WO2011160055A2 - Hair follicle neogenesis - Google Patents
Hair follicle neogenesis Download PDFInfo
- Publication number
- WO2011160055A2 WO2011160055A2 PCT/US2011/040937 US2011040937W WO2011160055A2 WO 2011160055 A2 WO2011160055 A2 WO 2011160055A2 US 2011040937 W US2011040937 W US 2011040937W WO 2011160055 A2 WO2011160055 A2 WO 2011160055A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- tsc2
- skin
- tsc1
- function
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
- A61L27/38—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
- A61L27/3886—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells comprising two or more cell types
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/36—Skin; Hair; Nails; Sebaceous glands; Cerumen; Epidermis; Epithelial cells; Keratinocytes; Langerhans cells; Ectodermal cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/14—Macromolecular materials
- A61L27/22—Polypeptides or derivatives thereof, e.g. degradation products
- A61L27/24—Collagen
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
- A61L27/38—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
- A61L27/3804—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells characterised by specific cells or progenitors thereof, e.g. fibroblasts, connective tissue cells, kidney cells
- A61L27/3813—Epithelial cells, e.g. keratinocytes, urothelial cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/36—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix
- A61L27/38—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells
- A61L27/3804—Materials for grafts or prostheses or for coating grafts or prostheses containing ingredients of undetermined constitution or reaction products thereof, e.g. transplant tissue, natural bone, extracellular matrix containing added animal cells characterised by specific cells or progenitors thereof, e.g. fibroblasts, connective tissue cells, kidney cells
- A61L27/3834—Cells able to produce different cell types, e.g. hematopoietic stem cells, mesenchymal stem cells, marrow stromal cells, embryonic stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/50—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
- A61L27/60—Materials for use in artificial skin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/14—Drugs for dermatological disorders for baldness or alopecia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0625—Epidermal cells, skin cells; Cells of the oral mucosa
- C12N5/0627—Hair cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0697—Artificial constructs associating cells of different lineages, e.g. tissue equivalents
- C12N5/0698—Skin equivalents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61F—FILTERS IMPLANTABLE INTO BLOOD VESSELS; PROSTHESES; DEVICES PROVIDING PATENCY TO, OR PREVENTING COLLAPSING OF, TUBULAR STRUCTURES OF THE BODY, e.g. STENTS; ORTHOPAEDIC, NURSING OR CONTRACEPTIVE DEVICES; FOMENTATION; TREATMENT OR PROTECTION OF EYES OR EARS; BANDAGES, DRESSINGS OR ABSORBENT PADS; FIRST-AID KITS
- A61F2/00—Filters implantable into blood vessels; Prostheses, i.e. artificial substitutes or replacements for parts of the body; Appliances for connecting them with the body; Devices providing patency to, or preventing collapsing of, tubular structures of the body, e.g. stents
- A61F2/02—Prostheses implantable into the body
- A61F2/10—Hair or skin implants
- A61F2/105—Skin implants, e.g. artificial skin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2430/00—Materials or treatment for tissue regeneration
- A61L2430/18—Materials or treatment for tissue regeneration for hair reconstruction
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/04—Immunosuppressors, e.g. cyclosporin, tacrolimus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/998—Proteins not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/09—Coculture with; Conditioned medium produced by epidermal cells, skin cells, oral mucosa cells
- C12N2502/092—Coculture with; Conditioned medium produced by epidermal cells, skin cells, oral mucosa cells hair cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/09—Coculture with; Conditioned medium produced by epidermal cells, skin cells, oral mucosa cells
- C12N2502/094—Coculture with; Conditioned medium produced by epidermal cells, skin cells, oral mucosa cells keratinocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
- C12N2502/1323—Adult fibroblasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/30—Coculture with; Conditioned medium produced by tumour cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2533/00—Supports or coatings for cell culture, characterised by material
- C12N2533/70—Polysaccharides
- C12N2533/78—Cellulose
Definitions
- the present invention relates to skin substitutes capable of inducing fully-formed human hair follicles.
- the present invention also relates to methods and compositions for inducing neogenesis of human hair follicles.
- the present invention can be used for the treatment of full- or partial- thickness skin loss, wounds, burns, scars, and full- or partial-hair loss.
- compositions but generally comprise a nonliving collagen matrix and different combinations of keratinocytes and fibroblasts.
- APLIGRAF ® APLIGRAF ®
- hair follicle neogenesis is not observed using any currently available skin substitute, which limits their use in patients.
- Hair follicles and their associated sebaceous glands are important for appearance, skin hydration, barrier formation, and protection against pathogens.
- hair follicles store epidermal stem cells that may be called upon during wound healing.
- skin with hair follicles heals more rapidly than skin without hair follicles.
- any stem cells that might exist in skin lacking hair follicles are located in superficial layers of the epidermis, making the cells susceptible to loss through minor trauma and damage through ultraviolet light.
- treatments that involve neogenesis of normal hair follicles would find much wider application for restoring normal skin function and appearance.
- Surgical options typically involve harvesting tissue comprising hair follicles from one part of the body and transplanting the follicles to a site where hair has been lost.
- neither approach triggers hair follicle neogenesis. Instead, both of these approaches require existing hair follicles in the skin, which limits their applicability in certain patients.
- DP and DP cells have been isolated from mice and rats, combined with epithelial cells, and grafted or injected into animals to induce hair follicle neogenesis.
- human cells have proven much less robust than rodent cells in inducing hair follicles, and complicated experimental systems have been devised to facilitate human hair follicle formation. These systems include chamber assays, subcutaneous injection assays, and sandwich and flap-graft assays.
- Hair follicle-like structures were formed using chimeric constructs of murine mesenchymal cells and human epidermal cells in a chamber assay (see Ehama et al., J. Invest. Dermatol. , 127:2106-15 (2007)), and DP cells from adult human scalp were shown to induce hair follicles in mouse embryonic epidermis using a flap-graft model (see Qiao et al., Regen. Med., 4:667-76 (2009)).
- a recent comparison of the chamber assay and sandwich assay showed equal utility for screening the hair follicle-inducing capabilities of human DP cells. (See Inoue et al., Cells Tissues Organs, 190:120-10 (2009).)
- keratinocytes to form hair follicles has been reported (Ehama et al.), it has not been possible to generate human hair follicles using cultured adult human fibroblasts, even when dermal papilla/dermal sheath cells (which are specialized for hair induction) were used.
- the invention provides a skin substitute comprising epithelial cells and modified mesenchymal cells, wherein the modified mesenchymal cells have decreased TSC1/TSC2 function, increased mTORCI function, and/or decreased mTORC2 function compared to wild type mesenchymal cells.
- the invention also provides a method for transplanting cells capable of inducing human hair follicles.
- the method comprises subdermally or intradermal ⁇ delivering to a patient modified mesenchymal cells having decreased TSC1/TSC2 function, increased mTORCI function, and/or decreased mTORC2 function compared to wild-type mesenchymal cells.
- the method further comprises delivering epithelial cells to the patient.
- the method comprises grafting to a patient a skin substitute of the invention.
- the patient has partial-thickness skin loss, full- thickness skin loss, a wound, a burn, a scar, or hair loss.
- the method induces formation of eccrine glands.
- the method induces formation of sebaceous glands.
- the TSC1 TSC2 function has been decreased, either directly, or indirectly because the function of at least one negative regulator of TSC1/TSC2 has been increased (such as by upregulating a protein that inhibits TSC1/TSC2 function), and/or the function of at least one positive regulator of TSC1/TSC2 has been decreased (such as by downregulating a protein that stimulates TSC1 TSC2 function) compared to wild type mesenchymal cells.
- the function of mTORCI has been increased, the function of mTORC2 has been decreased, or both, through mimetics of decreased
- TSC1/TSC2 function.
- the function of TSC1/TSC2 is decreased, the function of mTORCI is increased and/or the function of mTORC2 is decreased by downregulating TSC1 or TSC2; upregulating an inhibitory protein that inhibits TSC1 TSC2 function or acts as a mimetic of decreased TSC1/TSC2 function; or downregulating a stimulatory protein that stimulates TSC1/TSC2 function or acts as a mimetic of increased TSC1 TSC2 function.
- the stimulatory protein is chosen from at least one of TSC1 , TSC2, CYLD, LKB1 , FLCN, MEN1 , NF1 , PTEN, PRAS40, 4E-BP1 , GSK3, and Deptor.
- the inhibitory protein is chosen from at least one of Ras, Raf, Mek, Erk, Rsk1 , PI3K, Akt , Akt2, Akt3, Rheb, mTOR, Raptor, Rictor, ml_ST8, S6K1 , ribosomal protein S6, SKAR, SREBP1 , elF4e, IKKbeta, Myc, Runxl , and p27.
- TSC2 is downregulated.
- FLCN is down regulated.
- both TSC2 and FLCN are downregulated.
- the modified mesenchymal cells are from benign adnexal tumors.
- the modified mesenchymal cells are from angiofibromas, fibrofolliculomas, fibrous papules, forehead plaques, hair follicle nevi, infundibulomas, isthmicomas, perifollicular fibromas, sebaceous nevi, organoid nevi, syringomas, shagreen patches, trichodiscomas,
- the modified mesenchymal cells are from tumors associated with Birt-Hogg-Dube syndrome, Brooke-Spiegler syndrome, Cowden syndrome, multiple endocrine neoplasia type 1 , neurofibromatosis, or tuberous sclerosis complex.
- the modified mesenchymal cells are wild-type mesenchymal cells that are modified to decrease TSC1/TSC2 function, increase mTORCI function, and/or decrease mTORC2 function.
- the wild type mesenchymal cells are dermal fibroblasts, dermal papilla cells, dermal sheath cells, induced pluripotent stem cells, or mesenchymal stem cells.
- the wild type mesenchymal cells are dermal fibroblasts.
- the wild-type mesenchymal cells are modified to decrease TSC1/TSC2 function by increasing function of at least one negative regulator of TSC1/TSC2 and/or decreasing function of at least one positive regulator of TSC1/TSC2.
- the function of mTORCI has been increased, the function of mTORC2 has been decreased, or both, through mimetics of decreased TSC1/TSC2 function.
- the wild-type mesenchymal cells in the wild-type mesenchymal cells, the
- TSC1/TSC2 function is decreased, the function of mTORCI is increased and/or the function of mTORC2 is decreased by downregulating TSC1 or TSC2; upregulating an inhibitory protein that inhibits TSC1/TSC2 function or acts as a mimetic of decreased TSC1/TSC2 function; or downregulating a stimulatory protein that stimulates TSC1 TSC2 function or acts as a mimetic of increased TSC1/TSC2 function.
- the modification involves silencing a gene encoding a positive regulator of TSC1/TSC2 or a mimetic of increased TSC1/TSC2 function.
- the gene silencing may be accomplished by treating the wild type mesenchymal cells with siRNA, shRNA, or RNAi directed against the target gene.
- the modification involves overexpressing a gene encoding a negative regulator of TSC1 TSC2 or a mimetic of decreased TSC1/TSC2 function. In one embodiment, the overexpression may be
- the mesenchymal cells may be transfected with growth factor genes or treated with growth factors that decrease TSC1/TSC2 function or act as a mimetic of decreased TSC1/TSC2 function, such as insulin, EGF, HGF, IGF and KGF.
- growth factor genes such as insulin, EGF, HGF, IGF and KGF.
- the mesenchymal cells may be treated with recombinant proteins that decrease TSC1/TSC2 function or act as a mimetic of decreased TSC1/TSC2 function.
- cells may be treated with drugs that increase expression of transcription factors such as thiaolidinediones (including rosiglitazone and pioglitazone), which are agonists of the transcription factor PPARG (peroxisome proliferator-activated receptor gamma).
- transcription factors such as thiaolidinediones (including rosiglitazone and pioglitazone), which are agonists of the transcription factor PPARG (peroxisome proliferator-activated receptor gamma).
- the mesenchymal cells are incorporated into a microsphere.
- the microsphere is formed by mixing about 30,000 cells each of neonatal foreskin fibroblasts and neonatal foreskin
- the mesenchymal cells are provided with a matrix.
- the matrix is a collagen matrix or a ground substance matrix.
- the matrix is a type I collagen matrix.
- the matrix is a rat type I collagen matrix, a bovine type I collagen matrix, or a human type I collagen matrix.
- the epithelial cells comprise one or more epithelial cells from different sources.
- the epithelial cells are keratinocytes or keratinocyte-like cells.
- the keratinocytes are neonatal foreskin keratinocytes.
- the mesenchymal cells and epithelial cells are derived from the same donor.
- the donor is the patient.
- the mesenchymal cells and epithelial cells are derived from different donors.
- mesenchymal or epithelial cells is the patient.
- FIG. 1 A) is photograph of a fibrous forehead plaque on a patient.
- B) is a histological stained section of a skin substitute of the invention comprising fibroblast-like cells from a TSC2-null skin hamartoma overlaid by neonatal foreskin keratinocytes.
- C) is a photograph of a mouse grafted with a skin substitute of the invention comprising fibroblast-like cells from a TSC2-null skin hamartoma overlaid by neonatal foreskin keratinocytes.
- D) is a schematic of the hair follicle
- microanatomy that develops in a skin substitute of the invention comprising fibroblast-like cells from a TSC2-null skin hamartoma overlaid by neonatal foreskin keratinocytes.
- Figure 2 is a schematic representation of the mTOR (mammalian target of rapamycin) network.
- FIG. 3 A) is a histological stained section of normal skin from a TSC patient.
- B) is a histological stained section of a forehead plaque from a TSC patient.
- C) is an immunohistological anti-phospho-S6 stained section of normal skin from a TSC patient.
- D) is an immunohistological anti-phospho-S6 stained section of a forehead plaque from a TSC patient.
- E) is an immunohistological anti-Ki-67 stained section of normal skin from a TSC patient.
- F) is an immunohistological anti- Ki-67 stained section of a forehead plaque from a TSC patient.
- G) is an immunohistological anti- Ki-67 stained section of a forehead plaque from a TSC patient.
- immunohistological anti-CD68 stained section of normal skin from a TSC patient H) is an immunohistological anti-CD68 stained section of a forehead plaque from a TSC patient.
- I) is an immunohistological anti-CD31 stained section of normal skin from a TSC patient.
- J) is an immunohistological anti-CD31 stained section of a forehead plaque from a TSC patient.
- FIG. Histological stains of normal skin (A) and TSC skin hamartomas from a forehead plaque (B), an angiofibroma (C), and a periungual fibroma (D).
- FIG. 1 A) is a sequence analysis of part of the TSC2 gene in TSC2-null fibroblast-like cells.
- B) is an analysis of the microsatellite nucleotide repeat polymorphisms (D16S291 , D16S521 , and D16S663) from normal cells and TSC2-null fibroblast-like cells.
- Primer pairs for D16S291 are forward primer, 5'GCAGCCTCAGTTGTGTTTCCTAATC3' and reverse primer,
- Primer pairs for D16S521 are forward primer, 5' AGCGAGACTCCGTCTAAAAA3' and reverse primer, 5' TACAACCAAAATGCCTTACG 3 ⁇ Primer pairs for D16S663 are forward primer, 5' GTCTTTCTAGGAATGAAATCAT 3' and reverse primer,
- C) is a microdissection of a tumor xenograft dermal sheath encompassing the lower portion of the follicular epithelium.
- D) is a 10% TBE gel showing the results of a SsmA1 restriction enzyme digestion of Exon 10 of TSC2 amplified from TSC normal fibroblasts ("normal”), TSC2-null fibroblast- like cells (“tumor”), and laser microdissected follicular epithelium (“FE”) or dermal sheath ("DS”) regions of tumor xenografts.
- Figure 6. is a western blot of cell lysates from normal cells and forehead plaques from TSC patients. The blot shows levels of expression of actin (control), phosphorylated S6K1 (pS6K1), unphosphorylated S6K1 , phosphorylated ribosomal protein S6 (pS6), and S6 as a function of rapamycin treatment.
- B) is a bar graph presenting cell proliferation data for normal cells and forehead plaque cells from TSC patients as a function of rapamycin treatment.
- Figure 7 is a western blot of cell lysates from normal cells, forehead plaques, and angiofibromas from TSC patients.
- the blot shows levels of expression for actin (control), TSC2 (tuberin), phosphorylated S6 (pS6), and unphosphorylated S6.
- A) is a histological stain of grafts made with TSC normal fibroblasts and human neonatal foreskin keratinocytes.
- B) is a histological stain of grafts comprising TSC2-null cells from TSC skin hamartomas and human neonatal foreskin keratinocytes.
- E) and F) are immunohistological anti-COX IV antibody- stained epithelial cells and dermal cells from a skin substitute comprising TSC2-null cells from TSC skin hamartomas 17 weeks after grafting (scale bars:
- Figure 9E 130 pm
- Figure 9F 35 ⁇
- I) and J) are
- N) and O) are
- P) is an immunohistological anti-Keratin 75 antibody- stained section.
- H) is an immunohistochemical anti-pS6 antibody stained section of a xenograft containing normal fibroblasts from a TSC patient. The xenograft was taken from
- K) is an immunohistochemical anti-Ki-67 antibody stained section of a xenograft containing TSC2-null fibroblasts from a TSC patient.
- L) is an immunohistochemical anti-Ki-67 antibody stained section of a xenograft containing TSC2-null fibroblasts from a TSC patient.
- Q is an immunohistochemical anti-CD31 antibody stained section of a xenograft containing normal fibroblasts from a TSC patient.
- R is an immunohistochemical anti-CD31 antibody stained section of a xenograft containing normal fibroblasts from a TSC patient.
- T is an immunohistochemical anti-CD31 antibody stained section of a xenograft containing TSC2-null fibroblasts from a TSC patient. The xenograft was taken from
- D) is a bar graph showing the average numbers of non-follicular epidermal cells reactive with anti-Ki- 67 antibody relative to epidermal length of xenografts containing TSC2-null or normal fibroblasts from a TSC patient.
- E) is a bar graph showing the average numbers of dermal cells reactive with anti-F4/80 antibody relative to the dermal area of xenografts containing TSC2-null or normal fibroblasts from a TSC patient. The xenografts were taken from mice treated with or without rapamycin, as indicated.
- G) is a bar graph showing the average number and area of anti-CD31 positive blood vessels expressed as the average cross-sectional area of each vessel of xenografts containing TSC2-null or normal fibroblasts from a TSC patient.
- H is a bar graph showing the average number and area of anti-CD31 positive blood vessels expressed as the ratio of vessel area to dermal area within xenografts containing TSC2-null or normal fibroblasts from a TSC patient.
- FIG. 13 A) is a HLA immunochemical stained section of a xenograft containing normal fibroblasts from a TSC patient. The xenograft was taken from a mouse treated with vehicle. B) is a HLA immunochemical stained section of a xenograft containing normal fibroblasts from a TSC patient. The xenograft was taken from a mouse treated with rapamycin. C) is a HLA
- Figure 14 is a bar graph quantifying HLA-positivity as a parameter of fluorescence intensity in the dermis of xenografts relative to the dermal area for xenografts comprising normal fibroblasts or TSC2-null fibroblasts from a TSC patient.
