WO2012052954A1 - Signatures of clinical outcome in gastro intestinal stromal tumors and method of treatment of gastroinstestinal stromal tumors - Google Patents
Signatures of clinical outcome in gastro intestinal stromal tumors and method of treatment of gastroinstestinal stromal tumors Download PDFInfo
- Publication number
- WO2012052954A1 WO2012052954A1 PCT/IB2011/054688 IB2011054688W WO2012052954A1 WO 2012052954 A1 WO2012052954 A1 WO 2012052954A1 IB 2011054688 W IB2011054688 W IB 2011054688W WO 2012052954 A1 WO2012052954 A1 WO 2012052954A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mrna
- homo sapiens
- aurka
- expression
- gist
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
Definitions
- the present invention refers to a method for in vitro predicting survival and/or metastatic outcome of gastrointestinal stromal tumors (GISTs), a kit for (i) the in vitro prediction of the survival outcome of a patient suffering from GIST, (ii) and/or the development of metastases in a patient treated for or suffering from GIST, (ii) and/or the prediction of the efficacy of a treatment for GIST.
- GISTs gastrointestinal stromal tumors
- the present invention also refers to a method for screening for compounds for the use in the treatment of GISTs, and to a compound for its use in the treatment of GISTs.
- the present invention has utility in the medical and pharmaceutical fields, especially in the field of diagnosis.
- Gastrointestinal stromal tumors are the most frequent mesenchymal tumors of the gastrointestinal tract and account for approximately 25% of soft tissue sarcomas. GISTs are thought to arise from the intestinal cells of Cajal (1), or from a common progenitor cell (2).
- the KIT tyrosine kinase or the platelet-derived factor receptor a (PDGFRA) activating mutations are early oncogenic events in GISTs. Most GISTs (80%) are characterized by activating mutations of the KIT tyrosine kinase receptor, while a subset (8%) harbours platelet-derived factor receptor a ⁇ PDGFRA mutations (3,4). In addition to these mutations, other genetic changes do occur, the most frequent alterations reported being 14q, 22q and lp deletions (5). Overall, GIST cytogenetics is quite simple and imbalances mainly involve full chromosomes or chromosome arms. Notably, GIST molecular and cytogenetic profiles correlate with disease progression. Nevertheless, it has been observed that changes are more frequent and more complex in advanced tumors (6). Furthermore, the genetic basis of the metastatic outcome of GISTs is still poorly understood.
- Clinical management of GISTs consists mainly of surgical resection with adjuvant or neo-adjuvant targeted therapy with Imatinib Mesylate (Gleevec, formerly STI571, Novartis Pharma AG) which has been demonstrated to target the KIT- or PDGFRA- aberrant signaling induced by activating mutations (7).
- Imatinib Mesylate formerly STI571, Novartis Pharma AG
- the majority of cases can be cured by surgical resection alone, but 20-40% of patients relapse with distant liver metastasis being the most common manifestation of the recurrent disease.
- genomic and expression profiling has already been used but only partial and heterogeneous results have been reported.
- the genomic level it has been shown that the genome complexity level increases with tumor stage (6, 10), but no threshold has ever been defined and no specific alteration has been proposed except for pl6 INK4A alterations whose role in metastasis development is still controversial (11-16).
- Yamaguchi and colleagues have proposed a gene-expression signature : they identified CD26 as a prognostic marker but only in GISTs of gastric origin. Nevertheless, the authors concluded that CD26 might not be the cause of malignant progression of gastric GISTs.
- this signature is limited as it has been established on only a few cases (32 GISTs), it predicts outcome only in gastric GISTs (but not in GIST of the small intestine) and it has not been compared to histopathological grading methods considered as "gold standard" (17).
- the AURKA encoded for a gene that maps to chromosome 20ql3, is a mitotic centrosomal protein kinase (20). It is a well known oncogene, which main role in tumor development is the control of chromosome segregation during mitosis (21). Gene amplification and AURKA overexpression have been widely described in many cancer types (22). In particular, as it has been clearly demonstrated that AURKA overexpression induces centrosome duplication-distribution abnormalities and aneuploidy leading to transformation in breast cancer cells (23). Actually, centrosomes maintain genomic stability through the establishment of the bipolar spindle body during cell division, ensuring equal segregation of replicated chromosomes to two daughter cells.
- the AURKA expression has also been associated with poor prognosis mainly in breast carcinoma (24), colon carcinoma (25, 26), neuroblastoma (27) and head and neck squamous cell carcinoma (28). Taken together, these data indicate that up-regulation of AURKA expression could be a major driving event in establishing genome complexity leading to wild gene expression reprogramming, creating optimal conditions for development of metastasis.
- AURKA inhibitors are currently under clinical studies (29- In view of all these elements, it clearly still exists a need of new tools allowing to predict outcome of GISTs, notably palliating the failures, drawbacks and obstacles of the state of the art.
- the Applicant found surprisingly a one gene- expression signature prognostic for clinical outcome of primary GISTs.
- CINSARC signature CINSARC for Complexity INdex in SARComa, a 67 genes-expression prognostic signature related to genome complexity in sarcomas, PCT/FR2010/000323,
- the Applicant manages to show that a positive correlation exists between GI (Genomic Index) and A URKA expression.
- the Applicant surprisingly manages to construct a decisional algorithm based on GI and A URKA expression.
- application of the signature permits more selective imatinib therapy leading to decreased iatrogenic morbidity and improved outcomes for individual patients.
