WO2012020687A1 - Method of inducing differentiation from pluripotent stem cells to germ cells - Google Patents

Method of inducing differentiation from pluripotent stem cells to germ cells Download PDF

Info

Publication number
WO2012020687A1
WO2012020687A1 PCT/JP2011/067816 JP2011067816W WO2012020687A1 WO 2012020687 A1 WO2012020687 A1 WO 2012020687A1 JP 2011067816 W JP2011067816 W JP 2011067816W WO 2012020687 A1 WO2012020687 A1 WO 2012020687A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cell
pgc
pluripotent stem
epilcs
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/JP2011/067816
Other languages
English (en)
French (fr)
Inventor
Mitinori Saitou
Katsuhiko Hayashi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kyoto University NUC
Original Assignee
Kyoto University NUC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kyoto University NUC filed Critical Kyoto University NUC
Priority to EP11816353.4A priority Critical patent/EP2603583B1/en
Priority to JP2013506973A priority patent/JP5892661B2/ja
Priority to US13/816,681 priority patent/US9938496B2/en
Publication of WO2012020687A1 publication Critical patent/WO2012020687A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0603Embryonic cells ; Embryoid bodies
    • C12N5/0606Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0608Germ cells
    • C12N5/0611Primordial germ cells, e.g. embryonic germ cells [EG]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/11Epidermal growth factor [EGF]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/115Basic fibroblast growth factor (bFGF, FGF-2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/125Stem cell factor [SCF], c-kit ligand [KL]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/155Bone morphogenic proteins [BMP]; Osteogenins; Osteogenic factor; Bone inducing factor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10Growth factors
    • C12N2501/16Activin; Inhibin; Mullerian inhibiting substance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20Cytokines; Chemokines
    • C12N2501/23Interleukins [IL]
    • C12N2501/235Leukemia inhibitory factor [LIF]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/02Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/45Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from artificially induced pluripotent stem cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00Supports or coatings for cell culture, characterised by material
    • C12N2533/50Proteins
    • C12N2533/56Fibrin; Thrombin