- Figure 15 is an in situ hybridization of a skin substitute comprising TSC2-null cells from TSC skin hamartomas 17 weeks after grafting.
- DAPI stain shows nuclei of cells in blue.
- Cy3 is a human-specific centromeric probe in red with Cy3-labeled cells of the lower dermal sheath marked with a horizontal arrow and adjacent Cy3-lableled dermal fibroblasts marked with vertical arrows.
- FITC is a mouse-specific centromeric probe in green with FITC-labeled endothelial cells marked with an arrowhead. Merge is the combination of these three images.
- Figure 16 shows fluorescence microscopic images (panels on the left) and phase-contrast microscopic images (panels on the right) of neonatal foreskin fibroblasts stably transduced with shRNA vectors.
- Cells were transduced with GAPDHsh control, non-target shRNA control (Non Silencing sh), or TSC2 knock-down vector (TSC2sh1 , TSC2sh2, TSC2sh3).
- Figure 17 is a western blot of cell lysates from foreskin fibroblast cells transduced with non-target shRNA control (shNT), or TSC2-knockdown vector (shTSC2) showing levels of TSC2 (TSC2, top band), phosphorylated ribosomal protein S6 (pS6), total ribosomal protein S6 (S6), and tubulin loading control.
- shNT non-target shRNA control
- shTSC2 TSC2-knockdown vector
- B) is a stain of AP activity (blue) in monolayer cultures of normal human dermal papilla cells and modified
- FIG. 19 is a stain of AP activity (blue) in monolayer cultures of dermal papilla cells (DP) or neonatal foreskin fibroblasts (NFF) stably transduced with lentiviral particles with knockdown of TSC2 (shTSC2) compared to non- template control (NT).
- NT control shRNA
- shTSC2 TSC2 shRNA
- DP dermal papilla cells
- NFF neonatal foreskin fibroblast cells
- 4X and 10X indicate magnification levels.
- NT control shRNA
- shFLCNI , shFLCN2, and scFLCN3 three different FLCN shRNA
- shFLCN123 combination of all three FLCN silencing sequences.
- Figure 21 shows the results of an in vitro hanging drop culture hair follicle assay
- A) is a cluster composed of neonatal foreskin fibroblasts transduced with TSC2 knockdown vector (shTSC2) and neonatal foreskin keratinocytes (NFK) in a 1 :1 ratio, stained with hematoxylin and eosin (H&E).
- B) is a cluster composed of neonatal foreskin fibroblasts transduced with non-targeting control vector (NT) and NFK in a 1 : 1 ratio, stained with H&E.
- NT non-targeting control vector
- C) is a cluster composed of neonatal foreskin fibroblasts transduced with TSC2 knockdown vector (shTSC2) and NFK in a 1 :1 ratio, stained with anti-pan cytokeratin antibody.
- D) is a cluster composed of neonatal foreskin fibroblasts transduced with non-targeting control vector (NT) and NFK in a 1 :1 ratio, stained with anti-pan-cytokeratin antibody.
- E) is a cluster composed of neonatal foreskin fibroblasts transduced with TSC2 knockdown vector (shTSC2) and NFK in a 1 :1 ratio, stained with anti-pan-cytokeratin antibody and visualized using fluorescence microscopy. Autofluorescence of a hair-fiber-like structure is marked with an arrow.
- Figure 22 shows in vitro hair formation of hair follicle-like structures in dermal-epidermal composites (skin substitutes).
- A) shows hematoxylin and eosin (H&E) analysis of the skin equivalents four days after bringing the composite to the air-liquid interface. It is composed of neonatal foreskin fibroblasts transduced and stably expressing TSC2 knockdown vector (1 mg/mL of rat tail collagen type 1 in 10% FBS/DMEM, and overlaid with 1 x 10 6 keratinocytes. Image was taken with a 10X objective.
- B) is a skin substitute stained with H&E eight days after bringing the composite to the air-liquid interface. Image was taken with a 10X objective.
- C) is a skin substitute stained with anti-pan-cytokeratin antibody four days after bringing the composite to the air-liquid interface. Image was taken with a 10X objective.
- D) is a skin substitute stained with anti-pan-cytokeratin antibody eight days after bringing the composite to the air-liquid interface. Image was taken with a 10X objective.
- E) is a skin substitute stained with anti-pan-cytokeratin antibody four days after bringing the composite to the air-liquid interface. Image was taken with a 4X objective.
- Figure 23 shows hematoxylin and eosin stained sections of dermal- epidermal composites, sampled 10 weeks after grafting.
- Composites were composed of dermal papilla cells transduced with shRNA to TSC2, type I collagen, and normal neonatal foreskin keratinocytes.
- A) is a low-power (40x) image of the graft containing multiple hair follicles.
- B) is a medium power (100X) image of a hair follicle infundibulum (right side) and proximal (suprabulbar) hair follicle (left side).
- C) is a higher-power (400x) image of the proximal hair follicle, showing outer and inner root sheaths and pigmented hair shaft cortex.
- D) is a high-power image of a hair follicle infundibulum with early sebaceous gland development and pigmented hair fiber.
- the terms “about” and “approximately” mean within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system.
- “about” can mean from 1 to 1.5 standard deviation(s) or from 1 to 2 standard deviations, per the practice in the art.
- “about” can mean a range of up to and including 20%, 10%, 5%, or 1 % of a given value.
- the term can mean up to and including an order of magnitude, up to and including 5-fold, and up to and including 2-fold, of a value.
- apocrine gland refers to glands in the skin that have a coiled, tubular excretory portion with widely dilated lumen, lined by cuboidal epithelial cells with eosinophilic cytoplasm and apical snouts, and an outer discontinuous layer of myoepithelial cells resting on a prominent basement membrane.
- composition refers to a mixture that contains a therapeutically active component(s) and a carrier, such as a
- composition refers to the skin substitutes of the invention, which are described in further detail below.
- compositions of the invention may further comprise a matrix, which is defined below.
- the term "dermal papilla” refers to the follicular dermal papilla, i.e., the mesenchymal cell condensation at the base of the hair follicle.
- the term "decreased TSC1/TSC2 function” refers to a downregulation in the level, function, activity and/or effect of the TSC1/TSC2 complex and can be produced by downregulation of either TSC1 or TSC2, or by changes in function of upstream regulators of TSC1 or TSC2.
- the function of the TSC1/TSC2 complex can be mimicked by other proteins that affect its downstream targets, mTORC and mTORC2. Therefore upregulating a protein that acts as a mimetic of decreased TSC1 TSC2 function and/or downregulating a protein that acts as a mimetic of increased TSC1/TSC2 function will lead to increased mTORCI function, decreased mTORC2 function, or both, and such changes compared to wild-type mesenchymal cells are desired in one embodiment of this invention.
- Decreased TSC1/TSC2 function, increased mTORCI function, and/or decreased mTORC2 function can occur by: (1) downregulating of TSC1 and/or TSC2; (2) upregulating an inhibitory protein that inhibits TSC1/TSC2 function or acts as a mimetic of decreased TSC1/TSC2 function; or (3) downregulating a stimulatory protein that stimulates TSC1/TSC2 function or acts as a mimetic of increased TSC1/TSC2 function.
- Mimetics of increased or decreased function include other molecules that affect mTORCI or mTORC2 activity that are downstream of TSC1/TSC2 in the mTOR signaling network.
- One embodiment of this invention includes decreasing function of at least one stimulatory protein (e.g., LKB1 , NF1 , PTEN, CYLD, FLCN, PRAS40, 4E- BP1 , GSK3, and MEN1) and/or increasing function of at least one inhibitory protein (e.g., Ras, Raf, Mek, Erk, Rsk1 , PI3K, Akt1 , Akt2, Akt3, Rheb, mTOR, Raptor, Rictor, ml_ST8, S6K1 , ribosomal protein S6, SKAR, SREBP1 , elF4e, IKKbeta, Myc, Runxl , and p27). All of these modifications are encompassed by the term
- stimulatory protein e.g., LKB1 , NF1 , PTEN, CYLD, FLCN, PRAS40, 4E- BP1 , GSK3, and MEN1
- inhibitory protein e.g., Ras
- Eccrine glands refers to sweat glands in the skin. Eccrine glands consist of two anatomical portions: (1 ) the secretory coil, located in the deep dermis at the junction with the subcutaneous tissue and composed of clear pyramidal cells and dark-stained cells, surrounded by a single outer discontinuous layer of myoepithelial cells resting on a well-defined basement membrane; and (2) the excretory part composed of a straight intradermal portion and an intraepidermal spiral portion (acrosyringium), and a double layer of small cuboidal cells with no underlying myoepithelial layer.
- endothelial cell refers to the specialized cells that line the inner walls of blood vessels.
- epidermal cell refers to cells derived from the epidermis of the skin.
- Epidermal cells are one type of epithelial cells. Examples of epidermal cells include, but are not limited to keratinocytes, melanocytes, Langerhans cells, and Merkel cells.
- epithelial cell refers to cells that line the outside (skin), mucous membranes, and the inside cavities and lumina of the body.
- epithelial cell refers to stratified squamous epithelial cells. Most epithelial cells exhibit an apical-basal polarization of cellular components. Epithelial cells are typically classified by shape and by their specialization. For example, squamous epithelial cells are thin and have an irregular flattened shape mainly defined by the nucleus. Squamous cells typically line surfaces of body cavities, such as the esophagus.
- Cuboidal epithelial cells are cube-shaped and usually have their nucleus in the center. Cuboidal epithelial cells are typically found in secretive or absorptive tissue, e.g., kidney tubules, glandular ducts, and the pancreatic exocrine gland. Columnar epithelial cells are longer than they are wide and the elongated nucleus is usually near the base of the cell. These cells also have tiny projections, called microvilli, which increase the surface area of the cells. Columnar epithelial cells typically form the lining of the stomach and intestines, as well as sensory organs.
- the term "gene” refers to nucleic acid coding sequences necessary for the production of a polypeptide or precursor.
- the polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired functional properties (e.g., enzymatic activity, ligand binding, signal transduction, etc.) of the polypeptide are retained.
- the term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb on either end, such that the term "gene” corresponds to the length of the full-length mRNA.
- the sequences that are located 5' of the coding region and which are present on the mRNA are referred to as 5' untranslated sequences.
- the sequences that are located 3' or downstream of the coding region and that are present on the mRNA are referred to as 3' untranslated sequences. These sequences are referred to as "flanking" sequences or regions.
- the 5' flanking region may contain regulatory sequences such as promoters and enhancers that control or influence the transcription of the gene.
- the 3' flanking region may contain sequences that direct the termination of transcription, post- transcriptional cleavage and polyadenylation.
- genomic form or clone of a gene may contain the coding region interrupted with non-coding sequences termed "introns” or “intervening regions” or “intervening sequences.”
- Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA), and may contain regulatory elements such as enhancers. Introns are removed or “spliced out” from the nuclear or primary transcript and, therefore, are absent in the messenger RNA (mRNA) transcript.
- mRNA messenger RNA
- gene knockdown and “gene silencing” refer to any technique by which the expression of one or more genes is reduced.
- gene knockdown techniques include, but are not limited to, mutating genomic DNA to reduce or eliminate gene transcription or translation, creation of targeted double-strand breaks using a zinc finger nuclease, and treating genomic DNA with a reagent, such as an antisense oligonucleotide.
- a reagent such as an antisense oligonucleotide
- antisense nucleotide refers to a nucleic acid molecule that is substantially identical (or substantially complementary) to a portion of a target RNA or DNA.
- Antisense nucleotides include, but are not limited to, short complementary double stranded RNA oligonucleotides (dsRNA) such as small interfering RNA (siRNA), short interfering hairpin RNA (shRNA), micro RNA (miRNA), or interfering RNA (RNAi).
- dsRNA short complementary double stranded RNA oligonucleotides
- siRNA small interfering RNA
- shRNA short interfering hairpin RNA
- miRNA micro RNA
- RNAi interfering RNA
- inhibiting expression refers to the absence or observable decrease in the level of protein and/or mRNA product from a target gene.
- the inhibition may be either transient or permanent, depending on the application.
- the reduction may be at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction.
- the invention encompasses variations in antisense oligonucleotides.
- the terms "substantially identical” and “substantially complementary” as applied to antisense oligonucleotides means that the nucleotide sequence of one strand of the antisense oligonucleotide is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to 20 or more contiguous nucleotides of the target gene, and which hybridize to the target gene under stringent conditions (defined below).
- the antisense oligonucleotide may comprise a mismatch with the target gene of at least 1 , 2, or more nucleotides.
- the term "20 or more nucleotides” means a portion of the target gene that is at least about 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 75, 100, 150, 200, 300, 400, 500, 1000, 1500, or 2000 consecutive bases, up to the coding sequence of the target gene or the full length of the target gene.
- gene knockdown and “gene silencing” also refer to any technique by which the function of a protein expressed by one or more genes is reduced. Such gene knockdown techniques include, but are not limited to, mutating genomic DNA to reduce or eliminate protein function, and treating cells with a reagent that interferes with or inhibits protein function.
- amount sufficient to inhibit function refers to a concentration or amount of reagent that is sufficient to reduce levels of protein function in a cell.
- inhibitting function refers to the absence or observable decrease in the level of protein function in a cell.
- hair follicle refers to a tubular infolding of the epidermis from which a hair may grow.
- a hair follicle may contain a hair shaft in the correct anatomical location, exhibit long-term graft survival, normal hair follicle cycling, and sebaceous glands.
- hair regeneration refers to the stimulation of existing quiescent hair follicles to enter the anagen phase of hair growth.
- the term also refers to stimulation of hair formation from hair follicle remnants or components of hair follicles (e.g., implantation of microdissected dermal papilla and follicular epithelium, or hair growth after plucking), rather than starting with intact quiescent hair follicles.
- hair neogenesis refers to the stimulation of de novo hair follicle growth where no hair follicle previously existed in skin with no preexisting hair follicles, or in skin with fewer than the desired number of hair follicles.
- keratinocyte refers to epithelial cells in the epidermis of the skin (including cells in the follicular epithelium) that undergo cell division and stratification from basal cells in contact with the epidermal basement membrane into squamous cells. Keratinocytes express keratin.
- Keratinocyte-like cell refers to cells that express keratin and have the ability to form a stratified squamous epithelium or follicular epithelium. Keratinocyte-like cells may be derived from skin cells or other organs such as bone marrow or trachea, or from cells with stem-cell features (including embryonic stem cells) or that induce pluripotent stem cells.
- matrix and ground substance refer to any natural or synthetic extracellular matrix-like composition capable of forming a hydrated gel-like cellular support.
- Cells may be deposited within or on matrices and ground substances.
- Matrices and ground substances may comprise one or more fibrous proteins having both structural and adhesive functions. Such proteins include, but are not limited to elastin, fibronectin, laminin, and collagens I, II, III, IV, V, VI, VII, VIII, IX X, XI, and XII.
- matrices and ground substances may comprise proteoglycan molecules comprising polysaccharide chains covalently linked to proteins.
- proteoglycans include, but are not limited to, hyaluronan-, heparin sulfate-, chondroitin-, keratin sulfate-, and dermatin sulfate- linked proteins.
- the term "mesenchymal cell” refers to multipotent cells with the capacity or potential capacity to induce hair follicle formation similar to cells of the dermal papilla and connective tissue sheath from hair follicles.
- Mesenchymal cells are usually considered mesodermal connective tissue cells that express vimentin, but cells with the desired attributes may also be neural crest derived.
- Mesenchymal cells may be isolated from one or more of the following sources: patient skin or mucosa for autologous cells; donor skin or mucosa for allogeneic cells; normal skin or mucosa; skin with an adnexal tumor; and other tissues (e.g. fat, bone marrow).
- Mesenchymal cells include, but are not limited to, fibroblasts, dermal papilla cells, dermal sheath cells, onychofibroblasts (fibroblasts from nail unit), dental pulp cells, periodontal ligament cells, neural crest cells, adnexal tumor cells, induced pluripotent stem cells, and mesenchymal stem cells from bone marrow, umbilical cord blood, umbilical cord, fat, and other organs.
- the terms “morphologically correct” and “fully developed” refers to hair follicles that have a normal configuration with an epithelial filament coming out of the distal end of the follicle and dermal papilla sitting at the base of the follicle.
- the follicles also have cells proliferating at the base of the follicle, and have concentric layers of outer and inner root sheath, cuticle and cortex.
- the follicles exhibit normal differentiation of the outer root sheath, and have hair shafts and sebaceous glands. The hairs go through normal cycles, and contain an epithelial stem cell component.
- mutation refers to any change in the coding sequence of a gene. Mutations include missense mutations, frameshift mutations (i.e., insertions and deletions), splice site mutations, nonsense mutations (i.e., premature termination codons), and deletion of the gene itself.
- nucleotide sequence encoding a gene product means a nucleic acid sequence comprising the coding region of a gene or the nucleic acid sequence that encodes a gene product (i.e., a polypeptide).
- the coding region may be present in cDNA, genomic DNA, or RNA form.
- the nucleotide sequence may be single-stranded (i.e., the sense strand) or double-stranded.
- Suitable control elements such as enhancers/promoters, splice junctions, polyadenylation signals, etc. may be placed in close proximity to the coding region of the gene if needed to permit proper initiation of transcription and/or correct processing of the primary RNA transcript.
- the coding region may contain endogenous enhancers/promoters, splice junctions, intervening sequences, polyadenylation signals, etc. or a combination of both endogenous and exogenous control elements.
- the term "pharmaceutically acceptable carrier” refers to a non-toxic solid, semisolid, or liquid filler, diluents, encapsulating material, formulation auxiliary, or excipient of any conventional type.
- a pharmaceutically acceptable carrier is non-toxic to recipients at the dosages and concentrations employed, and is compatible with other ingredients of the formulation.
- nucleotide As used herein, the terms “polynucleotide,” “nucleotide,” “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” “polynucleotide sequence,” and “nucleotide sequence,” are used interchangeably to refer to polymeric forms of nucleotides of any length.
- the polynucleotides can comprise deoxyribonucleotides, ribonucleotides, deoxyribonucleosides, ribonucleosides, substituted and alpha- anomeric forms thereof, peptide nucleic acids (PNA), locked nucleic acids (LNA), phosphorothioate, methylphosphonate, and/or naturally occurring and non-naturally occurring analogs or derivatives thereof.
- PNA peptide nucleic acids
- LNA locked nucleic acids
- phosphorothioate phosphorothioate
- methylphosphonate and/or naturally occurring and non-naturally occurring analogs or derivatives thereof.
