WO2011149267A2 - ＰＭＭｏＶ 저항성 고추 품종을 선별하기 위한 프라이머 세트, 방법 및 키트 - Google Patents

ＰＭＭｏＶ 저항성 고추 품종을 선별하기 위한 프라이머 세트, 방법 및 키트 Download PDF

Info

Publication number
WO2011149267A2
WO2011149267A2 PCT/KR2011/003833 KR2011003833W WO2011149267A2 WO 2011149267 A2 WO2011149267 A2 WO 2011149267A2 KR 2011003833 W KR2011003833 W KR 2011003833W WO 2011149267 A2 WO2011149267 A2 WO 2011149267A2
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide primer
markers
pmmov
primer set
seq
Prior art date
Application number
PCT/KR2011/003833
Other languages
English (en)
French (fr)
Other versions
WO2011149267A9 (ko
WO2011149267A3 (ko
Inventor
강병철
양희범
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Publication of WO2011149267A2 publication Critical patent/WO2011149267A2/ko
Publication of WO2011149267A3 publication Critical patent/WO2011149267A3/ko
Publication of WO2011149267A9 publication Critical patent/WO2011149267A9/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to primer sets, methods and kits for screening PMMoV resistant pepper varieties. More particularly, the primer set according to the present invention is applied to pepper crops to efficiently screen and select pepper varieties exhibiting PMMoV resistance. It is to provide the base technology that can be fostered.
  • Pepper mild mottle virus is a pepper that is widely cultivated nationwide and is a major export crop commonly occurring in high-value-added peppers and colored peppers. PMMoV is easily transmitted by contaminated seeds or mechanical contact, causing economic damage. Recently, the introduction of seeds harvested from abroad has been continuously increasing, and it is necessary to develop early precision diagnosis technology to prevent the introduction and spread of PMMoV.
  • PMMoV belongs to Tobamovirus, a virus in which single-stranded ribonucleic acid is accumulated in rod-shaped envelope proteins. It is distributed worldwide, especially in the Americas, Europe, and Northeast Asia. In addition, the host range was wide, and infections were reported in 22 and 200 species, especially in the early stages of growth. Infection with PMMoV causes yellowing or leaf growth in the leaf or stem tissues, resulting in slower growth, as well as distortion in fruit, resulting in a loss of value.
  • the present invention provides a description of the development of molecular labels that are very closely associated with L 4 resistant alleles using some sequences of R gene analogues (RGAs) that are believed to be L 4 alleles, thereby utilizing PMMoV using the molecular labels of the present invention. Efficient uptake of pepper varieties showing resistance to On the other hand, nothing is already known about this.
  • the present invention is derived from the above requirements, the present invention is to efficiently foster pepper varieties that are resistant to PMMoV, as marker assisted selection (MAS) using the molecular markers associated with the L- resistance loci of pepper, pepper, of the basis of the fact that a number of NBS-LRR gene sequences in the DNA sequence around the PMMoV disease resistance loci L, L 4 allele one L 4 resistance alleles associated molecular marker gene and very close with some of the sequences of the RGA, probably It was developed to complete the present invention.
  • MAS marker assisted selection
  • oligonucleotide primer set of SEQ ID NO: 1 and 2 Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; And one or more oligonucleotide primer sets selected from the group consisting of oligonucleotide primer sets of SEQ ID NOs: 7 and 9, to provide a set of oligonucleotide primers for selecting pepper varieties resistant to PMMoV.
  • the present invention also provides a kit for selecting pepper varieties resistant to PMMoV comprising the oligonucleotide primer set.
  • the present invention also provides a method for selecting pepper varieties resistant to PMMoV using the primer set.
  • the molecular label according to the present invention to many pepper crops enables efficient selection and development of pepper varieties that are resistant to PMMoV. Therefore, the molecular label according to the present invention and the pepper variety selection method provided by the present invention, unlike bacteria or fungi, have tried hard to cultivate PMMoV resistant varieties to prevent the damage of viruses that are almost impossible to control by drugs. It will be very useful for breeders.
  • Figure 1 shows the melting curve of the L4segF & R marker. L alleles were classified into three different groups. The first melting curve shows L 0 , the second shows L 2 and L 4 , and the last shows L 1 and L 3 .
  • Model 2 shows a schematic diagram of putative genetic constructs of gene regions around the L 4 gene in different hybrids.
  • the genetic region (black) around the L locus from C. chacoence was found to be differently infiltrated into the C. annuum genome.
  • Models 1 and 2 are shown assuming the presence of one or more functional homologs.
  • Models 3, 4 and 5 are shown assuming translocation to the non-allele region. Deletion of the allele region can occur at 3 and 4 (dashed box), while at 5 the allele region remains.
  • Figure 3 shows a single nucleotide polymorphism (SNP) of four L candidate genes ( L 1 , AB523372; L 1a , AB523373; L 2 , AB523375; L 3 , AB523370; L 4 , AB523377, GenBank) in the L 3 and 3 'LRR regions. ).
  • the SNPs of L 1 (SP) and L 1 (MS) matched the SNPs of the L 1 and L 1a candidate genes, respectively.
  • Black lines represent SNPs included in each primer set.
  • the two primer sets L4RP-3F &3'endR and L4RP-3F & L4RP-3R included SNPs that could distinguish all L alleles, while the rest could distinguish only some of the L alleles.
  • L4RP-3F & L4RP-3R primer L 0 L 1
  • the six L alleles from the MS L 1 and L 2 L 3 and L 4 from the SP from HRM analysis of the set of The difference curves of the melting curve pattern and the homozygous genotype of the heterozygous genotype of each pair of genes are shown.
  • This set of markers can distinguish 15 heterozygous genotypes from homozygous genotypes.
  • the present invention provides an oligonucleotide primer set of SEQ ID NO: 1 and 2; Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; And one or more oligonucleotide primer sets selected from the group consisting of oligonucleotide primer sets of SEQ ID NOs: 7 and 9 to provide a set of oligonucleotide primers for selecting pepper varieties resistant to Pepper mild mottle virus (PMMoV). do.
  • PMMoV Pepper mild mottle virus
  • Oligonucleotide primer set is preferably an oligonucleotide primer set of SEQ ID NO: 1 and 2; Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; And oligonucleotide primer sets of SEQ ID NOs: 7 and 9, but is not limited thereto.
  • the oligonucleotide is preferably at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24 contiguous nucleotides in the sequence of SEQ ID NO: 1 It may be an oligonucleotide consisting of fragments of. In addition, the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 consecutive nucleotides in the sequence of SEQ ID NO: 2.
  • the oligonucleotide is preferably an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 consecutive nucleotides in the sequence of SEQ ID NO. Can be.
  • the oligonucleotide may preferably be an oligonucleotide consisting of segments of at least 16, at least 17, at least 18, at least 19, at least 20 consecutive nucleotides in the sequence of SEQ ID NO: 8.
  • the oligonucleotide is preferably 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more in the sequence of SEQ ID NO. , Oligonucleotides consisting of at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32 contiguous nucleotides.
  • primer refers to a single stranded oligonucleotide sequence that is complementary to the nucleic acid strand to be copied and may serve as a starting point for the synthesis of the primer extension product.
  • the length and sequence of the primers should allow to start the synthesis of extension products. The specific length and sequence of the primer will depend on the primer utilization conditions such as temperature and ionic strength as well as the complexity of the DNA or RNA target required.
  • oligonucleotides used as primers may also include nucleotide analogues, such as phosphorothioate, alkylphosphothioate or peptide nucleic acid, or It may comprise an intercalating agent.
  • the present invention provides a kit for selecting pepper varieties resistant to PMMoV, comprising the oligonucleotide primer set according to the present invention and a reagent for carrying out an amplification reaction.
  • the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, buffers and the like.
  • the kits of the present invention may further comprise a user guide describing the optimal reaction performance conditions.
  • the guide is a printed document that explains how to use the kit, such as how to prepare a PCR buffer, and the reaction conditions presented.
  • the instructions include brochures in the form of pamphlets or leaflets, labels affixed to the kit, and instructions on the surface of the package containing the kit.
  • the guide includes information that is disclosed or provided through electronic media such as the Internet.
  • It provides a method for screening pepper varieties resistant to Pepper mild mottle virus (PMMoV), comprising detecting the amplification product.
  • PMMoV Pepper mild mottle virus
  • the method includes separating genomic DNA from pepper samples.
