molecule(s).
- a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired RNA molecule(s) that encoded from the composition of the invention.
- Such vectors can be constructed by recombinant DNA technology methods well known in the art or can be prepared by any method known in the art for the synthesis of DNA molecules.
- the recombinant polynucleotide constructs that encode for the RNA molecule(s) which are encoded from the composition of the invention may include a plasmid, vector, viral construct, or others known in the art, used for replication and expression in the appropriate target cell (which may include, for example, mammalian cells). Expression of these RNA molecule(s) can be regulated by any promoter known in the art to act in the target cell (such as, for example, mammalian cells, which include, for example human cells). Such promoters can be inducible or constitutive.
- Such promoters include, for example, but are not limited to: the SV40 early promoter region, the promoter contained in the 3' long terminal repeat of Rous sarcoma virus, the herpes thymidine kinase promoter, the regulatory sequences of the metallothionein gene, the viral CMV promoter, the human chorionic gonadotropin-beta promoter, and the like.
- Any type of plasmid, cosmid, YAC or viral vector can be used to prepare the recombinant polynucleotide constructs which can be introduced directly into the target tissue/cell site.
- viral vectors can be used which selectively infect the desired target cell.
- the vector that encodes for the RNA molecule(s) that are encoded from the composition of the invention will have a selectable marker.
- a number of selection systems can be used, including but not limited to selection for expression of the herpes simplex virus thymidine kinase, hypoxanthine-guanine phosphoribosyltransterase and adenine phosphoribosyl tranferase protein in tk-, hgprt- or aprt-deficient cells, respectively.
- anti-metabolic resistance can be used as the basis of selection for dihydrofolate tranferase (dhfr), which confers resistance to methotrexate; xanthine-guanine phosphoribosyl transferase (gpt), which confers resistance to mycophenolic acid; neomycin (neo), which confers resistance to aminoglycoside G-418; and hygromycin B phosphotransferase (hygro) which confers resistance to hygromycin.
- dihydrofolate tranferase dhfr
- methotrexate methotrexate
- gpt xanthine-guanine phosphoribosyl transferase
- neomycin which confers resistance to aminoglycoside G-418
- hygromycin B phosphotransferase hygromycin
- Vectors for use in the practice of the invention include any eukaryotic expression vectors.
- the RNA molecule(s) that are encoded from the composition of the invention are encoded by a viral expression vector.
- the viral expression vector may include, but is not limited to those belonging to a family of: Herpesviridae, Poxyiridae, Adenoviridae, Papillomaviridae, Parvoviridae, Hepadnoviridae, Retroviridae, Reoviridae, Filoviridae, Paramyxoviridae, Pneumoviridae, Rhabdoviridae, Orthomyxoviridae, Bunyaviridae.
- the viral expression vector may also include, but is not limited to an adenoviral vector that its cellular tropism has been modified by the replacement of the adenovirus terminal knob domain of the fiber protein (HI loop), which is exposed at the fiber surface.
- adenoviral vector that its cellular tropism has been modified by the replacement of the adenovirus terminal knob domain of the fiber protein (HI loop), which is exposed at the fiber surface.
- the composition of the invention may includes the RNA molecule(s) that is encoded from this composition, or derivatives or modified versions thereof, single-stranded or double-stranded.
- RNA molecule(s) that encoded from the composition of the invention may include, but are not limited to deoxyribonucleotides, ribonucleosides, phosphodiester linkages, modified linkages or bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).
- RNA molecule(s) that are encoded from the composition of the invention can be prepared by any method known in the art for the synthesis of RNA molecules.
- these RNA molecule(s) may be chemically synthesized using commercially available reagents and synthesizers by methods that are well known in the art.
- these RNA molecule(s) can be generated by in vitro and in vivo transcription of DNA sequences that encoding these RNA molecule(s).
- DNA sequences can be incorporated into a wide variety of vectors which incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters.
- These RNA molecule(s) may be produced in high yield via in vitro transcription using plasmids such as SPS65.
- RNA amplification methods such as Q-beta amplification can be utilized to produce these RNA molecule(s).
- polynucleotide molecules of the invention such as, DNA molecule(s) and/or RNA molecule(s), and/or the RNA molecules encoded by the composition can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, in order to improve stability of the molecule, hybridization, transport into the cell, etc. In addition, modifications can be made to reduce susceptibility to nuclease degradation.
- the polynucleotide molecule(s) of the composition of the invention and/or the RNA molecules encoded by the composition may include other appended groups such as, for example, peptides (for example, for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane or the blood- brain barrier, hybridization-triggered cleavage agents or intercalating agents.
- peptides for example, for targeting host cell receptors in vivo
- agents facilitating transport across the cell membrane or the blood- brain barrier hybridization-triggered cleavage agents or intercalating agents.
- Various other well known modifications can be introduced as a means of increasing intracellular stability and half- life. Possible modifications include, but are not limited to, the addition of flanking sequences of ribo- or deoxy-nucleotides to the 5' and/or 3' ends of the molecule.
- nucleic acids having modified intenucleoside linkages such as 2'-0-methylation may be preferred.
- Nucleic acids containing modified intenucleoside linkages may be synthesized using reagents and methods that are well known in the art.
- polynucleotide molecule(s) of the composition and/or the RNA molecule(s) that encoded from the composition of the invention may be purified by any suitable means, as are well known in the art (for example, reverse phase chromatography or gel electrophoresis).
- Cells that produce viral vectors that together encode the RNA molecule(s) that are encoded from the composition of the invention can also be used for transplantation in a patient for continuous treatment. These cells can further carry a specific gene that can kill them if a speci fic molecule is introduced to the patient's circulating system (for example: . HSV 1 Thymidine kinase / Ganciclovir).
- each one of the RNA molecule(s) that are encoded from the composition of the invention can be an RNA molecule or a reproducing RNA molecule.
- the reproducing RNA molecule is an RNA molecule that comprises a sequence that is complementary to any of these RNA molecule(s) such that the reproducing RNA molecule is capable of being replicated in the cell for the formation of any of these RNA molecule(s).
- each of the RNA molecule(s) that are encoded from the composition of the invention can be prepared from various types, including, but are not limited to: synthetic RNA, synthetic RNA with modified bases, RNA that is produced by in vitro transcription, DNA molecule that encodes the RNA molecule, vector or viral vector that encodes the RNA molecule or DNA with modified bases that encodes the RNA molecule.
- the functional RNA can be a synthetic siRNA while the exogenous RNA of interest can be encoded from a viral vector and while the Carrier RNA can be encoded from a plasmid.