Definitions

  • the present invention relates to a method of inducing primordial germ cell-like cells (PGC-like cells) from PPC-like cells.
  • EpiLCs pluripotent stem cells via epiblast-like cells
  • a reagent kit therefor a cell population containing EpiLCs obtained from the method and a method of inducing cells
  • PGCs in vitro from embryonic stem cells (ESCs) derived from the inner cell mass (ICM) of blastocysts in mice 1 ' 2 ' 3 ' 4 ' 5 and humans 6,7,8,9,10,11 (see also the reviews in 12 ' 13 ' 14 ) .
  • ESCs embryonic stem cells
  • ICM inner cell mass
  • EpiLCs epiblast-like cells
  • morphogenetic proteins induce germ cell differentiation from human embryonic stem cells. Stem Cells Dev 15, 831-837, doi:10.1089/scd.2006.15.831 (2006) .
  • mice germ cell lineage in mice. Nature 436, 207-213 (2005) .
  • an object of the present invention is to
  • Epiblast stem cells are pluripotent stem cells derived from E5.5 to E6.5 epiblasts in the continuous presence of activin A and basic fibroblast growth factor (bFGF) in
  • EpiSCs cultured under several conditions were not induced into Blimpl- and stella-positive cells efficiently in an SFM with BMP4. This might be because EpiSCs are not fully competent for the PGC fate, as reflected by their high-level expression of endoderm markers such as Gata6, Soxl7, and Cerl, a property distinct from pre-gastrulating epiblasts.
  • mice ESCs bearing the Bliinpl-mVenus and stella-ECFP reporters (BVSC; Reproduction 136, 503-514 (2008)). Since PGCs specifically express Blimpl ⁇ Prdml) and Stella ⁇ Dppa3) , the mouse ESCs enable visualization of PGC differentiation therefrom.
  • the reporter ESCs were maintained under a condition that keeps ESCs in the -E3.5-E4.5 ICM/early epiblast-like state, and then cultured in an SFM supplemented with activin A, and optionally bFGF and KnockOutTM Serum Replacement (KSR) for 3 days. During the culture, the ESCs were uniformly differentiated into
  • EpiLCs epiblast-like flattened cells
  • the present invention provides the following: [I] A method of producing an epiblast-like cell (EpiLC) from a pluripotent stem cell, which comprises culturing the pluripotent stem cell in the presence of activin A;
  • a method of producing a primordial germ cell-like (PGC-like) cell from a pluripotent stem cell which comprises the following steps I) and II) :
  • step II the step for culturing the EpiLC obtained in the step I) in the presence of B P4 and LIF;
  • step III) the step for selecting a Blimpl-positive cell from the cells obtained in the step II) ;
  • step III the step for selecting a SSEA1- and Integrin ⁇ 3-double positive cell from the cells obtained in the step II) ;
  • pluripotent stem cell is an induced pluripotent stem cell (iPSC) or embryonic stem cell (ESC) ;
  • a reagent kit for inducing the differentiation from a pluripotent stem cell to an EpiLC comprising activin A, bFGF and KSR;
  • a reagent kit for inducing the differentiation from a pluripotent stem cell to a PGC-like cell comprising the
  • pluripotent stem cell is an iPSC or ESC
  • reprogramming gene(s) are integrated into the genomes of the cells constituting the cell population;
  • reprogramming genes are 4 genes consisting of Oct3/4, Sox2, Klf4 and c-Myc, or 3 genes consisting of Oct3/4, Sox2 and Klf ; and [24] A method of producing a variety of cell types derived from epiblast which comprises utilizing the cell population of any of [20] -[23] above as a cell source.
  • the indution of PGC-like cells from pluripotent stem cells of the present invention involves the induction of EpiLCs as an intermediate.
  • EpiLCs are the culture equivalents of the E5.5- E6.0 epiblasts, the immediate precursors of PGCs.
  • the inventive induction system is considered to be a precise and stepwise recapitulation in culture of the PGC-specification pathway from the IC /early epiblasts in vivo. This notion is strongly supported by the gene expression dynamics associated with the PGC-like cell induction pathway, which is remarkably similar to that associated with the PGC specification pathway in vivo. Most notably, the induced PGC-like cells contributed to spermatogenesis with relatively high efficiency (3/6
  • the mechanism involved in the specification of PGCs and their subsequent development has been very difficult to explore, mainly because they are extremely small in number in vivo and refractory to proliferation in vitro.
  • the inventive culture system readily allows the generation of PGC-like cells in a relatively large number ( ⁇ 10 5 -10 6 ) and therefore serves as a foundation for elucidating areas of germ cell biology that have thus far been unexplored (e.g., analyses of the biochemical properties of key proteins involved in PGC specification and proliferation/survival, the precise mechanism of epigenetic reprogramming in PGCs, etc.) due to material limitations.
  • germ cell lineage such as sperm and egg is only one cell lineage that perpetuates genome information to the next generation and reconstitutes an individual.
  • hereditary diseases transmission/development of hereditary diseases.
  • an in vitro reconstruction of the developmental processes will promote not only the elucidation of detailed developmental mechanisms of germ cells but also the elucidation of mechanisms of infertility and development of hereditary diseases.
  • FIG. 1 shows an induction of epiblast-like cells (EpiLCs) from ESCs in culture.
  • FIG. 1A The scheme for EpiLC induction.
  • FIG. IB (a) Induction of the EpiLCs from ESCs with Blimpl- mVenus and stella-ECFP (BVSC) (top) and Prdml4-mVenus (P14V) (bottom) transgenes. Bright-field images and fluorescence images from the reporters are shown. The EpiLCs inductions were performed over three days. Bar, 50 urn.
  • FIG. 1C (a) Cell growth during the EpiLC induction. Average cell numbers with standard deviations from three independent experiments are shown. (b) Gene expression profiles during the EpiLC induction and of the epiblasts at E5.75 measured by Q-PCR. For each gene examined, the ACT from the average CT values of the two independent housekeeping genes Arbp and Ppia was
  • FIG. 2 shows an induction of the PGC-like cells from
  • FIG. 2A The effects of LIF, BMP4, or both on the induction of Blimpl (BV) in the floating 2-day culture of the ESCs, the day-1, -2, and -3 EpiLCs.
  • FIG. 2B The effects of BMP4, or BMP4 and LIF, or BMP4, LIF, SCF, BMP8b, and EGF (full induction) on the induction of Blimpl (BV) and stella (SC) in the floating 6-day culture of the ESCs, the day-1, -2, and -3 EpiLCs.
  • the day-2 EpiLCs developed as PGC-like cells with robust BVSC expression under the full induction condition.
  • FIG. 2C FACS analysis of the BVSC expression from day-2 EpiLCs under the full induction condition during the 6-day culture.
  • FIG. 2D The numbers of SC-positive cells at day 4 and 6 under the full induction condition from the day-2 EpiLCs. Each bar represents the number of BVSC-positive cells from 10 aggregates.
  • FIG. 2E Gene expression dynamics during the PGC-like cell induction from the day-2 EpiLCs. For each gene examined, the ACT from the average CT values of the two independent housekeeping genes Arbp and Ppia was calculated. For each point, the average value from two independent experiments is plotted on the log 2 scale. Red circles and lines, values of BV- or BVSC-positive cells (day 2 and day 4/6, respectively) ; blue circles and lines, values of BV- or BVSC-negative cells (day 2 and day 4/6, respectively) .
  • FIG. 2F Blimpl (left) and Stella (right) expression levels with SDs in BV(+) (day 2) and BV(+)SC(-) (green bars) or BVSC(+)
  • FIG. 3 shows epigenetic properties and cellular dynamics of the PGC-like cells.
  • FIG. 3A Reduced H3K9me2 (a), elevated H3K27me3 (b) , and repressed Dnmt3b (c) in BVSC-positive cells from the day-2 EpiLCs under the full induction condition at day 6. Images with DAPI staining are shown on the right. Bar, 20 jjm.
  • FIG. 3B Bisulfite sequence analysis of the cytosine
  • FIG. 3C (a) The numbers of
  • BVSC(+) blue circles
  • BV(+)SC(-) green circles
  • BV(-) grey circles
  • FIG. 4 shows a proper spermatogenesis and production of healthy offspring by the ESC-derived PGC-like cells.
  • FIG. 4A (a) Bright-field images of the seminiferous tubules with (right) or without (left) spermatogenesis transplanted with the PGC-like cells. Arrowheads indicate spermiated areas of the tubule. Bar, 500 ⁇ . (b) Spermatozoa derived from the PGC-like cells. Bar, 20 ⁇ . (c) , (d) Hematoxylin and eosin-stained histological sections of the seminiferous tubules undergoing spermatogenesis (c) and those without spermatogenesis (d) . Bar, 100 ⁇ . FIG.
  • FIG. 5 shows that the BVSC-positive cells are AP-positive.
  • the BVSC-positive cells induced for 6 days by BMP4 (500 ng/ml) , LIF (1000 U/ml), SCF (100 ng/ml), BMP8b (500 ng/ml), and EGF (50 ng/ml) from the day-2 EpiLCs were alkaline phosphatase (AP) - positive. Bar, 200 fjm.
  • FIG. 6 shows that the BVSC-positive cells persist up to 10 days in culture.
  • the BVSC-positive cells were induced from the day-2 EpiLCs by BMP4 alone (500 ng/ml) or by BMP4 (500 ng/ml) and LIF (1000 U/ml) . However, they were not maintained after day 6. In contrast, the BVSC-positive cells persisted robustly up to 10 days when induced by BMP4 (500 ng/ml), LIF (1000 U/ml), SCF (100 ng/ml), BMP8b (500 ng/ml), and EGF (50 ng/ml). Bar, 200 ⁇ .
  • FIG. 7 shows the PGC-like cell induction from independent ESC lines.
  • PGC-like cells day 2 , 4, and 6 were induced under the full induction condition [BMP4 (500 ng/ml), LIF (1000 U/ml), SCF (100 ng/ml), BMP8b (500 ng/ml), and EGF (50 ng/ml) in the
  • FIG. 8 shows generation of teratomas in the testes transplanted with non FACS-sorted cells induced at day 6 from the day-2 EpiLCs. Overt teratomas with cells of three germ layers were developed in the W/VF testes transplanted with non FACS-sorted, day-6 cells induced from the day-2 EpiLCs. Shown are the sections containing an epidermis-like structure
  • ectoderm hyaline cartilages (mesoderm) , epithelial structures with goblet cell-like cells (endoderm) , and striated muscles (mesoderm) . Bar, 50 ⁇ .
  • FIG. 9 shows an induction of the PGC-like cells
  • NG transgene
  • the EpiLCs inductions were performed over two days. Bar, 50 urn.
  • FIG. 9D Gene expression profiles during the EpiLC induction from iPSCs (492B-4) measured by Q-PCR. For each gene examined, the ACT from the average CT values of the two independent housekeeping genes Arbp and Ppia was
  • FIG. 9E FACS sorting by SSEAl and Integrin ⁇ 3 of day-6 aggregates for the PGC fate derived from iPSCs (20D17) (left panel) . Comparison of expression levels of the 20 genes (those analyzed in FIG. 2E) in each sub-population (PI, P2, and P3) with those in BV(+) cells (right panels) . R 2 represents the correlation coefficient.
  • FIG. 9F (a) (left panel) The
  • FIG. 10 shows the PGC-like cell induction from the
  • FIG. 10A PGC-like cell induction from E5.75 epiblasts (left) and day 2 EpiLCs (right, the same data as shown in FIG. 2B) under the full induction condition. Bar, 200 urn.
  • FIG. 10B Measurements of BV expression in epiblasts (top) or day 2 EpiLCs (bottom) at day 0 (left, grey) and day 2 (middle, red) of PGC-like cell induction. Merged profiles are shown on the right. Note that a great majority of both E5.75 epiblasts and day 2 EpilCs shifted toward the BV-positive state upon induction, although the response of the epiblasts was somewhat more cohesive.
  • FIG. IOC FACS analysis of BVSC expression from E5.75 epiblasts (top) and day 2 EpiLCs (bottom, the same data as shown in FIG. 2C) under the full induction condition during the 6-day culture.
  • FIG. 11 shows global transcription profiles during PGC- like cell induction.
  • FIG. 11A (a) Unsupervised hierarchical clustering (UHC) of non-amplified RNAs from ESCs, day (d) 1, d2, and d3 EpiLCs, EpiSCs, and PGC-like cells (PGCLCs) . (b) Scores of principal component (PC) 2 of ESCs and dl, 2, and 3 EpiLCs. (c) UHC of amplified RNAs from ESCs, d2 EpiLCs, EpiSCs, E5.75 epiblasts, PGCLCs and E9.5 PGCs .
  • FIG. 11B Comparison by
  • FIG. llC PCA of amplified RNAs from ESCs, d2 EpiLCs, EpiSCs, E5.75 epiblasts, PGCLCs, and E9.5 PGCs.
  • FIG. 11D Functional
  • epiblasts compared with ESCs.
  • FIG. 12 shows placental weights and growth of the
  • FIG. 13 shows induction and purification of PGC-like cells with capacity for spermatogenesis from ESCs with no germ-cell reporters.
  • FIG. 13A FACS sorting by SSEAl and Integrin-p3 of day-6 aggregates for the PGC fate from BVSC ESCs (left panel) .