  • a method for separating genomic DNA from the sample a method known in the art may be used.
  • a CTAB method may be used, or a wizard prep kit (Promega) may be used.
  • oligonucleotide primer sets according to one embodiment of the present invention may be used as a primer to amplify a target sequence.
  • Methods for amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification systems, There are any suitable methods for amplifying via strand displacement amplification or Q ⁇ replication or for amplifying nucleic acid molecules known in the art.
  • PCR is a method of amplifying a target nucleic acid from a pair of primers specifically binding to the target nucleic acid using a polymerase.
  • PCR methods are well known in the art, and commercially available kits may be used.
  • the amplified target sequence may be labeled with a detectable labeling substance.
  • the labeling material may be, but is not limited to, a material that emits fluorescence, phosphorescence, or radioactivity.
  • the labeling substance is Cy-5 or Cy-3.
  • the label using the radioactive material may add radioactive isotopes such as 32 P or 35 S to the PCR reaction solution when PCR is performed, and the amplification product may be incorporated into the amplification product while the amplification product is synthesized.
  • radioactive isotopes such as 32 P or 35 S
  • the amplification product may be incorporated into the amplification product while the amplification product is synthesized.
  • One or more sets of oligonucleotide primers used to amplify the target sequence are as described above.
  • the method of the present invention includes detecting the amplification product. Detection of the amplification product may be performed through DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting amplification products, gel electrophoresis can be performed. Gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, in the fluorescence measurement method, PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of a primer, and a target sequence is labeled with a detectable fluorescent labeling substance, and the labeled fluorescence is measured using a fluorimeter.
  • radioactivity measuring method is to add a radioactive isotope such as 32 P or 35 S to the PCR reaction solution to label the amplification product when performing PCR, and then radioactive measuring apparatus, for example, Geiger counter or liquid flash The radioactivity can be measured using a liquid scintillation counter.
  • a radioactive isotope such as 32 P or 35 S
  • radioactive measuring apparatus for example, Geiger counter or liquid flash
  • the radioactivity can be measured using a liquid scintillation counter.
  • Tobamovirus resistant Capsicum plants including specific L alleles ( L 0 , L 2 , L 3 and L 4 ), were used to develop differential L allele molecular markers.
  • C. annuum cv.Early California Wonder, C. frutescens cv. Tabasco, C. chinense var. PI 159236 And C. chacoense PI 260429 (USDA southern Regional Plant Introduction Station) were homozygous for L 0 , L 2 , L 3 and L 4 , respectively, and were used as indicator plants.
  • L 1 marker plants were obtained by self-pollination of F 1 commercial varieties (Seminis Korea Inc. Hungnong Seed Co., Ltd., Seoul, Korea) and Special (SP) (Enza Zaden, Enhjuizen, The Netherlands) from the F 2 population.
  • Tobamovirus pathotype P 1.2.3 And P 0 MS and SP F 2 Each was used for in vivo resistant phenotype screening of the population. Tobamovirus resistance of the mapping population was measured by visualizing hypersensitivity response (HR) and further measured by ELISA analysis. Above two The strain is three lines tobacco( N. tabaccum var. samsun) and Nicotiana Nicotiana ( N. nicotiana ) To grow. remind L One Marker plant is Tobamovirus pathogenic P 1.2.3 It was separated by leaf inoculation detached using. Individual plants that exhibited HR were determined to be resistant and plants that did not exhibit an HR phenotype were selected. 10-20 Fs used for tobacco mosaic virus (TMV) resistance screening of Monsanto hybrids 2: 3 Except for the individuals, phenotypic screening of commercial crossbrees was performed within each individual seed company.
  • TMV tobacco mosaic virus
  • Total gDNA of the mapping population was extracted from leaf tissue using the hexadecyltrimethyl-ammonium bromide (CTAB) process (Kang et al., 2010 Theor Appl Genet 120: 1587-1596). DNA samples were used for marker analysis. Total RNA of each marker plant was extracted from the leaf tissue using the RNeasy plant mini kit (QIAGEN, Germany) according to the manufacturer's manual. RNA samples were used for sequencing of L homologs.
  • CTAB hexadecyltrimethyl-ammonium bromide
  • PCR products were purified using a Zymoclean TM gel DNA recovery kit (Zymo Research, USA), and sequencing was performed by the Agricultural Sciences Joint Instrument Center (NICEM) of Seoul National University.
  • Zymoclean TM gel DNA recovery kit Zymo Research, USA
  • sequencing was performed by the Agricultural Sciences Joint Instrument Center (NICEM) of Seoul National University.
  • the BLAST program http://blast.ncbi.nlm.nih.gov/Blast.cgi
  • clustal W2 http://www.ebi.ac.uk The / Tools / msa / clustalw2 /) program was used for local nucleotide sequencing.
  • HRM high resolution melting
  • PCR was performed with 60 mM KCl, 10 mM Tris-Cl, 2.5 mM MgCl 2 , 0.25 mM each dNTP, 5 pmol each primer, 1 unit Taq polymerase, 1.25 ⁇ M syto9, and 50 ng gDNA 20 ⁇ l of template was performed.
  • PCR consisted of 1 minute reaction at 94 ° C, 40 cycles of 20 seconds at 94 ° C, 20 seconds at 58-60 ° C, and 30 seconds at 72 ° C, and 5 minutes at 72 ° C. Fluorescence signals were measured every 0.1 ° C. from 70 ° C. to 90 ° C. and melting curve analysis was performed using the manufacturer's operating software.
  • Co-segregation analysis was performed using a crossover comprising molecular markers associated with the SP, MS F 2 population and L 4 gene. Association analysis of molecular markers associated with the L locus was performed using the Carthagene 1.0 program with a LOD score threshold of 4.0 and a maximum distance of 30 cM (de Givry et al., 2005 Bioinformatics 21: 1704-1704).
  • L4segF & R One HRM marker, labeled L4segF & R, is available in commercial cultivars and populations. L To identify alleles L 4 It was developed based on the sequence located in the 5 'LRR domain of the candidate genes (Table 1). The marker is L 4 All containing one SNP specific to the candidate gene L Amplify 80 bp DNA fragment for the allele. HRM analyzes each L 5 were performed with L4segF & R using allele marker plants' genomic DNA. L The genotype of the allele is divided into three fusion curve patterns ( L 0 Allele, L 2 And L 4 Alleles, and L One And L 3 Alleles) are shown (Fig. 1). The results were in perfect agreement with the sequence information.
  • association analysis was performed using SP and MS F 2 populations to place L4segF & R on previously reported L 4 -associated markers. The same population was used for the development of markers and the construction of association maps associated with the L 4 gene (Yang et al., 2009 Mol Breeding 24: 433-446).
  • Four molecular markers associated with the L locus 087H03T7HRM, 189D23M, L4SC340 and L2kstd, were mapped in the MS F 2 population, while 087H03T7HRM and 189D23M were mapped in the SP F 2 population.
  • 189D23M has been shown to be the closest marker associated with the L 4 gene (Yang et al., 2009 Mol Breeding 24: 433-446).
  • L4segF & R A total of 631 and 858 individual plants in each population were analyzed by L4segF & R and 2 and 3 recombinants were found in the SP and MS populations respectively (Table 2).
  • the recombinant showed that the L 4 candidate gene may not be the target L 4 gene that confers TMV resistance, or that other genetic backgrounds may confer disease resistance to the two populations of TMV tested above.
  • the 189D23M and 087H03T7HRM markers flanking the L 4 gene are located at a gene distance of 1-2 cM in the MS and SP F 2 populations.
  • De Ruiter hybrids consisted of 29 progeny groups derived from 3 and 29 strains, all of which were resistant to TMV P 1.2.3 .
  • 14 progeny groups showed the same melting curve pattern as the MS and SP F 2 groups, while another progeny group showed different melting curve patterns from the markers.
  • the melting curve pattern of the 189D23M marker in all De Ruiter crosses was different from the MS and SP F 2 populations. Crossovers showing different melting curve patterns from the MS and SP F 2 populations were isolated from each progeny group. It was difficult to determine the genotype of these two markers.