- the terms also include naturally and non- naturally occurring variants of wild type sequences. Variants may include insertions, additions, deletions, or substitutions that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a wild type sequence.
- Insertional and deletional variants include polynucleotides that are 90%, 95%, 105%, or 1 10% of the length of the corresponding wild type sequence.
- sebaceous gland refers to hair follicle- dependent glands that originate as a budding of sebaceous glands primordium. Sebaceous glands consist of multiple lobules of rounded cells (sebocytes), filled with lipid-containing vacuoles, and rimmed by a single layer of small, dark germinative cells. The lobules converge on a short duct, which empties the lipid content of degenerated sebocytes into the hair follicle.
- skin substitute As used herein, the terms “skin substitute,” “skin equivalent,” “dermal-epidermal composite,” and “skin graft” refer to any product used for the purpose of damaged skin replacement, fully or partially, temporarily or permanently, and possessing some similarities with human skin, both anatomically or
- Skin substitutes include, but are not limited to, bioengineered skin equivalents, tissue-engineered skin, tissue-engineered skin constructs, biological skin substitutes, bioengineered skin substitutes, skin substitute bioconstructs, living skin replacements, dermal- epidermal composites and bioengineered alternative tissue.
- stringent hybridization conditions refers to conditions under which a polynucleotide will hybridize to a target sequence, but to a minimal number of other sequences.
- stringent hybridization conditions include low concentrations ( ⁇ 0.15M) of salts with inorganic cations such as Na 2+ or K 2+ (i.e., low ionic strength), temperatures higher than 20°C-25°C below the Tm of the hybridized complex (i.e., the temperature at which 50% of the oligonucleotides complementary to the target sequence hybridize to the target sequence at equilibrium), and the presence of denaturants such as formamide,
- Tm 81.5+0.41 (% G+C), when a nucleic acid is in aqueous solution at 1 M NaCI (See e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization [1985]).
- Exemplary stringent hybridization conditions include, but are not limited to, hybridization in 4 x sodium chloride/sodium citrate (SSC) at about 65-70°C, hybridization in 4 x SSC plus 50% formamide at about 42-50°C followed by one or more washes in 1 x SSC at about 65-70°C, hybridization in 400 mM NaCI, 40 mM PIPES pH 6.4, 1 mM EDTA, 60°C hybridization for 12-16 hours followed by washing at 60°C with 0.1 % SDS and 0.1% SSC for about 15-60 minutes, and hybridization at 42°C in a solution consisting of 5 x SSPE (43.8 g/l NaCI, 6.9 g/l NaH 2 P0 4 H 2 0 and 1.85 g/l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5 x Denhardt's reagent and 100 pg/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1
- transfection refers to the introduction of foreign DNA into eukaryotic cells. Transfection may be accomplished by a variety of means known to the art including calcium phosphate-DNA co-precipitation, DEAE- dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipofection, protoplast fusion, retroviral infection, and biolistics. Transfection also includes the introduction of foreign DNA
- transduction or viral transduction accomplished by replication-incompetent retroviral vectors, which may also be referred to as transduction or viral transduction.
- stable transfection or “stably transfected” refers to the introduction and integration of foreign DNA into the genome of the transfected cell.
- transient transfection or “transiently transfected” refers to the introduction of foreign DNA into a cell in which the foreign DNA fails to integrate into the genome of the transfected cell.
- the foreign DNA persists in the nucleus of the transiently transfected cell for several days. During this time the foreign DNA is subject to the regulatory controls that govern the expression of endogenous genes in the chromosomes.
- treatment refers to any administration or application of remedies for a condition in a mammal, including a human, to obtain a desired pharmacological and/or physiological effect. Treatments include inhibiting the condition, arresting its development, or relieving the condition, for example, by restoring or repairing a lost, missing, or defective function, or stimulating an inefficient process.
- the term “trichogenic” refers to the ability of a cell to induce a hair follicle and/or to promote hair follicle morphogenesis, i.e.,
- wild type and wild refer to a gene, gene product, or signaling network that has the characteristics of that gene, gene product, or signaling network in a naturally occurring source.
- a wild-type gene, gene product, or signaling network is that which is most frequently observed in a population and is thus arbitrarily designed the “normal” or “wild-type” form.
- modified refer to a gene, gene product, or signaling network that displays modifications in sequence and or functional properties (i.e., altered characteristics) when compared to the corresponding wild- type version. It is noted that naturally-occurring mutants can be isolated from a naturally occurring source, and are identified by the fact that they have altered characteristics when compared to the corresponding wild-type gene, gene product, or signaling network.
- the follicles have a normal configuration with an epithelial filament coming out of the distal end of the follicle and dermal papilla sitting at the base of the follicle.
- the follicles have cells proliferating at the base of the follicle, and have concentric layers of outer and inner root sheath, cuticle and cortex.
- the follicles exhibit normal differentiation of the outer root sheath, and have hair shafts and sebaceous glands. The hairs go through normal cycles, and contain an epithelial stem cell component.
- the invention provides cellular compositions capable of hair neogenesis.
- the invention provides a skin substitute comprising epithelial cells and modified mesenchymal cells, wherein the modified mesenchymal cells have decreased TSC1/TSC2 function, increased mTORCI function, and/or decreased mTORC2 function compared to wild type mesenchymal cells.
- modified mesenchymal cells wherein the modified mesenchymal cells have decreased TSC1/TSC2 function, increased mTORCI function, and/or decreased mTORC2 function compared to wild type cells and the modified mesenchymal cells are capable of interacting with the patient's own epithelial cells.
- compositions comprise trichogenic mesenchymal cells isolated from benign adnexal tumors, which can be considered "modified" with respect to wild-type cells.
- the trichogenic cells may be artificially created by decreasing TSC1/TSC2 function, increasing mTORCI function, and/or decreasing mTORC2 function in normal or wild-type mesenchymal cells.
- the function of TSC1/TSC2 may be decreased, the function of mTORCI increased, and/or the function of mTORC2 decreased by: downregulating TSC1 or TSC2; upregulating an inhibitory protein that inhibits TSC1/TSC2 function or acts as a mimetic of decreased TSC1/TSC2 function; or downregulating a stimulatory protein that stimulates TSC1/TSC2 function or acts as a mimetic of increased TSC1/TSC2 function compared to normal cells.
- Mammalian skin contains two primary layers: an outer layer called the epidermis and an inner layer called the dermis.
- the epidermis primarily contains keratinocytes that are formed in the deeper layers of the epidermis by mitosis and then migrate up to the surface, where they are eventually shed.
- the dermis contains a variety of structures including hair follicles, sebaceous glands, sweat glands, apocrine glands, nerves, lymphatic vessels, and blood vessels.
- Hair follicle morphogenesis takes place mostly in utero during embryogenesis. Hair follicle formation begins with the appearance of epidermal placodes, which mark the location of the new hair follicle. Mesenchymal cells (i.e., inductive multipotent cells) then begin to aggregate in the dermis below the epidermal placodes. The mesenchymal aggregates signal to the keratinocytes in the overlaying placodes, which then begin growing downward into the dermis.
- Mesenchymal cells i.e., inductive multipotent cells
- the epidermal keratinocytes When the epidermal keratinocytes reach the mesenchymal aggregates, the cells undergo a series of differentiation and proliferation processes, eventually forming a mature hair follicle.
- Mature hair follicles contain four main parts: the dermal papilla (DP), dermal sheath (DS), follicular epithelium, and hair shaft ( Figure 1 D).
- the DP is located at the base, or bulb, of the hair follicle adjacent to the hair matrix that produces the hair shaft.
- the DS is made up of connective tissue and envelops the hair follicle.
- the follicular epithelium includes the outer root sheath and the inner root sheath.
- the hair shaft is a proteinaceous structure that extends from the base of the follicle through the epidermis to the exterior of the skin.
- the hair follicle is a dynamic miniorgan that repeatedly cycles through periods of growth (anagen), regression (catagen), and quiescence
- telogen The lower portion of the hair follicle regresses or regrows, regenerating in each cycle through complicated interactions between the dermal mesenchymal cells and epidermal cells.
- the permanent portion of the lower hair follicle above the continuously remodeled part is referred to as the "bulge" because it protrudes slightly from the follicle.
- the bulge contains multipotent cells capable of forming the follicle, sebaceous gland, and epidermis.
- the anagen and catagen phases of the hair follicle cycle become shorter, and hair follicles experience a more rapid shift to the telogen phase.
- normal hairs are gradually replaced by finer vellus hairs, and in some individuals, the cells may lose their trichogenic properties entirely.
- the skin substitutes of the invention comprise either (1 ) modified mesenchymal cells, or (2) modified mesenchymal cells and epithelial cells.
- the skin substitutes comprise modified mesenchymal cells and no epithelial cells
- the mesenchymal cells interact with the patient's epithelial cells to produce a hair follicle.
- the skin substitute comprises modified mesenchymal cells and epithelial cells
- the modified mesenchymal cells and epithelial cells the modified
- mesenchymal and epithelial cells supplied in the skin substitute interact, with or without the patient's epithelial cells, to produce a hair follicle.
- any source of mesenchymal cells ⁇ i.e., inductive multipotent cells
- the present invention is not limited to the use of any particular source of cells with the capacity or potential capacity of inducing hair follicle formation.
- the present invention contemplates the use of a variety of cell lines and sources that can induce hair follicles.
- Mesenchymal cells are usually considered mesodermal connective tissue cells that express vimentin, but vimentin-expressing cells with these attributes may also be neural crest derived.
- Sources of cells include the inductive multipotent cells of the dermal papilla and connective tissue sheath from hair follicles.
- Mesenchymal cells may be isolated from one or more of the following sources: patient skin or mucosa for autologous cells; donor skin or mucosa for allogeneic cells; normal skin; skin with an adnexal tumor; and other tissues (e.g., fat, bone marrow, etc.).
- mesenchymal cells examples include fibroblasts, dermal papilla cells, dermal sheath cells, onychofibroblasts (fibroblasts from nail unit), dental pulp cells, periodontal ligament cells, neural crest cells, adnexal tumor cells, induced pluripotent stem cells, and mesenchymal stem cells from bone marrow, umbilical cord blood, umbilical cord, fat, and other organs.
- any source of epithelial cells or cell line that can stratify into squamous epithelia are useful in the present invention. Accordingly, the present invention is not limited to the use of any particular source of cells that are capable of differentiating into squamous epithelia. Indeed, the present invention contemplates the use of a variety of cell lines and sources that can differentiate into stratified squamous epithelia. Sources of cells include primary and immortalized keratinocytes, keratinocyte-like cells, and cells with the capacity to be differentiated into keratinocyte-like cells, obtained from humans and cavaderic donors (Auger et al., In Vitro Cell. Dev. Biol.
- Epithelial cells may also be obtained from: patient skin or mucosa (autologous), donor skin or mucosa (allogeneic), epidermal cell lines, epidermal cells derived from stem cells, primary or passaged epidermal cells, trachea, and cells derived from blood mononuclear cells or circulating stem cells. Subpopulations of epithelial cells from these sources may also be used, for example by enriching the number of cells with stem-cell properties. Epithelial cells express keratin or can be induced to express keratin, and have the capacity of forming a stratified squamous epithelium and/or follicular epithelium.
- the epithelial cells are from two different sources.
- the invention may be practiced using immortalized keratinocytes together with autologous keratinocytes.
- the relative proportion of autologous cells to immortalized cells may be 1 :99, 5:95, 10:90, 20:80, 30:70, 40:60, 50:50, 60:40, 70:30, 80:20, or 90:10. In this way, the number of autologous keratinocytes may be reduced.
- the immortalized keratinocytes may be enhanced to promote skin healing, for example by genetically modifying the cells to express growth factors or angiogenic factors.
- the immortalized keratinocytes may be modified so that they can be targeted for elimination at any point following engraftment.
- so called "suicide genes” may be used and the cells can be genetically modified so that they die in response to a drug treatment.
- Mesenchymal and epithelial cells may be isolated from skin or mucosa samples or skin tumors using any suitable techniques.
- mesenchymal cells may be isolated by migration of cells from tissue explants. An example of such a method is described in further detail in Example 3.
- cells may be dissociated from skin or mucosa samples or skin tumors to isolate mesenchymal and epithelial cells. Examples of such a method are described in further detail in Example 3.
- epithelial cells may be isolated by inducing multipotent stem cells to differentiate into epithelial cells. An example of such a method is described in further detail in Example 7.
- Isolated cells may be grown in any suitable medium known to those skilled in the art. Exemplary media are discussed in detail in Example 6.
- the samples may be enriched for hair inductive cells based on any technique known to those skilled in the art.
- cells may be selected based on the presence of suitable cell markers, such as CD133, CD10, or nestin, as discussed in greater detail in Example 5.
- growth factors such as BMP2, 4, 5, or 6, Wnt-3a, Wnt-IOb, insulin, FGF2, KGF, etc. may be added to maintain and enrich the hair inductive cells, including dermal papilla cells, as discussed in greater detail in Example 5.
- Cells may also be enriched for their ability to differentiate into hair follicles using the cell adhesion and cell sorting methods discussed in greater detail in Example 8.
- modified mesenchymal cells used in the skin substitutes of the invention have either naturally occurring modifications to the TSC1/TSC2 and mTOR signaling network, or are engineered to create a modification of the
- TSC1/TSC2 and mTOR signaling network encompasses both naturally occurring and engineered changes to this network compared to wild-type cells.
- TSC1 and TSC2 genes are tumor-suppressor genes.
- TSC1 is located on chromosome 9q34 and encodes a 140 kDa protein called hamartin
- TSC2 is located on chromosome 16p13.3 and encodes a 200 kDa protein called tuberin.
- Hamartin (also called TSC1) and tuberin (also called TSC2) associate to form a heterodimeric protein complex called the TSC1 TSC2 complex.
- the TSC1/TSC2 complex acts as a central hub, linking a network of signaling networks into what is referred to herein as the TSC1/TSC2 and mTOR signaling network.
- the TSC1 /TSC2 complex is believed to exert its effect in the invention by inhibiting function of mTORCI , which is part of the mTOR (mammalian target of rapamycin) network. It is also believed to stimulate function of mTORC2.
- the mTOR network is centrally involved in growth regulation and proliferation control.
- Figure 2 presents a schematic overview of the mTOR network.
- mTOR is a member of the phosphoinositide-3-kinase-related (PI3K-related) family of kinases.
- PI3K-related phosphoinositide-3-kinase-related
- the TSC1/TSC2 protein complex functions upstream of both mTORCI and mTORC2.
- the TSC1/TSC2 complex exhibits a GTPase activating protein (GAP) function through the TSC2 protein, which inactivates the small G- protein Rheb (Ras homolog enriched in brain), thereby negatively regulating mTORCI .
- GAP GTPase activating protein
- the TSC1/TSC2 complex positively regulates mTORC2.
- the TSCi rSC2 complex and the individual TSC1 and TSC2 proteins also interact with a number of other signaling networks.
- the TSC1/TSC2 complex interacts with components of InR (insulin-like receptor) signaling, including InR, PTEN (phosphate and tensin homologue deleted on chromosome 10), Akt (protein Kinase B), and S6K1 (70 kDa ribosomal protein S6 kinase).
- InR insulin-like receptor
- PTEN phosphate and tensin homologue deleted on chromosome 10
- Akt protein Kinase B
- S6K1 70 kDa ribosomal protein S6 kinase
- TSC1 interacts with the proteins DOCK7, ezrin/radixin/moesin, FIP200, IKKbeta, Melted, Merlin, NADE(p75NTR), NF-L, Plk1 and TBC7.
- TSC2 interacts with 14-3-3 (isoforms beta, epsilon, gamma, eta, sigma, tau, and zeta), Akt, AMPK, CaM, CRB3/PATJ, cyclin A, cyclins D1 , D2, D3, Dsh, ERalpha, Erk, FoxOI , HERC1 , HPV16 E6, HSCP-70, HSP70-1 , MK2, NEK1 , p27KIP1 , Pam, PC1 , PP2Ac, Rabaptin-5, Rheb, RxRalphaA/DR and SMAD2/3.
- the proteins axin, Cdk1 , cyclin B1 , GADD34, GSK3, mTOR and RSK1 have been shown to co- immunoprecipitate with both TSC1 and TSC2.
- TSC1 , TSC2, FLCN, MEN1 , and PTEN are shared among the different syndromes discussed below that have an inherited predisposition to skin adnexal tumors.
- TSC1/TSC2 may be decreased by any method known to those skilled in the art, as may the function of mTORCI be increased and/or the function of mTORC2 be decreased. This may be carried out by directly downregulating TSC1 or TSC2 and/or by downregulating a stimulatory protein that stimulates TSC1/TSC2 function or acts as a mimetic of increased TSC1/TSC2 function (e.g., CYLD, LKB1 , FLCN, MEN1 , NF1 , PTEN, PRAS40, 4E-BP1 , GSK3, or Deptor).
- a stimulatory protein that stimulates TSC1/TSC2 function or acts as a mimetic of increased TSC1/TSC2 function (e.g., CYLD, LKB1 , FLCN, MEN1 , NF1 , PTEN, PRAS40, 4E-BP1 , GSK3, or Deptor).
- dsRNA short complementary double stranded RNA oligonucleotides
- siRNA small interfering RNA
- shRNA short interfering hairpin RNA
- miRNA micro RNA
- RNAi interfering RNA
- lentiviral particles may be used to deliver custom cloned short hairpin RNA (shRNA) to the mesenchymal cells. A detailed description of such a method is provided in Examples 2 and 4.
- gene-therapy based methods may be used to downregulate TSC1 , TSC2, and/or stimulatory proteins that stimulate TSC1/TSC2 function.
- TSC1 , TSC2, and/or stimulatory proteins that stimulate TSC1/TSC2 function may be downregulate TSC1 , TSC2, and/or stimulatory proteins that stimulate TSC1/TSC2 function.
- stimulatory proteins suchs as zinc finger nucleases may be used to generate targeted double-strand breaks in the TSC1 or TSC2 genes, or in the genes encoding stimulatory proteins that stimulate
- TSC1/TSC2 function. Through the process of non-homologous end joining, such double strand breaks create a functional knockout of the targeted gene(s).
- TSC1 , TSC2 and/or TSC1/TSC2 stimulatory proteins may also be inhibited by mutating the gene encoding these proteins to eliminate protein function.
- the function of TSC1 or TSC2 may also be regulated indirectly by decreasing the expression of certain interacting proteins. For example, knocking down the expression of polycystin-1 , a protein that represses mTORCI by protecting TSC2 from Akt phosphorylation (Dere R. et al., "Carboxy terminal tail of polycystin-1 regulates localization of TSC2 to repress mTOR," PLoS One,
- TSC2 is expected to decrease TSC2 function.
- Another approach is to knock down the expression of proteins regulating upstream or downstream interacting proteins. For example, the loss of TSC1/TSC2 function results in activation of mTORCI , and knocking down Deptor is expected to increase mTORCI function.