- composition of the present invention may be used in various applications including, but not limited to: regulation of gene expression, targeted cell death, treatment, and/or prevention of various diseases and health related conditions (such as, for example, proliferative disorders (for example, cancer), infectious diseases and the like), diagnosis of various health related conditions, formation of transgenic organisms, suicide gene therapy, and the like.
- diseases and health related conditions such as, for example, proliferative disorders (for example, cancer), infectious diseases and the like
- diagnosis of various health related conditions formation of transgenic organisms, suicide gene therapy, and the like.
- the composition of the present invention can be used to activate toxic gene in cells that comprise viral RNA, in order to kill these cells.
- the composition of the present invention can be used to activate toxic gene in cells that include an endogenous mRNA which comprises a predetermined signal sequence that is unique to cancer cells, for the targeted and specific killing of these cells.
- a method for killing a specific cell/cell population wherein the cell population comprises an endogenous signal RNA. comprising a predetermined signal sequence, which is unique and specific for these cells; the method includes introducing the cells with the composition of the invention, wherein the composition comprises one or more polynucleotides for directing the specific cleavage of an exogenous RNA of interest at a specific target site that is located within a specific sequence, which is of sufficient complementarity to hybridize with the predetermined signal sequence, wherein the cleavage of the exogenous RNA of interest leads to the expression of an exogenous protein of interest, capable of killing the cells.
- the exogenous protein of interest may be selected from, but not limited to: any type of protein that can damage the cell function and as a result lead to the death of the cell.
- the protein may include such types of proteins as, but not limited to: toxins, cel l growth inhibitors, modulators of cellular growth, inhibitors of cellular signaling pathways, modulators of cellular signaling pathways, modulators of cell permeability, modulators of cellular processes, and the like.
- compositions and methods of the present invention may provide a specific and targeted "all or none" response in a cell.
- compositions and methods of the present invention are such that the exogenous RNA of interest is cleaved (and consequently, the protein of interest is expressed and activated) only in those target cells, which include a specific endogenous signal RNA, whereas cells that do not include the endogenous signal RNA will not be effected by the composition of the invention.
- the composition and methods of the present invention may thus provide enhanced safety and control, since no leakiness in the expression of the exogenous protein of interest is observed in cells which do not include the endogenous signal RNA, which comprises the predetermined signal sequence.
- the composition of the present invention can be used to activate reporter gene in the presence of viral RNA for the diagnosis of viral infection diseases.
- the composition of the present invention may be used to stably transfect cells for the formation of transgenic organism that is resistant to viral infection.
- the composition of the present invention can be used to stably transfect cells for the formation of transgenic organism that is able to activate reporter gene in the presence of viral RNA for the diagnosis of viral infection diseases.
- the composition of the present invention can be used to monitor in real time the changes in RNA sequence in the cell .
- the delivery systems and methods include, for example, use of various transfecting agents, encapsulation in liposomes, microparticles, microcapsules, recombinant cells that are capable of expressing the composition, receptor-mediated endocytosis, construction of the composition of the invention as part of a viral vector or other vector, viral vectors that are capable of being reproduced without killing the cell during the process of reproduction and that comprise the composition of the invention, viral vectors that are not capable of reproduction and that comprise the composition of the invention, injection of cells that produce viral vectors that comprise the composition of the invention, injection of DNA, electroporation, calcium phosphate mediated transfection, and the like, or any other suitable delivery system known or to be developed in the future.
- the present invention also provides for pharmaceutical compositions comprising an effective amount of the composition of the invention, and a pharmaceutically acceptable carrier.
- a pharmaceutically acceptable carrier means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
- Carrier in the phrase “Pharmaceutically acceptable carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered.
- the pharmaceutical compositions of the invention may be admi nistered local ly to the target area in need of treatment. This may be achieved by, for example, and not limited to: local infusion during surgery, topical application, e.g. in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
- the local administration may be also achieved by control release drug delivery systems, such as nanoparticles, matrices such as controlled-release polymers or hydrogels.
- the composition of the invention can be administered in amounts which are effective to produce the desired effect in the targeted cell.
- Effective dosages of the composition of the invention can be determined through procedures well known to these in the art which address such parameters as biological half-life, bioavailability and toxicity.
- the amount of the composition of the invention which is effective depend on the nature of the disease or disorder being treated, and may be determined by standard clinical techniques. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges.
- the administered means may also include, but are not limited to permanent or continuous injection of the composition of the invention to the patient blood stream.
- the present invention also provides for pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human or animal administration.
- EXAiVfPLE 1 use of the composition of the invention to kill the cancer cells of a specific patient
- the composition of the invention is designed to specifically kill the cancer cells of a specific patient.
- the first step in the designing of the composition of the invention for a specific patient is to identify the predetermined signal sequence, which is a sequence of 18-25 nucleotides long of an endogenous RNA molecule that is present in the cancer cells of this specific patient, such that the predetermined signal sequence is not present in any endogenous RNA molecule in the healthy or nonmetastatic tumourigenic cells of the body of the specific patient. Therefore, the predetermined signal sequence is an RNA sequence of a gene that is mutated in the cancer cells.
- each tumor comprises mutations in 90 protein-coding genes [16] and each tumor initiated from a single founder cell [38], therefore there is a need to identify only one of them that it is transcribed into RNA molecule in the cancer cells.
- Various methods can be used for the identification of this predetermined signal sequence; these methods include, but are not limited to DNA microarray, Tilling (Targeting Induced Local Lesions in Genomes) and large-scale sequencing of cancer genomes. Furthermore the identification of the predetermined signal sequence can utilize the Cancer Genome Atlas project that has been cataloguing all the genetic mutations responsible for cancer by their genes.
- the predetermined signal sequence that is unique to the cancer cells of the specific patient is: 5'-UAUUAUUAUCUUGGCCGCCCG-3' and is located in an endogenous mRNA. Therefore, in this example the composition of the invention is designed to kill cells that comprise mRNA that comprises the sequence 5'- UAUUAUUAUCUUGGCCGCCCG-3'.
- the functional RNA in this example is shRNA that is designed to effect the cleavage of the 5' end of the predetermined signal sequence.
- the functional RNA is transcribed under the control of the very strong U6 promoter of RNA polymerase III.
- the G at the 5' end and the UU at the 3 ' end of the shRNA are necessary for the transcription by U6 promoter of RNA polymerase III.
- FIG. 40 It has been reported that in the cell the functional half-life of each of the two portions of a cleaved mRNA is reduced from the intact mRNA only by 2.6-1.7 fold [10]. It has also been reported that two portions of an mRNA that has been cleaved by RISC-RNA complex in a cell can be easily detected by Northern analysis [6].