  • De Ruiter Class I Several genetic features of De Ruiter Class I have been discovered. All subjects that were heterozygous for the L4segF & R marker were heterozygous for the 087H03T7HRM marker. However, homozygous individuals resistant to L4segF & R markers were homozygous sensitive to 087H03T7HRM and 087H03T7CAPS markers, and homozygous individuals sensitive to L4segF & R markers were resistant to 087H03T7CAPS and 087H03T7HRM markers. The genotype of the 189D23M marker could not be determined because the fusion curve pattern of the individuals differed from the plant material used as a control, but is expected to be co-separated using another three markers.
  • 087H03T7HRM was located 1.5 cM from the L 4 gene.
  • De Ruiter Class I may be evidence of the shift of the gene region around the L 4 gene from the 087H03T7HRM marker region or recombination between the L4segF & R and 087H03T7HRM marker.
  • De Ruiter class II Genotyping with markers around the L 4 gene revealed several genetic features of De Ruiter class II.
  • the melting curve patterns of the 087H03T7HRM and 189D23M markers were different from those of the MS and SP F 2 populations. However, the genotypes of these two markers were perfectly co-separated, indicating that 087H03T7HRM and 189D23M markers are associated.
  • De Ruiter class II was classified into three subclasses by association between four markers around the L 4 gene.
  • the first subclass, De Ruiter Class II-A consists of six of the 14 Progenies. Genotypes of 087H03T7HRM and 087H03T7CAPS were not co-separated from De Ruiter Class II-A. The 087H03T7CAPS markers were not isolated in all individuals of this subclass, and their genotypes were all homozygous resistant. L4segF & R, 189D23M and 087H03T7HRM markers were separated in this subclass.
  • the 189D23M and 087H03T7HRM markers showed four different melting curve patterns, respectively, different from MS and SP (data not shown), and each progeny group had only two types of genotypes for the L4segF & R, 189D23M and 087H03T7HRM markers.
  • L4segF & R markers were co-separated with 189D23M and 087H03T7HRM in 52 individuals of De Ruiter class II-A, indicating that the L4segF & R marker is associated with another two markers.
  • the second subclass, De Ruiter Class II-B consists of six of the 14 Progenies. It is contemplated that the 189D23M, 087H03T7CAPS and 087H03T7HRM markers would have been co-separated from 48 individuals of this subclass without recombinants. L4segF & R was not co-separated with the three markers, and the genotypes of the subclass individuals were all homozygous resistant genotypes. We further found six melting curve patterns in the 189D23M and 087H03T7HRM markers, respectively (data not shown).
  • the third subclass, De Ruiter Class II-C consists of three of the 14 Progeny groups. Genotypic patterns of L4segF & R and 087H03T7CAPS were identical to De Ruiter Class I. Four additional fusion curve patterns were found respectively at 189D23M and 087H03T7HRM (data not shown), and the fusion curve patterns of 189D23M and 087H03T7HRM were co-separated with L4segF & R and 087H03T7CAPS in 28 individuals of De Ruiter Class II-C. It is thought to be. This indicates that all four markers are closely related to the subclass. Only one Progeny group belongs to De Ruiter Class III.
  • the melting curve patterns of 087H03T7HRM and 087H03T7CAPS were the same, but the melting curve patterns of 189D23M were different from the MS and SP F 2 populations.
  • L4segF & R and 189D23M markers are thought to have been co-separated, and 087H03T7HRM and 087H03T7CAPS were co-separated.
  • the inventors analyzed the Monsanto and basal hybrids using L4segF & R markers and found that 60 out of 93 individuals and 8 out of 22 individuals were recombinant. The Monsanto and was a higher percentage of recombinants will result nongwoo mating state could not at all expected, since the genetic distance of the marker from the R & L4segF L 4 gene is MS and SP F than in the second group 0.5 cM. The results indicate that the gene constructs around the L 4 gene in Monsanto or in a cattle breeder differ from those in the MS and SP F 2 populations.
  • Monsanto strain-A derived progeny was all homozygous resistant or all heterozygous for the three markers.
  • Monsanto SB-derived Progeny exhibited three different genotype patterns, as follows; Resistance genotype homozygous for all three markers, resistance genotype homozygous for L4segF & R and 189D23M markers, genotype heterozygous for 087H03T7HRM marker, resistance genotype homozygous for 087H03T7HRM, and 189D23 sensitive for L4segF & M and 189D23 Phosphorus genotype (Table 4).
  • the first genotype pattern was homozygous resistant for all three markers, and the second pattern was heterozygous genotype for all three markers.
  • the final pattern showed sensitivity for 087H03T7, homozygous resistance for L4segF & R, and new allele for 189D23M.
  • L 4 candidate genes sequences the L4segF & R markers developed on the basis that if assuming that the only gene L 4 gene confers resistance to Toba parent virus in capsicum (Capsicum), resistance to Toba parent virus P 1.2.3 It was expected to accurately represent the contributing L 4 gene.
  • the other two markers, 189D23M and 087H03, are associated markers located near the L 4 gene with gene distances of 1.5 and 0.9 cM, respectively.
  • homozygous resistant or heterozygous genotypes to L4segF & R markers are expected to exhibit a resistant phenotype, whereas plants with homozygous sensitive genotypes are expected to be sensitive phenotypes.
  • a total of eight recombinants were found in the MS, SP F 2 population and De Ruiter hybrids whose genotype results did not match the expected phenotype.
  • Three individuals from the De Ruiter hybrid and one individual from the MS F 2 population with homozygous susceptibility genotype by L4segF & R exhibited a resistant phenotype, with one or more functional homologues associated with the L 4 candidate gene for tobamovirus. Indicates that resistance may be imparted. Based on this assumption, two models (No. 1 and No. 2) were modeled (FIG. 2).
  • R homozygous resistance
  • H heterozygous resistance
  • S homozygous susceptible
  • model 5 was modeled on the basis of overlap and co-existence of different L loci. In this case, the heterozygous genotype was detected when all progenies exhibited a homozygous resistant phenotype.
  • L allele soldiers L 0 , L 1 , L 2 , L 3 and L 4 interact with five tobamovirus pathogens P 0 , P 1 , P 1.2 , P 1.2.3 and P 1.2.3.4 Decided by.
  • Several molecular markers associated with L 3 or L 4 have been developed, but no marker distinguishes all L alleles.
  • the total sequence of one L 3 allele and six L candidate genes L 1 , L 1a , L 1c , L 2 , L 2b and L 4 have been reported (Tomita et al., 2011 Mol Plant Microbe In 24: 108 -117).
  • Nucleotide diversity of the LRR domain is typically because higher than the NBS domain, L4RP-1F & R, L4RP -2F & R and three marker sets marked L4RP-3F & R has been designed based on the 3 'LRR sequences of the L 4 candidate genes, One primer labeled 3'end was designed based on the 3 'terminal sequence of the L 4 candidate gene ( Figure 3).
  • L4RP-1F / L4RP-1R L4RP-2F / L4RP-2R, L4RP-3F / L4RP-3R, L4RP-1F / L4RP-2R, L4RP-2F / L4RP-3R, and L4RP-3F / 3'end was analyzed using marker plants homozygous for each L allele.
  • the L4RP-3F / L4RP-3R primer set amplified five different bands in the 160-400 bp range.
  • the L4RP-3F / 3'end primer set amplified only one weak single band for the homozygous L 0 genotype, but clearly and cleanly for all other genotypes.
  • L4RP-3F / 3'end For the primer set, because the amplifier is not familiar with the L 0, L 0 is the melting curve pattern was relatively unstable. L 0 can be detected by a late amplified fluorescence signal compared to other L alleles. The fluorescence signal of the other L allele increased from 23-28 cycles, while the fluorescence signal of L 0 increased from 37-39 cycles. Although many bands were derived from various homologous sequences amplified by L4RP-3F / L4RP-3R, the HRM fusion curve results of the markers were very stable and showed reliable genotyping results.
  • the L4RP-3F / L4RP-3R primer set distinguishes all heterozygous types, while the L4RP-3F / 3'end primer set distinguishes the remaining heterozygous types except for artificial heterozygosity mixed with L 1 from MS. (FIG. 5).
  • the inventors further performed a blind test for commercial crossovers (Enza Zaden) using L4RP-3F / L4RP-3R and L4RP-3F / 3'end primer sets.