  • the SSEAl/Integrin- 3 high PI sub-population is nearly identical to the BV(+) sub-population (right panels) . Numbers represent the percentages of each sub-population.
  • FIG. 13B FACS sorting by SSEAl and Integrin ⁇ 3 of day-6 aggregates for the PGC fate from AAG ESCs (left panel) . Comparison of expression levels of the 20 genes (those analyzed in FIG.
  • FIG. 13C (a) Testes of VJ/W mice transplanted with the whole population (left) , the PI sub-population (middle) , and no cells (right) of aggregates of day 2 EpiLCs with AAG transgenes induced for the PGC fate for 6 days. (b) Spermatogenic colonies in a W/T testis transplanted with the PI sub-population. BF: bright field image. (c) , (d) Immunofluorescence (IF) analysis of EGFP and Mvh expression in a spermatogenic colony in (a) .
  • IF Immunofluorescence
  • the present invention provides a method of producing
  • EpiLCs from pluripotent stem cells which comprises culturing the pluripotent stem cells in the presence of activin A.
  • the pluripotent stem cell for use as the starting material may be any undifferentiated cell possessing a "self-renewal” that enables it to proliferate while retaining the undifferentiated state, and "pluripotency” that enables it to differentiate into all the three primary germ layers of the embryo. Examples include iPS cells, ES cells, embryonic germ (EG) cells, embryonic cancer (EC) cells and the like, with preference given to iPS cells or ES cells.
  • the method of the present invention is applicable to any mammalian species for which any pluripotent stem cell line has been established or can be established.
  • mice examples include humans, mice, rats, monkeys, dogs, pigs, bovines, cats, goat, sheep, rabbits, guinea pigs, hamsters and the like, with preference given to humans, mice, rats, monkeys, dogs and the like, more preferably humans or mice.
  • Pluripotent stem cells can be acquired by methods known per se.
  • available methods of preparing ES cells include, but are not limited to, methods in which a mammalian inner cell mass in the blastocyst stage is cultured [see, for example, Manipulating the Mouse Embryo: A Laboratory Manual,
  • ES cells can be obtained from various public and private depositories and are commercially available.
  • human ES cell lines HI and H9 can be obtained from WiCell Institute of University of Wisconsin and KhES-1, -2 and - 3 can be obtained from Institute for Frontier Medical Sciences, Kyoto University.
  • KhES-1, -2 and - 3 can be obtained from Institute for Frontier Medical Sciences, Kyoto University.
  • An iPS cell can be prepared by transferring a nuclear reprogramming substance to a somatic cell.
  • Any cells other than germ cells of mammalian origin e.g., mice, humans
  • Any cells other than germ cells of mammalian origin e.g., mice, humans
  • Examples include keratinizing
  • epithelial cells e.g., keratinized epidermal cells
  • mucosal epithelial cells e.g., epithelial cells of the superficial layer of tongue
  • exocrine gland epithelial cells e.g., mammary gland cells
  • hormone-secreting cells e.g., adrenomedullary cells
  • cells for metabolism or storage e.g., liver cells
  • intimal epithelial cells constituting interfaces e.g., type I alveolar cells
  • intimal epithelial cells of the obturator canal e.g., vascular endothelial cells
  • cells having cilia with transporting capability e.g., airway epithelial cells
  • cells for extracellular matrix secretion e.g., fibroblasts
  • constrictive cells e.g., smooth muscle cells
  • cells of the blood and the immune system e.g., T lymphocytes
  • sense-related cells e.g., bacillary cells
  • autonomic nervous system neurons e.g., cholinergic neurons
  • sustentacular cells of sensory organs and peripheral neurons e.g., satellite cells
  • nerve cells and glia cells of the central nervous system e.g., astroglia cells
  • pigment cells e.g., retinal pigment
  • tissue progenitor cells such as adipose-derived stromal (stem) cells, nerve stem cells, hematopoietic stem cells, mesenchymal stem cells, and dental pulp stem cells.
  • somatic cells are patient's own cells or collected from another person having the same or substantially the same HLA type as that of the patient.
  • Substantially the same HLA type means that the HLA type of donor matches with that of patient to the extent that the transplanted cells, which have been obtained by inducing differentiation of iPS cells derived from the donor's somatic cells, can be engrafted when they are transplanted to the patient with use of immunosuppressor and the like.
  • it includes an HLA type wherein major HLAs (the three major loci of HLA-A, HLA-B and HLA-DR or four loci further including HLA-Cw) are identical (hereinafter the same meaning shall apply) and the like.
  • major HLAs the three major loci of HLA-A, HLA-B and HLA-DR or four loci further including HLA-Cw
  • the PGC-like cells are not to be administered (transplanted) to a human, but used as, for example, a source of cells for screening for evaluating a patient's drug susceptibility or adverse reactions, it is
  • Somatic cells separated from a mammal can be pre-cultured using a medium known per se suitable for the cultivation thereof, depending on the kind of the cells.
  • a medium known per se suitable for the cultivation thereof include, but are not limited to, a minimal essential medium
  • MEM fetal calf serum
  • DMEM Dulbecco's modified Eagle medium
  • RPMI1640 199 medium
  • F12 medium F12 medium
  • a transfection reagent such as a cationic liposome in contacting the cell with nuclear reprogramming substance (s) and iPS cell establishment efficiency improver (s)
  • the medium be previously replaced with a serum-free medium to
  • the nuclear reprogramming substance refers to any substance (s) capable of inducing an iPS cell from a somatic cell, which may be composed of any substance such as a proteinous factor or a nucleic acid that encodes the same (including forms incorporated in a vector) , or a low- molecular compound.
  • the nuclear reprogramming substance is a proteinous factor or a nucleic acid that encodes the same, the following combinations, for example, are preferable (hereinafter, only the names for proteinous factors are shown) .
  • Oct3/4 may be replaced with another member of the Oct family, for example, OctlA, Oct6 or the like.
  • Sox2 (or Soxl, Sox3, Soxl5, Soxl7, Soxl8) may be replaced with another member of the Sox family, for example, Sox7 or the like.
  • Lin28 may be replaced with another member of the
  • Lin family for example, Lin28b or the like.
  • nuclear reprogramming substances any combination that does not fall in (1) to (24) above but comprises all the constituents of any one of (1) to (24) above and further comprises an optionally chosen other substance can also be included in the scope of "nuclear reprogramming substances" in the present invention.
  • somatic cell to undergo nuclear reprogramming is endogenously expressing one or more of the constituents of any one of (1) to (24) above at a level sufficient to cause nuclear reprogramming, a
  • nuclear reprogramming substances in the present invention.
  • a combination of at least one, preferably two or more, more preferably three or more, selected from among Oct3/4, Sox2, Klf4, c-Myc, Nanog, Lin28 and SV40LT, is a preferable nuclear reprogramming substance.
  • the iPS cells obtained are to be used for therapeutic purposes, a combination of the three factors Oct3/4, Sox2 and Klf4 [combination (9) above] are preferably used.
  • the four factors Oct3/4, Sox2, Klf4 and c-Myc, or the five factors Oct3/4, Klf4, c-Myc, Sox2 and Lin28, or the six factors consisting of the five factors and Nanog [combination (12) above] or the seven factors consisting of the six factors and SV40 Large T
  • a proteinous factor for use as a nuclear reprogramming substance can be prepared by inserting the cDNA obtained into an appropriate expression vector, introducing the vector into a host cell, and recovering the recombinant proteinous factor from the cultured cell or its conditioned medium. Meanwhile, when the nuclear reprogramming substance used is a nucleic acid that encodes a proteinous factor, the cDNA obtained is inserted into a viral vector, plasmid vector, episomal vector etc. to
  • Transfer of a nuclear reprogramming substance to a somatic cell can be achieved using a method known per se for protein transfer into a cell, provided that the substance is a
  • the starting material iPS cell be also prepared without gene manipulation.
  • Such methods include, for example, the method using a protein transfer reagent, the method using a protein transfer domain (PTD)- or cell penetrating peptide (CPP)- fusion protein, the microinjection method and the like.
  • Protein transfer reagents are commercially available, including those based on a cationic lipid, such as BioPOTER Protein Delivery Reagent (Gene Therapy Systems) , Pro-JectTM Protein Transfection Reagent
  • Nuclear reprogramming substance (s) is (are) diluted in an appropriate solvent (e.g., a buffer solution such as PBS or HEPES) , a transfer reagent is added, the mixture is incubated at room temperature for about 5 to 15 minutes to form a complex, this complex is added to cells after exchanging the medium with a serum-free medium, and the cells are incubated at 37°C for one to several hours. Thereafter, the medium is removed and replaced with a serum-containing medium.
  • an appropriate solvent e.g., a buffer solution such as PBS or HEPES
  • Developed PTDs include those using transcellular domains of proteins such as drosophila-derived AntP, HIV-derived TAT (Frankel, A. et al, Cell 55, 1189-93 (1988) or Green, M. &
  • Transportan (Pooga, M. et al. FASEB J. 12, 6 ⁇ - ⁇ (1998)), MAP (model amphipathic peptide) (Oehlke, J. et al. Biochim. Biophys. Acta. 1414, 127-39 (1998)), K-FGF (Lin, Y. Z. et al. J. Biol.
  • CPPs derived from the PTDs include polyarginines such as 11R (Cell Stem Cell, 4,381-384 (2009)) and 9R (Cell Stem Cell, 4, 472-476 (2009)).
  • a fused protein expression vector incorporating cDNA of a nuclear reprogramming substance and PTD or CPP sequence is prepared, and recombination expression is performed using the vector.
  • the fused protein is recovered and used for transfer. Transfer can be performed in the same manner as above except that a protein transfer reagent is not added.
  • Microinjection a method of placing a protein solution in a glass needle having a tip diameter of about 1 um, and
  • injecting the solution into a cell ensures the transfer of the protein into the cell.
  • nuclear reprogramming substance may also be used preferably in the form of a nucleic acid that encodes a proteinous factor, rather than the factor as it is.
  • the nucleic acid may be a DNA or an RNA, or a DNA/RNA chimera, and may be double-stranded or single-stranded.
  • the nucleic acid is a double-stranded DNA, particularly a cDNA.
  • a cDNA of a nuclear reprogramming substance is inserted into an appropriate expression vector comprising a promoter capable of functioning in a host somatic cell.
  • expression vectors include, for example, viral vectors such as retrovirus, lentivirus, adenovirus, adeno-associated virus, herpesvirus and Sendai virus, plasmids for the expression in animal cells (e.g., pAl-11, pXTl, pRc/CMV, pRc/RSV, pcDNAI/Neo) and the like.
  • viral vectors such as retrovirus, lentivirus, adenovirus, adeno-associated virus, herpesvirus and Sendai virus
  • plasmids for the expression in animal cells e.g., pAl-11, pXTl, pRc/CMV, pRc/RSV, pcDNAI/Neo
  • a vector for this purpose can be chosen as appropriate according to the intended use of the iPS cell to be obtained.
  • Useful vectors include adenovirus vector, plasmid vector, adeno- associated virus vector, retrovirus vector, lentivirus vector, Sendai virus vector, episomal vector and the like.
  • promoters used in expression vectors include the EFla promoter, the CAG promoter, the SRa promoter, the SV40 promoter, the LTR promoter, the CMV (cytomegalovirus) promoter, the RSV (Rous sarcoma virus) promoter, the MoMuLV (Moloney mouse leukemia virus) LTR, the HSV-TK (herpes simplex virus thymidine kinase) promoter and the like, with preference given to the EFla promoter, the CAG promoter, the MoMuLV LTR, the CMV promoter, the SRa promoter and the like.
  • the expression vector may contain as desired, in addition to a promoter, an enhancer, a polyadenylation signal, a
  • selectable marker gene a SV40 replication origin and the like.
  • selectable marker genes include the dihydrofolate reductase gene, the neomycin resistant gene, the puromycin resistant gene and the like.