- cells may be treated with chemicals or molecules that decrease the function of the stimulatory protein.
- TSC2 is activated by AMPK, and drugs that inhibit AMPK, such as compound C or sunitinib (Laderoute K.R.
- the function of proteins that inhibit TSC1/TSC2 function or act as a mimetic of decreased TSC1/TSC2 function may be increased by any method known to those skilled in the art, as may the function of mTORCI be increased and/or the function of mTORC2 be decreased.
- the function of inhibitory proteins may be increased by knocking in strong promoters to drive expression of the genes encoding the inhibitory proteins. A detailed description of such a method is provided in
- cells may be treated with dsRNA directed to genes whose products suppress the expression or function of the inhibitory proteins.
- the function of inhibitory proteins may also be increased by mutating the genes encoding the inhibitory proteins to render the protein constitutively active.
- the inhibitory protein may be delivered directly to the cells, as described in detail in Example 4.
- the modifications to the TSC1/TSC2 and mTOR signaling network may be naturally occurring. These naturally occurring modifications may be present in a benign adnexal tumor. Therefore, any benign adnexal tumor is believed to provide an adequate source for modified
- mesenchymal cells according to the invention.
- Benign adnexal tumors are non-malignant skin neoplasms that exhibit morphological differentiation towards one of the different types of adnexal epithelium present in normal skin: (1) the pilosebaceous unit (i.e., the hair shaft, the hair follicle, and the sebaceous gland); (2) the eccrine sweat glands; and (3) the apocrine sweat glands.
- Benign adnexal tumors are usually multilobulated, have symmetric and smooth borders, and have uniform collections of epithelial cells, usually with no tumor necrosis or ulceration. There is usually no atypia (i.e., cellular abnormalities), and mitotic activity is generally minimal. Dense fibrotic stromal reaction occurs frequently in these tumors.
- Examples of benign adnexal tumors include, but are not limited to, angiofibromas, apocrine/eccrine nevus, basaloid epidermal proliferations, basaloid follicular hamartoma, chondroid syringoma, cylindroma, desmoplastic
- trichilemmoma desmoplastic trichoepithelioma, fibrofolliculoma, fibrous papules, folliculosebaceous cystic hamartoma, forehead plaques ( Figure A), hair follicle nevi, hidroacanthoma simplex, hidradenoma, hidradenoma papilliferum, hidrocystoma, infundibulomas, intraepidermal poroma, isthmicomas, nevus sebaceous of Jadassohn, nodular hidradenoma, organoid nevi overlying dermal mesenchymal lesions, papillary eccrine adenoma, perifollicular fibromas, pilar tumor, pilar sheath acanthoma, pilomatricoma, poroma, proliferative pilomatricoma, proliferating trichilemmal cyst, sebaceous hyperplasia
- trichodiscoma trichoepitheliomas
- trichofolliculoma tubular apocrine adenoma
- tubulopapillary hidradenoma tubulopapillary hidradenoma
- ungual fibromas trichodiscoma, trichoepitheliomas, trichofolliculoma, tubular apocrine adenoma, tubulopapillary hidradenoma, and ungual fibromas.
- angiofibromas fibrous forehead plaques, fibrofolliculoma, trichodiscoma, and perifollicular fibroma are the most similar to each other. These share histological and immunohistological features. In addition, ungual fibroma and shagreen patch share TSC1 TSC2 abnormalities.
- Benign adnexal tumors also include, but are not limited to, the tumors associated with Birt-Hogg-Dube syndrome, Brooke-Spiegler syndrome, Cowden syndrome (CS), familial basaloid follicular hamartoma syndrome, multiple endocrine neoplasia type 1 (MEN1), neurofibromatosis (NF1), Peutz-Jeghers syndrome (PJS), and tuberous sclerosis complex (TSC).
- Birt-Hogg-Dube syndrome Brooke-Spiegler syndrome
- CS Cowden syndrome
- MEN1 multiple endocrine neoplasia type 1
- NF1 neurofibromatosis
- JS jö-Jeghers syndrome
- TSC tuberous sclerosis complex
- Benign adnexal tumors consist of multiple cell types and show disorganized and excessive cell growth with a tendency to accentuate one skin structure.
- the tumors observed in CS which are called
- TSC tumors found in TSC
- NF1 which are called neurofibromas
- PJS tumors found in PJS
- TSC tuberous sclerosis
- TSC affects about 1 in 6000 live births and is characterized by seizures, cognitive dysfunction, and the development of tumor-like growths in the kidneys, heart, skin, lungs, and brain.
- the skin lesions develop in early childhood in nearly all patients and include angiofibromas, periungual fibromas, calcified retinal hamartomas, cortical tubers, renal angiomyolipomas, hypomelanotic macules, forehead fibrous plaques, facial angiofibromas, and shagreen patches.
- the severity of TSC and its impact on quality of life is extremely variable. The greatest source of morbidity is the brain tumors (cortical tubers), which cause seizures in 80-90% of affected individuals and behavioral abnormalities (mostly autism) in over half of affected individuals.
- the TSC1/TSC2 complex also plays a role in benign adnexal tumor syndromes caused by mutations in other genes.
- JS Peutz-Jeghers syndrome
- the LKB1 protein is a serine/threonine kinase that phosphorylates and activates adenosine monophosphate-activated protein kinase (AMPK), which in turn phosphorylates and activates TSC2.
- AMPK adenosine monophosphate-activated protein kinase
- PJS affects about 1 in 120,000 births.
- Cowden syndrome CS
- Bannayan-Riley-Ruvalcaba syndrome BRRS
- Proteus syndrome PS
- Lhermitte-Duclos disease LPD
- CS Cowden syndrome
- BRRS Bannayan-Riley-Ruvalcaba syndrome
- PS Proteus syndrome
- LDD Lhermitte-Duclos disease
- NF1 neurofibromatosis type 1
- NF1 neurofibromatosis type 1
- Ras Ras-GTPase-activating protein
- Ras has many functions in the cell, one of which is to inhibit the TSC1/TSC2 complex.
- NF1 occurs in about 1 in 3000 patients, and affected individuals can exhibit cognitive deficits, bone deformations, and hamartomatous lesions of the iris.
- Neurofibrosarcomas malignant NF1
- schwannomas develop in 3% to 15% of affected individuals, most often associated with deep neurofibromas.
- ADPKD autosomal dominant polycystic kidney disease
- the mTORC1/TSC1 TSC2 signaling network provides a common link among several different benign adnexal tumor syndromes.
- compositions of the invention include both skin substitutes and preparations for injection.
- the skin substitutes of the invention contain different cell types than prior art skin substitutes, yet may be prepared by any methods known to those in the art ( Figure 1 B).
- Figure 1 B Greenberg S et al., "In vivo transplantation of engineered human skin,” Methods Mol Biol., 289:425-30 (2005) discloses methods for creating in vitro skin substitutes.
- Shevchenko RV et al. "A review of tissue-engineered skin bioconstructs available for skin reconstruction," J R Soc Interface, 7(43):229-58 (2010) provides a review of various approaches that may be used for preparing skin substitutes. Exemplary methods are also provided in Example 9.
- the compositions comprising trichogenic cells are provided in the form of a skin substitute.
- the skin substitutes are formed by combining the trichogenic cells (or trichogenic cells with fibroblasts, endothelial cells, and/or other supportive mesenchymal cells) with a ground substance or matrix, and then overlaying the construct with epithelial cells.
- the epithelial cells Prior to grafting, the epithelial cells may be induced to partially or fully form a stratified squamous epithelium and cornified layer by exposing the surface of the substitute to air.
- the trichogenic cells may be cultured before combining with a matrix.
- the cell-matrix mixture is cultured before combining with the epithelial cells.
- the trichogenic cells are grown on or below, rather than being incorporated into, the ground substance or matrix, and this is overlaid with epithelial cells.
- the trichogenic cells are first made into microspheres before being incorporated or inserted into, or laid on, the ground substance/matrix/scaffold, and this is overlaid with epithelial cells.
- microspheres may be composed of trichogenic cells with or without epithelial cells and with or without matrix. If the microsphere has a matrix, it may be the same or different in composition from that of dermal scaffold.
- the ground may be composed of trichogenic cells with or without epithelial cells and with or without matrix. If the microsphere has a matrix, it may be the same or different in composition from that of dermal scaffold.
- substance/matrix/scaffold into which the microspheres are placed may be with or without added fibroblasts, endothelial cells, and/or other supportive mesenchymal cells.
- the spacing of the microspheres may be random or at intervals replicating the spacing of hair follicles in normal human skin.
- the trichogenic cells are used in a dermal construct that is made separately from the epidermal construct, and the two are grafted sequentially to the patient.
- the epithelial cells may be sprayed onto the grafted dermal construct, using an aerosol of cells in media or in fibrin glue.
- substance/mathx/scaffold include collagens, elastin, laminin, fibrin, hyaluronan or hyaluronic acid, fibronectin, chitosan, cellulose, silk fibroin, and alginates. These compounds may be human, rat, porcine, or bovine; from crustaceons or fungi (chitosan) or plants or algae (cellulose); or proteins expressed as recombinant forms in bacteria or other organisms.
- These compounds may also be modified or combined, such as hair keratin-collagen sponge, hyaluronan coupled with fibronectin functional domains, poly(lactic-co-glycolic acid)/chitosan hybrid nanofibrous membrane, polycaprolactone (PCL) collagen nanofibrous membrane, silk fibroin and alginate, polyvinyl alcohol/chitosan/fibroin blended sponge, tegaderm-nanofibre construct, bacterial cellulose, ICX-SKN skin graft replacement (InterCytex, Cambridge, England), collagen-glycosaminoglycan-chitosan, composite nano-titanium oxide-chitosan, Collatamp ® (EUSAPharma, Langhorne, PA), deacetylated chitin or plant cellulose transfer membranes.
- the scaffold may also be human, porcine, or bovine acellular dermis, tendon, or submucosa, that can be lyophilized, cross-linked, me
- the matrix, ground substance, or scaffold may also consist of or incorporate synthetic materials, including silicone, polysiloxane, polyglycolic acid, polylactic acid, nylon,
- PolyActiveTM matrix (OctoPlus, Cambridge, MA) (polyethylene oxide terephthalate and polybutylene terephthalate), and biodegradable polyurethane microfibers
- the skin substitute may be supplied sealed in a heavy gauge polyethylene bag with a 10% C0 2 /air atmosphere and agarose nutrient medium, ready for single use.
- the skin substitute may be kept in the sealed bag at
- the skin substitute may be supplied as a circular disk, for example, approximately 75 mm in diameter and 0.75 mm thick.
- the agarose shipping medium may contain agarose, L-glutamine, hydrocortisone, human recombinant insulin, ethanolamine, O-phosphorylethanolamine, adenine, selenious acid, DMEM powder, HAM's F-12 powder, sodium bicarbonate, calcium chloride, and water for injection.
- the skin substitute may optionally be stored on a plastic tray or in a cell culture dish within the bag.
- the skin substitute may be packaged with an epidermal (dull, matte finish) layer facing up and a dermal (glossy) layer facing down, resting on a polycarbonate membrane.
- the invention includes preparations for injection or implantation. These preparations may be prepared by any methods known to those in the art. Exemplary methods are provided in Example 9. In one embodiment, the
- mesenchymal cells are presented in a buffer suitable for injection, such as a sterile saline solution, phosphate buffered saline, Dulbecco's modified Eagle's medium (DMEM), Hank's balanced salt solution, Plasmalyte A, or RPMI.
- a buffer suitable for injection such as a sterile saline solution, phosphate buffered saline, Dulbecco's modified Eagle's medium (DMEM), Hank's balanced salt solution, Plasmalyte A, or RPMI.
- the mesenchymal cells are incorporated into microspheres.
- the mesenchymal cells are provided with a matrix or ground substance.
- the matrix may be natural polymers such as methylcellulose, collagen, chitosan, hyaluronic acid, gelatin, alginate, fibrin, fibronectin, or agarose.
- the matrix may be complex mixtures such as MatrigelTM or synthetic polymers.
- the mesenchymal cells are combined with epithelial cells with or without matrix or ground substance before injection or implantation.
- the compositions comprising trichogenic cells may be subdermally or intradermally injected or implanted at a site where hair growth is desired without further culture.
- Cells prepared by dissociation methods as described in Example 3B may be resuspended in buffer and injected directly or first incorporated into microspheres prior to injection or implantation.
- the cells in culture medium can be stored on ice for 24 or more hours or frozen in liquid nitrogen for long-term storage. For cryopreservation, cells are placed in a solution of 10% DMSO, 70% DMEM and 20% fetal bovine serum.
- Cells are placed in cryovials at a concentration of 0.1-10 million cells per ml and frozen in a control-rate freezer and stored at -180°C until the day of injection or implantation. Viability of all thawed cells may be verified to be more than 85% before use.
- compositions comprising trichogenic cells may be injected or implanted into recipient skin or wound. Compositions may also be injected or implanted into grafts (split-thickness grafts or skin substitutes including dermal- epidermal composites and dermal constructs combined with epidermal constructs or cell spraying) before application to the patient or following grafting. In another embodiment, the compositions comprising trichogenic cells may be cultured before injection or implantation.
- the invention provides for at least two modes of administering the skin substitutes of the invention.
- the skin substitutes of the invention may be grafted onto a patient ( Figure 1 C) or they may be injected into a patient.
- the invention provides a method for transplanting cells to a patient that are capable of inducing human hair follicles in the patient.
- compositions of the invention are useful for treating patients with full-thickness or partial-thickness skin loss, devitalized skin, wounds, ulcers, chemical or thermal burns, scars, and full or partial losses or abnormalities of hair, sebaceous glands, or eccrine glands that may be congenital or acquired.
- Skin injuries are grouped into three categories: epidermal, partial-thickness, and full- thickness. Epidermal injuries do not require specific surgical treatment, as only the epidermis is affected and this regenerates rapidly without scarring. Partial-thickness wounds affect the epidermis and the dermis.
- Such wounds generally heal by epithelialization from the margins of the wound, where basal keratinocytes from the wound edge, hair follicle, or sweat glands migrate to cover the damaged area.
- Full- thickness injuries are characterized by the complete destruction of epithelial- regenerative elements. This type of injury heals by contraction, with epithelialization from only the edge of the wound. Partial-thickness injuries and full-thickness injuries often require skin grafting.
- compositions of the invention may also be used to treat surgical wounds. For example, the removal of large skin lesions, such as giant nevi (moles), leaves wounds that cannot heal on their own, and are too large for autologous split- thickness skin grafts.
- the compositions of the invention will be useful for treating such lesions.
- hair loss is a progressive hair thinning condition called androgenic alopecia. Hair loss can occur on any part of the body and can arise from any number of factors. For example, traction alopecia is most commonly found in people who pull on their hair with excessive force into ponytails or cornrows. Alopecia areata is an autoimmune disorder that can result in hair loss in just one location (alopecia areata monolocularis), or can result in the loss of every hair on the entire body (alopecia areata universalis). Hypothyroidism, tumors, and skin outgrowths (such as cysts) also induce localized baldness.
- Hair loss can also be caused by chemotherapy, radiation therapy, childbirth, major surgery, poisoning, mycotic infections, and severe stress.
- iron deficiency is a common cause of hair thinning.
- the hair follicles have stopped cycling and have entered a quiescent stage. In other cases, the hair follicles are lost completely, or never formed in the first place.
- compositions and methods of the invention are useful for treating any condition requiring growth of hair follicles.
- the method also induces eccrine glands.
- the method further induces sebaceous glands.
- the method comprises grafting to a patient the skin substitute of the invention.
- the skin substitutes of the invention may be administered by any suitable technique known to those skilled in the art.
- the graft site may be prepared by any technique known to those skilled in the art.
- An exemplary technique is provided in Example 12.
- the graft site may be injured skin (for example, partial- or full-thickness chemical or thermal burns, denuded skin, or devitalized skin), a wound bed with partial or complete absence of skin (for example, a site where the skin was avulsed or ulcerated), a surgical wound (for example, following excision of benign or malignant skin growths), or skin with any congenital (for example, aplasia cutis congenita) or acquired (for example, skin scarred by any cause) reduction, abnormality, or absence of hair follicles, sebaceous glands, and/or eccrine glands.
- any congenital for example, aplasia cutis congenita
- acquired for example, skin scarred by any cause
- the graft site is washed with water, an antibiotic wash, or an alcohol solution (such as an alcohol swab).
- an alcohol solution such as an alcohol swab
- a desired pattern of hair is drawn on the graft site with a surgical marker.
- a local anesthetic is administered to the patient.
- a gaseous, intravenous, or nerve block anesthetic may be administered to the patient.
- the existing skin tissue, devitalized tissue, eschar, wound or ulcer edges, or scar tissue is removed using standard techniques in the art.
- any skin infections or deteriorating conditions should be resolved prior to application of the graft.
- Antimicrobial, antifungal, and antiviral agents, administered topically or systemically, may be used during a period of time (such as a week) prior to and following administration of the skin substitute to reduce the risk of infection.
- Skin substitutes may be applied to a clean, debrided skin surface after thoroughly irrigating the wound with a non-cytotoxic solution.
- Debridement may extend to healthy, viable, bleeding tissue. Prior to application, hemostasis may be achieved.
- the wound Prior to debridement the wound may be thoroughly cleansed with sterile saline to remove loose debris and necrotic tissue. Using tissue nippers, a surgical blade, or curette, hyperkeratotic and/or necrotic tissue and debris may be removed from the wound surface. Ulcer margins may be debrided to have a saucer effect. After debridement, the wound may be cleansed thoroughly with sterile saline solution and gently dried with gauze. Oozing or bleeding resulting from
- debridement or revision of wound edges may be stopped through the use of gentle pressure, or if necessary ligation of vessels, electrocautery, chemical cautery, or laser.
- Heavy exudation may displace a skin substitute and reduce adherence. Exudation may be minimized by appropriate clinical treatment. For example, sterile air at room temperature or up to 42°C may be blown over the wound until the wound is sticky. If exudation persists, the skin substitute may be made permeable to exudate by perforating the skin substitute to allow for drainage.
- Skin substitutes may be applied in the outpatient clinic or in a surgical suite depending on the size of the defect being repaired, pain level, and the need for general anesthesia. Exemplary techniques are described in Examples 11 and 12. Before applying the skin substitute, the practitioner can review the expiration date of the skin substitute, check the pH, and visually observe and smell the skin substitute to ensure that there are no contaminants, such as bacterial contaminants or particulate matter.