  • the hybrids consisted of 91 individuals homozygous for the L 0 , L 1 , L 3 and L 4 alleles. The two markers successfully detected the four different L alleles, and only one individual of L 1 was assigned to the wrong allele using the primer set.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Chemical Kinetics & Catalysis (AREA)

Abstract

본 발명은 ＰＭＭｏＶ 저항성 고추 품종을 선별하기 위한 프라이머 세트, 방법 및 키트에 관한 것으로, 더욱 상세하게는 서열번호 1 및 2의 올리고뉴클레오티드 프라이머 세트; 서열번호 7 및 8의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 7 및 9의 올리고뉴클레오티드 프라이머 세트로 구성되는 군으로부터 선택된 하나 이상의 올리고뉴클레오티드 프라이머 세트를 포함하는 PMMoV에 대해 저항성을 갖는 고추 품종을 선별하기 위한 올리고뉴클레오티드 프라이머 세트, 상기 올리고뉴클레오티드 프라이머 세트를 포함하는 PMMoV에 대해 저항성을 갖는 고추 품종을 선별하기 위한 키트 및 상기 프라이머 세트를 이용하여 PMMoV에 대해 저항성을 갖는 고추 품종을 선별하기 위한 방법에 관한 것이다.

Description

ＰＭＭｏＶ 저항성 고추 품종을 선별하기 위한 프라이머 세트, 방법 및 키트
본 발명은 PMMoV 저항성 고추 품종을 선별하기 위한 프라이머 세트, 방법 및 키트에 관한 것으로, 더욱 상세하게는 본 발명에 따른 프라이머 세트를 고추 작물들에 적용하여 PMMoV에 저항성을 나타내는 고추 품종을 효율적으로 선별 및 육성할 수 있게 하는 기반기술을 제공하고자 하는 것이다.
고추마일드모틀바이러스(Pepper mild mottle virus, PMMoV)는 전국적으로 널리 재배되고 있는 고추와 주요 수출작목으로 경제적 부가가치가 높은 단고추와 착색단고추 등에 흔히 발생하고 있다. PMMoV는 오염된 종자나 기계적인 접촉에 의해 쉽게 전염되어 경제적으로 큰 피해를 주고 있다. 최근에는 해외에서 채종된 종자의 도입이 계속적으로 증가하고 있어 PMMoV의 도입 및 확산을 막기 위한 조기정밀진단기술의 개발이 요구되는 실정이다.
PMMoV는 현재까지 몇 가지 계통이 알려져 있으며, 이들 간에는 상당한 변이가 존재한다. 현재까지 PMMoV에 대한 진단 방법은 혈청학적 진단 방법만이 개시되어 있을 뿐이다. 하지만 동 방법으로는 계통간 변이가 존재하는 경우 검출능의 한계로 인해 검출에 실패할 가능성이 상당히 높은 실정이나 아직 이렇다할 대안은 제시되고 있지 못하다.
PMMoV는 단일 가닥의 리보 핵산이 막대 모양의 외피 단백질에 쌓여 있는 바이러스로 토바모바이러스(Tobamovirus)에 속한다. 전 세계적으로 분포하며 특히 미대륙, 유럽, 동북아시아에서 큰 피해를 주고 있다. 기주 범위도 넓어 22과 200여 종에서 감염이 보고되었으며, 고추에서는 특히 생육 초기에 큰 피해를 입힌다. PMMoV에 감염되면 잎 또는 줄기 조직에서 황화 현상이 나타나거나 생육 속도가 감소해 생장이 둔화되는 병징이 나타나며, 과실에서도 뒤틀림 현상이 나타나 상품의 가치를 떨어뜨리기도 한다.
본 발명은 L 4 대립유전자일 것으로 추측되는 RGA(R gene analog)의 일부 서열을 이용해 L 4 저항성 대립유전자와 매우 가깝게 연관된 분자표지를 개발한 내용을 제공함으로써, 본 발명의 분자표지를 이용하여 PMMoV에 저항성을 보이는 고추 품종의 효율적인 육성을 가능하게 한다. 한편, 이에 대하여 이미 알려진 바는 전혀 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명은 PMMoV에 저항성을 나타내는 고추 품종을 효율적으로 육성하기 위하여, 고추의 L 저항성 유전자좌에 연관된 분자표지를 이용한 Marker assisted selection(MAS)으로써, 고추의 PMMoV 병 저항성 유전자좌인 L 주변의 염기서열에서도 여러 NBS-LRR 유전자 서열이 있다는 사실을 토대로 하여, L 4 대립유전자일 것으로 추측되는 RGA의 일부 서열을 이용해 L 4 저항성 대립유전자와 매우 가깝게 연관된 분자표지를 개발하여 본 발명을 완성하게 되었다.
상기 과제를 해결하기 위해, 서열번호 1 및 2의 올리고뉴클레오티드 프라이머 세트; 서열번호 7 및 8의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 7 및 9의 올리고뉴클레오티드 프라이머 세트로 구성되는 군으로부터 선택된 하나 이상의 올리고뉴클레오티드 프라이머 세트를 포함하는 PMMoV에 대해 저항성을 갖는 고추 품종을 선별하기 위한 올리고뉴클레오티드 프라이머 세트를 제공한다.
또한, 본 발명은 상기 올리고뉴클레오티드 프라이머 세트를 포함하는 PMMoV에 대해 저항성을 갖는 고추 품종을 선별하기 위한 키트를 제공한다.
또한, 본 발명은 상기 프라이머 세트를 이용하여 PMMoV에 대해 저항성을 갖는 고추 품종을 선별하기 위한 방법을 제공한다.
본 발명에 따른 분자표지를 많은 고추 작물들에 적용하면 PMMoV에 저항성을 나타내는 고추 품종을 효율적으로 선별 및 육성할 수 있게 한다. 따라서, 본 발명에 따른 분자표지 및 본 발명에서 제공하는 고추 품종 선별 방법은 세균이나 곰팡이와는 다르게 약제에 의한 방제가 거의 불가능한 바이러스의 피해를 막고자 PMMoV 저항성 품종을 육성하기 위해 많은 노력을 해온 고추 육종업자들에게 매우 유용할 것이다.
도 1은 L4segF&R 마커의 융해 곡선을 나타낸 것이다. L 대립유전자는 3가지 상이한 군으로 분류되었다. 첫 번째 융해 곡선은 L 0 를, 두번째는 L 2 및 L 4 를, 마지막은 L 1 및 L 3 를 나타낸다.
도 2는 상이한 교배주에서 L 4 유전자 주변 유전자 영역의 추정 유전적 구조물의 모식도를 나타낸 것이다. 캡시쿰 샤코엔스(C. chacoence) 유래 L 유전자좌 주변의 유전자 영역(흑색)은 캡시쿰 아눔(C. annuum) 게놈으로 다르게 침투된 것으로 나타났다. 모델 1 및 2번은 하나 이상의 기능적 상동체의 존재를 가정하여 나타내었다. 모델 3, 4 및 5번은 비-대립유전자 영역으로의 전좌(translocation)를 가정하여 나타내었다. 대립유전자 영역의 결실은 3 및 4번에서 일어날 수 있는 반면(점선 박스), 5번에서는 대립유전자 영역이 남아 있다.
도 3은 L 3 및 3' LRR 영역 내 4개의 L 후보 유전자(L 1 , AB523372; L 1a , AB523373; L 2 , AB523375; L 3 , AB523370; L 4 , AB523377, GenBank)의 단일 뉴클레오티드 다형성(SNP)을 나타낸 것이다. L 1 (SP) 및 L 1 (MS)의 SNP는 L 1 및 L 1a 후보 유전자의 SNP와 각각 일치하였다. 흑색 선은 각 프라이머 세트에 포함된 SNP를 나타낸다. 2개의 프라이머 세트 L4RP-3F & 3'endR 및 L4RP-3F & L4RP-3R은 모든 L 대립유전자를 구분할 수 있는 SNP를 포함한 반면, 나머지는 L 대립유전자의 일부만을 구분할 수 있었다.
도 4는 L 4 후보 유전자의 3' LRR을 기초로 하여 개발된 SNP 마커 프로파일을 나타낸 것이다. 6개의 다른 프라이머 세트는 각 L 대립유전자에 대해 동형접합성인 표지자 식물의 gDNA를 이용하여 분석되었다. 2개의 프라이머 세트 L4RP-3F & L4RP-3R 및 L4RP-3F & 3'end는 모든 L 대립유전자를 명확하게 구분할 수 있었다.