  • nucleic acids as nuclear reprogramming substances may be separately integrated into
  • an expression vector incorporating two kinds or more of genes and another expression vector incorporating one gene alone can be used in combination.
  • genes when a plurality of genes are incorporated in one expression vector, these genes can be incorporated in one expression vector.
  • intervening sequence enabling polycistronic expression By using an intervening sequence enabling polycistronic expression, it is possible to more efficiently express a plurality of genes incorporated in one kind of expression vector.
  • Useful sequences enabling polycistronic expression include, for example, the 2A sequence of foot-and-mouth disease virus ⁇ PLoS ONE 3, e2532, 2008, Stem Cells 25, 1707, 2007), IRES sequence (U.S. Patent No. 4,937,190) and the like, with preference given to the 2A
  • An expression vector harboring a nucleic acid as a nuclear reprogramming substance can be introduced into a cell by a technique known per se according to the choice of the vector.
  • a viral vector for example, a plasmid containing the nucleic acid is introduced into an appropriate packaging cell (e.g., Plat-E cells) or a complementary cell line (e.g., 293-cells) , the viral vector produced in the culture supernatant is recovered, and the vector is infected to the cell by a method suitable for the viral vector.
  • an appropriate packaging cell e.g., Plat-E cells
  • a complementary cell line e.g., 293-cells
  • specific means using a retroviral vector are disclosed in WO2007/69666, Cell, 126, 663-676 (2006) and Cell, 131, 861-872 (2007) .
  • Specific means using a lentivirus vector is disclosed in Science, 318, 1917-1920 (2007).
  • a nucleic acid encoding a nuclear reprogramming substance is preferably expressed transiently, without being integrated into the chromosome of the cells.
  • an adenoviral vector whose integration into chromosome is rare, is preferred. Specific means using an adenoviral vector is disclosed in Science, 322, 945-949 (2008) . Because an adeno-associated viral vector is also low in the frequency of integration into chromosome, and is lower than adenoviral vectors in terms of cytotoxicity and inflammation- inducibility, it can be mentioned as another preferred vector. Because Sendai viral vector is capable of being stably present outside the chromosome, and can be degraded and removed using an siR A as required, it is preferably utilized as well. Regarding a Sendai viral vector, one described in J. Biol. Chem., 282, 27383-27391 (2007) and JP-3602058 B can be used.
  • a retroviral vector or a lentiviral vector when used, even if silencing of the transgene has occurred, it possibly becomes reactivated; therefore, for example, a method can be used preferably wherein a nucleic acid encoding a nuclear reprogramming substance is cut out using the Cre-loxP system, when becoming unnecessary. That is, with loxP sequences
  • the Cre recombinase is allowed to act on the cells using a plasmid vector or adenoviral vector, and the region sandwiched by the loxP sequences can be cut out. Because the enhancer-promoter sequence of the LTR U3 region possibly upregulates a host gene in the vicinity thereof by insertion mutation, it is more preferable to avoid the expression
  • a plasmid vector can be transferred into a cell using the lipofection method
  • liposome method liposome method, electroporation method, calcium phosphate co- precipitation method, DEAE dextran method, microinjection method, gene gun method and the like.
  • Specific means using a plasmid as a vector are described in, for example, Science, 322, 949-953 (2008) and the like.
  • the transfection can be performed once or more plasmid vector, an adenovirus vector and the like.
  • optionally chosen times e.g., once to 10 times, once to 5 times or the like.
  • the transfection can be performed once or more optionally chosen times (e.g., once to 10 times, once to 5 times or the like) , preferably the
  • transfection can be repeatedly performed twice or more (e.g., 3 times or 4 times) .
  • transgene can get integrated into chromosome; therefore, it is eventually necessary to confirm the absence of insertion of the gene into chromosome by Southern blotting or PCR. For this reason, like the aforementioned Cre-loxP system, it can be advantageous to use a means wherein the transgene is integrated into chromosome, thereafter the gene is removed.
  • a method can be used wherein the transgene is integrated into chromosome using a transposon, thereafter a transposase is allowed to act on the cell using a plasmid vector or adenoviral vector so as to completely
  • transposons As examples of preferable transposons, piggyBac, a transposon derived from a lepidopterous insect, and the like can be mentioned. Specific means using the piggyBac transposon is disclosed in Kaji, K. et al., Nature, 458: 771-775 (2009), Woltjen et al., Nature, 458: 766-770 (2009).
  • Another preferred non-recombination type vector is an episomal vector autonomously replicable outside the chromosome.
  • a specific procedure for using an episomal vector is disclosed by Yu et al. in Science, 324, 797-801 (2009).
  • an expression vector may be constructed by inserting a
  • the episomal vector examples include vectors comprising a sequence required for its autonomous replication, derived from EBV, SV40 and the like, as a vector element.
  • the vector element required for its autonomous replication is a replication origin or a gene that encodes a protein that binds to the replication origin to regulate its replication; examples include the replication origin oriP and EBNA-1 gene for EBV, and the replication origin ori and SV40 large T antigen gene for SV40.
  • the episomal expression vector contains a promoter that controls the transcription of the reprogramming gene.
  • the promoter used can be the same promoter as the above.
  • the episomal expression vector may further comprise an enhancer, poly-A addition signal, selection marker gene and the like as desired, as described above. Examples of selection marker gene include the dihydrofolate reductase gene, neomycin resistance gene and the like.
  • An episomal vector can be introduced into a cell using, for example, lipofection method, liposome method,
  • electroporation method calcium phosphate co-precipitation method, DEAE dextran method, microin ection method, gene gun method and the like. Specifically, the method described in Science, 324: 797-801 (2009) , for example, can be used.
  • Whether or not the vector element required for replication of reprogramming gene has been removed from the iPS cell can be determined by performing Southern blot analysis or PCR analysis using a part of the vector as a probe or primer, with an episome fraction isolated from the iPS cell as the template, to examine for the presence or absence of a band or the length of the band detected.
  • An episome fraction can be prepared using a method well known in the art, for example, the method described in Science, 324: 797-801 (2009) .
  • the nuclear reprogramming substance is a low- molecular compound
  • introduction thereof into a somatic cell can be achieved by dissolving the substance at an appropriate concentration in an aqueous or non-aqueous solvent, adding the solution to a medium suitable for cultivation of somatic cells isolated from human or mouse [e.g., minimal essential medium (MEM) comprising about 5 to 20% fetal bovine serum, Dulbecco' s modified Eagle medium (DMEM) , RPMI1640 medium, 199 medium, F12 medium, and the like] so that the nuclear reprogramming
  • MEM minimal essential medium
  • DMEM Dulbecco' s modified Eagle medium
  • the nuclear reprogramming substance concentration will fall in a range that is sufficient to cause nuclear reprogramming in somatic cells and does not cause cytotoxicity, and culturing the cells for a given period.
  • the nuclear reprogramming substance concentration varies depending on the kind of nuclear reprogramming substance used, and is chosen as appropriate over the range of about 0.1 nM to about 100 nM. Duration of contact is not particularly limited, as far as it is sufficient to cause nuclear reprogramming of the cells; usually, the nuclear reprogramming substance may be allowed to be co-present in the medium until a positive colony emerges .
  • establishment efficiency improvers are expected to further raise the efficiency of establishment of iPS cells.
  • siR As and shRNAs against HDAC e.g., HDAC1 siRNA Smartpool ® (Millipore)
  • methyltransferase inhibitors e.g., low-molecular inhibitors such as BIX-01294 (Cell Stem Cell, 2: 525-528 (2008)), nucleic acid-based expression inhibitors such as siRNAs and shRNAs against G9a (e.g., G9a siRNA (human) (Santa Cruz Biotechnology) and the like) and the like], L-channel calcium agonists (e.g., Bayk8644) [Cell Stem Cell, 3, 568-574 (2008)], p53 inhibitors
  • low-molecular inhibitors such as BIX-01294 (Cell Stem Cell, 2: 525-528 (2008)
  • nucleic acid-based expression inhibitors such as siRNAs and shRNAs against G9a (e.g., G9a siRNA (human) (Santa Cruz Biotechnology) and the like) and the like
  • L-channel calcium agonists e.g., Bayk8644 [Cell Stem Cell, 3, 568-574 (2008)
  • nucleic acid-based expression inhibitors may be in the form of expression vectors harboring a DNA that encodes an siR A or shRA.
  • SV40 large T and the like can also be included in the scope of iPS cell establishment efficiency improvers because they are deemed not essential, but auxiliary, factors for somatic cell nuclear reprogramming.
  • iPS cell establishment efficiency improvers because they are deemed not essential, but auxiliary, factors for somatic cell nuclear reprogramming.
  • nuclear reprogramming substances considered as nuclear reprogramming substances or iPS cell establishment efficiency improvers.
  • somatic cell nuclear reprogramming process is understood as an overall event resulting from contact of nuclear reprogramming
  • contact of an iPS cell establishment efficiency improver with a somatic cell can be achieved as described above for each of three cases: (a) the improver is a proteinous factor, (b) the improver is a nucleic acid that encodes the proteinous factor, and (c) the improver is a low-molecular compound.
  • An iPS cell establishment efficiency improver may be brought into contact with a somatic cell simultaneously with a nuclear reprogramming substance, or either one may be contacted in advance, as far as the efficiency of establishment of iPS cells from the somatic cell is significantly improved, compared with the absence of the improver.
  • the nuclear reprogramming substance is a nucleic acid that encodes a proteinous factor
  • the iPS cell establishment efficiency improver is a chemical inhibitor
  • the establishment efficiency improver can be added to the medium after the cell is cultured for a given length of time after the gene transfer treatment, because the nuclear reprogramming substance involves a given length of time lag from the gene transfer treatment to the mass-expression of the proteinous factor, whereas the iPS cell establishment efficiency improver is capable of rapidly acting on the cell.
  • the nuclear reprogramming substance and an iPS cell when a nuclear reprogramming substance and an iPS cell
  • establishment efficiency improver are both used in the form of a viral or plasmid vector, for example, both may be simultaneously introduced into the cell.
  • hypoxic conditions means that the oxygen concentration in the ambient atmosphere during cell culture is significantly lower than that in the air.
  • such conditions include lower oxygen
  • the oxygen concentration in the ambient atmosphere is 15% or less (e.g., 14% or less, 13% or less, 12% or less, 11% or less and the like), 10% or less (e.g., 9% or less, 8% or less, 7% or less, 6% or less and the like), or 5% or less (e.g., 4% or less, 3% or less, 2% or less and the like) .
  • the oxygen concentration in the ambient atmosphere is preferably 0.1% or more (e.g., 0.2% or more, 0.3% or more, 0.4% or more and the like), 0.5% or more (e.g., 0.6% or more, 0.7% or more, 0.8% or more, 0.9% or more and the like), or 1% or more (e.g., 1.1% or more, 1.2% or more, 1.3% or more, 1.4% or more and the like).
  • C0 2 incubators are commercially available from a number of manufacturers of equipment (e.g., C0 2 incubators for hypoxic culture manufactured by Thermo Scientific, Ikemoto Scientific Technology, Juji Field Inc., and Wakenyaku Co., Ltd. can be used) .
  • conditions is not particularly limited, as far as it does not interfere with improving the efficiency of establishment of iPS cells compared with that obtained at a normal oxygen