- the skin substitute may be stored in a polyethylene bag at controlled temperature 68°F-73°F (20°C-23°C) until
- the practitioner may cut open the sealed polyethylene bag, and if the skin substitute is provided in a cell culture dish or plastic tray, it may be transferred to the sterile field with aseptic technique. If present, a tray or cell culture dish lid may be lifted off, and the practitioner may note the epidermal and dermal layer orientation of the skin substitute. Using a sterile atraumatic instrument, a practitioner may gently dislodge approximately 0.5 inch of the skin substitute away from the wall of the tray or cell culture dish. When lifting the skin substitute, a practitioner may be careful not to perforate or lift any membrane beneath the skin substitute, which, if present, should remain in the tray.
- a practitioner may insert one index finger under the released section of the skin substitute and use the other index finger to grasp the skin substitute in a second spot along the edge of the device. Holding the skin substitute in two places, the practitioner may lift the entire skin substitute out of the tray or cell culture dish using a smooth, even motion. If excessive folding occurs, the skin substitute can be floated (epidermal surface up) onto warm sterile saline solution in a sterile tray.
- the skin substitute may be placed so that the dermal layer (the glossy layer closest to the medium) is in direct contact with the site for the skin substitute.
- the practitioner may smooth the skin substitute onto the site so there are no air bubbles or wrinkled edges. If the skin substitute is larger than the site for application, the excess skin substitute may be trimmed away to prevent it from adhering to the dressing. If the skin substitute is smaller than the site for application, multiple skin substitutes may be applied adjacent to each other until the defect is filled.
- the skin substitute may be secured with any appropriate clinical dressing. Sutures or samples are not required but may be used in some instances to anchor the graft to the graft bed. Dressings may be used to assure contact of the skin substitute to the site for application and to prevent movement. Therapeutic compression may be applied to the graft site. In some cases it may be necessary to immobilize the grafted limb to minimize shearing forces between the skin substitute and the application site. Dressings may be changed once a week or more frequently if necessary.
- Additional applications of skin substitutes may be necessary in certain instances. Prior to additional applications, non-adherent remnants of a prior skin graft or skin substitute should be gently removed. Healing tissue or adherent skin substitutes may be left in place. The site may be cleansed with a non-cytotoxic solution prior to additional applications of skin substitute. In one embodiment, an additional skin substitute may be applied to the areas where the prior skin substitute is not adherent.
- the trichogenic cells of the invention may be injected by any suitable method known to those skilled in the art.
- An exemplary method is described in Example 1 .
- the method comprises subdermally or
- the method further comprises delivering epithelial cells to the patient.
- Cells may be delivered as a suspension or as microspheres. When injecting a suspension, each injection site may deliver 50-2,000 cells. When injecting microspheres, each injection site may deliver one or more microspheres.
- the graft site may be washed with water, an antibiotic wash, or an alcohol solution (such as an alcohol swab).
- a desired pattern of hair may be drawn on the graft site with a surgical marker, either in an outline fashion or a pixilated fashion showing each injection site.
- Paper templates or templates of other material may also be applied to the injection site showing the pattern for injection, or injections may be delivered at the correct spacing by using robotics or a device with multiple injection ports in a grid.
- a local anesthetic may be administered to the patient. In cases requiring further anesthetics, a gaseous, intravenous, or nerve block anesthetic may be
- the injections may be administered according to techniques known in the art for subdermal or intradermal injections.
- a concentration of 1 ,000 to 20,000 cells/ml may be used in the injection.
- a volume of 0.05 to 0.1 ml may be injected at each injection site using a 1-3 ml syringe with a 14-30 gauge needle.
- the skin is pulled taut, and the needle is inserted bevel up at a 5° to 30° angle with the skin.
- the cells are then injected slowly with gentle pressure, the needle is removed, and gentle pressure is applied to prevent leakage and promote absorption.
- Injections may be repeated over a period of time, either for patient comfort or because additional hair follicles may be produced after repeated administration.
- the administrations may be spaced a week apart, two weeks, three weeks, a month, two months, three months, or six months apart.
- TSC skin hamartomas including fibrous forehead plaques, angiofibromas, and periungual fibromas, contain dermal and/or perifollicular fibroblast-like cells and variable changes in the epithelium.
- Patients diagnosed with TSC were enrolled in an Institutional Review Board-approved protocol, 00-H-0051 at the National Heart, Lung, and Blood Institute, NIH.
- Samples of angiofibromas, periungual fibromas, fibrous plaques, and normal-appearing skin from TSC patients were obtained and bisected, with one portion used for routine pathology and the other used for frozen sections or cell culture.
- macrophages were detected in the samples by immunohistochemical staining with rat anti-mouse F4/80 antibody (Abeam). Macrophage content in the dermis was measured using a 20X objective by counting three random fields of each section and normalizing by area. CD68-positive mononuclear phagocytes were identified by immunohistochemical staining using an ABC kit (vector) and an anti-CD68 antibody (M0814, DakoCytomation). Finally, elevated mTORCI function was determined by immunostaining for phosphorylated ribosomal protein S6 (anti-pS6, 2211 , Cell Signaling).
- the fibrous plaques showed larger cells, altered collagen structure, and increased vessels compared to normal skin ( Figure 3A and 3B).
- Fibroblast-like cells from TSC fibrous plaques like angiofibromas and ungual fibromas, also showed increased immunoreactivity for phosphorylated ribosomal protein S6 compared to normal fibroblasts ( Figures 3C and 3D), indicating that fibrous plaques exhibit increased mTOR function compared to normal skin.
- the epidermis of the fibrous plaques also exhibited greater immunoreactivity for pS6 ( Figures 3C and 3D), as well as greater proliferation (Figures 3E and 3F) than normal skin. This may be caused by paracrine factors released by the TSC2-null cells.
- the ungual fibromas did not have follicular structures.
- Fibroblasts were isolated from the angiofibromas, periungual fibromas, forehead plaques, and normal-appearing skin biopsies by cutting the biopsies into small pieces and plating them on 35 mm culture dishes in 1 ml DMEM with 10% FBS, penicillin (100 U/ml) and streptomycin (100 pg/ml) to cover the tissue. The medium was changed twice a week until the cells migrated to cover the dishes. The cells were then harvested for sub-culture.
- the isolated cells were analyzed for TSC2 expression by PCR, restriction digestion, and sequence verification. Briefly, DNA isolated from the cultured cells was used for amplification of exon 10 of TSC2 using AmpliTaq gold DNA polymerase (Applied Biosystems) in magnesium-containing buffer supplied by the manufacturer. Thermocycling was performed as follows: denaturation at 95°C for 30 seconds, annealing at 59°C for 1 minute, and extension at 72°C for 1 minute, followed by cycling 34 times and a final extension at 72°C for 1 minute. The PCR- amplified DNA products were separated by electrophoresis and purified by
- PCR primers for sequencing were:
- the PCR-amplified DNA products were also analyzed by restriction enzyme digestion.
- the PCR primers were used to amplify exon 10 for enzyme digestion analysis were: 5'AAGCAGCTCTGACCCTGTGT3' and
- the cells were also analyzed for hyperphosphorylation of ribosomal protein S6 under conditions of serum starvation.
- Cells (5 X 10 5 cells in DMEM with 10% FBS) are seeded in 60-mm dishes. The next day, the medium was replaced by serum-free DMEM.
- cells were lysed in protein extraction buffer (20 mM Tris, pH 7.5, 150m NaCI, 1% Nonidet P- 40, 20 mM NaF, 2.5 mM Na 2 P 4 0 7 , 1mM ⁇ -glycerophosphate, 1 mM benzamidine, 10 mM p-nitrophenyl phosphate, 1 mM phenylmethylsulfonyl fluoride).
- protein extraction buffer (20 mM Tris, pH 7.5, 150m NaCI, 1% Nonidet P- 40, 20 mM NaF, 2.5 mM Na 2 P 4 0 7 , 1mM ⁇ -glycerophosphate, 1 mM benzamidine, 10 mM p-nitrophenyl phosphate, 1 mM phenylmethylsulfonyl fluoride).
- the cells were also treated with rapamycin, which inhibits mTORCI .
- TSC skin tumor cells or normal-appearing fibroblasts were plated in a 96-well plate (2000 cells per well) in DMEM containing 10% FBS. The next day, the medium was changed to 10% FBS/DMEM with or without rapamycin at 0.2 nM, 2 nM, or 20 nM for 3 days. The cell numbers were then assessed using an MTT cell proliferation assay kit (CELLTITER ® Non-Radioactive Cell Proliferation Assay (Promega, Madison, Wl)). These experiments revealed that rapamycin blocked mTORCI activation (Figure 6A), (mTORCI activation was measured by
- melanocytes were isolated from foreskins of unidentified normal neonates by treating with dispase (Becton Dickinson Labware, Bedford, MA) at 4°C overnight.
- the epidermal sheet was separated from dermal sheets and subsequently digested with 0.05% trypsin-0.53 mM EDTA (Invitrogen, Gaithersburg, MD) at 37°C for 20 min.
- the cells were collected and plated on tissue culture dishes in keratinocyte serum-free media (Invitrogen) supplemented with bovine pituitary extract and recombinant epidermal growth factor.
- Skin substitutes were created by mixing TSC2-null skin tumor cells or TSC2 normal fibroblasts harvested from female patients with 1 mg/ml of rat tail collagen type 1 (BD Biosciences, Bedford, MA) in 10% FBS/DMEM. The mixture was placed into 6-well Transwell plates (Corning Inc., Corning, NY) at a density of 0.5 x 10 6 cells per well. The cell mixture was cultured for 3 days, and then the cultured keratinocytes were added at a density of 1 x 10 6 cells per well. The constructs were then submerged in a 3:1 mixture of DMEM and Ham's F12
- keratinocytes were brought to the air-liquid interface, by removing some of the liquid, and cultured in DMEM and Ham's F12 (1 :1 ) containing 1 % FBS for another 2 days before grafting.
- mice were grafted in a surgery room using 6-8 week old female Cr:NIH(S)-nu/nu mice (FCRDC, Frederick, MD). Mice were anesthetized using inhalant anesthesia with a mixture of 0 2 and isoflurane (2-4%). The grafting area on the back of the mouse was estimated, and skin was removed using curved scissors after washing with povidine and 70% ethanol. Skin substitutes were placed on the graft bed in correct anatomical orientation, covered with sterile petroleum jelly gauze, and secured with bandages. The mice were then transferred to sterile cages after reawakening. The bandages were changed at week 2 and removed after 4 weeks.
- mice sacrificed 8 to 17 weeks after grafting grafts containing TSC normal fibroblasts formed skin without hair follicles ( Figure 8A). Grafts containing TSC2-null cells from certain TSC skin tumors formed hair follicles ( Figure 8B, Table 1), suggesting that TSC skin tumor cells induced follicular neogenesis in the foreskin keratinocytes.
- a hair shaft, sebaceous glands, concentric layers of inner and outer root sheath surrounded by a dermal sheath, and hair bulb with dermal papilla, hair matrix, and cortex were all present (Figure 9A-9D).
- the hair follicles mimicked the region from which they were obtained. For example, as in facial skin, more follicles were in catagen (regressing) and telogen (resting) than anagen (growing), which is more typical of scalp follicles (Figure 8B).
- hair shafts were not visible from the skin surface of grafts of cells harvested from the forehead or nose (Figure 1 C).
- mesenchymal cells from the scalp are used to treat a balding scalp, while mesenchymal cells from the arm are used to treat a burn on the arm).
- keratinocytes which are of male origin
- TSC2-null cells from female patients.
- Y chromosome FISH was carried out using CEP Y (DY21 ) chromosome spectrum orange probe (Vysis, Downers IL60515) according to the manufacturer's protocol.
- the probe hybridized to nuclei in the epidermis and the follicular epithelium, but not to the nuclei of dermal cells ( Figures 9G and 9H) or flanking normal mouse skin (not shown).
- Sections were also analyzed for alkaline phosphatase activity.
- TSC2-null cells are multipotent progenitor cells that can exhibit features of dermal fibroblasts or dermal papilla/dermal sheath cells.
- mice were sacrificed 24 hours after the last injection, the grafts were harvested, and one half of each graft was prepared for paraffin embedding, while the other half was prepared for frozen sections. Paraffin sections were stained for blood vessels (CD31) ( Figures 11Q-1 1T), phosphorylation of ribosomal protein S6 (pS6) ( Figures 11 E-11 H), and persistence of human cells (COX-IV) ( Figures 11A-11 D). Frozen sections were stained for cell proliferation (Ki- 67) ( Figures 11 I-11 L), and tumor associated macrophages (F4/80) ( Figures 11 M- 11 P).
- mice treated with or without rapamycin There were no gross differences in size or appearance between tumor and normal grafts in mice treated with or without rapamycin.
- the numbers of COX IV-positive cells in the dermis of the tumor grafts was similar to those in normal grafts ( Figures 11 A, 11 C, and 12A).
- tumor grafts treated with vehicle contained greater numbers of dermal and epidermal cells immunoreactive for pS6 than normal grafts ( Figures 1 E, 11 G, 12B, and 12C ).
- the epidermis of tumor grafts treated with vehicle had greater numbers of Ki-67-positive cells than normal grafts ( Figures 111, 1 K, and 12D).
- Tumor grafts treated with vehicle also contained increased numbers of CD68-positive
- Rapamycin treatment decreased the number of human dermal cells in tumor xenografts, as determined by staining with human anti-HLA class I (Figure 13C,D) or COX-IV antibodies ( Figure 11 C,D), but tumor cells persisted throughout treatment. Rapamycin had no significant effects on cell number in normal xenografts ( Figures 13 and 14). Persistence of TSC2-null cells at the end of treatment was confirmed by the presence of mutant DNA in both microdissected dermis of tumor xenografts and in fibroblasts grown from tumor xenografts following harvesting (data not shown).
- TSC2-null cells persisted despite in vivo penetration of rapamycin, as shown by loss of pS6 immunoreactivity in dermal and epidermal cells ( Figures 1 E and 11G). Rapamycin treatment decreased the number of Ki-67 positive epidermal cells, mononuclear phagocytes, and vessel density, size, and total area in tumor grafts ( Figures 11 and 12). These results suggest that the decreased redness and size of TSC skin lesions observed in patients taking rapamycin may result from both anti-tumor cell effects and anti-angiogenic effects.
- the antiangiogenic effects of rapamycin may be due to direct inhibition of vascular endothelium and/or indirect effects such as decreased release of angiogenic factors by TSC2-null cells or decreased recruitment of pro-angiogenic mononuclear cells. Rapamycin did not influence the percentage of grafts with hair follicles, hair follicle density, or hair follicle diameter (Table 1). The lack of effect on hair follicle parameters may indicate that induction of follicles is mTORCI -independent, or that rapamycin was ineffective after follicular neogenesis had commenced.
- DAPI stain showed nuclei of cells comprising the hair follicle bulb, including the follicular epithelium and dermal papilla/dermal sheath cells and, at the left lower corner, vascular endothelial cells.
- the Cy3 human-specific centromeric probe marked cells in the hair follicle bulb, including cells of the lower dermal sheath (horizontal arrow) and adjacent dermal fibroblasts (vertical arrows).
- the FITC mouse-specific centromeric probe labeled endothelial cells (arrowhead).
- a merged image showed that cells of the follicular epithelium, dermal sheath, and dermal papilla were of human origin (arrows).
- This example discloses skin substitutes capable of follicular neogenesis. This example also discloses the development of a xenograft model for skin hamartomas in tuberous sclerosis complex (TSC). TSC2-null fibroblast-like cells grown from human TSC skin hamartomas, but not fibroblasts from patient normal-appearing skin, stimulated histological changes mimicking TSC
- TSC tuberous sclerosis complex
- TSC2-null cells surrounding the lower portion of the hair follicle i.e., the hair bulb
- Tumor xenografts recapitulated features of TSC skin hamartomas including increased mTORCI function, angiogenesis, and proliferation of overlying epidermal cells. Treatment with rapamycin, an mTORCI inhibitor, normalized these parameters and reduced the number of tumor cells, but did not alter hair follicle size or density.
- TSC2-null fibroblast-like cells are the inciting cells for TSC skin hamartomas, simulating angiogenesis, and are capable of inducing follicular neogenesis.
- the expression of stem-cell markers and the preservation of hair-inducing ability by these cells suggest that loss of TSC2 function alters differentiation of a multipotent progenitor cell in the dermis.
- TSC2-null cells from angiofibromas and fibrous plaques are tools for exploring follicular morphogenesis and regeneration.
- TSC skin tumors usually arise postnatally suggests the possibility of creating or enhancing follicle-inducing cells by using agents impacting the TSC1 TSC2 network and/or signaling networks involved in the genesis of other follicular hamartomas. This study of hamartomas provides insights into tissue organization and maturation.
- shRNA was used to knock down TSC2 expression in cultured fibroblasts and dermal papilla cells.
- shRNA was also used to knock down FLCN expression in cultured fibroblasts and dermal papilla cells. As discussed below, TSC2 and FLCN knockdowns enhanced the trichogenic properties of cells.
- Wild-type mesenchymal cells i.e., dermal fibroblasts and dermal papilla cells
- TSC1/TSC2 function i.e., dermal fibroblasts and dermal papilla cells
- wild-type mesenchymal cells were modified to mimic loss of TSC1/TSC2 function by decreasing expression of FLCN using shRNA to FLCN.
- Commercially available lentiviral particles carrying the pGIPZ-lentiviral shRNAmir vector containing a hairpin sequence targeting TSC2 (Open Biosystems) were used to knockdown TSC2 expression.
- lentiviral particles carrying the pGIPZ-lentiviral shRNAmir vector contianing a hairpin seqeunce targeting FLCN (Open Biosystems) were used ot knockdown FLCN expression.
- Neonatal foreskin fibroblasts or human dermal papilla cells were transduced by the lentiviral particles followed by puromycin selection (2 g/ml) starting 48 hrs post transduction.
- the cells stably expressing shRNA (as determined by GFP-expression) were pooled and maintained in puromycin.
- a pGIPZ lentivirus containing a non-targeting shRNA control (shNT, NT) with no homology to known mammalian genes was used as the negative control for the knockdown experiments.
- Figure 16 shows the successful expression of GFP in all of the stably transfected foreskin fibroblasts from a TSC2 knockdown experiment. All cells remained permanently transduced for at least 1 passages. Western blot analysis confirmed that the transductions resulted in a more than 90% knockdown of TSC2 ( Figure 17, top band). The same results were observed in dermal papilla cells transduced with TSC2 knock-down vectors (data not shown). In addition, the FLCN knock-down particles transduced 00% of fibroblasts (data not shown). Thus, virtually all cells were transduced with the vectors used for knocking down the genes of interest, and expression of the target genes was substantially reduced.
- TSC1 TSC2 function.
- Alkaline phosphatase is a marker for dermal papilla cells, and dermal papilla cells with higher alkaline phosphatase activity have greater capacity for inducing hair follicles in vivo. Accordingly, alkaline phosphatase activity was measured in the cultured transduced cells to determine whether knockdown of TSC2 or FLCN expression resulted in increased numbers of trichogenic cells. As shown in Figure 18, human dermal papilla cells have high alkaline phosphatase activity during early passage, which rapidly decreases with subsequent passage.