도 5는 L4RP-3F & L4RP-3R 프라이머 세트의 HRM 분석에서 SP로부터 L 0 , L 1 , MS로부터 L 1 와 L 2 , L 3 및 L 4 의 여섯개의 L 대립유전자의 동형접합성 유전자형 및 이 대립유전자들 각 쌍의 이형접합성 유전자형의 융해 곡선 패턴 및 동형접합성 유전자형의 차이 그래프를 나타낸 것이다. 이 마커 세트는 동형접합성 유전자형으로부터 이형접합성 유전자형 15개 형태를 구별할 수 있다.
본 발명의 목적을 달성하기 위하여, 본 발명은 서열번호 1 및 2의 올리고뉴클레오티드 프라이머 세트; 서열번호 7 및 8의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 7 및 9의 올리고뉴클레오티드 프라이머 세트로 구성되는 군으로부터 선택된 하나 이상의 올리고뉴클레오티드 프라이머 세트를 포함하는 Pepper mild mottle virus (PMMoV)에 대해 저항성을 갖는 고추 품종을 선별하기 위한 올리고뉴클레오티드 프라이머 세트를 제공한다.
본 발명의 일 구현예에 따른 올리고뉴클레오티드 프라이머 세트는 바람직하게는 서열번호 1 및 2의 올리고뉴클레오티드 프라이머 세트; 서열번호 7 및 8의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 7 및 9의 올리고뉴클레오티드 프라이머 세트를 포함할 수 있으나, 이에 제한되지 않는다.
상기 올리고뉴클레오티드는 바람직하게는 서열번호 1의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상, 20개 이상, 21개 이상, 22개 이상, 23개 이상, 24개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드일 수 있다. 또한, 상기 올리고뉴클레오티드는 바람직하게는 서열번호 2의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상, 20개 이상, 21개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드일 수 있다.
또한, 상기 올리고뉴클레오티드는 바람직하게는 서열번호 7의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상, 20개 이상, 21개 이상, 22개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드일 수 있다. 또한, 상기 올리고뉴클레오티드는 바람직하게는 서열번호 8의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상, 20개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드일 수 있다.
또한, 상기 올리고뉴클레오티드는 바람직하게는 서열번호 9의 서열 내의 16개 이상, 17개 이상, 18개 이상, 19개 이상, 20개 이상, 21개 이상, 22개 이상, 23개 이상, 24개 이상, 25개 이상, 26개 이상, 27개 이상, 28개 이상, 29개 이상, 30개 이상, 31개 이상, 32개 이상의 연속 뉴클레오티드의 절편으로 이루어진 올리고뉴클레오티드일 수 있다.
본 발명에 있어서, "프라이머"는 카피하려는 핵산 가닥에 상보적인 단일 가닥 올리고뉴클레오티드 서열을 말하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 상기 프라이머의 길이 및 서열은 연장 산물의 합성을 시작하도록 허용해야 한다. 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도(complexity) 뿐만 아니라 온도 및 이온 강도와 같은 프라이머 이용 조건에 의존할 것이다.
본 명세서에 있어서, 프라이머로서 이용된 올리고뉴클레오티드는 또한 뉴클레오티드 유사체(analogue), 예를 들면, 포스포로티오에이트(phosphorothioate), 알킬포스포로티오에이트 또는 펩티드 핵산(peptide nucleic acid)을 포함할 수 있거나 또는 삽입 물질(intercalating agent)을 포함할 수 있다.
본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은 본 발명에 따른 올리고뉴클레오티드 프라이머 세트 및 증폭 반응을 수행하기 위한 시약을 포함하는, PMMoV에 대해 저항성을 갖는 고추 품종을 선별하기 위한 키트를 제공한다. 본 발명의 키트에서, 상기 증폭 반응을 수행하기 위한 시약은 DNA 폴리머라제, dNTPs, 버퍼 등을 포함할 수 있다. 또한, 본 발명의 키트는 최적의 반응 수행 조건을 기재한 사용자 안내서를 추가로 포함할 수 있다. 안내서는 키트 사용법, 예를 들면, PCR 완충액 제조 방법, 제시되는 반응 조건 등을 설명하는 인쇄물이다. 안내서는 팜플렛 또는 전단지 형태의 안내 책자, 키트에 부착된 라벨, 및 키트를 포함하는 패키지의 표면상에 설명을 포함한다. 또한, 안내서는 인터넷과 같이 전기 매체를 통해 공개되거나 제공되는 정보를 포함한다.
본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은
고추 시료에서 게놈 DNA를 분리하는 단계;
상기 분리된 게놈 DNA를 주형으로 하고, 본 발명에 따른 올리고뉴클레오티드 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및
상기 증폭 산물을 검출하는 단계를 포함하는, Pepper mild mottle virus (PMMoV)에 대해 저항성을 갖는 고추 품종을 선별하기 위한 방법을 제공한다.
본 발명의 방법은 고추 시료에서 게놈 DNA를 분리하는 단계를 포함한다. 상기 시료에서 게놈 DNA를 분리하는 방법은 당업계에 공지된 방법을 이용할 수 있으며, 예를 들면, CTAB 방법을 이용할 수도 있고, wizard prep 키트(Promega 사)를 이용할 수도 있다. 상기 분리된 게놈 DNA를 주형으로 하고, 본 발명의 일 실시예에 따른 하나 이상의 올리고뉴클레오티드 프라이머 세트를 프라이머로 이용하여 증폭 반응을 수행하여 표적 서열을 증폭할 수 있다. 표적 핵산을 증폭하는 방법은 중합효소연쇄반응(PCR), 리가아제 연쇄반응(ligase chain reaction), 핵산 서열 기재 증폭(nucleic acid sequence-based amplification), 전사 기재 증폭 시스템(transcription-based amplification system), 가닥 치환 증폭(strand displacement amplification) 또는 Qβ 복제효소(replicase)를 통한 증폭 또는 당업계에 알려진 핵산 분자를 증폭하기 위한 임의의 기타 적당한 방법이 있다. 이 중에서, PCR이란 중합효소를 이용하여 표적 핵산에 특이적으로 결합하는 프라이머 쌍으로부터 표적 핵산을 증폭하는 방법이다. 이러한 PCR 방법은 당업계에 잘 알려져 있으며, 상업적으로 이용가능한 키트를 이용할 수도 있다.
본 발명의 방법에 있어서, 상기 증폭된 표적 서열은 검출가능한 표지 물질로 표지될 수 있다. 일 구현예에서, 상기 표지 물질은 형광, 인광 또는 방사성을 발하는 물질일 수 있으나, 이에 제한되지 않는다. 바람직하게는, 상기 표지 물질은 Cy-5 또는 Cy-3이다. 표적 서열의 증폭시 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지될 수 있다. 또한, 방사성 물질을 이용한 표지는 PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하면 증폭 산물이 합성되면서 방사성이 증폭 산물에 혼입되어 증폭 산물이 방사성으로 표지될 수 있다. 표적 서열을 증폭하기 위해 이용된 하나 이상의 올리고뉴클레오티드 프라이머 세트는 상기에 기재된 바와 같다.
본 발명의 방법은 상기 증폭 산물을 검출하는 단계를 포함한다. 상기 증폭 산물의 검출은 DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있으나, 이에 제한되지 않는다. 증폭 산물을 검출하는 방법 중의 하나로서, 겔 전기영동을 수행할 수 있다. 겔 전기영동은 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 PCR 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
재료 및 방법
식물 재료
특정 L 대립유전자(L 0 , L 2 , L 3 및 L 4 )를 포함하는, 토바모바이러스 (Tobamovirus) 저항성 캡시쿰(Capsicum) 식물을 차별적 L 대립유전자 분자 마커 개발에 이용하였다. 캡시쿰 아눔 씨브이 얼리 캘리포니아 원더(C. annuum cv. Early California Wonder), 캡시쿰 프루테센스 씨브이 타바스코(C. frutescens cv. Tabasco), 캡시쿰 치넨세 변종(C. chinense var.) PI 159236 및 캡시쿰 차코엔세 (C. chacoense) PI 260429(USDA southern Regional Plant Introduction Station) 는 각각 L 0 , L 2 , L 3 및 L 4 에 대해 동형접합성이고, 표지자(indicator) 식물로 이용하였다. L 1 표지자 식물은 각각 F1 시판 품종의 자가수분에 의해 수득된 명성(MS)(Seminis Korea Inc. Hungnong Seed Co., Ltd., Seoul, Korea) 및 스페샬(SP)(Enza Zaden, Enhjuizen, The Netherlands) F2 집단으로부터 분리하였다.