- the carrier RNA in this example is designed to be transcribed under the control of the very strong U6 promoter of RNA polymerase III and is designed to include the sequence: 3'- UUAUAAUAAUAGAACCGGCGGGCGGUG-5', the G at the 5' end and the UU at the 3' end of the carrier RNA are necessary for the transcription by U6 promoter of RNA polymerase III.
- the carrier RNA is hybridized to the cleaved mRNA portion that includes the predetermined signal sequence and after processing by Dicer, the duplex that is formed is thermodynamically weaker at the 5' end of the predetermined signal sequence, thus the predetermined signal sequence is be the strand that is loaded into Rise [3]. For example, see FIG. 40.
- RNA transcripts of about 23 nucleotides in length that have a complementary region of about 19 nucleotides in length at the 5' end are hybridized with each other and are capable of directing target specific RNA interference [7]. It lias also been reported that a dsRNA of 52 nucleotides long that further comprises 20 nucleotides long ssRNA at one of the 3' ends is a substrate for a Dicer at the blunt end [8]. Furthermore it has also been reported that in mammal Rise is coupled to Dicer [9].
- the specific sequence in the exogenous RNA of interest of this example is designed to comprise the sequence: 5 ' -CGGGCGGCCAAGAUAAUAAUA-3 ' that is 100% complementary to the predetermined signal sequence. For example, see FIG. 40.
- the exogenous RNA of interest is also designed to comprise a sequence encoding Diphtheria toxin fragment A (DT-A) downstream from the specific sequence.
- DT-A Diphtheria toxin fragment A
- the exogenous RNA of interest is designed to be transcribed under the control of the strong viral CMV promoter. For example, see FIG. 40.
- the exogenous RNA of interest is also designed to comprise an inhibitory sequence upstream from the specific sequence, the inhibitory sequence comprises 3 initiation codons that 2 of them are located within the human Kozak consensus sequence: 5'-ACCAUGG-3' and each one of them is not in the same reading frame with the start codon of DT-A. For example, see FIG. 40.
- the exogenous RNA of interest is also designed to comprise the very efficient cis-acting hammerhead ribozyme - Nl 17 [23] at the 5' end for reducing the efficiency of translation of the exogenous RNA of interest of the invention before it is cleaved.
- the cis-acting hammerhead ribozyme - Nl 1 7 also comprises 2 initiation codons however each one of them is not in the same reading frame with the start codon of DT-A. For example, see FIG. 40.
- the functional RNA, the carrier RNA and the exogenous RNA of interest are transcribed by a viral vector. For example, see FIG. 40.
- the viral vector transcribes: the functional RNA, the carrier RNA and the exogenous RNA of interest.
- the cis acting ribozyme N1 17 in the exogenous RNA of interest removes the CAP structure from the 5' end for reducing any translation by the exogenous RNA of interest and the out of reading frame initiation codons prevent translation of DT-A.
- the functional RNA (shRNA) effects the cleavage of the 5' end of the predetermined signal sequence.
- the carrier RNA is hybridized to the cleaved mRNA portion that comprises the predetermined signal sequence and the predetermined signal sequence is processed by Dicer and loaded into Rise.
- the Rise-signal sequence complex cleaves the exogenous RNA of interest at the specific sequence and the out of reading frame initiation codons are detached, so that DT- A is expressed at least one time, which enough to cause cell death. For example, see FIG. 40.
- EXAMPLE 2 use of the composition of the invention to kill EBV-associated gastric carcinomas cancer cells, nasopharyngeal carcinoma cancer cells, Burkitt's lymphoma cancer cells and Hodgkin's lymphoma cancer cells
- Epstein-Barr virus is a ubiquitous human gammaherpesvirus that establishes lifelong latent infections in B lymphocytes following the primary infection. EBV infects the majority of the population worldwide and has been implicated in the pathogenesis of several human malignancies including Burkitt's and Hodgkin's lymphomas, gastric carcinoma and nasopharyngeal carcinoma (NPC) [32]. EBV infection is mainly characterized by the expression of latent genes including EBNA1 , LMP 1, LMP2 and EBER [32]. LMP 1 (latent membrane protein 1) was the first EBV latent gene found to be able to transform cell lines and alter the phenotype of cells due to its oncogenic potential [32]. In human epithelial cells, LMP1 alters many functional properties that are involved in tumor progression and invasions [32].
- the composition of the invention is designed to kill cancer cells of Burkitt's lymphomas, Hodgkin's lymphomas, gastric carcinoma and nasopharyngeal carcinoma, which are latently infected with EBV, by using the LMP1 mRNA as the endogenous signal RNA and by using the sequence: 5'-CUCUGUCCACUUGGAGCCCUU-3' (nucleotides 269-289 of LMP 1 mRNA) as the predetermined signal sequence.
- This predetermined signal sequence is chosen because it is located in a region that does not have RNA secondary structure and because it is located in a region that has been shown to be a good target for siRNA [33]. Furthermore, this predetermined signal sequence is also chosen because its cleavage creates a relatively short RNA molecule of 289 nucleotides long.
- the carrier sequence and the functional RNA are located in the same RNA duplex that is hybridized in the cell, such that the double strand region is located at the 5' end of the carrier sequence and such that when the double strand region is processed by Dicer, the carrier sequence is detached from the RNA duplex and the siRNA duplex that is formed is the functional RNA and is capable of effecting the cleavage of the mRNA of LMP-1 at the 3 ' end of the predetermined signal sequence.
- the 2 strands of the RNA duplex are: 3'- UUCUCUGGAAGAGACAGGUGAACCUCGGGAACCUCGGGAAACAUAUGAGG-5' and 5'-GGAGCCCUUUGUAUACUCCUU-3'.
- the 2 strands of the RNA duplex are transcribed under the control of the very strong U6 promoter of RNA polymerase III, thus their 5' end is G and their 3 ' end is UU. For example, see FIG. 41.
- the carrier sequence directs the predetermined signal sequence to Dicer processing and the duplex that is formed is thermodynamically weaker at the 5' end of the predetermined signal sequence, thus the predetermined signal sequence will be the strand that will be loaded into Rise [3]. For example, see FIG. 41.
- the specific sequence in the exogenous RNA of interest of the example is designed to comprise the sequence: 3 '-GAGACAGGUGAACCUCGGGAA-5 ' that is 100% complementary to the predetermined signal sequence.
- the exogenous RNA of interest is also designed to comprise a sequence encoding Diphtheria toxin (DT) downstream from the specific sequence.
- the exogenous RNA of interest is designed to be transcribed under the control of the strong viral CMV promoter.