- the invention provides for a method for in vitro predicting survival and/or metastatic outcome of gastrointestinal stromal tumors (GISTs), the method comprising the measure of the level, in a patient-derived biological sample of GIST, of a pool of polypeptides or polynucleotides consisting in Aurora kinase A (AURKA).
- GISTs gastrointestinal stromal tumors
- Predicting survival and/or metastatic outcome refers herein to predicting whether a patient has a chance to survive, or a risk to develop metastases following the outcome of a GIST.
- the survival or development of metastases may be calculated from the date of initial diagnosis to the date of first metastases, relapse, last follow-up or death for patients with diagnosis of metastasis.
- GIST may be classified in a group with high risk to develop metastases within 5 years of an outcome of GIST, or in a group with no risk to develop metastases within 5 years, or in an intermediate group.
- the group of patient with high risk to develop metastases within 5 years is characterized by a risk to develop metastases within 5 years of more than 80%, when AURKA is up-regulated, compared to a group with no risk to develop metastases within 5 years when AURKA is down-regulated.
- Patient-derived biological sample of GIST refers herein to any biological sample containing GIST cells and obtained from a patient treated for or suffering from GIST.
- GIST may be primary untreated tumors.
- Polypeptide refers herein to the AURKA protein (Genbank accession number
- the polypeptide may be a polypeptide having at least 70% of sequence identity with the peptidic sequence of AURKA. protein, or a polypeptide having at least 80% of sequence identity with the peptidic sequence of AURKA protein, or a polypeptide having at least 90% of sequence identity with the peptidic sequence of AURKA protein.
- Polynucleotide refers herein to any polynucleotide coding for the polypeptide as defined above, or to any polynucleotide hybridizing under stringent conditions to a polypeptide coding for the polypeptide as defined above.
- the polynucleotide of the invention may be any of DNA and RNA, for example the sequence SEQ ID NO: 2.
- the DNA may be in any form of genomic DNA, a genomic DNA library, cDNA or a synthetic DNA.
- the polynucleotide of the present invention may be any of those amplified directly by an RT-PCR method using total RNA or an mRNA fraction prepared from a GIST.
- the polynucleotide of the present invention includes a polynucleotide that hybridizes under stringent conditions to a polynucleotide.
- the measure of the level of polypeptides may be realized by any appropriate technique known by the man skilled in the art. It may be, for example, an immunohistochemistry technique, in which the expression of the protein is measured after hybridization of an antibody recognizing specifically the AURKA protein.
- the measure of the level of polynucleotides may be realized be any appropriate technique known by the man skilled in the art. It may be, for example, a method of genomic qPCR (quantitative polymerization chain reaction), CGH-array (Comparative Genomic Hibridization) or RT-qPCR (real time qPCR) in order to check copy number of genomic DNA or quantify expression of genomic DNA.
- genomic qPCR quantitative polymerization chain reaction
- CGH-array Comparative Genomic Hibridization
- RT-qPCR real time qPCR
- the method of the invention may comprise the calculation of the Genomic Index (GI), i.e. the number and type of alterations of the GIST genome, according to the formula as follows:
- GI Genomic Index
- A is the number of alterations in GIST genome and C is the number of involved chromosomes in GIST.
- Numberer of alterations in GIST genome refers herein to different numerical and segmental gains and losses.
- the alterations may for example involve whole chromosome arms or chromosome without rearrangement, or intra-chromosome gains or losses. It may be measured by techniques known in the art, such as CGH-array.
- Number of involved chromosomes in GIST refers herein to the number of chromosomes of GIST cells having an alteration. The number of chromosome may be measured by CGH-array.
- GIST is classified in a group of metastasis- and disease-free survival group when AURKA is down-regulated and the GI is equal or less than 10.
- AURKA expression may be less than 9.13, or less than 9, or less than 8, or less than 7, or less than 6, or less than 5.
- there is a survival of 5 years i.e. there are no metastasis or disease during 5 years after GIST outcome or after the end of a treatment.
- GIST may be classified in a group with low risk to develop metastases within 5 years, i.e.
- AURKA expression is equal or less than the mean of AURKA expression, and GI is equal or less than 10, said mean being the mean of AURKA expression/level in several GISTs, for example a series of 50 to 70 GISTs, for example 60 GISTs. In this case, there is no metastasis or disease during 5 years.
- GIST may be classified in a group with high risk to develop metastases within 5 years, i.e. with a risk to develop metastases within 5 years more than 75%, when AURKA expression is more than the mean of AURKA expression and GI is more than 10, said mean being the mean of AURKA expression in several GISTs, for example in a series of 50 to 70 GISTs, for example 60 GISTs. In this case, there are 75% of cases of metastasis or disease during 5 years after GIST outcome or after the end of a treatment.
- Another object of the invention is a kit for the in vitro prediction of the survival outcome of a patient suffering from GIST, and/or the development of metastases in a patient treated for or suffering from GIST, and/or the prediction of the efficacy of a treatment for GIST, characterized in that it comprises means for detecting and/or quantify, in a sample, AURKA expression/level, and means for the calculation of the GI.
- Means for detecting and/or AURKA expression/level may be any means for detecting levels of proteins or of polynucleotides known by the man skilled in the art.
- the means may be for example the means to realize an immunohistochemistry analysis, a western blot or a q-PCR.