- Figure 21 compares the structures formed in hanging drop cultures using keratinocytes and fibroblasts transduced with TSC2-knockdown shRNA or non-template (NT) control.
- Clusters with TSC2-knockdown cells tended to show greater organization, with keratinocytes surrounding the fibroblasts ( Figures 21A and 21 C), whereas NT controls tended to remain disorganized ( Figures 21 B and 21 D).
- Hair-fiber-like structures were observed in TSC2-knockdown cultures.
- refractile fiber-like structures formed that auto-fluoresced with the same green color as normal human hair ( Figure 2 E).
- These clusters with TSC2- knockdown cells may be implanted into skin or incorporated into grafts for hair follicle formation, as discussed below.
- Dermal-epidermal composites were generated using neonatal foreskin fibroblast (NFF) or dermal papilla cells transduced and stably expressing TSC2 knockdown vector.
- the cells were mixed with 1 mg/mL of rat tail collagen type 1 in 10% FBS/DMEM, and added to 6-well transwell plates at a density of 0.5 X 10 6 cells per well.
- the dermal constructs were grown in 10% FBS/DMEM for 3 days. Five 30,000 cell hanging drop microspheres of NFF transduced with shTSC2 were placed gently on the dermal constructs and overlaid with 1 X 10 6 keratinocytes.
- the dermal-epidermal composites were incubated for 4 days submerged in a mixture of DMEM and Ham's F12 (3:1 ) containing 0.1 % FBS, after which the composites were brought to the air-liquid interface and the skin equivalents were fixed in 10% formalin after growing for either 4 or 8 days in DMEM and Ham's F12 (1 :1 ) containing 1 % FBS.
- the skin equivalents were then analyzed by hematoxylin and eosin (H&E), and immunohistochemistry was performed with anti-pan-cytokeratin antibody.
- the dermal-epidermal composites composed of normal human keratinocytes and fibroblasts in a collagen gel formed a stratified squamous epithelium overlying the dermal equivalent, and the dermal epidermal junction was fairly straight without invaginations of keratinocytes.
- tubular invaginations of keratinocytes formed by 4 days ( Figure 22A), and by 8 days these invaginations had enlarged into multicellular tubes with a peripheral rim of pallisading keratinocytes ( Figure 22B), similar in appearance to a developing hair follicle.
- mice grafting experiments were performed to determine if knockdown of TSC2 promotes formation of hair follicles in vivo. Briefly, neonatal foreskin fibroblast and dermal papilla were transduced and selected for either TSC2 knockdown vector or nontargeting vector as discussed above. The cells were mixed with 1 mg/ml of rat tail collagen type 1 (BD Biosciences, Bedford, MA) in 10% FBS/D EM, and added to 6-well transwell plates (Corning Incorporated, Corning, NY) at a density of 0.5 X 10 6 cells per well. The dermal constructs were grown in 10% FBS/DMEM for 3 days and overlaid with 1 X 10 6 keratinocytes .
- rat tail collagen type 1 BD Biosciences, Bedford, MA
- FBS/D EM 6-well transwell plates
- the dermal- epidermal composites were incubated for 2 days submerged in a mixture of DMEM and Ham's F12 (3:1) (GIBCO/lnvitrogen, Grand Island, NY) containing 0.1 % FBS, after which the composites were brought to the air-liquid interface and grown for another 2 days in DMEM and Ham's F12 (1 :1) containing 1% FBS before grafting.
- mice Female 6-8 week old Cr:NIH(S)-nu/nu mice (FCRDC, Frederick, MD) were anesthetized with a mixture of 0 2 and isoflurane (2-4%). The grafting area on the back of the mouse was carefully estimated, and skin was removed using curved scissors. Composites were placed on the graft bed in correct anatomical orientation, covered with sterile petroleum jelly gauze, and secured with bandages. The bandages were changed at 2 weeks and removed after 4 weeks.
- mice were grafted (6 mice - neonatal foreskin fibroblast with non-targeting control shRNA; 14 mice - neonatal foreskin fibroblast with TSC2 shRNA; 6 mice - dermal papilla with non-targeting control shRNA; and 13 mice - dermal papilla with TSC2 shRNA).
- shTSC2 fibroblasts induced hair-follicle-like structures in one of three mice sampled
- shTSC2 dermal papilla cells induced hair follicles in one of three mice sampled ( Figure 23). Results are pending for the other mice at the time of filing.
- EXAMPLE 3 ISOLATION OF MESENCHYMAL CELLS FROM ADNEXAL TUMORS OR NORMAL HUMAN SKIN
- Mesenchymal cells may be isolated from one or more of the following sources: patient skin or mucosa for autologous cells; donor skin or mucosa for allogeneic cells; normal skin or mucosa; skin with an adnexal tumor; and other tissues (e.g. fat, bone marrow, etc.).
- Fibroblasts may be isolated by enzyme digestion if the sample size is sufficiently large (i.e., greater than or equal to 1 cm 3 ).
- Cells may be isolated from skin samples or skin tumors using a cell migration method.
- skin samples are cut into small pieces and transferred into 35 or 100 mm sterile dishes containing 1 or 5 ml_ of 10% FBS/DMEM or mesenchymal stem cell growth medium (MSCGM; Lonza Group Ltd, Switzerland).
- the plates are incubated in a 5% C0 2 incubator at 37°C.
- the medium is changed twice a week until a substantial number of mesenchymal cells are observed.
- the cells migrating out of tissue fragments are regularly monitored using an inverted microscope.
- Mesenchymal cells are subcultured when they occupy most of the dish surface between explants (approximately 2-3 weeks after start of the culture). The cells are harvested for sub-culture and the small tissue pieces are transferred to fresh dishes for isolating more cells, repeating the transfer of explants more than 10 times until cells no longer migrate from the tissue. Cells from each transfer are stored in liquid nitrogen at early passage.
- Cell dissociation from skin samples or skin tumors may be used to isolate mesenchymal cells.
- the skin sample (1 X 1 cm) is treated overnight in 60 mm dishes with 3 ml of dispase at 4°C.
- samples may be treated with 0.25% trypsin for 30 minutes at room temperature.
- the dermis is separated from the epidermal sheet and cut into small pieces.
- the sample is incubated in a 50 ml centrifuge tube with 10 ml of enzyme solution (HEPES containing Richter's improved MEM insulin medium (RPMI), supplemented with 1 mM sodium pyruvate, 2.75 mg/mL bacterial collagenase, 1.25 mg/mL hyaluronidase, and 0.1 mg/mL DNase I) at room temperature for 3 h.
- HPES Richter's improved MEM insulin medium
- RPMI Richter's improved MEM insulin medium
- the supernatant is discarded, and the cell pellet is resuspended in 10 ml of medium (such as mesenchymal stem cell growth medium or DMEM plus 10%FBS) and transferred into a 75-cm 2 culture dish.
- medium such as mesenchymal stem cell growth medium or DMEM plus 10%FBS
- the cells are cultured in a 5% C0 2 incubator at 37°C, and the medium is changed 24 h later to remove nonadherent material.
- the cell concentration is determined three times in three independently taken samples (isolation cell yield), and viability is assessed by trypan blue (Sigma) exclusion.
- Cells are seeded in culture at a density of 5 x 10 4 or 10 * 10 4 cells/cm 2 in three separate flasks. After 24 hours, the percentage of attached cells is assessed using an inverted microscope connected to a video camera with frame grabber image- printer.
- Dermal papilla cells may be isolated from samples of human scalp by microdissection, followed by treatment with collagenase for 30 minutes with mild agitation at 37°C. The enrichment for dermal papilla cells may be confirmed using toluidine blue staining, or by examining the cells for intranuclear rodlets. Cells may be grown in a 1 :1 mixture of Chang medium and keratinocyte-conditioned medium, changed every 2-3 days.
- Dermal sheath cells may be isolated from normal adult human skin by dicing human skin samples and then enzymatically dissociating the samples with collagenase. Enzymatic dissociation yields more cells in a shorter time period than using skin explants. Moreover, cell viability and proliferation are sufficient to populate dermal equivalents for autologous grafting. Dermal sheath cells may be identified by incubating the cells with FITC labeled anti-CD10 antibody for 30 min. at 4°C, followed by cell sorting.
- DP and DS cells may also be isolated by rinsing normal human scalp tissue (1 X 1 cm) in Hanks buffer three times, each for 10 min, cutting into strips about 0.3-0.5 cm in width, and cutting off at the interface of dermis and subcutaneous fat.
- the subcutaneous tissue is incubated with 3-5 ml of 0.5% dispase (Sigma Chemical Co. St. Louis, MO) at 4°C for 16-18 h.
- the hair follicles are pulled out from cutaneous fat.
- the epithelia are extruded out from the dermal sheaths by applying gentle pressure with the tip of a pair of microforceps.
- the dermal sheaths are incubated in 0.2% collagenase D (Boehringer Mannheim, Germany) in Engle's minimum essential medium (MEM) (ICN Biomedicals, Inc., Aurora, OH, USA) containing 0% FBS at 37°C for 6-8 hours until the stalk of dermal papilla is digested under microscope control.
- MEM Engle's minimum essential medium
- the enzyme digestion is stopped. Hanks is added and the suspension is centrifuged for 5 minutes at 2000 rpm, which is repeated three times.
- the pellet is resuspended and centrifuged at low-speed at 200 rpm for 5 minutes and repeated three times leaving DS cells in the supernatant for culture.
- Dermal papillae are completely isolated out from residue with low-speed centrifugation.
- the final dermal papilla pellet is
- the isolated dermal papilla and dermal sheath cells may then be incubated in any suitable medium to test for induction or maintenance of dermal papilla and dermal sheath markers.
- Human mesenchymal cells are isolated using similar methods as skin-derived precursors. (Biernaskie, J. A. et al., Isolation of skin-derived precursors (SKPs) and differentiation and enrichment of their Schwann cell progeny, Nature protocols 1(6): 2803-2812 (2006)). Briefly, human skin samples or skin tumors are washed in HBSS, cut into small pieces measuring 3-5 mm 2 and digested in a 10 cm plastic tissue culture dishes filled with 25 ml of Blendzyme solution (Roche) for 24- 48 hours at 4°C.
- Blendzyme solution (Roche) for 24- 48 hours at 4°C.
- the epidermis is peeled away from the underlying dermis using fine forceps, and the isolated dermal tissue is minced into small, 1-2 mm 2 pieces using a razor blade. These small pieces of human dermis are collected into 15-ml conical tubes containing 5-10 ml of fresh Blendzyme solution. DNasel (one 400 ⁇ aliquot) can also be added to the suspension to reduce aggregation of cells. For most efficient digestion of the tissue, the sample may be gently agitated for 1-2 h at 37°C. Upon completion of the digestion, 20 ml wash medium plus 0% FBS is added to inactivate the Blendzyme. The tissue samples are centrifuged at
- the supernatant is collected into a 50 ml collection tube and kept on ice.
- the tissue pellet is dissociated in fresh medium for repeating the trituration step until the tissue pieces become thin and cells can no longer be liberated.
- the dissociated cell suspension is passed through a 70 pm cell strainer into a 50 ml conical tube and centrifuged at 1 ,200 r.p.m. for 7 min.
- the cell pellet is
- the dissociated dermal cells are diluted into 30 ml of proliferation medium (DMEM/F12 (3:1) containing 0.1% penicillin/streptomycin, 40 pg/ml fungizone, 40 ng/ml FGF2, 20 ng/ml EGF, 2% B27 supplement) for a 75 cm 2 flask and 10 ml for a 25 cm 2 flask.
- the cells are cultured for 7-14 days without passaging for the formation of spherical colonies, and the medium is changed every 4-5 days.
- lentiviral particles from custom cloned short hairpin RNA (shRNA) or non-target shRNA control in pLK0.1-puro-CMV-tGFP vector may be used according to the manufacturer's instructions.
- shRNA short hairpin RNA
- pLK0.1-puro-CMV-tGFP vector Sigma
- the medium is replaced by 2 ml of fresh 10% FBS/DMEM containing shRNA for the indicated gene or control shRNA lentiviral particles (0, 1 , 2, 5, 10 or 20 MOI) plus 8 pg/ml of hexadimethrine bromide and incubated overnight.
- the medium containing the viral particles is removed, and the cells are cultured in fresh complete medium for 24 hours before selecting with puromycin for 10-14 days (the titration may be done before use by treating 1 X10 4 cells in 96 well plates with 0.5- 10 pg/ml of puromycin).
- the medium with puromycin is replaced every 3 days.
- the puromycin resistant cell colonies are collected and cultured for further analysis. Gene expression is measured by qRT-PCR or Western blot.
- the transduced cells are pooled after puromycin selection. The levels of target protein in the transduced cells are measured by western blot and compared to control shRNA cells at passage 1 , 10, 20, 30, and 40.
- gene therapy methods may be used to knockdown gene expression.
- zinc finger nucleases may be used to generate targeted double-strand breaks in the TSC1 or TSC2 genes, or in the genes encoding proteins that stimulate TSC1/TSC2 function.
- isolated cells may be treated with CompoZr ® Zinc Finger Nucleases (ZFNs) (Sigma Aldrich) (or other suitable nucleases) that typically target the first 2/3 of the coding region of the gene of interest.
- ZFNs are designed in silico and tested in a cellular assay to identify ZFNs that cleave the target site, and a pair of ZFNs is selected for use.
- ZFNs may be delivered to the cells using nucleofection, electroporation, or lipid-based transfection of ZFN plasmids or mRNA transcripts.
- ZFNs may also be delivered using a viral vector such as lentivirus.
- nucleofection 5 x 10 6 to 10 x 10 6 cells at about 80% confluency are trypsinized and transfected with about 5 pg of each ZFN-encoding plasmid using Nucleofector kits (Amaxa Biosystems) according to the manufacturer's instructions.
- cells are maintained in media such as DMEM with 10% FBS.
- a mismatch-specific cleavage assay such as the Surveyor endonuclease assay (Cel-1 ; Transgenomics) in which Cel-1 cleaves heteroduplexes of wild-type and mutated DNA strands following denaturation-renaturation
- Cel-1 Surveyor endonuclease assay
- the cells may be cloned.
- a gene such as GFP or a puromycin plasmid may be inserted by homologous recombination at the time of TSC1 or TSC2 knockout with ZFNs, allowing the cells to be sorted using FACS or enriched using antibiotic selection.
- the levels of target protein in the treated cells may be measured by western blot and compared to control untreated cells.
- the transduced cells may also be analyzed for the effect of the knockdown on mTORCI signaling. This may be accomplished by measuring phospho-S6 expression in the transduced cells by western blot and comparing to control shRNA cells at passage 1 , 10, 20, 30, and 40. Since Wnt signaling is active during hair morphogenesis, the effect of the knockdowns on Wnt signaling may also be evaluated. This may be done by measuring the level of beta-catenin and GSK3 by western blot with specific antibodies (Cell Signaling Technology, Inc). The WNT network is active in the epidermal placode during development, and WNT proteins are thought to be part of the signal that triggers the dermal condensate to form. (Kishimoto, J.
- Human mesenchymal cells may be transfected for stable expression of mTOR network activating or hair follicle related genes (e.g., Ras, Raf, Mek, Erk, Rsk1 , PI3K, Akt1, Akt2, Akt3, Rheb, mTOR, Raptor, Rictor, mLST8, S6K1 , ribosomal protein S6, SKAR, SREBP1 , elF4e, IKKbeta, Myc, Runxl , or p27) under the control of a constitutively active promoter using standard procedures.
- mTOR network activating or hair follicle related genes e.g., Ras, Raf, Mek, Erk, Rsk1 , PI3K, Akt1, Akt2, Akt3, Rheb, mTOR, Raptor, Rictor, mLST8, S6K1 , ribosomal protein S6, SKAR, SREBP1 , elF4e
- the genes may be introduced into Streptomyces phage ⁇ 031 integrase-assisted stable integration plasmid with CMV IE promoter by inserting the 285-bp ⁇ 031 attB sequence as a Bglll fragment into the Bglll sites of the backbone vector pcDNA3.1/zeo creating the plasmid pcDNAattB.
- IRES and blastocidin resistance sequences may be removed from a pWZL Blast vector as a blunted SnaBI-Nhel fragment, which is inserted into the EcoRV/Xbal sites of pcDNAattB, creating the plasmid pcDNAattB-IB.
- one of the indicated genes is amplified and cloned with a lacZ gene as an EcoRI, Hindlll/EcoRI, and EcoRI (blunt)/BamHI fragments into the EcoRI, Hindlll/EcoRI, and Hindlll (blunt)/BamHI sites, respectively, of pcDNAattB-IB.
- hexadimetherine bromide (Aldrich Chemical Co., Milwaukee, Wl) in HBSS are added and again vortexed. This mixture is overlaid on the cells for 6 hours.
- a 28% DMSO (Sigma Chemical Co., St. Louis, MO) in growth media mix is applied to the cells after the media has been aspirated. The cells are incubated for 90 seconds before the DMSO is aspirated and replaced with PBS containing 10% bovine calf serum. The plates are rinsed twice and the cells are incubated with fresh growth medium overnight at 37°C.
- 3 days after transfection cells are subjected to 10 day of blasticidin (4 Mg/ml) in culture media. Efficiency of gene transfer is verified by immunofluorescence microscopy and immunoblot analysis. After 10 day selection, mesenchymal cells colonies are trypsinized and subcloned at limiting dilution to obtain highly proliferative clones.
- the mTOR network activating or hair follicle related proteins may be delivered into human mesenchymal cells using methods as described. (Weill, CO. et al., A Practical Approach for Intracellular Protein Delivery, Cytotechnology 56 (1 ), 41-48 (2008).) Cells are plated in order to reach approximately 70-80% confluency the day of protein delivery. For one well of a 24-well plate, 0.5-8 pg of purified protein is diluted in 100 ⁇ of Hepes buffer (20 mM, pH 7.4) in a 1.5 ml microcentrifuge tube, under sterile conditions. In each tube, 1-8 ⁇ of protein delivery reagent PULSinTM (lllkirch, France) are added to the protein solution.
- the protein/reagent mix is incubated for 15 min at room temperature to allow complex formation.
- the cells are washed with 1 ml of PBS, and 900 ⁇ of culture medium without serum is added to each well. After addition of the complexes into each well, the plate is gently mixed and further incubated at 37°C. After 4 hours, the incubation medium is removed and replaced with 1 ml of fresh complete medium (containing serum). Protein delivery is analyzed immediately or at later time points by immunocytochemistry.
- the skin tissue is prepared as described in either protocol in Example 3B.
- Cells are harvested after 7 days using a solution containing 0.25% trypsin and 5 mM EDTA (Sigma) and enriched for hair inductive cells based on cell marker, CD- 0.