- the exogenous RNA of interest is also designed to comprise an inhibitory sequence upstream from the specific sequence.
- the inhibitory sequence comprises 2 initiation codons that are located within the human ozak consensus sequence: 5'-ACCAUGG- 3' and each one of them is not in the same reading frame with the start codon of DT.
- the exogenous RNA of interest is also designed to comprise the very efficient cis-acting hammerhead ribozyme - snorbozyme [22] at the 5' end for reducing the efficiency of translation of the exogenous RNA of interest of the invention before it is cleaved.
- the cis-acting hammerhead ribozyme - snorbozyme also comprises 2 initiation codons however each one of them is not in the same reading frame with the start codon of DT.
- the exogenous RNA of interest is also designed to comprise a nucleotide sequence of 23 nucleotides downstream from the specific sequence and upstream from the sequence encoding DT, such that the nucleotide sequence is capable of binding to a sequence of 23 nucleotides that is located downstream from the sequence encoding DT, such that the exogenous RNA of interest forms a circular structure that increases the efficiency of translation of DT particularly when the exogenous RNA of interest is cleaved.
- FIG.41 in this example, the two strands of the RNA duplex and the exogenous RNA of interest are transcribed by a viral vector (see FIG. 41 ).
- the cis acting ribozyme, snorbozyme, in the exogenous RNA of interest removes the CAP structure from the 5' end for reducing any translation by the exogenous RNA of interest and the out of reading frame initiation codons prevent translation of DT.
- the two strands of the RNA duplex are hybridized with each other and with the predetermined signal sequence at the LMP- 1 mPv A, the double strand region of the RNA duplex is cleaved by Dicer and forms the functional RNA that is siRNA and the carrier sequence.
- the siRNA cleaves the predetermined signal sequence at the 3' end and the carrier sequence directs the cleaved predetermined signal sequence to Dicer processing.
- the processed predetermined signal sequence is loaded into Rise and then the Rise-signal sequence complex cleaves the exogenous RNA of interest at the specific sequence and the out of reading frame initiation codons are detached, so that DT is capable of being expressed.
- the RNA portion that comprises the sequence encoding DT forms a circular structure that increases DT translation for killing the cancer cell and the neighboring cells. For example, see FIG. 41.
- the functional RNA and the carrier sequence are located in the same RNA duplex, thus the carrier sequence may bring the functional RNA into proximity with the predetermined signal sequence and by this may also bring the components of the RNA interference pathway (e.g. Dicer and Rise) into proximity with the predetermined signal sequence.
- EXAMPLE 3 use of the composition of the invention to kill HIV-1 infected cells
- HIV Human immunodeficiency virus
- AIDS acquired immunodeficiency syndrome
- HIV-1 and HIV-2 Two species of HIV infect humans: HIV-1 and HIV-2. HIV-1 is more virulent, relatively easily transmitted, and is the cause of the majority of HIV infections globally. HIV-2 is less transmittable than HIV- 1 and is largely confined to West Africa.
- the composition of the invention is designed to kill HIV- 1 infected cells by using the HIV-1 mRNA as the endogenous signal RNA and by using the sequence: 5'- UACCAAUGCUGCUUGUGCCUG-3' (nucleotides 8492-8512 of HIV- 1 mRNA) as the predetermined signal sequence.
- This predetermined signal sequence is chosen because it is located in a region that does not include an RNA secondary structure and because it is located in a region that has been shown to be a good target for siRNA [34].
- the exogenous RNA of interest of this example is transcribed under the control of the strong viral CMV promoter and is designed to comprise 2 specific sequences, such that each one of them is: 3 '-AUGGUUACGACGAACACGGAC-5' that is 100% complementary to the predetermined signal sequence.
- the exogenous RNA of interest is also designed to comprise a sequence encoding Diphtheria toxin fragment A (DT-A) between the 2 specific sequences. In mammal cells single molecule of Diphtheria toxin fragment A introduced into a cell can kill the cell [14].
- the exogenous RNA of interest is also designed to comprise two inhibitory sequences one at the 5' end and other at the 3' end.
- the inhibitory sequence that is located at the 5' end of the exogenous RNA of interest is designed to include 3 initiation codons. such that one of them is located within the human Kozak consensus sequence: 5'-ACCAUGG-3', such that each one of them is not in the same reading frame with the start codon of DT-A and such that all the 3 initiation codons are in the same reading frame.
- the inhibitory sequence that is located at the 5' end of the exogenous RNA of interest also comprises a nucleotide sequence downstream from the 3 initiation codons and upstream from the 2 specific sequences, such that the nucleotide sequence is in the same reading frame with the 3 initiation codons and such that the nucleotide sequence encodes for a sorting signal for the subcellular localization that is the Peroxisomal targeting signal 2 of the human alkyl dihydroxyacetonephosphate synthase (H2N— -RLRVLSGHL) [30].
- H2N— -RLRVLSGHL human alkyl dihydroxyacetonephosphate synthase
- the inhibitory sequence that is located at the 3' end of the exogenous RNA of interest is designed to include an intron downstream from the 2 specific sequences, such that the exogenous RNA of interest is a target for nonsense-mediated decay (NMD) that degrades RNA molecule that comprises an intron downstream from the coding sequence [31 ].
- the intron comprises 2 artificial microRNAs that are designed to effect the cleavage of the predetermined signal sequence at the 5 ' end and at the 3 ' end [35].
- the inhibitory sequence that is located at the 3' end of the exogenous RNA of interest also comprises an AU-rich element (ARE) at the 3' end that stimulates degradation of the exogenous RNA of interest.
- the AU-rich elements is 47 nucleotides long and it comprises the sequences: 5'-AUUUA-3' and 5'-UUAUUUA(U/A)(U/A)- 3' [28]. For example, see FIG. 42.
- the carrier RNA in this example is designed to be transcribed under the control of the very strong U6 promoter of RNA polymerase III and is designed to include the sequence: 3 '- UUAUGGUUACGACGAACACGG-5 ', the G at the 5' end and the UU at the 3 ' end of the carrier RNA are necessary for the transcription by U6 promoter of RNA polymerase III.
- the carrier RNA of the invention may be hybridized to the cleaved predetermined signal sequence and the duplex that is formed is thermodynamically weaker at the 5' end of the predetermined signal sequence, thus the predetermined signal sequence is the strand that is loaded into Rise [3]. For example, see FIG. 42.
- the carrier RNA and the exogenous RNA of interest are transcribed by a viral vector.
- the viral vector transcribe: the carrier RNA and the exogenous RNA of interest.