  • the starting time may be before or after contact of nuclear reprogramming substances with a somatic cell, and may be at the same time as the contact. For example, it is preferable that cell culture under hypoxic conditions be begun just after contacting a nuclear reprogramming substance with a somatic cell, or after a given time (e.g., 1 to 10 (e.g., 2, 3, 4, 5, 6, 7, 8 or 9) days) following the contact.
  • a given time e.g., 1 to 10 (e.g., 2, 3, 4, 5, 6, 7, 8 or 9) days
  • the duration of cell culture under hypoxic conditions is not particularly limited, as far as it does not interfere with improving the efficiency of establishment of iPS cells compared with that obtained at a normal oxygen concentration (20%) ;
  • examples include, but are not limited to, between 3 days or more, 5 days or more, 7 days or more or 10 days or more, and 50 days or less, 40 days or less, 35 days or less or 30 days or less.
  • the preferred duration of cell culture under hypoxic conditions also varies depending on the oxygen concentration in the ambient atmosphere; those skilled in the art can adjust as appropriate the duration of cell culture according to the oxygen
  • the preferred starting time and duration of cell culture under hypoxic conditions also vary depending on the choice of nuclear reprogramming substances used, the efficiency of establishment of iPS cells under conditions involving a normal oxygen concentration, and other factors.
  • the nuclear reprogramming substance (s) and iPS cell establishment efficiency improver (s)) is (are) brought into contact with the cell
  • the cell can be cultured under conditions suitable for the cultivation of, for example, ES cells.
  • the cultivation is carried out with the addition of Leukemia Inhibitory Factor (LIF) as a
  • bFGF basic fibroblast growth factor
  • SCF stem cell factor
  • the cells are cultured in the co- presence of mouse embryo-derived fibroblasts (MEFs) treated with radiation or an antibiotic to terminate the cell division thereof, as feeder cells.
  • MEFs mouse embryo-derived fibroblasts
  • STO cells and the like are commonly used as MEFs, but for inducing iPS cells, SNL cells
  • Co-culture with feeder cells may be started before contact of the nuclear reprogramming substance, at the time of the contact, or after the contact (e.g., 1-10 days later) .
  • a candidate colony of iPS cells can be selected by a method with drug resistance and reporter activity as indicators, and also by a method based on visual examination of morphology.
  • resistance and/or reporter activity is selected using a
  • pluripotent cells e.g., Fbxl5, Nanog, Oct3/4 and the like, preferably Nanog or Oct3/4 .
  • pluripotent cells e.g., Fbxl5, Nanog, Oct3/4 and the like, preferably Nanog or Oct3/4 .
  • recombinant somatic cells include MEFs from a mouse having the Pgeo (which encodes a fusion protein of ⁇ -galactosidase and neomycin phosphotransferase) gene knocked-in to the Fbxl5 locus [Takahashi & Yamanaka, Cell, 126, 663-676 (2006)], MEFs from a transgenic mouse having the green fluorescent protein (GFP) gene and the puromycin resistance gene integrated in the Nanog locus [Okita et al., Nature, 448, 313-317 (2007)] and the like.
  • GFP green fluorescent protein
  • examples of the method of selecting candidate colonies based on visual examination of morphology include the method described by Takahashi et al. in Cell, 131, 861-872 (2007) .
  • the method using reporter cells is convenient and efficient, it is desirable from the viewpoint of safety that colonies be selected by visual examination when iPS cells are prepared for the purpose of human treatment.
  • the three factors Oct3/4, Klf4 and Sox2 are used as nuclear reprogramming substances, the number of clones established decreases but the resulting colonies are mostly of iPS cells of high quality comparable to ES cells, so that iPS cells can efficiently be established even without using reporter cells.
  • the identity of the cells of a selected colony as iPS cells can be confirmed by positive responses to a Nanog (or Oct3/4) reporter (puromycin resistance, GFP positivity and the like) as well as by the formation of a visible ES cell-like colony, as described above.
  • a Nanog or Oct3/4 reporter
  • puromycin resistance or GFP positivity and the like
  • pluripotent stem cells can exit in two functionally distinct states, LIF-dependent ES cells and bFGF-dependent epiblast stem cells (EpiSCs) .
  • EpiSCs bFGF-dependent epiblast stem cells
  • human ES and iPS cells in a mouse ES cell-like pluripotent state have been established by ectopic induction of Oct3/4, Sox2, Klf4, c-Myc and Nanog in the presence of LIF (see Cell Stem Cells, 6: 535-546, 2010), or ectopic induction of Oct3/4, Klf4 and Klf2 combined with LIF and inhibitors of GSK3P and ERK1/2 pathway (see Proc. Natl. Acad. Sci. USA, online publication doi/10.1073/pnas.1004584107) .
  • naive human ES and iPS cells may be prefarable starting materials for the present invention due to their pluripotent more immature compared to that of conventional human ES and iPS cells.
  • Basal media for differentiation induction include, but are not limited to, Neurobasal medium, Neural Progenitor Basal medium, NS-A medium, BME medium, BGJb medium, CMRL 1066 medium, minimal essential medium (MEM), Eagle MEM, aMEM, Dulbecco's modified Eagle medium (DMEM) , Glasgow MEM, Improved MEM Zinc Option medium, IMDM medium, 199 medium, DMEM/F12 medium, Ham's medium N RPMI1640 medium, Fischer's medium, and mixtures thereof.
  • MEM minimal essential medium
  • DMEM Dulbecco's modified Eagle medium
  • IMDM medium IMDM medium
  • 199 medium 199 medium
  • DMEM/F12 medium Ham's medium N RPMI1640 medium
  • Fischer's medium and mixtures thereof.
  • the medium can be a serum-containing or serum-free medium.
  • a serum-free medium can be used.
  • the serum-free medium refers to media with no unprocessed or unpurified serum and accordingly, can include media with purified blood- derived components or animal tissue-derived components (such as growth factors) .
  • the concentration of serum for example, fetal bovine serum (FBS) , human serum, etc.
  • FBS fetal bovine serum
  • human serum etc.
  • the concentration of serum can be 0-20%, preferably 0-5%, more preferably 0-2%, most preferably 0% (i.e., serum- free) .
  • the SFM may contain or may not contain any alternatives to serum.
  • the alternatives to serum can include materials which appropriately contain albumin (such as lipid-rich albumin, albumin substitutes such as recombinant albumin, plant starch, dextrans and protein hydrolysates) , transferrin (or other iron transporters), fatty acids, insulin, collagen precursors, trace elements, 2-mercaptoethanol, 3' thiolglycerol, or equivalents thereto.
  • albumin such as lipid-rich albumin, albumin substitutes such as recombinant albumin, plant starch, dextrans and protein hydrolysates
  • transferrin or other iron transporters
  • fatty acids insulin
  • collagen precursors such as recombinant albumin, plant starch, dextrans and protein hydrolysates
  • transferrin or other iron transporters
  • fatty acids such as lipid-rich albumin, albumin substitutes such as recombinant albumin, plant starch, dextrans and protein hydrolysates
  • transferrin or other iron transporters
  • fatty acids such as lipid-rich
  • the medium can also contain other additives known per se.
  • the additive is not subject to limitation, as long as EpiLCs equivalent to pre-gastrulating epiblast cells can be produced by the method of the present invention; for example, growth factors (for example, insulin and the like), polyamines (for example, putrescine and the like) , minerals (for example, sodium selenate and the like), saccharides (for example, glucose and the like), organic acids (for example, pyruvic acid, lactic acid and the like), amino acids (for example, non-essential amino acids
  • NEAA L-glutamine and the like
  • reducing agents for example, 2-mercaptoethanol and the like
  • vitamins for example, ascorbic acid, d-biotin and the like
  • steroids for example, [beta]- estradiol, progesterone and the like
  • antibiotics for example, streptomycin, penicillin, gentamycin and the like
  • buffering agents for example, HEPES and the like
  • nutritive additives for example, B27 supplement, N2 supplement, StemPro-Nutrient Supplement and the like
  • each of the additives be contained in a
  • pluripotent stem cells may be cultured in the presence or absence of feeder cells.
  • the feeder cells are not subject to limitation, as long as EpiLCs can be produced by the method of the present invention; feeder cells known per se for use in culturing pluripotent stem cells such as ESCs and iPSCs can be used; for example, fibroblasts (mouse embryonic fibroblasts, mouse fibroblast cell line STO and the like) can be mentioned.
  • the feeder cells are preferably inactivated by a method known per se, for example, radiation (gamma rays and the like) , treatment with an anticancer agent (mitomycin C and the like) and the like.
  • pluripotent stem cells are cultured under feeder-free conditions.
  • the medium for inducing differentiation from pluripotent stem cells to EpiLCs contains activin A as an essential additive in the basal medium.
  • the activin A concentration is, for example, about 5 ng/ml or more, preferably about 10 ng/ml or more, more preferably about 15 ng/ml or more, and is, for example, about 40 ng/ml or less, preferably about 30 ng/ml or less, more preferably 25 ng/ml or less.
  • the medium A preferably further contains bFGF and/or KSR.
  • Basic FGF and KSR remarkably increase the induction efficiency for EpiLCs when present in a range of effective concentrations.
  • the bFGF concentration is, for example, about 5 ng/ml or more, preferably about 7.5 ng/ml or more, more preferably about 10 ng/ml or more, and is, for example, about 30 ng/ml or less, preferably about 20 ng/ml or less, more preferably about 15 ng/ml or less.
  • the KSR concentration is, for example, about 0.1 w/w% or more, preferably about 0.3 w/w% or more, more preferably about 0.5 w/w% or more, and is, for example, about 5 w/w% or less, preferably about 3 w/w% or less, more preferably about 2 w/w% or less.
  • the medium A contains activin A, bFGF and KSR in addition to the basal medium.
  • concentrations of these ingredients can be chosen over the range of about 10-30 ng/ml, preferably 15-25 ng/ml for activin A, about 7.5-20 ng/ml, preferably about 10-15 ng/ml for bFGF, and about 0.3-3 w/w%, preferably about 0.5-2 w/w% for KSR.
  • the activin A and bFGF contained in the medium A are not subject to limitation as to the source thereof, may be isolated and purified from cells of any mammals (for example, human, mouse, monkey, swine, rat, dog and the like) . It is preferable to use activin A and bFGF homologous to the pluripotent stem cells subjected to the culture.
  • the activin A and bFGF may also be chemically synthesized or biochemically synthesized using a cell-free translation system, or produced from a transformant bearing a nucleic acid encoding each of the proteins.
  • the recombinant products of activin A and bFGF are commercially available .
  • a culture vessel used for inducing pluripotent stem cells into EpiLCs can include, but is particularly not limited to, flask, flask for tissue culture, dish, petri dish, dish for tissue culture, multi dish, micro plate, micro-well plate, multi plate, multi-well plate, micro slide, chamber slide, schale, tube, tray, culture bag, and roller bottle.
  • the culture vessel can be cellular adhesive.
  • the cellular adhesive culture vessel can be coated with any of substrates for cell adhesion such as extracellular matrix (ECM) to improve the adhesiveness of the vessel surface to the cells.
  • the substrate for cell adhesion can be any material intended to attach pluripotent stem cells or feeder cells (if used) .
  • the substrate for cell adhesion can be any material intended to attach pluripotent stem cells or feeder cells (if used) .
  • collagen includes collagen, gelatin, poly-L-lysine, poly-D-lysine, poly- L-ornithine, laminin, and fibronectin and mixtures thereof for example Matrigel, and lysed cell membrane preparations
  • pluripotent stem cells are plated onto the culture vessel mentioned above to obtain a cell density of, for example, about 10-10 5 cells/cm 2 , preferably about 2 to 8 x 10 4 cells/cm 2 , and cultured in an incubator under atmospheric conditions of 1-10% CO 2 /99-90% air at about 30-40°C, preferably about 37°C, for less than 3 days, preferably about 2 days (e.g., 48 ⁇ 12 hours, preferably 48 ⁇ 6 hours) .