- FITC labeled anti CD- 0 antibody (eBioscience) is incubated with the fibroblast for 30 min at 4°C.
- the cells are sorted using BD Biosciences
- the cells are labeled with anti-CD10/RPE antibody (10 ml for 1 X 10 6 cells; DAKO, Glostrup, Denmark; clone SS2/36) for 30 min at room temperature.
- Labeled cells are washed with PBS, 2% bovine serum albumin, incubated with anti-PE micro beads (10 ml/10 6 cells; iltenyi Biotec, Bergisch Gladbach, Germany) for 30 min at room temperature and separated by MACS columns placed in a MiniMACS Separator (Miltenyi Biotec) according to
- Wnt-3a Wnt-IOb
- FGF2 FGF2, KGF, or others
- Wnt-3a Wnt-IOb
- FGF2 KGF growth factor
- dermal papilla cells are cultured in the presence of an increased level of WNT protein or an agent that mimics the effects of WNT-promoted signal transduction. This method is based upon the discovery, discussed above, that WNT signaling is active during hair morphogenesis. (Kishimoto, J. et al., Wnt Signaling Maintains the Hair-Inducing Activity of the Dermal Papilla, Genes & Development 14 (10):1181-1185 (2000); Shimizu, H.
- pGKWnt-3a may be constructed by inserting the human Wnt-3a cDNA, whose expression is driven by a promoter of rat phosphoglycerokinase gene (PGK promoter) and terminated at a transcriptional terminator sequence of the bovine growth hormone gene, into pGKneo, containing the neomycin phosphotransferase gene (neo) driven by the PGK promoter.
- PGK promoter rat phosphoglycerokinase gene
- pGKWnt-3a is introduced by the calcium phosphate method into L cells, which are plated in 60 mm culture dishes at a density of 1.5 X 10 6 cells/plate 1 day before the DNA addition. To these cultures, 400 mg/mL of G418 are added 2 days after transfection. Stably transfected clones are then selected and sub- cultured. To collect the conditioned medium (CM) from cultures of Wnt-3a- producing L cells, these cells are seeded at a density of 1 X 10 6 cells in a 100 mm dish containing a 1 :1 mixture of DMEM and HAM F12 supplemented with 10% FCS, and cultured for 4 days.
- CM conditioned medium
- conditioned medium is harvested, centrifuged at 1000 g for 10 min, and filtered through a nitrocellulose membrane.
- conditioned medium may be prepared from L cells transfected only with pGKneo and cultured under the same conditions as above.
- the conditioned medium may be used to obtain Wnt-enhanced hair inductive cells. Briefly, 100-1000 of skin mesenchymal cells are plated on 100 mm dishes in DMEM plus 10% FBS and cultured for 24 hours. In the next day, the medium is replaced by L cell conditioned medium containing Wnt2a protein and cultured for 2 weeks with medium changes every 3 days. After 2 weeks, the cell clones are collected for further analysis or injection to human skin.
- EXAMPLE 6 MAINTENANCE OF HAIR INDUCTIVE PROPERTIES DURING PROPAGATION USING SPECIALIZED MEDIA OR GROWTH FACTORS
- the hair follicle inductive potential of human DP cells may be maintained in one of following media:
- Chang medium (Chang H. C. et al., "Human amniotic fluid cells grown in a hormone-supplemented medium: suitability for prenatal diagnosis," Proc Natl Acad Sci U S A 79(15): 4795-9 (1982)): Briefly, the basic culture medium
- [serum free (SF) medium] is a 1 :1 mixture of Dulbecco-Vogt modified Eagle's medium (DVME medium) and Ham's F12 medium (F12 medium) supplemented with 15 mM Hepes and 1.2 g of NaHC03, 40 mg of penicillin, 8 mg of ampicillin, and 90 mg of streptomycin per liter.
- the SF medium plus 10 growth-promoting factors is termed H medium (supplemented medium).
- the growth promoting factors added are: transferrin (5 pg/ml), selenium (20 nM), insulin (10 g/ml),
- triiodothyronine (0.1 nM), glucagon (1 pg/ml), fibroblast growth factor (10 ng/ml), hydrocortisone (1 nM), testosterone (1 nM), estradiol (1 nM), and progesterone (1 nM).
- Keratinocyte-conditioned medium To collect KCM from keratinocyte culture, 10 6 of the cells are plated on 100-mm dish and cultured for 3-5 days in 10 ml of medium (50% DMEM plus 50% KSFM in the absence of FBS or growth supplements). The conditioned medium is collected and used for culture of skin mesenchymal cells for 2-4 weeks before injection to human skin.
- Mesenchymal stem cell medium (Invitrogen), or human follicle DP cell growth medium (PromoCell) is used for culture of human DP cells.
- Other growth factors such as BMP6 (10 ng/ml), FGF-2 (10 ng/ml, BioVision) or leptin (0, 10, or100 ng/ml, Sigma-Aldrich) may be used for DP cell culture.
- GSK-3 inhibitor To maintain the hair inductive mesenchymal cells, GSK-3 inhibitor, BIO (Calbiochem, La Jolla, CA) is added to culture medium at 1.5 ⁇ in 100-mm of dish. The cells are sub-cultured and passaged for more than 2 weeks before further analysis or injection to human skin.
- Epidermal cells may be isolated from the following sources: patient skin or mucosa (autologous), donor skin or mucosa (allogeneic), epidermal cell lines, epidermal cells derived from stem cells, and primary or passaged epidermal cells.
- keratinocytes human neonatal foreskin or adult skin tissues are treated with dispase at 4°C for overnight.
- the epidermal sheet is separated from dermal sheet and subsequently digested with 0.05% trypsin, 0.53 mM EDTA at 37°C for 20 min.
- the cells are collected and plated on tissue culture dishes in keratinocyte serum-free media supplemented with bovine pituitary extract and recombinant epidermal growth factor. This method parallels the cell dissociation method discussed above for mesenchymal cells (i.e., the dermal section is used for the mesenchymal cells, and the epithelial section is used for the epidermal cells).
- stem cells may be used to generate epidermal cells by inducing the stem cells to differentiate into epidermal cells using the following protocol.
- stem cells growing on 35-mm tissue culture dishes are coated with Matrigel (1 mL/35-mm dish, approx 0.1 mg) for 30 min at room temperature, then the Matrigel is gently replaced with 15% DMEM.
- the cells are treated with 0.25% trypsin-EDTA for 2 to 3 min in the incubator.
- the cells are transferred into a 15-mL Falcon tube and an aliquot is removed to count the total available cells.
- the cells are centrifuged at 700xg for 2 to 3 min for pellet formation. While spinning, the cells are counted using a Coulter Counter. The pellet is resuspended with 15% DMEM and diluted appropriately in order to plate
- EXAMPLE 8 ENRICHMENT OF EPIDERMAL CELLS WITH ABILITY TO DIFFERENTIATE INTO HAIR FOLLICLES
- the stem cell populations of neonatal or adult human skin can be enriched by rapid adherence according to previously reported methods. Briefly, 100mm bacteriological plastic dishes are coated overnight with 100 g/ml of type IV collagen, incubated with 0.5 mg/ml heat denatured BSA at 37°C for 1 hour, and washed in serum-free medium. Keratinocytes are resuspended in serum-free medium at a density of 1- 5 X 10 3 cells/ml. Ten ml of cell suspension is added to type IV collagen coated dishes, and the dishes are returned to the incubator for 5 microscope.
- Rapidly adherent cells are harvested and re-plated at 1 X10 5 cells for further culture in FAD (DMEM/F12 3:1 , v/v, Gibco) supplemented with 0.4 mg/ml hydrocortisone (Sigma), 5 mg/ml transferrin (Sigma), 5 mg/ml insulin (Sigma), 100 IU/ ml penicillin, 100 mg/ml streptomycin, 10% FCS, 10 ng/ml epidermal growth factor (EGF) (Sigma), and 10 ng/ml basic fibroblast growth factor (bFGF) (Gibco).
- FAD DMEM/F12 3:1 , v/v, Gibco
- the dishes are placed in an incubator at 37°C, 100% humidity, and 5% C0 2 , and the medium is changed every 2-3 days. Epidermal stem cells that are more adherent to the culture dish coated with extracellular matrix have more potential ability to form into hair follicles.
- Bulge cells may be isolated with magnetic beads systems. Two magnetic beads systems are combined to isolate bulge ORS cells from the mid- follicle suspension. First, hair follicle cells are stained with the cocktail of PE- conjugated anti-human CD24, CD34, CD71 , and CD146 antibodies (BNC) for 20 min. at 4°C. After washing, follicle cells are incubated with anti-PE microbeads (Miltenyi Biotec) for 25 minutes at 4°C. Then, PE-positive non-bulge cells are removed with the magnetic separations using mini-MACS MS columns (Miltenyi Biotec). The removal procedures are repeated 3-5 times to ensure maximum depletion.
- BNC PE- conjugated anti-human CD24, CD34, CD71 , and CD146 antibodies
- mid-follicle cells are incubated with purified anti-human CD200 mouse mAb at 4°C for 20 minutes, washed, and incubated with Dynabeads M-450 sheep anti-mouse IgG magnetic beads (Dynal Biotech) at 4°C for 30 minutes with tilting. Then, positive selection is performed with a MPC-L magnetic particle concentrator (Dynal Biotech) to obtain CD200-positive cells. CD59-positive cells may be similarly collected as a positive selection control. It is expected that preparations of epidermal cells that are enriched for bulge cells will have greater capacity to form hair follicles.
- Three-dimensional in vitro constructs are prepared for grafting using established methods modified as described herein. Briefly, mesenchymal cells are mixed with 1 mg/ml type I collagen (rat or bovine, as described below) in 10% FBS/DMEM, and added to 6 well transwell plates (Corning Incorporated, Corning, NY) at a density of 1.5 X 10 5 cells per cm 2 . The dermal equivalents are cultured in 10% FBS/DMEM for 4 days before aliquoting 1 X 10 6 keratinocytes on top.
- mesenchymal cells are mixed with 1 mg/ml type I collagen (rat or bovine, as described below) in 10% FBS/DMEM, and added to 6 well transwell plates (Corning Incorporated, Corning, NY) at a density of 1.5 X 10 5 cells per cm 2 .
- the dermal equivalents are cultured in 10% FBS/DMEM for 4 days before aliquoting 1 X 10 6 keratinocytes on top.
- the constructs are cultured submerged for 2 days in a mixture of DMEM and Ham's F12 (3:1) (GIBCO/lnvitrogen, Grand Island, NY) containing 0.1% FBS, after which the keratinocytes are brought to the air-liquid interface and cultured in a mixture of DMEM and Ham's F12 (3:1) containing 1% FBS for another 2 days before grafting.
- DMEM and Ham's F12 3:1 (GIBCO/lnvitrogen, Grand Island, NY) containing 0.1% FBS
- Cell aggregates for injection may be formed using the hanging droplet method.
- a mixture of human mesenchymal cells and keratinocytes (10:1 , 5:1 , 1:1 , 1 :5 or 1 :10) is suspended in Chang medium containing 0.24% methylcellulose.
- the cells are applied in 20- ⁇ droplets (each droplet contains 4 ⁇ 0 4 cells) in the bottom of a 100-mm petri dish. The petri dish is inverted such that the droplets are hanging upside down.
- the suspended droplets are incubated in a 37°C, 5% CO2 incubator. Aggregate formation is completed within 18-20 h. Upon formation, aggregates are transferred individually to wells of a 96-well round-bottom assay plate containing 50 ⁇ Chang medium. The wells are precoated with 0.24% methylcellulose medium to prevent adherence of proto-hairs. The culture medium is changed every 2-3 days.
- the microspheres are collected by centrifugation, washed three times with distilled water, and strained to a size of 50-200 ⁇ in diameter.
- the microspheres are lyophilized and sterilized with ultraviolet light for 6 hours.
- Human mesenchymal cells (2.5 x 10 7 cells) and keratinocytes (6 * 10 6 cells) are placed with PLGA microspheres (1 g microspheres/10 5 cells) in a spinner flask (Bellco Glass Inc., Vineland, NJ) containing 30 ml of serum-free KGM containing 10 ng/ml of EGF for keratinocytes, or DMEM/F12 containing 10% (v/v) FBS for mesenchymal cells, and cultured at 50 rpm for 2 weeks. The medium is exchanged every other day.
- Cell aggregates are allowed to settle down, 16 ml of the culture supernatant is collected and centrifuged, 15 ml of the supernatant is removed, and 15 ml of fresh medium is added to the centrifuged cells in 1 ml of remaining supernatant.
- the cells in fresh medium are transferred to the spinner flasks.
- clusters of cells may be formed by suspending the cells in sodium alginate and then forming spherical droplets using a high-voltage electric droplet generator as described in Lin CM. et a!., "Microencapsulated human hair dermal papilla cells: a substitute for dermal papilla?," Arch Dermatol Res. 300(9):531-5 (2008).
- EXAMPLE 10 EVALUATION OF SKIN SUBSTITUTES OF THE INVENTION FOR
- the skin substitutes of the invention may be tested for
- Biomechanical properties include skin barrier function, sebum secretion, skin tensile strength, transepidermal water loss, and skin electrical capacitance.
- Skin capacitance may be measured using a Corneometer CM 825 PC (Courage & Khazaka Electronic GmbH, Cologne, Germany).
- Transepidermal water loss may be measured by a Tewaeter TM 300 (Courage & Khazaka Electronic GmbH, Cologne, Germany).
- Tewaeter TM 300 Cosmetic & Khazaka Electronic GmbH, Cologne, Germany.
- To assess the activity of sebaceous glands one may measure the expression of human sebum lipid and proteins using oil red O staining and real-time PCR of laser microdissected material. Total RNA may be isolated from laser-microdissected sebaceous glands and the mRNA reverse transcribed.
- a small strip of graft obtained after sacrificing the animal may be placed in a tensiometer (Instron 5542 tensiometer, Insron, Canton, MA) and peak breaking force measured. Briefly, a small portion of the tissue strip (approximately 0.5 cm of incision) is oriented in the jaws of the tensiometer perpendicular to the line of the incision. Peak breaking forces are measured and converted to tensile strength values (kilogram force per square centimeter) by dividing the breaking force by the cross-sectional area of the tissue that broke. The same procedure may be used to measure the tensile strength of plucked hairs.
- wounds may be created in the grafts four to six weeks after grafting.
- the wound may be bandaged, and the rate of wound healing determined by serial photography every 1-2 days with a scale to measure wound contraction and reepitheliazation.
- Sections of grafts may be harvested and stained with Masson's trichome and evaluated histologically for wound and scar area, dermal thickness, and epidermal thickness by sectioning through the center of the wound. Histomorphometric measurements of the wounds may be performed, and qualitative assessments made of inflammatory cell infiltrate, fibroblast proliferation, collagen formation, and angiogenesis.
- Immunohistochemistry may be used to identify human cells, cell proliferation (Ki-67), and numbers of
- Hair cycling may be documented by repeated observations throughout the hair cycle. However, since the hair cycle takes about 00 days for non-scalp skin and up to a few years for the scalp, the experimental progress may be speeded by hair plucking (e.g., using wax). Hair plucking is a well-proven method for inducing hairs to re-enter anagen.
- the hair-plucking assay may be combined with an assessment of the epidermal stem-cell compartment for the presence of label-retaining cells in the epidermis and bulge region of the hair follicle. BrdU may be injected intraperitoneally twice daily for 6 days beginning at the completion of follicular neogenesis. At 10-14 weeks, the hairs on one half of the graft may be plucked.
- mice are grafted in a horizontal laminar flow hood using 6-8 week old female Cr:NIH(S)-nu/nu mice (FCRDC, Frederick, MD) anesthetized using inhalant anesthesia with a mixture of 0 2 and isoflurane (2-4%).
- the grafting area on back of the mouse is carefully estimated, and skin is removed using curved scissors after washing with povidine and 70% ethanol.
- Constructs are placed on the graft bed in correct anatomical orientation, covered with sterile petroleum jelly gauze, and secured with bandages.
- the mice are transferred back to the sterile cages after reawakening.
- the bandages are changed at 2 weeks and removed after 4 weeks. Mice are sacrificed 4-18 weeks after grafting.
- full-thickness skin wounds (1.5 1.5 cm 2 rectangular shape) are created on the transplantation area.
- the skin at the wound margins is burned using a cautery and fixed to adjacent muscle layers with nonresorbable 5-0 nylon sutures (AILEE Co., Pusan, Korea).
- Mesenchymal cells approximately 10 8 cells/wound
- keratinocytes approximately 7.5 * 10 6 cells/wound
- mice After transplantation, the wounds are dressed with dressing materials, Tegaderm (3M Health Care, St. Paul, MN) and sterile cotton gauze, and firmly fixed using Coban, a self-adhesive wrap (3M Health Care).
- Tegaderm 3M Health Care, St. Paul, MN
- Coban a self-adhesive wrap
- mice an antibiotic (Cefazolin, 0.1 mg/mouse, Yuhan Co., Seoul, Korea) and an analgesic
- mice (Buprenorphine, 0.1 mg/kg, Hanlim Pharm Co., Seoul, Korea) are administered intramuscularly and subcutaneously, respectively, for 5 days after transplantation.
- the mice are housed singly after surgery and receive humane care in compliance with the guidelines for the care and use of laboratory animals of NIH.
- EXAMPLE 12 APPLICATION OF SKIN SUBSTITUTE TO A PATIENT WOUND
- Patients exhibiting full- or partial-thickness skin loss, wounds, burns, scars, and full- or partial-hair loss are given a standard preoperative assessment to determine surgical risk.
- the site for application of the skin substitute should have a good blood supply, such as dermis, fascia, muscle, granulation tissue, periosteum, perichondrium, peritenon, and perineurium, but not cartilage, tendon, or nerve.
- the wound must be free of necrotic tissue.
- the wound should be relatively
- Antimicrobial, antifungal, and antiviral agents administered topically or systemically, may be used during a period of time (such as a week) prior to and following administration of the skin substitute to reduce the risk of infection.
- Wound vacuum-assisted closure may be used to improve wound bed characteristics prior to grafting, and may also be used after grafting.
- the patient is anesthetized using local, regional, or general anesthesia, and the graft site is washed with water, an antibiotic wash, or an alcohol solution (such as an alcohol swab).
- an alcohol solution such as an alcohol swab.
- the existing skin tissue, devitalized tissue, eschar, wound or ulcer edges, or scar tissue is removed using standard techniques in the art.
- Debridement may extend to healthy, viable, bleeding tissue. Prior to debridement thoroughly cleanse the wound with sterile saline to remove loose debris and necrotic tissue. Using tissue nippers, a surgical blade, or curette remove hyperkeratotic and/or necrotic tissue and debris from the wound surface. Ulcer margins may be debrided to have a saucer effect.