- the out of reading frame initiation codons prevent translation of DT-A
- the Peroxisomal targeting signal 2 sends the erroneous protein and the exogenous RNA of interest to the peroxisome.
- the intron targets the exogenous RNA of interest to degradation by the nonsense-mediated decay (NMD) and the AU-rich element also stimulates degradation of the exogenous RNA of interest.
- the two artificial microRNAs cleave the predetermined signal sequence at the 5' end and at the 3 ' end and the carrier RNA is hybridized to the cleaved predetermined signal sequence, and the signal sequence may be loaded into Rise. Then the Rise-signal sequence complex may cleave the exogenous RNA of interest at the two specific sequences and all the inhibitory sequences are detached, so that DT-A is expressed at least one time, which enough to cause cell death. For example, see FIG .42.
- the predetermined signal sequence is cleaved from both of its ends and thus with the carrier RNA it is a better substrate for Dicer or Rise.
- the viral vector may also encode transcriptional factors that are capable of enhancing the transcription of HIV- 1 mRNA in HIV-1 infected cell (e.g. NF- ⁇ ).
- the viral vector may also encode genes that are capable of preventing new HIV- 1 particles production (e.g. Rev, which prevents HIV- 1 mRNA splicing).
- EXAMPLE 4 use of the composition of the invention to kill hsv- 1 infected cells
- Many viruses including HSV- 1 (herpes simplex virus- 1 ) exhibit a dormant or latent phase, during which no protein synthesis is conducted. The viral infection is essentially invisible to the immune system during such phases. Current antiviral treatment regimens are largely ineffective at eliminating cellular reservoirs of latent viruses [ 15].
- the latency- associated transcript (LA T) of herpes simplex virus- 1 (HSV- 1 ) is the only viral gene that is expressed during latent infection in neurons. LAT inhibits apoptosis and maintains latency by promoting the survival of infected neurons. No protein product has been attributed to the LA T gene.
- the composition of the invention is designed to kill HSV- 1 infected cel ls by using the latency-associated transcript (LA T) as the endogenous signal RNA and by using the sequence: 5'-AAGCGCCGGCCGGCCGCUGGU-3' (nucleotides 108- 128 of the latency-associated transcript - LAT of HSV- 1 ) as the predetermined signal sequence.
- This predetermined signal sequence is chosen because its cleavage creates a relatively short RNA molecule of 128 nucleotides long. For example, see FIG. 43.
- the carrier sequence and the functional RNA are located in the same stem loop structure that is transcribed by the RNA polymerase III U6 promoter.
- the carrier sequence is detached from the stem loop structure and the siRNA duplex that is formed is the functional RNA, which is capable of effecting the cleavage of LAT at the 3 ' end of the predetermined signal sequence.
- the G at the 5 ' end and the UU at the 3 ' end of the stem loop structure are necessary for the transcription by U6 promoter of RNA polymerase III.
- the carrier sequence is hybridized to the cleaved LAT portion that comprises the predetermined signal sequence and after processing by Dicer, the duplex that is formed is thermodynamically weaker at the 5' end of the predetermined signal sequence, thus the predetermined signal sequence will be the strand that will be loaded into Rise [3]. For example, see FIG. 43.
- the exogenous RNA of interest of this example is transcribed under the control of the strong viral CMV promoter and is designed to comprise 2 specific sequences, such that each one of them is: 5 '-ACCAGCGGCCGGCCGGCGCUU-3 ' that is 100% complementary to the predetermined signal sequence.
- the exogenous RNA of interest is also designed to comprise a sequence encoding Diphtheria toxin (DT) between the 2 specific sequences.
- DT Diphtheria toxin
- the exogenous RNA of interest is also designed to comprise 2 inhibitory sequences one at the 5' end and other a( the 3' end of the exogenous RNA of interest.
- the inhibitory sequence that is located at the 5' end of the exogenous RNA of interest is designed to include 3 initiation codons, such that 2 of them are located within the human Kozak consensus sequence: 5'-ACCAUGG-3', such that each one of them is not in the same reading frame with the start codon of DT.
- the inhibitory sequence that is located at the 3' end of the exogenous RNA of interest is designed to comprise the translational repressor smaug recognition elements (SRE): 5'- UGGAGCAGAGGCUCUGGCAGCUUUUGCAGCG-3' downstream from the 2 specific sequences. For example, see FIG. 43.
- Smaug 1 is encoded in human chromosome 14 and is capable of repressing translation of SRE-containing messengers [26, 27].
- Murine Smaug 1 is expressed in the brain and is abundant in synaptoneurosomes, a subcellular region where translation is tightly regulated by synaptic stimulation [26].
- the inhibitory sequence that is located at the 3' end of the exogenous RNA of interest also comprises an RNA localization signal for myelinating periphery (A2RE - Nuclear Ribonucleoprotein A2 Response Element): 5'-GCCAAGGAGCCAGAGAGCAUG-3' at the 3' end [29]. For example, see FIG. 43.
- A2RE is a c «'-acting sequence that is located at the 3 '-untranslated region of MBP (Myelin basic protein) mRNA and is sufficient and necessary for MBP mRNA transport to the myelinating periphery of oligodendrocytes [29].
- MBP Myelin basic protein
- the hnRNP (Heterogeneous Nuclear Ribonucleoprotein) A2 binds the A2RE and mediates transport of MBP [29].
- the exogenous RNA of interest of this example also comprises a cytoplasmic polyadenylation element (CPE) immediately downstream from the sequence encoding DT.
- CPE cytoplasmic polyadenylation element
- the CPE comprises the sequence 5 '-UUUUUAUU-3 ' immediately downstream from the sequence encoding DT and the sequence 5 '-UUUUAUU-3 ' 91 nucleotides downstream from the sequence encoding DT [25].
- CPEB cytoplasmic polyadenylation element binding protein
- CPEB cytoplasmic polyadenylation element binding protein
- CPEB appears to stimulate the translation of a-CaMKII mRNA, which comprises CPE, by polyadenylation-induced translation [36] .
- the exogenous RNA of interest and the stem loop structure are transcribed by a viral vector.
- the out of reading frame initiation codons prevent translation of DT
- the Smaugl translational repressor
- the hnRNP A2 binds the A2RE and mediates the transport of the RNA molecule to the myelinating periphery.
- the stem loop structure is processed by Dicer such that the carrier sequence is detached from the stem loop structure and the siRNA duplex that is formed is the functional RNA, and then the functional RNA effects the cleavage of LAT at the 3 ' end of the predetermined signal sequence. Then the carrier sequence is hybridized to the LAT portion that comprises the predetermined signal sequence and the predetermined signal sequence is processed by Dicer and loaded into Rise.