  • a cell density for example, about 10-10 5 cells/cm 2 , preferably about 2 to 8 x 10 4 cells/cm 2 , and cultured in an incubator under atmospheric conditions of 1-10% CO 2 /99-90% air at about 30-40°C, preferably about 37°C, for less than 3 days, preferably about 2 days (e.g., 48 ⁇ 12 hours, preferably 48 ⁇ 6 hours) .
  • a result of the culture cells with flattened epiblast-like structure uniformly emerged.
  • the fact of differentiation into EpiLCs can be confirmed by, for example, analyzing the expression levels of EPiLC- and/or pluripotent stem cell-marker genes using RT-PCR.
  • the EpiLC of the present invention means a cell in E5.5-E6.0
  • the EpiLC is defined as a cell having either or both of the following properties:
  • the EpiLC of the present invention has the following properties:
  • the medium A of the present invention contains activin A, bFGF and KSR.
  • the present invention also provides a reagent kit for inducing the differentiation from pluripotent stem cells to EpiLCs comprising activin A, bFGF and KSR.
  • These ingredients may be supplied in a state dissolved in water or an appropriate buffer solution, and may also be supplied as a lyophilized powder which may be used after being freshly dissolved in an appropriate solvent.
  • These ingredients may be supplied as individual reagents in respective kits, and, as far as they do not adversely affect each other, they can be supplied as a single mixed reagent of 2 kinds or more.
  • EpiLCs having properties equivalent to pre- gastrulating epiblast cells for the first time. Since epiblasts are also progenitors of somatic cell lineages other than germ cell lineage, thus-obtained EpiLCs can be used as a starting cell material for inducing not only germ cell lineage but also other various cell lineages. They would also be useful for the investigation of the genetic and epigenetic mechanism underlying the ICM to epiblast differentiation, which is a critical but less understood subject in pluripotent cell biology. Derivation of EpiLCs from ESCs or iPSCs as an intermediate for specific lineages is a very straightforward process, and provides a novel strategy for in vitro reconstruction of lineage specification.
  • a second aspect of the present invention relates to a method of producing PGC- like cells from pluripotent stem cells through EpiLCs obtained by the method of (2) above. Namely, the method comprises:
  • step II the step for culturing the EpiLC obtained in the step I) in the presence of BMP4 and LIF.
  • the basal media exemplified for the use in the step I) are likewise preferably used.
  • the medium may contain the same additives as those exemplified for the use in the step I) , as long as PGC-like cells capable of contributing to normal spermatogenesis can be produced by the method of the present invention.
  • the medium can be a serum-containing or serum-free medium (SFM) .
  • SFM serum-free medium
  • concentration of serum for example, fetal bovine serum (FBS) , human serum, etc.
  • FBS fetal bovine serum
  • human serum etc.
  • concentration of serum can be 0-20%, preferably 0-5%, more
  • the SFM may contain or may not contain any alternatives to serum such as KSR.
  • the medium for inducing differentiation from EpiLCs to PGC-like cells contains bone morphogenetic protein 4 (BMP4) and leukemia inhibitory factor (LIF) as an essential additive in the basal medium.
  • BMP4 bone morphogenetic protein 4
  • LIF leukemia inhibitory factor
  • concentration of B P4 is, for example, about 100 ng/ml or more, preferably about 200 ng/ml or more, more preferably about 300 ng/ml or more. Also, the concentration of B P4 is, for example, about 100 ng/ml or more, preferably about 200 ng/ml or more, more preferably about 300 ng/ml or more. Also, the
  • concentration of BMP4 is, for example, about 1,000 ng/ml or less, preferably about 800 ng/ml or less, more preferably 600 ng/ml or less.
  • concentration of LIF is, for example, about 300 U/ml or more, preferably about 500 U/ml or more, more preferably about 800 U/ml or more.
  • concentration of LIF is, for example, about 2,000 U/ml or less, preferably about 1,500 U/ml or less, more preferably 1,200 U/ml or less.
  • the medium B preferably further contains at least one additive (s) selected from stem cell factor (SCF) , bone
  • BMP8b morphogenetic protein 8b
  • EGF epidermal growth factor
  • concentrations are, for example, about 30 ng/ml or more, preferably about 50 ng/ml or more, more
  • the concentration of SCF is, for example, about 200 ng/ml or less, preferably about 150 ng/ml or less, more preferably about 120 ng/ml or less.
  • the concentration of BMP8b is, for example, about 100 ng/ml or more, preferably about 200 ng/ml or more, more preferably about 300 ng/ml or more.
  • the concentration of BMP8b is, for example, about 1,000 ng/ml or less, preferably about 800 ng/ml or less, more preferably 600 ng/ml or less.
  • the concentration of EGF is, for example, about 10 ng/ml or more, preferably about 20 ng/ml or more, more preferably about 30 ng/ml or more. Also, the concentration of EGF is, for example, about 100 ng/ml or less, preferably about 80 ng/ml or less, more preferably about 60 ng/ml .
  • the medium B contains BMP, LIF, SCF, BMP8b and EGF in addition to the basal medium.
  • concentrations of these ingredients can be chosen as appropriate over the ranges of about 200-800 ng/ml,
  • the BMP4, LIF, SCF, B P8b and EGF contained in the medium B are not subject to limitation as to the source thereof, may be isolated and purified from cells of any mammals (for example, human, mouse, monkey, swine, rat, dog and the like) . It is preferable to use BMP4, LIF, SCF, BMP8b and EGF homologous to the EpiLCs subjected to the culture.
  • the BMP4, LIF, SCF, BMP8b and EGF may also be chemically synthesized or biochemically synthesized using a cell-free translation system, or produced from a transformant bearing a nucleic acid encoding each of the proteins.
  • the recombinant products of BMP4, LIF, SCF, BMP8b and EGF are commercially available.
  • EpiLCs are seeded to a cellular non- adhesive or low-adhesive culture vessel known per se to obtain a cell density of, for example, about 3 to lOxlO 4 cells/mL, preferably about 4 to 8xl0 4 cells/mL, and cultured in an
  • incubator in an atmosphere of 1-10% CO 2 /99-90% air at about 30- 40°C, preferably about 37°C, for about 4-10 days, preferably 4-8 days, more preferably about 6 days (e.g., 144 ⁇ 12 hours,
  • the fact of differentiation into PGC-like cells can be confirmed by, for example, analyzing the expression of Blimpl by RT-PCR and the like. As required, furthermore, the expression of other genes and cell surface antigens can also be examined. Examples of other genes include Stella. When pluripotent stem cells bearing fluorescent protein genes under the control of Blimpl- and/or Stella-promoters are used as a starting material, the fact of differentiation into PGC-like cells can be confirmed by FACS analysis.
  • the pluripotent stem cells bear no appropriate transgenic reporter, such as ESCs or iPSCs derived from human or other non-mouse mammals, it is preferable to confirm the fact of differentiation into PGC-like cells by FACS analysis and the like using one or more cell surface antigens specifically expressed on PGC-like cells.
  • the cell surface antigens preferably SSEA-1 and integrin ⁇ 3 are exemplified.
  • the medium B of the present invention contains BMP4, LIF, SCF, BMP8b and EGF. Accordingly, the present invention also provides a reagent kit for inducing the differentiation from EpiLCs to PGC-like cells comprising BMP4, LIF, SCF, BMP8b and EGF.
  • ingredients may be supplied in a state dissolved in water or an appropriate buffer solution, and may also be supplied as a lyophilized powder which may be used after being freshly
  • ingredients may be supplied as individual reagents in respective kits, and, as far as they do not adversely affect each other, they can be supplied as a single mixed reagent of 2 kinds or more.
  • the present invention also provides a cell population containing PGC-like cells derived from pluripotent stem cells, produced by the foregoing steps I) and II) .
  • the cell population may be a purified population of PGC-like cells, and 1 kind or more of cells other than PGC-like cells may be co-present.
  • PGC-like cell is defined as a cell that shows elevated
  • the PGC-like cells can also be isolated and purified by FACS using a reporter under the control of gene whose expression increases along with Blimpl and Stella (e.g., Nanog) as a marker.
  • Blimpl and Stella e.g., Nanog
  • the cell population containing PGC-like cells of the present invention is a cell population derived from iPSCs or ESCs.
  • the iPSCs have been produced by, for example, transferring reprogramming gene(s) to somatic cells by means of a retroviral vector or lentiviral vector, the reprogramming gene(s) are integrated in the genome of the cells; therefore, the PGC-like cells derived from the iPSCs also have the
  • a reprogramming gene to be integrated in the genome of PGC-like cells is a nucleic acid that encodes one of the nuclear reprogramming substances described above with respect to preparing iPSCs, preferably 3 genes consisting of Oct3/4, Sox2, and Klf4, or 4 genes
  • the PGC-like cells derived from pluripotent stem cells thus established can be used for varied purposes. For example, since the PGC-like cells transplanted into a testis of a recipient animal can robustly contribute to spermatogenesis in the testis and the generation of healthy offspring, they can be used for the treatment of infertility or hereditary diseases of reproductive tissues.
  • the transplantation of the PGC-like cells into a testis can be performed by using the PGC-like cells in place of germlime stem cells (GS cells) in the methods disclosed in WO 2004/092357 and Biol. Reprod. , 69: 612-616 (2003).
  • GS cells germlime stem cells
  • the PGC-like cells can be cultured in the same manner as WO 2004/092357 and Biol. Reprod. (2003), supra to induce differentiation into GS cells, then transplanted into a testis .
  • the PGC-like cells (including a cell population containing PGC-like cells; the same applies below) of the present invention are produced as a parenteral preparation, preferably as an injection, suspension, or drip infusion, in a mixture with a pharmaceutically acceptable carrier, by a conventional means.
  • Examples of the pharmaceutically acceptable carrier that can be contained in the parenteral preparation include aqueous liquids for injection, such as physiological saline and isotonic
  • the agent of the present invention may be formulated with, for example, a buffering agent (e.g., phosphate buffer solution, sodium acetate buffer solution), a soothing agent (e.g., benzalkonium chloride, procaine hydrochloride and the like), a stabilizer (e.g., human serum albumin, polyethylene glycol and the like) , a preservative, an anti-oxidant and the like.
  • a buffering agent e.g., phosphate buffer solution, sodium acetate buffer solution
  • a soothing agent e.g., benzalkonium chloride, procaine hydrochloride and the like
  • a stabilizer e.g., human serum albumin, polyethylene glycol and the like
  • the agent of the present invention is prepared as an aqueous suspension
  • PGC-like cells are suspended in one of the aforementioned aqueous liquids to obtain a cell density of about ⁇ . ⁇ ⁇ ⁇ 6 to about 1.0*10 7 cells/ml.
  • the agent of the present invention can be cryopreserved under conditions typically used for the cryopreservation of stem cells, and thawed immediately before use.
  • the preparation thus obtained is stable and less toxic, it can be safely administered to mammals such as humans.
  • the method of administration is not particularly limited
  • the preparation is preferably administered by injection or drip infusion into a seminiferous tubule.
  • a male for a male
  • infertility patient for example, it is usually convenient to administer the agent in an amount of about 1.0*10 5 to about 1*10 7 cells, based on the amount of PGC-like cells per dose, once or 2-10 times at about 1- to 2-week intervals.
  • the present invention is the first demonstration of an in vitro reconstruction of germ-cell specification pathway from inner cell mass (ICM) .
  • ICM inner cell mass
  • mice The BVSC and P14V transgenic mice were reported previously and maintained on a largely C57BL/6 background (Nat Genet 40, 1016-1022 (2008); Reproduction 136, 503-514 (2008)). All the animal experiments were performed under the ethical guidelines of Kyoto University.