L 4 후보(candidate) 유전자의 확인 및 L 유전자좌(locus) 주변의 유전자 구조물 구축에 이용된 교배주(breeding line)는 De Ruiter(Amstelveen, Netherland), 몬산토 코리아(Seoul, Korea) 및 농우 바이오(Suwon, Korea)를 포함하는 상업적인 종자 회사에 의해 제공되었다. 뿐만 아니라, Enza zaden의 교배주는 L 대립유전자 특이적 마커의 확인에 이용하였다.
바이러스 균주 및 내성 스크리닝
토바모바이러스 병원형(pathotype) P1.2.3 및 P0 는 MS 및 SP F2 집단의 생체내(in vivo) 저항성 표현형 스크리닝에 각각 이용되었다. 맵핑 집단의 토바모바이러스 저항성은 과민성 반응(HR)을 가시화하여 측정되었고, ELISA 분석에 의해 추가로 측정되었다. 상기 두 균주는 삼선 담배(N. tabaccum var. samsun) 및 니코티아나 니코티아나(N. nicotiana)를 이용하여 증식시켰다. 상기 L 1 표지자 식물은 토바모바이러스 병원형 P1.2.3 를 이용하여 떼어낸 잎 접종에 의해 분리되었다. HR을 나타내는 개별 식물들은 저항성으로 결정되었고, HR 표현형을 나타내지 않는 식물이 선별되었다. 몬산토 교배주의 TMV(tobacco mosaic virus) 저항성 스크리닝을 위해 이용된 10 내지 20개의 F2:3 개체를 제외하고는, 시판 교배주의 표현형 스크리닝은 각 개별 종자 회사 내에서 수행되었다.
게놈 DNA 추출
맵핑 집단의 총 gDNA는 헥사데실트리메틸-암모늄 브로마이드(CTAB) 과정을 이용하여 잎 조직으로부터 추출되었다(Kang et al., 2010 Theor Appl Genet 120:1587-1596). DNA 샘플은 마커 분석에 사용되었다. 각 표지자 식물의 총 RNA는 제조사의 매뉴얼에 따라 RNeasy plant mini kit(QIAGEN, Germany)를 이용하여 잎 조직으로부터 추출되었다. RNA 샘플은 L 상동체(homolog)의 시퀀싱에 이용되었다.
DNA 서열 분석
PCR 산물은 ZymocleanTM gel DNA Recovery kit(Zymo Research, USA)를 이용하여 정제되었고, 시퀀싱은 서울대학교의 농업과학 공동기기센터(NICEM)에 의해 수행되었다.
2개의 프로그램이 서열 분석에 이용되었다. 블라스트(BLAST) 프로그램(http://blast.ncbi.nlm.nih.gov/Blast.cgi)은 국소적 뉴클레오티드의 서열정렬 분석에 이용되었고, clustal W2(http://www.ebi.ac.uk/Tools/msa/clustalw2/) 프로그램은 국소적 뉴클레오티드 서열정렬에 이용되었다.
SNP 마커 개발 및 분석
고해상도 융해(HRM, high resolution melting) 방법은 L 4 유전자좌와 연관된 분자 마커를 개발하고, Rotor-gene Q(QIAGEN)를 이용한 각 식물 개체의 유전자형을 분석하기 위해 사용되었다. PCR은 60 mM의 KCl, 10 mM의 Tris-Cl, 2.5 mM의 MgCl2, 0.25 mM의 각 dNTP, 5 pmol의 각 프라이머, 1 유닛의 Taq 폴리머라아제, 1.25 μM의 syto9, 및 50 ng의 gDNA 주형으로 이루어진 20 ㎕에서 수행되었다. PCR은 94℃에서 1분 동안의 반응과 94℃에서 20초, 58~60℃에서 20초 및 72℃에서 30초로 구성되는 40주기의 반응, 그리고 72℃에서 5분 동안의 반응으로 구성되었다. 형광 신호는 70℃에서 90℃까지 0.1℃ 마다 측정되었고, 융해 곡선 분석은 제조사의 작동 소프트웨어를 이용하여 수행되었다.
L 4 유전자와 연관된 분자 마커의 연관성 분석
공-분리(co-segregation) 분석은 SP, MS F2 집단 및 L 4 유전자와 연관된 분자 마커를 포함하는 교배주를 이용하여 수행되었다. L 유전자좌와 연관된 분자 마커의 연관성 분석은 4.0의 LOD 스코어 역치 및 30cM의 최대 거리를 가지는 Carthagene 1.0 프로그램을 이용하여 수행되었다(de Givry et al., 2005 Bioinformatics 21:1704-1704).
실시예 1: L 4 후보 유전자(candidate)를 기초로 한 마커 개발
L4segF&R로 표시된 1개의 HRM 마커는 시판 교배주 및 집단에서 L 대립유전자를 확인하기 위해 L 4 후보 유전자의 5' LRR 도메인에 위치한 서열을 기초로 하여 개발되었다(표 1). 상기 마커는 L 4 후보 유전자에 특이적인 하나의 SNP를 포함하는 모든 L 대립유전자에 대해 80bp의 DNA 절편을 증폭한다. HRM 분석은 각 L 대립유전자 표지자 식물의 게놈 DNA를 이용하여 L4segF&R로 수행되었고, 5개 L 대립유전자의 유전자형을 3개의 융해 곡선 패턴(L 0 대립유전자, L 2 및 L 4 대립유전자, 그리고 L 1 및 L 3 대립유전자)으로 구분하는 결과를 나타냈다(도 1). 상기 결과는 서열 정보와 완벽하게 일치되었다. L4segF&R은 L 4 /L 1 대립유전자를 분리한 2개의 F2 집단에서 추가로 조사되었다. MS 및 SP F2 집단에서 각 개체의 유전자형은 구별되어 L 4 /L 1 , L 1 /L 1 및 L 4 /L 4 와 같은 예상된 융해 곡선 패턴을 각각 나타내었다. 상기 두 집단의 유전적 백그라운드는 HRM 분석에서 임의의 효과를 나타내지 않았다.
표 1 L4 후보의 LRR 영역의 개발에 사용된 프라이머 리스트
L4segF TGTGAGAATCTTGAAATATTTTCGG (서열번호 1)
L4segR CTTTGCGCAAGAGTGGATATTC (서열번호 2)
L4RP-1F ATGTGGGACCCAGATGACGT (서열번호 3)
L4RP-1R TCCCAATTCTCACCACCAACA (서열번호 4)
L4RP-2F CACGATGGCAGTGACGAAGAGAT (서열번호 5)
L4RP-2R GGGCAATTCCAGATCAATAGACT (서열번호 6)
L4RP-3F TCTTCAGCACCTCAATTCGGTTC (서열번호 7)
L4RP-3R GAAGAGGGCATCCCTTTTACT (서열번호 8)
L3'endR TCACAGGCATTCACAGTCAAACATAGTGCGACC (서열번호 9)
실시예 2: L 4 후보 유전자의 연관성 분석
연관성 분석은 이전에 보고된 L 4 -연관 마커에 L4segF&R를 위치시키기 위해 SP 및 MS F2 집단을 이용하여 수행되었다. 상기와 동일한 집단이 마커의 개발 및 L 4 유전자와 연관된 연관 맵의 구축에 이용되었다(Yang et al., 2009 Mol Breeding 24:433-446). L 유전자좌와 연관된 4가지 분자 마커인 087H03T7HRM, 189D23M, L4SC340 및 L2kstd는 MS F2 집단에서 맵핑된 반면, 087H03T7HRM 및 189D23M은 SP F2 집단에서 맵핑되었다. 189D23M은 L 4 유전자와 연관된 가장 가까운 마커로 나타났다(Yang et al., 2009 Mol Breeding 24:433-446).
각 집단에서 총 631 및 858개의 개체 식물은 L4segF&R로 분석되었고, 2 및 3개의 재조합체가 SP 및 MS 집단에서 각각 발견되었다(표 2). 상기 재조합체는 L 4 후보 유전자가 TMV 저항성을 부여하는 표적 L 4 유전자가 아닐 수 있거나, 다른 유전적 백그라운드가 상기 시험된 2개 집단의 TMV에 대한 질병 저항성을 부여할 수도 있다는 것을 나타내었다.