- the Rise-signal sequence complex cleaves the exogenous RNA of interest at the 2 specific sequences and all the inhibitory sequences are detached, so that the CPEB (cytoplasmic polyadenylation element binding protein) binds to the CPE and stimulates the extension of the poly-A tail in the cleaved exogenous RNA of interest, such that DT is capable of being expressed and kills the cell and the neighboring cells.
- CPEB cytoplasmic polyadenylation element binding protein
- the functional RNA and the carrier sequence are located in the same RNA molecule, which requires less transcriptional units.
- the major advantage of this proximity of the functional RNA and the carrier sequence is that they are created in the same place in the cel l and in the same time and also at a constant ratio.
- EXA MPLE 5 use of the composition of the invention to kill cancer cells of a specific patient
- composition of the invention is designed to kill the cancer cells of a specific patient.
- the first step in the designing of the composition of the invention for a specific patient is to identify the predetermined signal sequence, which is a sequence of 1 8-25 nucleotides long of an RNA molecule that present in the cancer cells of this speci fic patient, such that the predetermined signal sequence is not present in any RNA molecule in the healthy or nonmetastatic tumourigenic cells of the body of this specific patient. Therefore, the predetermined signal sequence is an RNA sequence of a gene that is mutated in the cancer cells.
- each tumor comprises mutations in 90 protein-coding genes [16] and each tumor initiated from a single founder cell [38], therefore there is a need to identify only one of them that it is transcribed into an RNA molecule in the cancer cells.
- the identification of this predetermined signal sequence can utilize the Cancer Genome Atlas project that has been cataloguing all the genetic mutations responsible for cancer by their genes.
- the predetermined signal sequence that is unique to the cancer cells of the specific patient is: 5'-AAUUAAGUUUAUGAACGGGUC-3 ' and is located in an endogenous mRNA. Therefore, in this example the composition of the invention is designed to kill cells that comprise endogenous mRNA (as the endogenous signal RNA) that comprises the sequence 5'-AAUUAAGUUUAUGAACGGGUC-3'.
- the functional RNA in this example is Rz-B, a hammerhead-type ribozyme [21] that is designed to effect the cleavage of the 3' end of the predetermined signal sequence.
- the hammerhead-type ribozyme Rz-B is transcribed under the control of the very strong U6 promoter of RNA polymerase III.
- the G at the 5' end and the UU at the 3 ' end of the hammerhead-type ribozyme Rz-B are necessary for the transcription by U6 promoter of RNA polymerase HI. For example, see FIG. 44.
- the carrier sequence of this example is: 5'-
- CCCGUUCAUAAACUUAAUUAACCGGUC-3' and 103 contiguous carrier sequences are located in an RNA sequence that is transcribed under the control of the strong viral CMV promoter.
- Rz-A a hammerhead-type ribozyme [21]
- the hammerhead-type ribozyme Rz-A is transcribed under the control of the very strong U6 promoter of RNA polymerase III.
- the G at the 5' end and the UU at the 3' end of the hammerhead-type ribozyme Rz-A are necessary for the transcription by U6 promoter of RNA polymerase III. For example, see FIG. 44.
- the hammerhead-type ribozyme Rz-A detaches up to 101 perfect carrier sequences from 1 RNA sequence.
- the detached carrier sequence is hybridized to the cleaved mRNA portion that comprises the predetermined signal sequence and after Dicer processing the duplex that is formed is thermodynamically weaker at the 5' end of the predetermined signal sequence, thus the predetermined signal sequence will be the strand that will be loaded into Rise [3].
- the specific sequence in the exogenous RNA of interest of the example is designed to comprise the sequence: 3'-UUAAUUCAAAUACUUGCCCAG-5' that is 100% complementary to the predetermined signal sequence.
- the exogenous RNA of interest is also designed to comprise a sequence encoding Diphtheria toxin (DT) downstream from the specific sequence.
- the exogenous RNA of interest is designed to be transcribed under the control of the strong viral CMV promoter.
- the exogenous RNA of interest is also designed to comprise an inhibitory sequence upstream from the specific sequence.
- the inhibitory sequence comprises 3 initiation codons that 2 of them are located within the human Kozak consensus sequence: 5'-ACCAUGG-3' and each one of them is not in the same reading frame with the start codon of DT.
- the exogenous RNA of interest of the invention also comprises the palindromic termination element (PTE) from the human HIST1 H2AC (H2ac) gene 3'UTR (5'- GGCUCUUUUCAGAGCC-3') downstream from the sequence encoding DT.
- PTE palindromic termination element
- H2ac human HIST1 H2AC
- the PTE plays an important role in mRNA processing and stability [1 1 ].
- Transcripts from HIST1H2AC gene lack poly(A) tails and are still stable, due to the PTE.
- the exogenous RNA of interest the hammerhead-type ribozyme Rz-B / Rz-A and the RNA sequence that comprising 103 carrier sequences are transcribed by a viral vector.
- the viral vector transcribes: the exogenous RNA of interest, the hammerhead-type ribozyme Rz-B / Rz-A and the RNA sequence that comprising 103 carrier sequences.
- the out of reading frame initiation codons prevent translation of DT.
- the hammerhead-type ribozyme Rz-B cleaves the 3 ' end of the predetermined signal sequence.
- the hammerhead-type ribozyme Rz-A detaches up to 101 perfect carrier sequences from 1 RNA sequence.
- the detached carrier sequence is hybridized to the cleaved mRNA portion that comprises the predetermined signal sequence and the predetermined signal sequence is processed by Dicer and loaded into Rise.
- the Rise-signal sequence complex cleaves the exogenous RNA of interest at the specific sequence and the out of reading frame initiation codons are detached and the palindromic termination element stabilizes the cleaved exogenous RNA of interest and protects it from degradation, so that the DT is capable of being expressed and kills the cell and the neighboring cells population.
- the palindromic termination element stabilizes the cleaved exogenous RNA of interest and protects it from degradation, so that the DT is capable of being expressed and kills the cell and the neighboring cells population.