  • the ESCs were derived in N2B27 medium (a 1:1 mixture of DME /F12 supplemented with N2 and Neurobasal supplemented with B27) [Nat Biotechnol 21, 183-186, doi : 10.1038/nbt780 ) with 2i and LIF on mouse embryonic feeder cells [Nature 453, 519-523, doi:nature06968 [pii] 10.1038/nature06968 (2008)).
  • BMP8b 500 ng/ml; R&D Systems
  • EGF 50 ng/ml; R&D Systems
  • SFM SFM
  • GMEM Invitrogen
  • dissection microscope equipped with a DP72 camera (Olympus) or an Axiovert200 inverted fluorescent microscope equipped with an AxioCamMRm camera (Zeiss) .
  • Dnmt3b CTCGCAAGGTGTGGGCTTTTGTAAC (33) CTGGGCATCTGTCATCTTTGCACC (34) c-Myc AAGGAGAACGGTTCCTTCTGAC (35) GCTGAAGCTTACAGTCCCAAAG (36)
  • Soxl 7 TTCTGTACACTTTAATGAGGCTGTTC (65) TTGTGGGAAGTGGGATCAAG (66)
  • Igf2r TTAGTGGGGTATTTTTATTTGTATGG (71) AAATATCCTAAAAATACAAACTACAC (72)
  • Kcnqlotl nest TAGAAGTAGGGGTGG7TTTGAGG 1 1 1 1 1 1 1 IG (84) CCACAACATAAATAACTATATTAAAAMTCA (85)
  • Alexa Fluor 488 anti-rabbit IgG Alexa Fluor 568 anti-rabbit, or -rat
  • Alexa Fluor 633 anti-mouse IgG all of these are goat polyclonal
  • FACS fluorescence Activated Cell Sorting
  • ROSA mice [B6;129S- Gt (ROSA) 26Sor/J (stock number: 002073) ] ⁇ Genes Dev 5, 1513-1523 (1991) ) were purchased from the Jackson Laboratory.
  • the W/f mice (WB*C57BL/6) were purchased from SLC (Shizuoka, Japan) .
  • embryonic day (E) 0.5 designated as embryonic day (E) 0.5.
  • the blastocysts bearing the BVSC and ROSA transgenes were flushed out from the uterus at E3.5 and placed and cultured in a well of a 96-well plate in N2B27 medium (a 1:1 mixture of
  • the EpiSCs were derived from E5.75 epiblasts on MEFs in N2B27 medium containing activin A (20 ng/ml; Peprotech) , bFGF (12 ng/ml; Invitrogen), and KSR (20%; Invitrogen).
  • the cells were passaged every 3 days by dissociating with collagenase IV (1 mg/ml; Invitrogen) as cell clumps, and the cells bearing the typical morphology of EpiSCs were established after around 10 passages .
  • the EpiLCs were induced by plating 1.0*10 5 ESCs on a well of a 12-well plate coated with human plasma fibronectin (16.7 ⁇ g/ml; Millipore) in N2B27 medium containing activin A (20 ng/ml; Peprotech), bFGF (12 ng/ml; Invitrogen), and KSR (1%;
  • the medium was changed every day.
  • the PGC-like cells were induced in a floating condition by plating 1.0*10 3 EpiLCs in a well of a low-cell-binding U-bottom 96-well plate (NUNC) in serum-free medium [SFM; GMEM (Invitrogen) with 15% KSR, 0.1 mM NEAA, 1 mM sodium pyruvate, 0.1 mM 2-mercaptoethanol, 100 U/ml penicillin, 0.1 mg/ml streptomycin, and 2 mM L-glutamine] in the presence of the cytokines BMP4 (500 ng/ml; R&D Systems) , LIF (1000 U/ml; Invitrogen) , SCF (100 ng/ml; R&D Systems), BMP8b (500 ng/ml; R&D Systems), and EGF (50 ng/ml; R&D Systems).
  • the induced PGC-like cells were dissociated with TrypLE
  • RNAs from the isolated E5.75 epiblasts, ESCs, EpiLCs, and the FACS-sorted PGC-like and non-PGC-like cells were:
  • RNAs were reverse-transcribed by Superscript III
  • RNAs from approximately 500 ESCs, d2 EpiLCs, EpiSCs, E5.75 epiblasts, PGC-like cells, and E9.5 PGCs were amplified as described previously (Nucleic Acids Res 34, e42
  • Genomic DNAs were isolated from ESCs, the FACS-sorted PGC- like cells, tails of the offspring derived from the PGC-like cells, and tails of the wild-type mice, and bisulfite reactions were performed using an EpiTect Bisulfite Kit (QIAGEN) .
  • PCR amplification of differentially methylated regions of Igf2r, Snrpn, HI9, and Kcnqlotl was carried out using the primer sets and conditions described previously (Genomics 79, 530-538
  • Genotyping of the BVSC transgenes was performed as described previously (Reproduction 136, 503-514 (2008); Nature 448, 313-317 (2007); Cell 126, 663-676 (2006)) (Table 1).
  • the primary antibodies used were as follows: anti-Oct3/4 (mouse monoclonal; BD Bioscience), anti-Sox2 (rabbit polyclonal; Santa Cruz), anti-Nanog (rat monoclonal; eBioscience) , anti-H3K9me2 (rabbit polyclonal; Upstate) , anti-H3H27me3 (rabbit polyclonal; Upstate) , and anti-Dnmt3b (mouse monoclonal; Abeam) .
  • anti-Oct3/4 mouse monoclonal; BD Bioscience
  • anti-Sox2 rabbit polyclonal; Santa Cruz
  • anti-Nanog rat monoclonal; eBioscience
  • anti-H3K9me2 rabbit polyclonal; Upstate
  • anti-H3H27me3 rabbit polyclonal; Upstate
  • anti-Dnmt3b mouse monoclonal; Abeam
  • secondary antibodies used were as follows: Alexa Fluor 488 anti- rabbt IgG, Alexa Fluor 568 anti-rabbit, or -rat, or -mouse IgG, Alexa Fluor 633 anti-mouse IgG (all of these are goat
  • a BrdU labeling and detection kit (Roche) was used. Aggregates induced for PGC- like cells for 4 days were incubated with 10 ⁇ of BrdU for 6 hours. After the incubation, aggregates were dissociated by TrypLE treatment, spread on a slide glass by Cytospin4 (Thermo Scientific) , fixed with 70% EtOH in 50 mM glycine, and washed with PBS. The cells were then incubated with anti-BrdU and anti-GFP, followed by Alexa Fluor 568 anti-mouse IgG and Alexa 488 anti-rat IgG. Immunofluorescence images were obtained by a confocal microscope (Olympus FV1000) .
  • Recipient animals [neonatal (7- to 9-day old) W/i mice lacking endogenous spermatogenesis (J Exp Zool 134, 207-237 (1957)) from a WB*C57BL/6 Fl background (SLC) ] were induced into hypothermic anaesthesia on ice, and the donor cell suspension [the whole-cell dissociates or the FACS-sorted BV- positive cells ( ⁇ 2 ⁇ ) (Table 3) ] was injected into the efferent duct of each testis ⁇ Int J Dev Biol 41, 111-122 (1997)).
  • the recipient animals were returned to their littermates after surgery and analyzed after 10 weeks.
  • the spermatozoa derived from the induced PGC-like cells were prepared from the seminiferous tubules of recipient testis at 10 weeks after transplantation. Briefly, seminiferous tubules were isolated from the recipient testis and those with dark central areas corresponding to spermiation or with GFP fluorescence from the Aero/Act-EGFP transgenes were located under a dissection microscope. These tubules were minced gently with scissors and dissociated to obtain the spermatogenic cell suspension. The cell suspension was kept at 4°C until ICSI. The ICSI was performed essentially as described previously ⁇ Biol Reprod 52, 709-720 (1995)).
  • the male iPSCs (MEF-Ng-20D-17 : Nature 448, 313-317 (2007); MEF-Ng-178B-5: Nat Biotechnol 26, 101-106 (2008); MEF-Ng-492B-4 : Science 322, 949-953 (2008)) were obtained from RIKEN BRC.
  • the iPSCs were maintained in N2B27 medium (a 1:1 mixture of DMEM/F12 supplemented with N2 and Neurobasal supplemented with B27) with 2i (PD0325901, 0.4 u ; Stemgent; CHIR99021, 3 ⁇ ; Stemgent) and LIF (1000 U/ml) on a dish coated with poly-L-ornithine (0.01%; Sigma) and Laminin (10 ng/ml, BD Biosciences) .
  • N2B27 medium a 1:1 mixture of DMEM/F12 supplemented with N2 and Neurobasal supplemented with B27
  • 2i PD0325901, 0.4 u ; Stemgent; CHIR99021, 3 ⁇ ; Stemgent
  • LIF 1000 U/ml
  • dish coated with poly-L-ornithine 0.01%; Sigma
  • Laminin 10 ng/ml, BD Biosciences
  • EpiLCs and PGC-like cells from iPSCs were performed in the same manner as 3. above.
  • the EpiLCs and PGC- like cells induced were analyzed in the same manner as 5. above.
  • Example 1 Pre-gastrulating epiblast-like cells (EpiLCs) from ESCs
  • C57BL/6 background were derived and maintained in N2B27 medium with an inhibitor against MAPK signalling (PD0325901, 0.4 ⁇ ) , an inhibitor against GSK3 (CHIR99021, 3 ⁇ ) , and LIF (1000 U/ml) [2i+LIF] , a condition that keeps ESCs in the ⁇ E3.5-E4.5
  • FIG. 1C To examine the properties of the EpiLCs more precisely, we compared the expression of a number of markers between the EpiLCs and the isolated epiblasts at E5.75 by quantitative (Q)-PCR. In good agreement with the reporter gene expression and immunofluorescence analysis, during the course of EpiLC differentiation, Oct3/4 was expressed at a relatively constant level, whereas genes more tightly associated with the ICM state, such as Sox2, Nanog, and Prdml4, as well as Zfp42 [Rexl) , Tbx3, Tell, Esrrb, Klf2, Klf4, and Klf5, were down-regulated to levels similar to those in the epiblasts (FIG. IE) .
  • Sox2, Nanog, and Prdml4 as well as Zfp42 [Rexl) , Tbx3, Tell, Esrrb, Klf2, Klf4, and Klf5
  • FACS fluorescence-activated cell sorting
  • BV- or BVSC-negative cells retained/regained relatively high levels of Oct3/4, Sox2, and Nanog, and up- regulated germ-cell-specific genes to some extent (FIG. 2E) .
  • RNAs from ESCs dl/2/3 EpiLCs, EpiSCs, E5.75 epiblasts, BVSC-positive PGC-like cells at day 6 of induction, and stella-EGFP (+) PGCs at E9.5 ⁇ Genesis 44, 75-83 (2006) ) .
  • Unsupervised hierarchical clustering (UHC) of non- amplified samples showed that two independent samples from ESCs, dl/2/3 EpiLCs, EpiSCs, and PGC-like cells were clustered tightly together (FIG. llA(a)), reflecting the reproducibility of the PGC-like cell induction.
  • Principal component analysis (PCA) provided ESCs, dl, d2, and d3 EpiLCs with PC2 scores of
  • BVSC(+) cells at days 4/6 were enriched in the G2 phase, whereas BV(-) cells exhibited profiles similar to those of cycling somatic cells, especially at days 4/6 (FIG. 3C(b)). Consistently, PGC-like cells did not incorporate BrdU
  • spermatogenesis by transplanting them into the seminiferous tubules of W/W neonatal mice lacking endogenous germ cells (Development 132, 117-122 (2005)).
  • the cell's ability to contribute to spermatogenesis is the most stringent index of whether it has become a male germ cell (Cold Spring Harb Symp Quant Biol 73, 17-23, doi : sqb.2008.73.033
  • testes dissociated single cells from the entire aggregates or the BV- positive cells sorted by FACS, and evaluated the recipient testes after 10 weeks. All the testes (8/8 and 6/6)
  • the testes transplanted with the FACS-sorted BV-positive cells did not show teratoma formation. Instead, remarkably, three out of six testes harboured
  • the transplanted seminiferous tubules contained dark central sections apparently corresponding to spermiation, and these tubules were much thicker than those without spermatogenesis (FIG. 4A(a) and Table 3) . Examination of the inside of the thick tubules indeed revealed the presence of abundant spermatogenesis
  • AAG ESCs Non-sorted cells 6 2.4x10* 6/6 (100) N. D. N.D.
  • Integrin- V, CXCR4, and KIT Integrin- V, CXCR4, and KIT
  • Integrin-p3 they were divided into three major sub-populations [PI (SSEA1 high, Integrin- 3 high), P2 (SSEA1 high, Integrin- 3 low) , and P3 (SSEA1 low, Integrin ⁇ 3 high/low) ] . Notably, more than 99% of the cells in PI were BV(+), whereas only 1.2% and 1.7% of the cells in P2 and P3, respectively, contained BV(+) cells (FIG. 13A) , indicating that PI is nearly identical to the BV(+) population.
  • Example 7 PGC-like cell induction from iPSCs through EpiLCs, spermatogenesis and offspring from PGC-like cells
  • EpiLCs and PGC-like cells were induced from iPSCs in the same manner as Examples 1 and 2, and characterized by
  • iPS178B-5 (Nat Biotechnol 26, 101-106 (2008)) produced by the introduction of 3 genes (Oct3/4, Sox2, Klf4) and iPS492B-4 (Science 322, 949-953 (2008)) and 20D17 (Nature 448, 313-317 (2007)) produced by the introduction of 4 genes (Oct3/4, Sox2, Klf4, c-Myc) , all bearing Nanog-EGFP (NG) transgenes, were used. The results of analyses are shown in FIG. 9. Likewise in the case of ESCs, the
  • EpiLCs derived from iPSCs were induced into PGC-like cells, as in the case of those derived from ESCs.
  • the EpiLCs were cultured under the "full induction conditions" (in SFM containing BMP4, LIF, SCF, BMP8b and EGF) for 6 days. Cell aggregates expanded along with the PGC-like cell induction as in the case of ESC-derived EpiLCs . Nanog-positive cells were detected in the peripheral zone of cell aggregates on day 6 of the cultivation, as in the case of BVSC-positive cells when inducing differentiation of ESC-derived EpiLCs into PGC-like cells (FIG. 9A-9C, (b) ) .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Chemical & Material Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Reproductive Health (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/JP2011/067816 2010-08-13 2011-07-28 Method of inducing differentiation from pluripotent stem cells to germ cells Ceased WO2012020687A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP11816353.4A EP2603583B1 (en) 2010-08-13 2011-07-28 Method of inducing differentiation from pluripotent stem cells to germ cells
JP2013506973A JP5892661B2 (ja) 2010-08-13 2011-07-28 多能性幹細胞から生殖細胞への分化誘導方法
US13/816,681 US9938496B2 (en) 2010-08-13 2011-07-28 Method of inducing differentiation from pluripotent stem cells to germ cells