- Means for the calculation of the GI refers herein to any means allowing the calculation of the number of alterations in GIST genome and of the number of involved chromosomes in GIST.
- Another object of the invention is a method for screening for compounds for the use in the treatment of GISTs, comprising the steps of :
- Down-regulation refers herein to any diminution of the expression or level of AURKA protein or polynucleotide.
- the method may also comprise the steps of :
- Another object of the invention is an AURKA inhibitor for its use in the treatment of GISTs.
- “Inhibitor” refers herein to any compound allowing a decrease of the expression/level of AURKA protein, or in a decrease of a biological effect of AURKA, when the inhibitor is contacted with GIST.
- the AURKA inhibitor may be PHA-739358 (29, 54), MLN8237 (30), MK-5108 (33).
- Another object of the invention is a method of treatment of GIST, in a subject in need thereof, comprising the step of administering to the patient a pharmaceutically effective dose of a inhibitor as defined above.
- FIG. 2 Kaplan-Meyer analysis of metastasis- free (MFS) and disease-free (DFS) survival according to AURKA expression.
- AURKA has been identified in the present 60-GISTs series, this series is considered as (a) the "training set” and the Yamaguchi's series as (b) the "validation set”.
- Al corresponds to tumors with below- average A URKA expression.
- FIG. 3 CGH profiles of four cases representing GISTs with very few rearrangements (GIST #8), GISTs moderately rearranged (GISTs #49 and #11) and GISTs highly rearranged (GIST #38). Genomic alterations are presented and organized from chromosome 1 to 22 on the X axis and log ratio values are reported on the Y axis. Significant gains or losses are indicated by blue lines and blue areas above or below each profile, respectively.
- CI metastasis- free (MFS) and disease-free (DFS) survival according to both GI and AURKA expression.
- CI corresponds to tumors with GI below 10 and AURKA expression below average.
- C2 corresponds to tumors with GI over 10 and AURKA expression above average.
- FIG. 6 Volcano-plot representation of t-test comparing expression profiles of GISTs with or without metastasis. Venn diagram at the bottom indicates the number of genes overlapping with CINSARC signature.
- FIG. 8 Histogram presenting the 4000 more frequently deleted probe sets in metastatic (M) cases (blue). Corresponding frequencies for non-metastatic (NM) cases are in red. Y axes represent the deletion frequency. Bottom panels are detailed views of the probe sets with the highest differences between M and NM cases.
- FIG. 10 prognostic values of protein expression of AURKA gene.
- the expression of the AURKA protein has been measured after specific hybridization with an antibody recognizing specifically AURKA protein. The hybridization of the antibody was then revealed by a chromogenic process. Examples
- GIST tumors Sixty seven fresh frozen GIST tumors were selected from the European GIST database CONTICAGIST (www.conticagist.org) which contains data from GIST tissues, including information regarding patients, primary tumor, treatment, follow-up and availability of tumor samples. All GISTs selected were primary untreated tumors. Their characteristics are presented in supplementary table 1. Most GISTs (59/67) were studied by both CGH-array and gene expression profiling (a combination of 66 by CGH-array and 60 by gene expression profiling).
- Genomic DNA was extracted using the standard phenol-chloroform method.
- Reference DNA female
- the concentration and the quality of DNA were measured using NanoDrop ND-1000 Spectrophotometer and gel electrophoresis.
- Tumor and control DNAs were hybridized to 8 x 60K whole-genome Agilent arrays (G4450A). Briefly, for each sample, 350 ng of DNA were fragmented by a double enzymatic digestion (Alul + Rsal) and checked with LabOnChip (2100 Bioanalyzer System, Agilent Technologies) before labeling and hybridization.
- Tumor and control DNAs were labeled by random priming with CY5-dUTPs and CY3-dUTP, respectively, hybridized at 65°C for 24h and rotating at 20 rpm.
- Arrays were scanned using an Agilent G2585CA DNA Microarray Scanner and image analysis was done using the Feature-Extraction V10.1.1.1 software (Agilent Technologies). Normalization was done using the ranking-mode method available in the Feature-Extraction VIO.1.1 software, with default value for any parameter.
- Raw copy number ratio data were transferred to CGH Analytics v4.0.76 software.
- the ADM-2 algorithm of CGH Analytics v4.0.76 software was used to identify DNA copy number anomalies at the probe level.
- a low-level copy number gain was defined as a log 2 ratio >0.25 and a copy number loss was defined as a log 2 ratio ⁇ -0.25.
- a high-level gain or amplification was defined as a log 2 ratio >1.5 and a homozygous deletion is suspected when ration is below -1.
- Tumor data were normalized against data obtained for normal DNA. The results were then calculated as previously described (52).
- a normal status corresponds to 0.8 ⁇ ratio ⁇ 1.2, 0.1 ⁇ ratio ⁇ 0.8 is considered as a hemizygous deletion. When ratio is inferior to 0.1, the deletion is considered as homozygous.
- CDKN2A locus has been submitted to sequencing as previously described ([52]) and RBI gene was sequenced using genomic DNA according to Houdayer et al (53) or cDNA with following primers : (Fl) 5'- TCATGTCAGAGAGAGAGCTTGG-3 ' (SEQ ID NO: 6), (Rl) 5'- CGTGCACTCCTGTTCTGACC-3 ' (SEQ ID NO: 7); (F2) 5'- AATGGTTCACCTCGAACACC -3' (SEQ ID NO: 8), (R2) 5'-
- RNAs were extracted from frozen tumor samples with TRIzol reagent (Life Technologies, Inc.) and purified using the RNeasy® Min Elute TM Cleanup Kit (Qiagen) according to the manufacturer's procedures. RNA quality was checked on an Agilent 2100 bioanalyzer (Agilent Technologies). RNAs with a RNA Integrity Number (RIN) > 6.5 were used for microarray.