표 2 L4segF&R 마커 유전자형 및 TMV 저항성의 공-분리 분석
Population Type Recombinants / Total number of population
SP F2 2 / 631
MS F2 3 / 858
Deruiter Breeding lines 3 / 249
Monsanto Breeding lines 0 (60)* / 132
Nongwoo Breeding lines 0 (8)* / 22
Total - 8 (68)* / 1920
* 후대검정(progeny test)에 의해 결정된 추가적인 재조합체들
De Ruiter, 몬산토 및 농우와 같은 종자 회사에 의해 지원된 총 431개의 시판 교배주는 L4segF&R을 이용해 스크리닝되었고, 3개의 개별 재조합체가 검출되었다(표 2).
실시예 3: L 4 유전자 주변에서 교배주의 유전적 백그라운드 분석
L 4 유전자의 측면에 있는 189D23M 및 087H03T7HRM 마커는 MS 및 SP F2 집단에서 1~2 cM의 유전자 거리에 위치한다. 본 발명자들은 시판 교배주를 이용하여 L 4 유전자좌 주변에서 유전적 백그라운드를 조사하기 위해 189D23M 및 087H03T7HRM 마커를 사용하였다(Yang et al., 2009 Mol Breeding 24:433-446).
De Ruiter 교배주는 3개의 개체주 및 29개의 주로부터 유도된 29개의 프로제니(progeny) 군으로 이루어져 있으며, 상기 모든 개체 및 프로제니는 TMV P1.2.3 에 대해 저항성을 나타내었다. 본 발명자들은 087H03T7HRM를 이용하여 De Ruiter 교배주 중 3개의 개별주를 분석하였다. 그 결과, 14개의 프로제니 군이 MS 및 SP F2 집단과 동일한 융해 곡선 패턴을 나타냈으나, 또 다른 프로제니 군은 상기 마커와는 다른 융해 곡선 패턴을 나타냈다. 모든 De Ruiter 교배주에서 189D23M 마커의 융해 곡선 패턴은 MS 및 SP F2 집단과는 상이하였다. MS 및 SP F2 집단과는 상이한 융해 곡선 패턴을 나타내는 교배주는 각 프로제니 군에서 분리되었다. 상기 두 마커의 유전자형을 결정하는 것은 어려웠다. 본 발명자들은 De Ruiter 교배주 개체들의 유전자형을 결정하기 위해, 087H03T7HRM로부터 변환된 087H03T7CAPS 마커를 추가로 이용하였다(Yang et al., 2009 Mol Breeding 24:433-446). 총 4개의 마커인 L4segF&R, 189D23M, 087H03T7HRM 및 087H03T7CAPS은 L 4 유전자 주변의 유전자 영역을 조사하기 위해 사용되었다. De Ruiter 주는 MS 및 SP F2 집단과의 융해 곡선 패턴 동일성 및 상기 4개의 마커 사이의 연관성에 의해 3개의 클래스로 분류되었다(표 3).
표 3 각 집단의 표현형 및 유전자형 정보
Class Identity of melting curve patterns with MS and SP F2 populations Linkage between markers No. of lines Recombinants for L4segF&R /total numbers of individuals
087H03T7HRM 189D23M
Deruiter Class I Identical Different L4segF&R, 189D23M, 087H03T7HRM, 087H03T7CAPS 16 3/112
Deruiter Class II-A Different Different L4segF&R, 189D23M, 087H03T7HRM / 087H03T7CAPS 6 0/52
Deruiter Class II-B Different Different 189D23M, 087H03T7HRM, 087H03T7CAPS / L4segF&R 6 0/48
Deruiter Class II-C Different Different L4segF&R, 189D23M, 087H03T7HRM, 087H03T7CAPS 3 0/28
Deruiter class III Identical Different L4segF&R, 189D23M / 087H03T7HRM, 087H03T7CAPS 1 0/9
Total 32 3/240
De Ruiter 클래스 I의 몇 가지 유전적 특징이 발견되었다. L4segF&R 마커에 대해 이형접합성인 모든 개체는 087H03T7HRM 마커에 대해서도 이형접합성이었다. 그러나, L4segF&R 마커에 대해 저항성인 동형접합성 개체는 087H03T7HRM 및 087H03T7CAPS 마커에 대해 민감성인 동형접합성이었고, L4segF&R 마커에 대해 민감성인 동형접합성 개체는 087H03T7CAPS 및 087H03T7HRM 마커에 대해 저항성인 동형접합성이었다. 189D23M 마커의 유전자형은 개체들의 융해 곡선 패턴이 대조군으로 사용한 식물 재료와 상이했기 때문에 결정될 수 없었지만, 또 다른 3개의 마커를 이용하면 공-분리될 것으로 예상된다. 087H03T7HRM는 L 4 유전자로부터 1.5 cM에 위치하였다. De Ruiter 클래스 I은 087H03T7HRM 마커 영역으로부터 L 4 유전자 주변의 유전자 영역의 이동 또는 L4segF&R 및 087H03T7HRM 마커 사이의 재조합을 증명하는 증거일 수 있다. 놀랍게도, L4segF&R 마커에 대해 민감성인 유전자형을 나타내지만 087H03T7HRM에 대해서는 저항성인 동형접합성 유전자형을 나타내는 3개의 개체가 있었다. 모든 De Ruiter 교배 개체는 TMV에 대해 저항성이며, L4segF&R 마커는 L 4 후보 유전자를 기초로 하여 개발되었다. 상기 3가지 개체는 L 4 후보 유전자가 L 4 유전자 또는 L 4 유전자의 또 다른 기능적 상동체의 존재를 정정하지 않을 수도 있다는 것을 나타내었다.
L 4 유전자 주변의 마커를 이용한 유전자형 분석은 De Ruiter 클래스 II의 몇 가지 유전적 특징을 발견하였다. 087H03T7HRM 및 189D23M 마커의 융해 곡선 패턴은 MS 및 SP F2 집단의 것과는 상이하였다. 그러나, 상기 두 마커의 유전자형은 완벽하게 공-분리되었으며, 이는 087H03T7HRM 및 189D23M 마커가 연관되어 있다는 것을 나타낸다. De Ruiter 클래스 II는 L 4 유전자 주변의 4개 마커들 사이의 연관성에 의해 3개의 서브클래스로 분류되었다.
첫 번째 서브클래스인 De Ruiter 클래스 II-A는 14개의 프로제니 군들 중 6개로 이루어졌다. 087H03T7HRM 및 087H03T7CAPS의 유전자형은 De Ruiter 클래스 II-A에서 공-분리되지 않았다. 087H03T7CAPS 마커는 상기 서브클래스의 모든 개체에서 분리되지 않았고, 이들의 유전자형은 모두 동형접합성 저항성이었다. L4segF&R, 189D23M 및 087H03T7HRM 마커는 상기 서브클래스에서 분리되었다. 189D23M 및 087H03T7HRM 마커는 MS 및 SP와는 상이한 4개의 융해 곡선 패턴을 각각 나타내었고(데이터 미제시), 각 프로제니 군은 L4segF&R, 189D23M 및 087H03T7HRM 마커에 대해 단지 2가지 유형의 유전자형을 가진다. L4segF&R 마커는 De Ruiter 클래스 II-A의 52개 개체에서 189D23M 및 087H03T7HRM와 함께 공-분리되었으며, 이는 L4segF&R 마커가 또 다른 2개의 마커와 연관되어 있다는 것을 나타낸다.
두 번째 서브클래스인 De Ruiter 클래스 II-B는 14개의 프로제니 군 중 6개로 이루어졌다. 189D23M, 087H03T7CAPS 및 087H03T7HRM 마커는 재조합체가 없는 상기 서브클래스의 48개의 개체에서 공-분리되었을 것으로 생각된다. L4segF&R은 상기 3개의 마커와 함께 공-분리되지 않았으며, 상기 서브클래스 개체들의 유전자형은 모두 동형접합성 저항성 유전자형이었다. 본 발명자들은 189D23M 및 087H03T7HRM 마커에서 6개의 융해 곡선 패턴을 추가로 각각 발견하였다(데이터 미제시).