- RNA interference is mediated by 21 - and 22-nucleotide RNAs. Genes & Dev 15, 2: 188-200. 9. Richard I. Gregory, Thimmaiah P. Chendrimada, Neil Cooch, Ramin Shiekhattar, 2005, Human RISC Couples MicroRNA Biogenesis and Posttranscriptional Gene Silencing. Cell 123 : 63 1-640.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Virology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/IL2010/000895 WO2012056441A1 (en) | 2010-10-28 | 2010-10-28 | Compositions and methods for specific cleavage of exogenous rna in a cell |
| US13/881,356 US20130225660A1 (en) | 2010-10-28 | 2011-10-27 | Compositions and methods for specific cleavage of exogenous rna in a cell |
| AU2011322106A AU2011322106A1 (en) | 2010-10-28 | 2011-10-27 | Compositions and methods for specific cleavage of exogenous RNA in a cell |
| PCT/IL2011/000827 WO2012056449A2 (en) | 2010-10-28 | 2011-10-27 | Compositions and methods for specific cleavage of exogenous rna in a cell |
| EP11835735.9A EP2632931A4 (en) | 2010-10-28 | 2011-10-27 | COMPOSITIONS AND METHODS FOR SPECIFIC CLEAVAGE OF EXOGENIC RNA IN A CELL |
| CN2011800633117A CN103282372A (zh) | 2010-10-28 | 2011-10-27 | 用于特异性裂解细胞中的外源rna的组合物和方法 |
| CA2815632A CA2815632A1 (en) | 2010-10-28 | 2011-10-27 | Compositions and methods for specific cleavage of exogenous rna in a cell |
| JP2013535585A JP2013544510A (ja) | 2010-10-28 | 2011-10-27 | 細胞において外来性rnaを特異的に切断するための組成物および方法 |
| IL226038A IL226038A0 (en) | 2010-10-28 | 2013-04-28 | Compositions and methods for specific cleavage of exogenous rna in a cell |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/IL2010/000895 WO2012056441A1 (en) | 2010-10-28 | 2010-10-28 | Compositions and methods for specific cleavage of exogenous rna in a cell |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2012056441A1 true WO2012056441A1 (en) | 2012-05-03 |
Family
ID=45993240
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IL2010/000895 Ceased WO2012056441A1 (en) | 2010-10-28 | 2010-10-28 | Compositions and methods for specific cleavage of exogenous rna in a cell |
| PCT/IL2011/000827 Ceased WO2012056449A2 (en) | 2010-10-28 | 2011-10-27 | Compositions and methods for specific cleavage of exogenous rna in a cell |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IL2011/000827 Ceased WO2012056449A2 (en) | 2010-10-28 | 2011-10-27 | Compositions and methods for specific cleavage of exogenous rna in a cell |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20130225660A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP2632931A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2013544510A (cg-RX-API-DMAC7.html) |
| CN (1) | CN103282372A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2011322106A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2815632A1 (cg-RX-API-DMAC7.html) |
| WO (2) | WO2012056441A1 (cg-RX-API-DMAC7.html) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2911034T3 (es) | 2006-08-08 | 2022-05-17 | Univ Bonn Rheinische Friedrich Wilhelms | Estructura y uso de oligonucleótidos 5' fosfato |
| WO2009141146A1 (en) | 2008-05-21 | 2009-11-26 | Gunther Hartmann | 5' triphosphate oligonucleotide with blunt end and uses thereof |
| EP2508530A1 (en) | 2011-03-28 | 2012-10-10 | Rheinische Friedrich-Wilhelms-Universität Bonn | Purification of triphosphorylated oligonucleotides using capture tags |
| EP2712870A1 (en) | 2012-09-27 | 2014-04-02 | Rheinische Friedrich-Wilhelms-Universität Bonn | Novel RIG-I ligands and methods for producing them |
| EP3436590A4 (en) * | 2016-04-01 | 2019-12-04 | National University of Singapore | TRANSSPLEISSEN OF RNA (TSRNA) |
| DE102017103383A1 (de) * | 2017-02-20 | 2018-08-23 | aReNA-Bio GbR (vertretungsberechtigter Gesellschafter: Dr. Heribert Bohlen, 50733 Köln) | System und Verfahren zur Zelltyp-spezifischen Translation von RNA-Molekülen in Eukaryoten |
| WO2022182697A1 (en) * | 2021-02-23 | 2022-09-01 | Board Of Regents, The University Of Texas System | A novel rna-based approach to cancer treatment |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5869248A (en) * | 1994-03-07 | 1999-02-09 | Yale University | Targeted cleavage of RNA using ribonuclease P targeting and cleavage sequences |
| US6013487A (en) * | 1995-12-15 | 2000-01-11 | Mitchell; Lloyd G. | Chimeric RNA molecules generated by trans-splicing |
| WO2006083331A2 (en) * | 2004-10-08 | 2006-08-10 | Intronn, Inc | Use of rna trans-splicing for antibody gene transfer and antibody polypeptide production |
| US7094399B2 (en) * | 2002-05-08 | 2006-08-22 | Intronn, Inc. | Use of spliceosome mediated RNA trans-splicing to confer cell selective replication to adenoviruses |
| EP1147188B1 (en) * | 1999-01-26 | 2007-05-16 | Vlaams Interuniversitair Instituut voor Biotechnologie vzw. | Internal ribosome entry site (ires), vector containing same and the uses thereof |
| US7267979B2 (en) * | 2002-07-01 | 2007-09-11 | Pioneer Hi-Bred International, Inc. | Method of controlling gene silencing using site specific recombination |
| US20090217397A1 (en) * | 2006-06-12 | 2009-08-27 | Patrick Stern | Cre-lox based gene knockdown constructs and methods of use thereof |
| US20090234109A1 (en) * | 2007-12-10 | 2009-09-17 | Si-Ping Han | Signal activated RNA interference |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20030219407A1 (en) * | 2002-05-15 | 2003-11-27 | The Regents Of The University Of California | RNA silencing in animals as an antiviral defense |
| EP2000160A3 (en) * | 2002-10-30 | 2009-03-11 | Gambro Lundia AB | Method and apparatuses for determining the efficiency of dialysis |
| AU2003295600A1 (en) * | 2002-11-14 | 2004-06-15 | Dharmacon, Inc. | Functional and hyperfunctional sirna |
| WO2005112620A2 (en) * | 2004-05-18 | 2005-12-01 | Massachusetts Institute Of Technology | A cre-lox based method for conditional rna interference |