- RNA expression analysis was carried out using Agilent Whole human 44K Genome Oligo Array (Agilent Technologies). This specific array represents over 41 000 human genes and transcripts, all with public domain annotations.
- Total RNA 500 ng was reverse transcribed into cRNA by incorporating a T7 oligo-dT promoter primer prior to the generation of fluorescent cRNA using an Agilent Quick Amp Labeling Kit (Agilent Technologies).
- the labeled cRNA was purified using a Qiagen RNeasy Mini Kit (Qiagen) and quantified using a NanoDrop ND-1000 instrument.
- Cy3-labeled (sample) cRNAs were hybridized to the array using a Gene Expression Hybridization Kit (Agilent Technologies).
- the hybridization was incubated in Agilent SureHyb chambers for 17 hours in a Hyb Oven set to 65°C and rotating at 10 rpm.
- the microarray slides were washed according to the manufacturer's instructions and then scanned on an Agilent G2565BA DNA Microarray Scanner and image analysis was done using the Feature- Extraction VI 0.1.1.1 software (Agilent Technologies).
- centroids represent a centered mean of expression for the signature genes for each patient outcome (metastatic and non-metastatic). Thus, centroids were calculated from the cohort 1 samples (17) and then each sample of our series (thus considered as a validation set) was allocated to the prognostic class (centroid) with the highest Spearman correlation.
- Metastasis- and disease- free survival was calculated by the Kaplan-Meier method from the date of initial diagnosis to the date of first metastasis, relapse, last follow-up or death for patients within diagnosis of metastasis. Survival curves were compared with the log rank test. Hazard ratios were performed with the Cox proportional hazard model. All statistical analyses were performed using R software version 2.11.11 and the package "survival".
- Table 2 297 genes differentially ex between GISTs with or without metastasis (t-test).
- AURKA aurora kinase A
- NCAPG2 non-SMC condensin II complex, subunit G2
- ESPL1 Homo sapiens extra spindle pole bodies homolog 1 (S. cerevisiae) (ESPL1 ), mRNA
- SMC1 B Homo sapiens structural maintenance of chromosomes 1 B (SMC1 B), mRNA
- TRIP13 Homo sapiens thyroid hormone receptor interactor 13 (TRIP13), mRNA
- STAG3 Homo sapiens stromal antigen 3
- TACC3 transforming, acidic coiled- coil containing protein 3
- mRNA transforming, acidic coiled- coil containing protein 3 (TACC3), mRNA
- NUF2 cerevisiae
- centrosomal protein 72kDa A_23_P302654 1 .16E-06 3.2 NM_018140 CEP72 (CEP72), mRNA [NM_018140]
- FLJ13236 FLJ13236
- CCNB1 Homo sapiens cyclin B1 (CCNB1 ), mRNA
- BUB1 Homo sapiens BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) (BUB1 ),
- centromere protein F 350/400ka (mitosin) (CENPF)
- CENPF centromere protein F
- NM_005480 Homo sapiens trophinin associated protein A_23_P 150935 2.44E-06 5.4 NM_005480 (tastin) (TROAP), mRNA [NM_005480]
- NIMA severe in mitosis gene a
- NEK2 kinase 2
- v-myb myeloblastosis viral oncogene homolog (avian)-like 2 MYBL2
- NCAPH non-SMC condensin I complex, subunit H
- FLJ13236 FLJ13236
- Homo sapiens cell division cycle 2 G1 to S and G2 to M (CDC2), transcript variant 1 ,
- chromosome 15 open reading frame 42 (C15orf42), mRNA
- chromosome 15 open reading frame 42 (C15orf42), mRNA
- CKAP2L cytoskeleton associated protein 2-like
- CDK2-associated dual specificity phosphatase CDKN3
- CDKN3 Homo sapiens cyclin-dependent kinase inhibitor 3 (CDK2-associated dual specificity phosphatase)
- HMMR Homo sapiens hyaluronan-mediated motility receptor
- MCM10 transcript variant 1
- DKFZp762E1312 (DKFZp762E1312), A_24_P257099 9.31 E-06 7.1 NM_018410 DKFZp762E1312 mRNA [NM_018410]
- CDT1 Homo sapiens chromatin licensing and DNA replication factor 1 (CDT1 ), mRNA
- A_23_P88331 9.69E-06 6.2 NM_014750 DLG7 (Drosophila) (DLG7), mRNA [NM_014750] A 23 P57379 9.69E-06 4.1 NM 003504 CDC45L Homo sapiens CDC45 cell division cycle 45-
- TTK TTK protein kinase
- GINS complex subunit 1 Homo sapiens GINS complex subunit 1
- FANCA complementation group A
- PBK Homo sapiens PDZ binding kinase
- centromere protein F 350/400ka (mitosin) (CENPF)
- CENPF centromere protein F
- CCNB2 Homo sapiens cyclin B2 (CCNB2), mRNA
- NIMA severe in mitosis gene a
- NEK2 kinase 2
- KRT18 Homo sapiens keratin 18
- CDT1 Homo sapiens chromatin licensing and DNA replication factor 1 (CDT1 ), mRNA