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US37356310P 2010-08-13 2010-08-13
US61/373,563 2010-08-13

Publications (1)

Publication Number Publication Date
WO2012020687A1 true WO2012020687A1 (en) 2012-02-16

Family

ID=45567656

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2011/067816 Ceased WO2012020687A1 (en) 2010-08-13 2011-07-28 Method of inducing differentiation from pluripotent stem cells to germ cells

Country Status (4)

Country Link
US (1) US9938496B2 (https=)
EP (1) EP2603583B1 (https=)
JP (1) JP5892661B2 (https=)
WO (1) WO2012020687A1 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014133194A1 (en) * 2013-03-01 2014-09-04 Kyoto University Method of inducing differentiation from pluripotent stem cells to germ cells
WO2014141210A3 (en) * 2013-03-15 2015-04-30 Avita International Ltd. Multifunctional immature dental pulp stem cells and therapeutic applications
US11207352B2 (en) 2013-03-15 2021-12-28 Avita International Ltd. Compositions comprising stem cells expressing mesenchymal and neuronal markers and uses thereof to treat neurological disease

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9828634B2 (en) 2015-01-22 2017-11-28 Regenerative Medical Solutions, Inc. Markers for differentiation of stem cells into differentiated cell populations
US10563171B2 (en) 2015-06-29 2020-02-18 Kyoto University Method for inducing differentiation of pluripotent stem cells into germ cells
WO2018225802A1 (ja) * 2017-06-07 2018-12-13 国立大学法人京都大学 多能性幹細胞から生殖系列幹細胞様細胞への分化誘導方法
JP7302865B2 (ja) * 2019-09-12 2023-07-04 株式会社Dioseve 未成熟卵母細胞の誘導方法及び成熟卵母細胞の作製方法
EP4346395A4 (en) * 2021-05-28 2025-04-23 ABS Global, Inc. In vitro breeding systems and methods in livestock

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4937190A (en) 1987-10-15 1990-06-26 Wisconsin Alumni Research Foundation Translation enhancer
WO1998030679A1 (en) 1997-01-10 1998-07-16 Life Technologies, Inc. Embryonic stem cell serum replacement
WO2004092357A1 (ja) 2003-04-15 2004-10-28 Kyoto University 精子幹細胞の生体外における増殖方法、その方法を利用して増殖された精子幹細胞、および精子幹細胞の生体外増殖に用いられる培地添加剤キット
WO2007069666A1 (ja) 2005-12-13 2007-06-21 Kyoto University 核初期化因子
WO2008118820A2 (en) 2007-03-23 2008-10-02 Wisconsin Alumni Research Foundation Somatic cell reprogramming

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0622395D0 (en) 2006-11-09 2006-12-20 Univ Cambridge Tech Methods relating to pluripotent cells
EP2169051B1 (en) 2007-05-30 2016-02-10 Kumamoto University Method for induction of differentiation of es cell
US10023838B2 (en) 2013-03-01 2018-07-17 Kyoto University Method of inducing differentiation from pluripotent stem cells to germ cells

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4937190A (en) 1987-10-15 1990-06-26 Wisconsin Alumni Research Foundation Translation enhancer
WO1998030679A1 (en) 1997-01-10 1998-07-16 Life Technologies, Inc. Embryonic stem cell serum replacement
WO2004092357A1 (ja) 2003-04-15 2004-10-28 Kyoto University 精子幹細胞の生体外における増殖方法、その方法を利用して増殖された精子幹細胞、および精子幹細胞の生体外増殖に用いられる培地添加剤キット
WO2007069666A1 (ja) 2005-12-13 2007-06-21 Kyoto University 核初期化因子
WO2008118820A2 (en) 2007-03-23 2008-10-02 Wisconsin Alumni Research Foundation Somatic cell reprogramming

Non-Patent Citations (40)

* Cited by examiner, † Cited by third party
Title
"Manipulating the Mouse Embryo: A Laboratory Manual", 1994, COLD SPRING HARBOR LABORATORY PRESS
BAGUISI ET AL., NATURE BIOTECHNOLOGY, vol. 17, 1999, pages 456
BIOL. REPROD., 2003
BIOL. REPROD., vol. 69, 2003, pages 612 - 616
BRONS,I.G. ET AL.: "Derivation of pluripotent epiblast stem cells from mammalian embryos.", NATURE, vol. 448, no. 7150, 27 June 2007 (2007-06-27), pages 191 - 195, XP002472620 *
CELL RESEARCH, 2008, pages 600 - 603
CELL STEM CELL, vol. 2, 2008, pages 525 - 528
CELL, vol. 126, 2006, pages 663 - 676
CELL, vol. 131, 2007, pages 861 - 872
CELL, vol. 137, 2009, pages 571 - 584
CIBELLI ET AL., SCIENCE, vol. 280, 1998, pages 1256
HAYASHI K. ET AL.: "Reconstitution of the mouse germ cell specification pathway in culture by pluripotent stem cells.", CELL, vol. 146, no. 4, 19 August 2011 (2011-08-19), pages 519 - 532, XP028383021 *
HAYASHI K. ET AL.: "Self-renewing epiblast stem cells exhibit continual delineation of germ cells with epigenetic reprogramming in vitro.", DEVELOPMENT, vol. 136, no. 21, November 2009 (2009-11-01), pages 3549 - 3556, XP055095616 *
IRITANI ET AL., PROTEIN, NUCLEIC ACID AND ENZYME, vol. 44, 1999, pages 892
JAMES D. ET AL.: "TGFbeta/activin/nodal signaling is necessary for the maintenance of pluripotency in human embryonic stem cells", DEVELOPMENT, vol. 132, no. 6, March 2005 (2005-03-01), pages 1273 - 1282, XP003015121 *
NAT BIOTECHNOL, vol. 21, pages 183 - 186
NAT GENET, vol. 40, 2008, pages 1016 - 1022
NAT. CELL BIOL., vol. 11, 2009, pages 197 - 203
NATURE BIOTECHNOLOGY, vol. 26, 2008, pages 101 - 106
NATURE, vol. 448, 2007, pages 313 - 317
NATURE, vol. 451, 2008, pages 141 - 146
NATURE, vol. 453, 2008, pages 519 - 523
NATURE, vol. 454, 2008, pages 646 - 650
NAYERNIA K. ET AL.: "In vitro-differentiated embryonic stem cells give rise to male gametes that can generate offspring mice.", DEV. CELL, vol. 11, no. 1, July 2006 (2006-07-01), pages 125 - 132, XP055095618 *
OHINATA Y. ET AL.: "A signaling principle for the specification of the germ cell lineage in mice.", CELL, vol. 137, no. 3, 1 May 2009 (2009-05-01), pages 571 - 584, XP055095613 *
PEARSON S. ET AL.: "The stepwise specification of embryonic stem cells to hematopoietic fate is driven by sequential exposure to Bmp4, activin A, bFGF and VEGF", DEVELOPMENT, vol. 135, no. 8, April 2008 (2008-04-01), pages 1525 - 1535, XP008092701 *
PLOS ONE, vol. 3, 2008, pages E2532
PROC. NATL. ACAD. SCI. USA
REPRODUCTION, vol. 136, 2008, pages 503 - 514
RIDEOUTIII ET AL., NATURE GENETICS, vol. 24, 2000, pages 109
SCIENCE, vol. 318, 2007, pages 1917 - 1920
SCIENCE, vol. 324, 2009, pages 797 - 801
See also references of EP2603583A4
STEM CELLS, vol. 25, 2007, pages 1707
STEM CELLS, vol. 26, 2008, pages 1998 - 2005
TESAR P.J. ET AL.: "New cell lines from mouse epiblast share defining features with human embryonic stem cells.", NATURE, vol. 448, no. 7150, 27 June 2007 (2007-06-27), pages 196 - 199, XP008135572 *
WAKAYAMA ET AL., NATURE GENETICS, vol. 22, 1999, pages 127
WAKAYAMA ET AL., NATURE, vol. 394, 1998, pages 369
WAKAYAMA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 96, 1999, pages 14984
WILMUT ET AL., NATURE, vol. 385, 1997, pages 810

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014133194A1 (en) * 2013-03-01 2014-09-04 Kyoto University Method of inducing differentiation from pluripotent stem cells to germ cells
JP2016508365A (ja) * 2013-03-01 2016-03-22 国立大学法人京都大学 多能性幹細胞から生殖細胞への分化誘導方法
US10023838B2 (en) 2013-03-01 2018-07-17 Kyoto University Method of inducing differentiation from pluripotent stem cells to germ cells
WO2014141210A3 (en) * 2013-03-15 2015-04-30 Avita International Ltd. Multifunctional immature dental pulp stem cells and therapeutic applications
US9790468B2 (en) 2013-03-15 2017-10-17 Avita Iinternational Ltd. Multifunctional immature dental pulp stem cells and therapeutic applications
US11207352B2 (en) 2013-03-15 2021-12-28 Avita International Ltd. Compositions comprising stem cells expressing mesenchymal and neuronal markers and uses thereof to treat neurological disease

Also Published As

Publication number Publication date
JP5892661B2 (ja) 2016-03-23
US20130143321A1 (en) 2013-06-06
EP2603583B1 (en) 2016-10-05
EP2603583A4 (en) 2014-04-16
US9938496B2 (en) 2018-04-10
EP2603583A1 (en) 2013-06-19
JP2013538038A (ja) 2013-10-10

Similar Documents

Publication Publication Date Title
JP7089298B2 (ja) 多能性幹細胞から生殖細胞への分化誘導方法
US9528092B2 (en) Methods of efficiently establishing induced pluripotent stem cells under hypoxic conditions
EP2603583B1 (en) Method of inducing differentiation from pluripotent stem cells to germ cells
JP7079017B2 (ja) 多能性幹細胞から生殖系列幹細胞様細胞への分化誘導方法
JP7307481B2 (ja) 始原生殖細胞/始原生殖細胞様細胞の維持増幅及び分化誘導方法
US10023838B2 (en) Method of inducing differentiation from pluripotent stem cells to germ cells
WO2013062140A1 (en) Method for efficiently inducing differentiation of pluripotent stem cells into hepatic lineage cells
US8709805B2 (en) Canine iPS cells and method of producing same
US20150252330A1 (en) Method of efficiently establishing induced pluripotent stem cells
WO2011111588A1 (en) Method of inducing the differentiation of germline stem cells, method of expanding the cells, and culture media therefor
CN116761882A (zh) 诱导性干细胞
Rasmussen et al. Embryonic stem cells in the pig: characterization and differentiation into neural cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11816353

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2013506973

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2011816353

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2011816353

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 13816681

Country of ref document: US