| EP1799825B1 (en) * | 2004-10-05 | 2011-06-29 | The California Institute of Technology | Aptamer regulated nucleic acids and uses thereof |
| JP2008537551A (ja) * | 2005-03-31 | 2008-09-18 | カランド ファーマシューティカルズ, インコーポレイテッド | リボヌクレオチドレダクターゼサブユニット2の阻害剤およびその使用 |
| CN101184840A (zh) * | 2005-03-31 | 2008-05-21 | 卡兰朵医药公司 | 核糖核苷酸还原酶亚基2的抑制剂及其用途 |
| US8158595B2 (en) * | 2006-11-09 | 2012-04-17 | California Institute Of Technology | Modular aptamer-regulated ribozymes |
| WO2008106658A2 (en) * | 2007-03-01 | 2008-09-04 | California Institute Of Technology | TRIGGERED RNAi |
| US8367815B2 (en) * | 2007-08-28 | 2013-02-05 | California Institute Of Technology | Modular polynucleotides for ligand-controlled regulatory systems |
-
2010
- 2010-10-28 WO PCT/IL2010/000895 patent/WO2012056441A1/en not_active Ceased
-
2011
- 2011-10-27 JP JP2013535585A patent/JP2013544510A/ja active Pending
- 2011-10-27 CN CN2011800633117A patent/CN103282372A/zh active Pending
- 2011-10-27 CA CA2815632A patent/CA2815632A1/en not_active Abandoned
- 2011-10-27 EP EP11835735.9A patent/EP2632931A4/en not_active Withdrawn
- 2011-10-27 WO PCT/IL2011/000827 patent/WO2012056449A2/en not_active Ceased
- 2011-10-27 US US13/881,356 patent/US20130225660A1/en not_active Abandoned
- 2011-10-27 AU AU2011322106A patent/AU2011322106A1/en not_active Abandoned
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5869248A (en) * | 1994-03-07 | 1999-02-09 | Yale University | Targeted cleavage of RNA using ribonuclease P targeting and cleavage sequences |
| US6013487A (en) * | 1995-12-15 | 2000-01-11 | Mitchell; Lloyd G. | Chimeric RNA molecules generated by trans-splicing |
| EP1147188B1 (en) * | 1999-01-26 | 2007-05-16 | Vlaams Interuniversitair Instituut voor Biotechnologie vzw. | Internal ribosome entry site (ires), vector containing same and the uses thereof |
| US7094399B2 (en) * | 2002-05-08 | 2006-08-22 | Intronn, Inc. | Use of spliceosome mediated RNA trans-splicing to confer cell selective replication to adenoviruses |
| US7267979B2 (en) * | 2002-07-01 | 2007-09-11 | Pioneer Hi-Bred International, Inc. | Method of controlling gene silencing using site specific recombination |
| WO2006083331A2 (en) * | 2004-10-08 | 2006-08-10 | Intronn, Inc | Use of rna trans-splicing for antibody gene transfer and antibody polypeptide production |
| US20090217397A1 (en) * | 2006-06-12 | 2009-08-27 | Patrick Stern | Cre-lox based gene knockdown constructs and methods of use thereof |
| US20090234109A1 (en) * | 2007-12-10 | 2009-09-17 | Si-Ping Han | Signal activated RNA interference |
Non-Patent Citations (4)
| Title |
|---|
| ABITBOL: "Mechanism for expressing gene in-vivo only if specific mRNA sequence exists", MS THESIS ABSTRACT 2006, pages 34, Retrieved from the Internet <URL:http://fohs.bgu.ac.il/bgu-med/pub/FOHS-gradProjectsBooklet.pdf> [retrieved on 20110723] * |
| HARIGAYA ET AL.: "No-go decay: a quality control mechanism for RNA in translation", WILEY INTERDISCIPLINARY REVIEWS - RNA, vol. 1, no. 1, 6 May 2010 (2010-05-06), pages 132 - 141 * |
| LEE ET AL.: "Conditional RNAi: towards a silent gene therapy", ADV DRUG DELIV REV., vol. 61, no. 7-8, 2009, pages 650 - 664 * |
| REBBAPRAGADA ET AL.: "Execution of nonsense-mediated mRNA decay: what defines a substrate?", CURR OPIN CELL BIOL, vol. 21, 2009, pages 394 - 402 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2815632A1 (en) | 2012-05-03 |
| EP2632931A2 (en) | 2013-09-04 |
| CN103282372A (zh) | 2013-09-04 |
| US20130225660A1 (en) | 2013-08-29 |
| AU2011322106A1 (en) | 2013-05-30 |
| JP2013544510A (ja) | 2013-12-19 |
| WO2012056449A2 (en) | 2012-05-03 |
| WO2012056449A3 (en) | 2012-07-19 |
| EP2632931A4 (en) | 2014-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20130245096A1 (en) | COMPOSITIONS AND METHODS FOR ACTIVATING EXPRESSION BY A SPECIFIC ENDOGENOUS miRNA | |
| ES2969371T3 (es) | Interferencia por ARN para el tratamiento de trastornos de ganancia de función | |
| CA2524569C (en) | A method of regulating gene expression | |
| CN101307085B (zh) | 抑制铁调素调节蛋白的siRNA、重组慢病毒及其应用 | |
| US20130225660A1 (en) | Compositions and methods for specific cleavage of exogenous rna in a cell | |
| US20060228800A1 (en) | Novel Transgenic Methods Using intronic RNA | |
| KR20190129903A (ko) | 압타머-조정된 RNase P 절단에 의한 유전자 발현의 조절 | |
| Zhang et al. | miR-146a promotes Borna disease virus 1 replication through IRAK1/TRAF6/NF-κB signaling pathway | |
| CN115209924A (zh) | Rna腺相关病毒(raav)载体及其用途 | |
| CN116783295A (zh) | 指导rna的新型设计及其用途 | |
| US7776569B2 (en) | Virally-encoded RNAs as substrates, inhibitors and delivery vehicles for RNAi | |
| CN121464217A (zh) | 用于治疗KIF1A相关神经紊乱的靶向KIF1A错义突变的RNAi | |
| WO2023147558A2 (en) | Crispr methods for correcting bag3 gene mutations in vivo | |
| Li et al. | An artificial small RNA editor by chimeric dsRNase with RNA binding protein | |
| US12365900B2 (en) | miRNA switches for RNA-triggered control of RNA interference | |
| US20240117350A1 (en) | Use of mirna-485 inhibitor to regulate psd95, synaptophysin, and caspase-3 expression | |
| JP2026509506A (ja) | リボザイム媒介rnaアセンブリおよび発現 | |
| Meganck | Engineering Elements for Improved RNA Stability | |
| CN119604617A (zh) | 无帽无尾治疗性外源性mRNA及其生产方法 | |
| Woldrich et al. | Site-directed A-to-I editing to manipulate protein expression | |
| Bahramian et al. | GENE impedance: a natural process for control of gene expression and the origin of RNA interference | |
| WO2024201420A1 (en) | Mirna-484 inhibitors and uses thereof | |
| HK40082840A (en) | Rna adeno-associated virus (raav) vector and uses thereof | |
| EP4118435A1 (en) | Diagnostic methods using pgc-1? expression | |
| Elmén | Nucleic acid based therapeutic approaches |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10858881 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 10858881 Country of ref document: EP Kind code of ref document: A1 |