- ASF1 anti-silencing function 1 homolog B S. cerevisiae
- ASF1 B S. cerevisiae
- NCAPG non-SMC condensin I complex, subunit G
- LMNB1 Homo sapiens lamin B1 (LMNB1 ), mRNA
- centrosomal protein 55kDa Homo sapiens centrosomal protein 55kDa
- EZH2 Homo sapiens enhancer of zeste homolog 2 (Drosophila) (EZH2), transcript variant 1 , A_23_P259641 2.22E-05 3.1 NM_004456 EZH2 mRNA [NM_004456]
- E2F transcription factor 8 A_23_P35871 2.26E-05 5.3 NM_024680 E2F8 (E2F8), mRNA [NM_024680]
- NUSAP1 Homo sapiens nucleolar and spindle associated protein 1 (NUSAP1 ), transcript
- ZWINT Homo sapiens ZW10 interactor
- transcript variant 4 mRNA
- MCM10 minichromosome maintenance deficient 10 S. cerevisiae (MCM10)
- transcript variant 1 mRNA
- CCNA2 Homo sapiens cyclin A2 (CCNA2), mRNA
- transcript variant 1 mRNA [NM_000224]
- FLJ40504 FLJ40504
- KRT18 Homo sapiens keratin 18
- Homo sapiens shugoshin-like 1 (S. pombe)
- GAL3ST1 Homo sapiens galactose-3-O- sulfotransferase 1 (GAL3ST1 ), mRNA
- shugoshin-like 1 S. pombe
- transcript variant A1 mRNA
- EGF LAG seven- pass G-type receptor 3 flamingo homolog, Drosophila
- E1A enhancer binding protein, E1AF E1A enhancer binding protein
- E1A enhancer binding protein, E1AF E1A enhancer binding protein
- kinesin family member 23 KIF23
- transcript variant 1 mRNA
- NT5DC3 Homo sapiens 5'-nucleotidase domain containing 3 (NT5DC3), transcript variant 2,
- TCAM1 testicular cell adhesion molecule 1 homolog
- RAD51 Homo sapiens RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) (RAD51 ),
- PJCG2 (PJCG2) mRNA, partial cds.
- KIAA0101 Homo sapiens KIAA0101 (KIAA0101 ), A_23_P1 17852 2.21 E-04 3.9 NM_014736 KIAA0101 transcript variant 1 , mRNA [NM_014736]
- Homo sapiens cancer susceptibility candidate 5 (CASC5), transcript variant 1 ,
- phosphatase type 2C (PPAP2C), transcript A_23_P 108294 2.53E-04 3.6 NM_177543 PPAP2C variant 3, mRNA [NM_177543]
- telomerase reverse transcriptase (TERT), transcript variant 1 , A_23_P1 10851 2.95E-04 6.4 NM_198253 TERT mRNA [NM_198253]
- EXO1 Homo sapiens exonuclease 1
- TNFSF18 tumor necrosis factor superfamily, member 18
- HSF2BP heat shock transcription factor 2 binding protein
- mRNA Homo sapiens matrilin 3 (MATN3), mRNA
- Homo sapiens polymerase DNA directed
- epsilon 2 p59 subunit
- POLE2 epsilon 2
- mRNA mRNA
- Kazal-type serine protease inhibitor domain containing protein 1 precursor Kazal-type serine protease inhibitor domain containing protein 1 precursor.
- chromosome 10 open reading frame 1 1 (C10orf1 1 ), mRNA
- Zinc finger protein 541 Zinc finger protein 541 .
- Homo sapiens melanoma antigen family A, 1 directs expression of antigen MZ2-E
- DIAPH3 Homo sapiens diaphanous homolog 3 (Drosophila) (DIAPH3), transcript variant 1 ,
- CSH2 somatomammotropin hormone 2
- ZNF483 Homo sapiens zinc finger protein 483 (ZNF483), transcript variant 1 , mRNA
- MCF2 cell line derived transforming sequence MCF2 cell line derived transforming sequence (MCF2), mRNA
- Homo sapiens solute carrier family 24 sodium/potassium/calcium exchanger
- catenin cadherin-associated protein
- CTNNA3 alpha 3
- Soares_multiple_sclerosis_2NbHMSP Homo sapiens cDNA clone
- CPE carboxypeptidase E
- C1 QTNF2 tumor necrosis factor related protein 2
- C1 QTNF2 tumor necrosis factor related protein 2
- LTBP1 latent transforming growth factor beta binding protein 1
- A_23_P364024 8.78E-05 3.2 NM_006851 GLIPR1 (glioma) (GLIPR1 ), mRNA [NM_006851 ] A_32_P73991 9.58E-05 7.1 THC2667995 THC2667995
- CCND2 Homo sapiens cyclin D2 (CCND2), mRNA
- SCD5 Homo sapiens stearoyl-CoA desaturase 5 (SCD5), transcript variant 1 , mRNA
- FXYD6 transport regulator 6 FXYD6
- MAP6 microtubule-associated protein 6
- transcript variant 1 transcript variant 1
- LMOD3 Homo sapiens leiomodin 3 (fetal) (LMOD3),
- LMOD3 Homo sapiens leiomodin 3 (fetal) (LMOD3),
- RIC3 Homo sapiens RIC3 isoform d (RIC3)
- Homo sapiens low density lipoprotein-related protein 1 B (deleted in tumors)
- MAP9 protein 9 MAP9 protein 9 (MAP9), mRNA [NM_001039580]
- MOB1 Homo sapiens MOB1 , Mps One Binder kinase activator-like 2B (yeast) (MOBKL2B),
- RAC-gamma serine/threonine-protein kinase (EC 2.7.1 1 .1 ) (RAC-PK-gamma)
- DKFZP564O0823 protein A 24 P191781 3.10E-04 4.5 NM 015393 DKFZP564O0823 (DKFZP564O0823), mRNA [NM_015393]
- PLACE3000155 weakly similar to Homo sapiens mRNA for KIAA0672 protein.