- Skin substitutes may be applied to a clean, debrided skin surface after thoroughly irrigating the wound with a non-cytotoxic solution. Before applying the skin substitute, the practitioner can review the expiration date of the skin substitute, check the pH, and visually observe and smell the skin substitute to ensure that there are no contaminants, such as bacterial contaminants or particulate matter.
- the skin substitute may be stored in a polyethylene bag at controlled temperature 68°F-73°F (20°C-23°C) until immediately prior to use. The practitioner may cut open the sealed polyethylene bag, and if the skin substitute is provided in a cell culture dish or plastic tray, it may be transferred to the sterile field with aseptic technique.
- a tray or cell culture dish lid may be lifted off, and the practitioner may note the epidermal and dermal layer orientation of the skin substitute.
- a practitioner may gently dislodge approximately 0.5 inch of the skin substitute away from the wall of the tray or cell culture dish.
- a practitioner may be careful not to perforate or lift any membrane beneath the skin substitute, which, if present, should remain in the tray.
- sterile gloved hands a practitioner may insert one index finger under the released section of the skin substitute and use the other index finger to grasp the skin substitute in a second spot along the edge of the device.
- the practitioner may lift the entire skin substitute out of the tray or cell culture dish using a smooth, even motion. If excessive folding occurs, the skin substitute can be floated (epidermal surface up) onto warm sterile saline solution in a sterile tray.
- the skin substitute may be placed so that the dermal layer (the glossy layer closest to the medium) is in direct contact with the site for the skin substitute.
- the practitioner may smooth the skin substitute onto the site so there are no air bubbles or wrinkled edges. If the skin substitute is larger than the site for application, the excess skin substitute may be trimmed away to prevent it from adhering to the dressing. If the skin substitute is smaller than the site for application, multiple skin substitutes may be applied adjacent to each other until the defect is filled.
- the skin substitute may be secured with any appropriate clinical dressing. It is preferable to use a nonadherent, semiocclusive, absorbent dressing material. It should provide uniform pressure over the entire grafted area. Sutures or staples are not required but may be used in some instances to anchor the graft to the graft bed (tacking sutures). Absorbable sutures, such as 5-0 fast absorbing gut, are preferable because they do not require removal. Dressings may be used to assure contact of the skin substitute to the site for application and to prevent movement. Therapeutic compression may be applied to the graft site. In some cases it may be necessary to immobilize the grafted limb to minimize shearing forces between the skin substitute and the application site.
- Bolster dressings are useful in areas where motion is difficult to avoid and in wounds with irregular contours. Dressings may be changed once a week or more frequently if necessary. Pain, odor, discharge, or other signs of complications are indications for dressing removal and inspection of the application site.
- Additional applications of skin substitutes may be necessary in certain instances. Prior to additional applications, non-adherent remnants of a prior skin graft or skin substitute should be gently removed. Healing tissue or adherent skin substitutes may be left in place. The site may be cleansed with a non-cytotoxic solution prior to additional applications of skin substitute. In one embodiment, an additional skin substitute may be applied to the areas where the prior skin substitute is not adherent.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Dermatology (AREA)
- Zoology (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Oral & Maxillofacial Surgery (AREA)
- Transplantation (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Pharmacology & Pharmacy (AREA)
- Urology & Nephrology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Developmental Biology & Embryology (AREA)
- Biophysics (AREA)
- Hematology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Immunology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Materials For Medical Uses (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP11796538.4A EP2582791B8 (en) | 2010-06-18 | 2011-06-17 | Hair follicle neogenesis |
| AU2011268139A AU2011268139B2 (en) | 2010-06-18 | 2011-06-17 | Hair follicle neogenesis |
| ES11796538.4T ES2667532T3 (es) | 2010-06-18 | 2011-06-17 | Neogénesis del folículo piloso |
| US13/704,431 US20130209427A1 (en) | 2010-06-18 | 2011-06-17 | Hair follicle neogenesis |
| CA2802880A CA2802880C (en) | 2010-06-18 | 2011-06-17 | Hair follicle neogenesis |
| JP2013515559A JP6071875B2 (ja) | 2010-06-18 | 2011-06-17 | 毛包新生 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US34425810P | 2010-06-18 | 2010-06-18 | |
| US61/344,258 | 2010-06-18 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2011160055A2 true WO2011160055A2 (en) | 2011-12-22 |
| WO2011160055A3 WO2011160055A3 (en) | 2012-04-26 |
Family
ID=45348909
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2011/040937 Ceased WO2011160055A2 (en) | 2010-06-18 | 2011-06-17 | Hair follicle neogenesis |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20130209427A1 (https=) |
| EP (1) | EP2582791B8 (https=) |
| JP (2) | JP6071875B2 (https=) |
| AU (1) | AU2011268139B2 (https=) |
| CA (1) | CA2802880C (https=) |
| ES (1) | ES2667532T3 (https=) |
| WO (1) | WO2011160055A2 (https=) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014040074A3 (en) * | 2012-09-10 | 2014-06-26 | Moerae Matrix, Inc. | Compositions and methods for treating cutaneous scarring |
| WO2014179559A1 (en) * | 2013-05-03 | 2014-11-06 | The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Skin substitutes and methods for hair follicle neogenesis |
| US9655930B2 (en) | 2012-10-01 | 2017-05-23 | Aderans Research Institute, Inc. | Compositions and methods for producing reconstituted skin |
| US10920197B2 (en) | 2012-02-10 | 2021-02-16 | Orbsen Therapeutics Limited | Stromal stem cells |
| WO2021038289A1 (en) * | 2019-08-23 | 2021-03-04 | Orbsen Therapeutics Limited | Compositions for monocyte and macrophage polarization and methods of use |
| CN114195458A (zh) * | 2021-12-27 | 2022-03-18 | 东莞市优鼎新材料科技有限公司 | 微球改性材料及其制备方法、填缝剂及其制备方法 |
| WO2023287986A1 (en) * | 2021-07-14 | 2023-01-19 | The Regents Of The University Of Michigan | Methods for hair growth |
| US12213995B2 (en) | 2019-07-18 | 2025-02-04 | Direct Biologics, Llc | Preparations comprising mesenchymal stem cells and cannabinoids and methods of their use |
| EP4165185A4 (en) * | 2020-06-11 | 2025-09-10 | Genetic Intelligence Inc New York Ny | FLCN GENE MODULATION COMPOSITIONS AND RELATED METHODS |
| US12453743B2 (en) | 2018-05-30 | 2025-10-28 | Direct Biologics, Llc | Mesenchymal stem cell (MSC) growth factor and extracellular vesicle preparation in frozen or powdered form and methods of use |
| US12570980B2 (en) | 2020-04-22 | 2026-03-10 | Direct Biologics, Llc | Methods and compositions for treating inflammatory conditions associated with infectious disease |
| US12569517B2 (en) | 2019-02-07 | 2026-03-10 | Direct Biologics, Llc | Method for treating osteoarthritis with mesenchymal stem cell exosomes |
| WO2026063864A1 (en) * | 2024-09-23 | 2026-03-26 | Medeze Treasury Pte. Ltd. | The method of hair transplant using dermal papilla and dermal sheath obtained from hair follicle |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9545302B2 (en) | 2013-11-20 | 2017-01-17 | Dermagenesis Llc | Skin printing and auto-grafting |
| US10767164B2 (en) | 2017-03-30 | 2020-09-08 | The Research Foundation For The State University Of New York | Microenvironments for self-assembly of islet organoids from stem cells differentiation |
| US11629331B2 (en) * | 2017-07-19 | 2023-04-18 | Seoul National University R & Db Foundation | Method of differentiation of human induced pluripotent stem cell to dermal papilla precursor cell and use thereof |
| CN108525021B (zh) * | 2018-04-17 | 2021-05-18 | 山西医科大学 | 基于3d打印的含血管及毛囊结构组织工程皮肤及其制备方法 |
| CN109321513B (zh) * | 2018-09-30 | 2021-05-04 | 洛阳师范学院 | 一种具有生理功能的组织工程皮肤构建方法 |
| US12331320B2 (en) | 2018-10-10 | 2025-06-17 | The Research Foundation For The State University Of New York | Genome edited cancer cell vaccines |
| KR20210121039A (ko) * | 2018-12-26 | 2021-10-07 | 다이렉트 바이오로직스 엘엘씨 | 피부 및 모발 장애를 치료하기 위한 방법 및 조성물 |
| US20240240143A1 (en) * | 2021-05-27 | 2024-07-18 | The University Of Hong Kong | Bioengineered dermal papilla and hair follicles and related products, methods and applications |
| EP4403568A4 (en) * | 2021-09-17 | 2025-07-23 | Acro Biomedical Company Ltd | USE OF COLLAGEN PARTICLES TO PROMOTE HAIR FOLLICLE FORMATION OR ANGIOGENESIS |
| US12502407B2 (en) | 2024-04-25 | 2025-12-23 | Direct Biologics, Llc | Treatment of fistula with bone marrow mesenchymal stem cell derived extracellular vesicles |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FI924773L (fi) * | 1990-04-24 | 1992-10-21 | Mark Eisenberg | Kompositionssubstituter av levande hud |
| SE9701162D0 (sv) * | 1997-03-27 | 1997-03-27 | Karolinska Innovations Ab | New use II |
| EP2295540A1 (en) * | 1998-11-19 | 2011-03-16 | Organogenesis, Inc. | Bioengineered tissue constructs and methods for producing and using them |
| WO2001074164A1 (en) * | 2000-03-31 | 2001-10-11 | The General Hospital Corporation | Methods of modulating hair growth |
| DE60126815T2 (de) * | 2000-12-08 | 2007-11-15 | Xgene Corp., San Carlos | Herstellung von geschichteten und nach zelltyp geordneten geweben in vitro |
| WO2003055990A2 (en) * | 2001-12-21 | 2003-07-10 | Pharmagap Inc. | Method for culturing and expansion of mammalian undifferentiated epidermal keratinocytes exhibiting stem cell characteristics |
| US7597885B2 (en) * | 2004-03-26 | 2009-10-06 | Aderans Research Institute, Inc. | Tissue engineered biomimetic hair follicle graft |
| GB0505202D0 (en) * | 2005-03-14 | 2005-04-20 | Intercytex Ltd | Skin equivalent culture |
| JP2007274949A (ja) * | 2006-04-05 | 2007-10-25 | Shiseido Co Ltd | 毛乳頭細胞培養方法 |
| US20090143418A1 (en) * | 2007-11-30 | 2009-06-04 | The Regents Of The University Of Michigan | Compositions and Methods for Preventing and Treating Hair Growth Cycle-Related Conditions |
-
2011
- 2011-06-17 CA CA2802880A patent/CA2802880C/en active Active
- 2011-06-17 US US13/704,431 patent/US20130209427A1/en not_active Abandoned
- 2011-06-17 WO PCT/US2011/040937 patent/WO2011160055A2/en not_active Ceased
- 2011-06-17 EP EP11796538.4A patent/EP2582791B8/en active Active
- 2011-06-17 JP JP2013515559A patent/JP6071875B2/ja not_active Expired - Fee Related
- 2011-06-17 AU AU2011268139A patent/AU2011268139B2/en active Active
- 2011-06-17 ES ES11796538.4T patent/ES2667532T3/es active Active
-
2016
- 2016-12-27 JP JP2016253496A patent/JP6449220B2/ja not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| GREENBERG S ET AL.: "In vivo transplantation of engineered human skin", METHODS MOL BIOL., vol. 289, 2005, pages 425 - 30 |
| QIAO ET AL.: "Hair follicle neogenesis induced by cultured human scalp dermal papilla cells", REGEN MED, vol. 4, no. 5, 2009, pages 667 - 76 |
| See also references of EP2582791A4 |
| SHEVCHENKO RV ET AL.: "A review of tissue-engineered skin bioconstructs available for skin reconstruction", J R SOC INTERFACE, vol. 7, no. 43, 2010, pages 229 - 58 |
Cited By (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10920197B2 (en) | 2012-02-10 | 2021-02-16 | Orbsen Therapeutics Limited | Stromal stem cells |
| US11926848B2 (en) | 2012-02-10 | 2024-03-12 | Orbsen Therapeutics Limited | Stromal stem cells |
| US11434471B2 (en) | 2012-02-10 | 2022-09-06 | Orbsen Therapeutics Limited | Stromal stem cells |
| US11230700B2 (en) | 2012-02-10 | 2022-01-25 | Orbsen Therapeutics Limited | Stromal stem cells |
| US11142747B2 (en) | 2012-02-10 | 2021-10-12 | Orbsen Therapeutics Limited | Stromal stem cells |
| AU2013312120B2 (en) * | 2012-09-10 | 2018-04-19 | Moerae Matrix, Inc. | Compositions and methods for treating cutaneous scarring |
| GB2520897A (en) * | 2012-09-10 | 2015-06-03 | Moerae Matrix Inc | Compositions and methods for treating cutaneous scarring |
| GB2520897B (en) * | 2012-09-10 | 2020-07-01 | Moerae Matrix Inc | Compositions and methods for treating cutaneous scarring |
| WO2014040074A3 (en) * | 2012-09-10 | 2014-06-26 | Moerae Matrix, Inc. | Compositions and methods for treating cutaneous scarring |
| US9655930B2 (en) | 2012-10-01 | 2017-05-23 | Aderans Research Institute, Inc. | Compositions and methods for producing reconstituted skin |
| US10398736B2 (en) | 2012-10-01 | 2019-09-03 | Aderans Research Institute, Inc. | Compositions and methods for producing reconstituted skin |
| US10398735B2 (en) | 2012-10-01 | 2019-09-03 | Aderans Research Institute, Inc. | Compositions and methods for producing reconstituted skin |
| AU2014259787B2 (en) * | 2013-05-03 | 2018-03-08 | The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Skin substitutes and methods for hair follicle neogenesis |
| US10478526B2 (en) | 2013-05-03 | 2019-11-19 | The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Skin substitutes and methods for hair follicle neogenesis |
| JP2016522682A (ja) * | 2013-05-03 | 2016-08-04 | ザ ヘンリー エム. ジャクソン ファウンデーション フォー ザ アドヴァンスメント オブ ミリタリー メディシン インコーポレイテッド | 代用皮膚および毛包新生の方法 |
| WO2014179559A1 (en) * | 2013-05-03 | 2014-11-06 | The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. | Skin substitutes and methods for hair follicle neogenesis |
| US12453743B2 (en) | 2018-05-30 | 2025-10-28 | Direct Biologics, Llc | Mesenchymal stem cell (MSC) growth factor and extracellular vesicle preparation in frozen or powdered form and methods of use |
| US12569517B2 (en) | 2019-02-07 | 2026-03-10 | Direct Biologics, Llc | Method for treating osteoarthritis with mesenchymal stem cell exosomes |
| US12213995B2 (en) | 2019-07-18 | 2025-02-04 | Direct Biologics, Llc | Preparations comprising mesenchymal stem cells and cannabinoids and methods of their use |
| EP4556072A3 (en) * | 2019-08-23 | 2025-06-11 | Orbsen Therapeutics Limited | Compositions for monocyte and macrophage polarization and methods of use |
| WO2021038289A1 (en) * | 2019-08-23 | 2021-03-04 | Orbsen Therapeutics Limited | Compositions for monocyte and macrophage polarization and methods of use |
| US12570980B2 (en) | 2020-04-22 | 2026-03-10 | Direct Biologics, Llc | Methods and compositions for treating inflammatory conditions associated with infectious disease |
| US12590310B2 (en) | 2020-04-22 | 2026-03-31 | Direct Biologics, Llc | Methods and compositions for treating inflammatory conditions associated with infectious disease |
| EP4165185A4 (en) * | 2020-06-11 | 2025-09-10 | Genetic Intelligence Inc New York Ny | FLCN GENE MODULATION COMPOSITIONS AND RELATED METHODS |
| WO2023287986A1 (en) * | 2021-07-14 | 2023-01-19 | The Regents Of The University Of Michigan | Methods for hair growth |
| CN114195458A (zh) * | 2021-12-27 | 2022-03-18 | 东莞市优鼎新材料科技有限公司 | 微球改性材料及其制备方法、填缝剂及其制备方法 |
| WO2026063864A1 (en) * | 2024-09-23 | 2026-03-26 | Medeze Treasury Pte. Ltd. | The method of hair transplant using dermal papilla and dermal sheath obtained from hair follicle |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2011160055A3 (en) | 2012-04-26 |
| JP6449220B2 (ja) | 2019-01-09 |
| ES2667532T3 (es) | 2018-05-11 |
| AU2011268139A1 (en) | 2013-01-31 |
| US20130209427A1 (en) | 2013-08-15 |
| JP6071875B2 (ja) | 2017-02-08 |
| EP2582791A4 (en) | 2013-12-25 |
| JP2017093451A (ja) | 2017-06-01 |
| CA2802880C (en) | 2019-09-24 |
| JP2013529919A (ja) | 2013-07-25 |
| CA2802880A1 (en) | 2011-12-22 |
| EP2582791B8 (en) | 2018-05-23 |
| EP2582791A2 (en) | 2013-04-24 |
| AU2011268139B2 (en) | 2014-09-04 |
| EP2582791B1 (en) | 2018-03-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2582791B1 (en) | Hair follicle neogenesis | |
| AU2018201536B2 (en) | Skin Substitutes And Methods For Hair Follicle Neogenesis | |
| EP3174563B1 (en) | Tissue graft | |
| EP3095470A1 (en) | Compartmental extract compositions for tissue engineering | |
| EP2471902B1 (en) | Production of artificial tissues by means of tissue engineering using agarose-fibrin biomaterials | |
| US9592257B2 (en) | Complete human skin organ generated from culture-expanded cells | |
| CN102027106A (zh) | 用于产生小毛囊和新生乳头的方法及其用于体外测试和体内植入的用途 | |
| Sanluis-Verdes et al. | Production of an acellular matrix from amniotic membrane for the synthesis of a human skin equivalent | |
| US10398735B2 (en) | Compositions and methods for producing reconstituted skin | |
| Zhang et al. | 3D-bioprinted human lipoaspirate-derived cell-laden skin constructs for healing of full-thickness skin defects | |
| US20070258956A1 (en) | Methods and apparatus for promoting hair growth using adipose cell based therapies | |
| AU2016357986A1 (en) | Method for the production of hair follicles and de novo papillae, and use thereof for in vitro test and in vivo implants | |
| US9737570B2 (en) | Method and composition of inducing hair follicle neogenesis | |
| Farrokhi | Evaluating the therapeutic use of Indoleamine 2, 3-dioxygenase (IDO) expressing allogenic dermal fibroblast populated within an acellular skin substitute as a wound coverage | |
| HK1156976B (en) | Methods for producing hair microfollicles and de novo papillae and their use for in vitro tests and in vivo implantations |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11796538 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011796538 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2013515559 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2802880 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2011268139 Country of ref document: AU Date of ref document: 20110617 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13704431 Country of ref document: US |