- DAB2IP Homo sapiens DAB2 interacting protein
- transcript variant 1 mRNA
- CCND2 Homo sapiens cyclin D2 (CCND2), mRNA
- DAB2IP Homo sapiens DAB2 interacting protein
- transcript variant 2 mRNA
- ANK2 Homo sapiens ankyrin 2, neuronal (ANK2),
- ADAM23 mRNA [NM_003812]
- FGF12 fibroblast growth factor 12
- transcript variant 2 mRNA
- PODN Homo sapiens podocan
- MLLT3 myeloid/lymphoid or mixed- lineage leukemia
- Rho GTPase activating protein 24 (ARHGAP24), transcript variant A_23_P1 10151 7.49E-04 4.0 NM_031305 ARHGAP24 2, mRNA [NM_031305]
- ISL2 transcription factor LIM/homeodomain, (islet-2) (ISL2), mRNA A_23_P54469 8.63E-04 4.3 NM_145805 ISL2 [NM_145805]
- Rho GTPase activating protein 24 (ARHGAP24), transcript variant
- Table 3 Comparison of enriched pathways (Gene Ontology analysis) in CINSARC genes and in t-test comparing tumors according to outcome and to pl6/Rbl pathway inactivation.
- AURKA is a significant marker of metastasis outcome
- Table 5 Expression of pi 6 and RBI measured by expression array and by RT-qPCR.
- Expression array data are log2 transformed and RT-qPCR data are difference between tested gene and reference genes CTs, that means that the highest the value, the lowest the expression. High expressions are indicated in red and low expressions in green. Main clinical data and results are reported from table I .
- GIST31 9.07 02 S 3.51 t 3 3 3 Gii AGI 2 2 2 2 i ⁇ 'Ask stomach No No P18 p.1843 D846del
- GIST20 9.60 C2 9.02 Ai 9 5 16.2 GI2 AG2 2 2 2 2 high risk abdominal wall No No Kll p.W557R
- GIST42 9.89 C2 9.50 A2 2 2 2 Ci' " ', AG 2 1 ⁇ . J 2 i 3 ⁇ 4 risk stomach No No WT WT
- GIST16 9.60 C2 9.70 A2 8 6 10.67 GI2 AG 2 2 2 2 1 high risk jejunum No Yes K9 p.A502 Y503dup
- GIST47 10.32 C2 9.64 A2 22 12 40.33 GI2 AG 2 i> ii 0 2 high risk stomach No Yes Kll p.E554 D572delinsF
- Chromosomal complexity is a significant prognosis factor of GISTs
- GI Genomic Index
- Integrative analysis allows identification of a no-risk group of patients
- P16/RB1 pathway is associated to metastatic outcome.
- CINSARC is a very powerful signature to predict metastatic outcome.
- CINSARC is composed of 67 genes which are all involved in chromosome integrity and mitosis control pathways, indicating that such mechanisms appear to be driving the development of metastasis in this tumor type, as we recently demonstrated in sarcomas (18). This is in line with results from the reciprocal approach, which is the identification of genes differentially expressed between GISTs with or without metastatic outcome.
- 45 were common with the CINSARC signature and the activated pathways were almost all the same.
- CDKN2A codes for two key tumor suppressor proteins, the pl6 INK4a and the pl4 ARF , which are involved in the regulation of the cell cycle Gl and G2/M transition. Together, these proteins regulate two important cell cycle checkpoints, the p53 and the RBI pathways for pl4 and pl6 INK4a , respectively. Loss of these genes can lead to replicate senescence, cell immortalization and tumor growth (48-51). Most of the CINSARC genes are under the transcriptional control of E2F, which is tightly regulated by RBI interaction. Actually, RBI sequestrates E2F which is delivered upon RBI phosphorylation by CDK4 (Cyclin Dependent Kinase 4) and pl6 a inhibits CDK4.
- Imatinib mesylate has been proven to target KIT-aberrant signaling inhibiting the proliferation and survival in GIST cells.
- imatinib therapy was restricted to disseminated or advanced disease at the time of diagnosis. Since then, adjuvant treatment has been approved and the necessity to apply selection criteria to identify patients susceptible to benefit from such management has emerged.
- Patient selection foreseen by FDA (Food and Drug Administration) and to a lesser extent by EMA (European Medicines Agency) is essentially based on the histological risk evaluation.
- AFIP (9) and NIH (8) histological-based staging systems are widely accepted as "gold standards" in determining tumor metastatic risk and to determine whether a GIST patient is eligible or not for adjuvant therapy with imatinib.
- the CINSARC signature and AURKA expression outperform the AFIP classification (survival analysis according to AFIP classification is presented in fig 4), particularly when associated to the CGH genomic index.
- the Genomic Index is able to distinguish good and poor prognosis patients in GISTs classified as intermediate-risk by these histopathological systems (which represent around 25% of diagnoses). More specifically, among the 16 AFIP intermediate-risk cases, four developed metastasis. These cases were classified as poor prognosis by GI (fig. 4 and Table 5).
- GI established in this study is therefore a very powerful tool to manage GIST patient more likely to benefit from therapy since CGH is a technique already used in the daily practice by a growing number of pathology departments and is applicable to formalin- fixed paraffin-embedded (FFPE) samples.
- FFPE formalin- fixed paraffin-embedded
- Gastrointestinal pacemaker cell tumor (GIPACT): gastrointestinal stromal tumors show phenotypic characteristics of the interstitial cells of Cajal. Am J Pathol 152, 1259-1269 (1998).
- a putative serine/threonine kinase encoding gene BTAK on chromosome 20ql3 is amplified and overexpressed in human breast cancer cell lines. Oncogene 14, 2195-2200 (1997).
- the RBI gene is the target of chromosome 13 deletions in malignant fibrous histiocytoma. Cancer Res. Nov 15, 6339-45 (2000).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2013534446A JP2014501496A (ja) | 2010-10-20 | 2011-10-20 | 消化管間質腫瘍における臨床転帰のシグネチャーおよび消化管間質腫瘍の治療の方法 |
| US13/880,155 US20130288250A1 (en) | 2010-10-20 | 2011-10-20 | Signatures of clinical outcome in gastro intestinal stromal tumors and method of treatment of gastrointestinal stromal tumors |
| ES11785107.1T ES2541054T3 (es) | 2010-10-20 | 2011-10-20 | Firmas del resultado clínico en tumores estromales gastrointestinales y método de tratamiento de tumores estromales gastrointestinales |
| CA2811744A CA2811744A1 (en) | 2010-10-20 | 2011-10-20 | Signatures of clinical outcome in gastro intestinal stromal tumors and method of treatment of gastroinstestinal stromal tumors |
| DK11785107.1T DK2630259T3 (en) | 2010-10-20 | 2011-10-20 | SIGNATURES OF CLINICAL OUTCOME In gastrointestinal stromal tumors AND METHOD FOR THE TREATMENT OF gastrointestinal stromal tumors |
| EP11785107.1A EP2630259B8 (en) | 2010-10-20 | 2011-10-20 | Signatures of clinical outcome in gastro intestinal stromal tumors and method of treatment of gastroinstestinal stromal tumors |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP10013806.4 | 2010-10-20 | ||
| EP10013806 | 2010-10-20 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2012052954A1 true WO2012052954A1 (en) | 2012-04-26 |
Family
ID=44999817
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2011/054688 Ceased WO2012052954A1 (en) | 2010-10-20 | 2011-10-20 | Signatures of clinical outcome in gastro intestinal stromal tumors and method of treatment of gastroinstestinal stromal tumors |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20130288250A1 (https=) |
| EP (1) | EP2630259B8 (https=) |
| JP (1) | JP2014501496A (https=) |
| CA (1) | CA2811744A1 (https=) |
| DK (1) | DK2630259T3 (https=) |
| ES (1) | ES2541054T3 (https=) |
| WO (1) | WO2012052954A1 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3064594A1 (en) | 2015-03-06 | 2016-09-07 | Université de Bordeaux | Signature of clinical outcome in uterine smooth muscle tumor analysis, and method of diagnosis thereof |
| KR101860652B1 (ko) | 2015-12-23 | 2018-05-24 | 연세대학교 산학협력단 | 위장관 간질 종양 진단용 마커 및 위장관 간질 종양의 진단 방법 |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6965621B2 (ja) * | 2017-08-02 | 2021-11-10 | 富士通株式会社 | 検出プログラム、検出方法及び検出装置 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006130613A2 (en) * | 2005-05-31 | 2006-12-07 | The Pfahl Family Trust (Dated 9 July 1996) | Substituted biarylheterocycle derivatives as protein kinase inhibitors for the treatment of cancer and other diseases |
| WO2006129064A1 (en) * | 2005-05-28 | 2006-12-07 | Astrazeneca Ab | Quinazolines and their use as aurora kinase inhibitors |
| WO2008025526A1 (en) * | 2006-08-31 | 2008-03-06 | F. Hoffmann-La Roche Ag | Indole derivatives, their manufacture and use as pharmaceutical agents |
| WO2008156614A2 (en) * | 2007-06-14 | 2008-12-24 | Schering Corporation | Imidazopyrazines as protein kinase inhibitors |
| WO2010068951A1 (en) * | 2008-12-12 | 2010-06-17 | Fox Chase Cancer Center | Combination therapy based on src and aurora kinase inhibition for the treatment of cancer |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2491067A1 (en) * | 2004-12-24 | 2006-06-24 | Stichting Katholieke Universiteit | Mrna rations in urinary sediments and/or urine as a prognostic marker for prostate cancer |
| CA2644586A1 (en) * | 2006-03-03 | 2008-04-17 | Veridex Llc | Molecular assay to predict recurrence of duke's b colon cancer |
| EP2102360A2 (en) * | 2006-12-13 | 2009-09-23 | Oncotherapy Science, Inc. | Ttk as tumor marker and therapeutic target for lung cancer |
-
2011
- 2011-10-20 US US13/880,155 patent/US20130288250A1/en not_active Abandoned
- 2011-10-20 CA CA2811744A patent/CA2811744A1/en not_active Abandoned
- 2011-10-20 DK DK11785107.1T patent/DK2630259T3/en active
- 2011-10-20 EP EP11785107.1A patent/EP2630259B8/en not_active Not-in-force
- 2011-10-20 JP JP2013534446A patent/JP2014501496A/ja active Pending
- 2011-10-20 WO PCT/IB2011/054688 patent/WO2012052954A1/en not_active Ceased
- 2011-10-20 ES ES11785107.1T patent/ES2541054T3/es active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006129064A1 (en) * | 2005-05-28 | 2006-12-07 | Astrazeneca Ab | Quinazolines and their use as aurora kinase inhibitors |
| WO2006130613A2 (en) * | 2005-05-31 | 2006-12-07 | The Pfahl Family Trust (Dated 9 July 1996) | Substituted biarylheterocycle derivatives as protein kinase inhibitors for the treatment of cancer and other diseases |
| WO2008025526A1 (en) * | 2006-08-31 | 2008-03-06 | F. Hoffmann-La Roche Ag | Indole derivatives, their manufacture and use as pharmaceutical agents |
| WO2008156614A2 (en) * | 2007-06-14 | 2008-12-24 | Schering Corporation | Imidazopyrazines as protein kinase inhibitors |
| WO2010068951A1 (en) * | 2008-12-12 | 2010-06-17 | Fox Chase Cancer Center | Combination therapy based on src and aurora kinase inhibition for the treatment of cancer |
Non-Patent Citations (56)
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3064594A1 (en) | 2015-03-06 | 2016-09-07 | Université de Bordeaux | Signature of clinical outcome in uterine smooth muscle tumor analysis, and method of diagnosis thereof |
| KR101860652B1 (ko) | 2015-12-23 | 2018-05-24 | 연세대학교 산학협력단 | 위장관 간질 종양 진단용 마커 및 위장관 간질 종양의 진단 방법 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2630259A1 (en) | 2013-08-28 |
| ES2541054T3 (es) | 2015-07-15 |
| US20130288250A1 (en) | 2013-10-31 |
| CA2811744A1 (en) | 2012-04-26 |
| JP2014501496A (ja) | 2014-01-23 |
| EP2630259B1 (en) | 2015-04-15 |
| EP2630259B8 (en) | 2015-05-27 |
| DK2630259T3 (en) | 2015-07-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Childs et al. | Low-level expression of microRNAs let-7d and miR-205 are prognostic markers of head and neck squamous cell carcinoma | |
| EP2714926B1 (en) | Biomarkers for lung cancer | |
| Feber et al. | MicroRNA prognostic signature for nodal metastases and survival in esophageal adenocarcinoma | |
| Bjaanæs et al. | Unique microRNA‐profiles in EGFR‐mutated lung adenocarcinomas | |
| Pedersen et al. | MicroRNA-based classifiers for diagnosis of oral cavity squamous cell carcinoma in tissue and plasma | |
| Villegas-Ruiz et al. | Heterogeneity of microRNAs expression in cervical cancer cells: over-expression of miR-196a | |
| Alvi et al. | Comprehensive molecular pathology analysis of small bowel adenocarcinoma reveals novel targets with potential for clinical utility | |
| US20160333419A1 (en) | Gene signatures associated with sensitivity to mdm2 inhibitors | |
| US20110166028A1 (en) | Methods for predicting treatment response based on the expression profiles of biomarker genes in notch mediated cancers | |
| WO2008077165A1 (en) | Set of tumor markers | |
| JP2017532959A (ja) | Mdm2阻害剤に対する感受性の遺伝子シグネチャーに基づく予測因子に関するアルゴリズム | |
| Watanabe et al. | Differential gene expression signatures between colorectal cancers with and without KRAS mutations: crosstalk between the KRAS pathway and other signalling pathways | |
| TWI622892B (zh) | 基因表現圖譜以及將其應用於乳癌醫療之方法與套組與微陣列晶片 | |
| Brito et al. | Identification of protein‐coding and intronic noncoding RNAs down‐regulated in clear cell renal carcinoma | |
| WO2013130748A1 (en) | Prostate cancer markers and uses thereof | |
| CA2695814A1 (en) | Methods and tools for prognosis of cancer in her2+ patients | |
| EP2630259B1 (en) | Signatures of clinical outcome in gastro intestinal stromal tumors and method of treatment of gastroinstestinal stromal tumors | |
| JP2011520454A (ja) | 結腸直腸癌を評価する方法及びかかる方法に使用するための組成物 | |
| Iorio et al. | MicroRNA profiling in ovarian cancer | |
| US9708666B2 (en) | Prognostic molecular signature of sarcomas, and uses thereof | |
| EP3677694B1 (en) | Compositions and methods for the analysis of radiosensitivity | |
| Jones et al. | PLK3 amplification and tumor immune microenvironment of metastatic tumors are linked to adjuvant treatment outcomes in uterine serous cancer | |
| Hurst et al. | Molecular profile of pure squamous cell carcinoma of the bladder identifies major roles for OSMR and YAP signalling | |
| US20170121778A1 (en) | E2f4 signature for use in diagnosing and treating breast and bladder cancer | |
| Islakoğlu et al. | hsa-miR-301a-and SOX10-dependent miRNA-TF-mRNA regulatory circuits inbreast cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11785107 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2811744 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2013534446 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011785107 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13880155 Country of ref document: US |