세 번째 서브클래스인 De Ruiter 클래스 II-C는 14개의 프로제니 군 중 3개로 이루어졌다. L4segF&R 및 087H03T7CAPS의 유전자형 패턴은 De Ruiter 클래스 I과 동일하였다. 189D23M 및 087H03T7HRM에서 4개의 새로운 융해 곡선 패턴이 추가로 각각 발견되었고(데이터 미제시), 189D23M 및 087H03T7HRM의 융해 곡선 패턴은 De Ruiter 클래스 II-C의 28개 개체에서 L4segF&R 및 087H03T7CAPS와 함께 공-분리되었을 것으로 생각된다. 이는 4개의 마커 모두가 상기 서브클래스와 밀접하게 연관되어 있다는 것을 나타낸다. 오직 1개의 프로제니 군이 De Ruiter 클래스 III에 속했다. 087H03T7HRM 및 087H03T7CAPS의 융해 곡선 패턴은 동일했지만, 189D23M의 융해 곡선 패턴은 MS 및 SP F2 집단과는 상이하였다. L4segF&R 및 189D23M 마커는 공-분리되었을 것으로 생각되고, 087H03T7HRM 및 087H03T7CAPS는 공-분리되었다. 그러나, L4segF&R 및 087H03T7HRM 마커 사이에는 2개의 재조합체가 있었다. 이는 087H03T7HRM 및 087H03T7CAPS가 또 다른 두 마커와 연관되어 있지 않다는 것을 나타낸다. 본 발명자들은 4개의 마커를 이용하여 De Ruiter 교배주를 분석하였고, L4segF&R 마커는 MS 및 SP F2 집단과 동일한 융해 곡선 패턴을 나타내었다. 그러나, 189D23M 및 087H03T7HRM 마커는 MS 및 SP F2 집단과 상이한 10개 및 12개의 새로운 융해 곡선 패턴을 각각 나타내었다. 상기 결과는 L 4 유전자 주변의 유전자 구조물이 매우 복잡하다는 것을 나타낸다.
본 발명자들은 L4segF&R 마커를 이용하여 몬산토 및 농우 교배주를 분석하였고, 93개의 개체 중 60개 및 22개의 개체 중 8개가 재조합체인 것을 각각 밝혀냈다. 상기 몬산토 및 농우 교배주 재조합체의 높은 비율은 전혀 예상하지 못한 결과였는데, 이는 L 4 유전자로부터의 L4segF&R 마커의 유전자 거리가 MS 및 SP F2 집단에서 0.5 cM 미만이기 때문이다. 상기 결과는 몬산토 또는 농우 교배주에서 L 4 유전자 주변의 유전자 구조물이 MS 및 SP F2 집단의 구조물과는 상이하다는 것을 나타낸다.
본 발명자들은 2개의 추가적인 마커인 087H03T7HRM 및 189D23M을 이용하여 L 4 유전자 주변의 유전자 영역을 분석하였다. 몬산토 주는 2가지 다른 주로부터 유래한 프로제니로 이루어졌다. 유전자형 분석은 A 및 B로 표시된 2가지 주로부터 유래한 프로제니가 상이한 마커 유전자형 패턴을 나타낸다는 것을 밝혀냈다.
몬산토 주-A 유래 프로제니의 유전자형은 3개의 마커에 대해 모두 동형접합성 저항성이거나 또는 모두 이형접합성이었다. 몬산토 주-B 유래 프로제니는 3가지 상이한 유전자형 패턴을 나타냈으며, 이는 하기와 같다; 3개 마커에 대해 모두 동형접합성인 저항성 유전자형, L4segF&R 및 189D23M 마커에 대해 동형접합성인 저항성 유전자형, 087H03T7HRM 마커에 대해 이형접합성인 유전자형, 087H03T7HRM에 대해 동형접합성인 저항성 유전자형, 그리고 L4segF&R 및 189D23M 마커에 대해 민감성인 유전자형(표 4).
표 4
Figure PCTKR2011003833-appb-T000001
TMV를 제어하는 오직 1개의 유전자가 있다는 가정하에, 본 발명자들은 몬산토 주-A 및 몬산토 주-B를 이용하여 연관성 분석을 Carthagene 1.0 프로그램으로 각각 수행하였다. L4segF&R 및 189D23M 마커는 0 cM의 유전자 거리로 1개 군에 연관되어 있는 반면, 상기 가정한 1개의 유전자는 두 몬산토 주에서 임의의 다른 마커와 연관되어 있지 않았다. 그리고, 087H03T7 마커는 몬산토 주-A에서 L4segF&R 및 189D23M 마커에 연관되어 있지만, 몬산토 주-B에서는 연관되어 있지 않았다. 연관성 분석은 TMV 저항성의 유전이 오직 1개의 유전자에 의해서 조절되지는 않는다는 것, 또는 3개의 마커가 TMV 저항성 유전자에 연관되어 있지 않다는 것을 나타낸다. 그러나, 본 발명자들은 몬산토 및 농우 교배주에 대한 L4segF&R 마커 유전자형을 결정하였고, 마커 유전자형 및 저항성 표현형이 완벽하게 일치되었다. 즉, 동형접합성 및 이형접합성인 L4segF&R 저항성 유전자형은 모두 저항성이었고, 동형접합성인 L4segF&R 민감성 유전자형은 모두 민감성이었다. 상기 결과는 분자 마커가 몬산토 교배주에서 TMV 저항성과 관련되어 있다는 것을 나타낸다.
최종적으로, 본 발명자들은 3개의 마커를 이용하여 동형접합성 저항성으로 고정된 농우 교배주를 분석하였고, 총 3개의 유전자형 패턴이 발견되었다. 첫 번째 유전자형 패턴은 3개의 마커에 대해 모두 동형접합성 저항성이었고, 두 번째 패턴은 3개의 마커에 대해 모두 이형접합성 유전자형이었다. 마지막 패턴은 087H03T7에 대해서는 민감성을, L4segF&R에 대해서는 동형접합성 저항성을, 그리고 189D23M에 대해서는 새로운 대립유전자를 나타냈다.
실시예 4: L 4 유전자 주변의 유전자 구조물
본 발명자들은 3개의 마커를 이용해 L 4 유전자좌 부근의 유전적 백그라운드를 분석하였다(표 5). L 4 후보 유전자 서열을 기초로 하여 개발된 L4segF&R 마커는 L 4 유전자가 캡시쿰(Capsicum)에서 토바모바이러스에 대한 저항성을 부여하는 유일한 유전자라고 가정한다면, 토바모바이러스 P1.2.3에 대한 저항성을 부여하는 L 4 유전자를 정확히 나타낼 것으로 예상되었다. 나머지 2개의 마커 189D23M과 087H03은 각기 1.5, 0.9cM의 유전자 거리로 L 4 유전자 부근에 위치하는 연관된 마커이다. 단일 우성의 저항성 유전자 모델에 따르면, L4segF&R 마커에 대한 동형접합성 저항성 또는 이형접합성의 유전자형은 저항성 표현형을 나타낼 것으로 예상된 반면, 동형접합성 민감성 유전자형을 가지는 식물은 민감성 표현형일 것으로 예상된다. 놀랍게도, 총 8개의 재조합체가 MS, SP F2 집단 및 유전자형 결과가 예상 표현형과 일치하지 않은 De Ruiter 교배주에서 발견되었다. De Ruiter 교배주의 3개 개체 및 L4segF&R에 의한 동형접합성 민감성 유전자형을 가지는 MS F2 집단의 1개 개체가 저항성 표현형을 나타내었는데, 이는 L 4 후보 유전자에 연관된 1개 이상의 기능적 상동체가 토바모바이러스에 대한 저항성을 부여할 수도 있다는 것을 나타낸다. 상기 가정을 기초로 하여, 2개의 모델(1번 및 2번)을 모식화하였다(도 2).
표 5 재조합체들의 유전적 배경 분석
Phenotype 087H02T7 L4segF&R 189D23M No. of individuals Population
R or H S S S 1 MS
R or H R S R 3 Deruiter
H R R R 37 Monsanto
H H R R 12 Monsanto
R H H H 19 Monsanto & Nongwoo
S H H H 4 MS & SP
R : homozygous resistance, H : heterozygous resistance, S : homozygous susceptible
L4segF&R를 이용한 유전자형 분석은 그에 해당하는 표현형과 대부분 공-분리되었기 때문에, 기능적 상동체는 L 4 후보 유전자와 밀접하게 연관되어 있을 것으로 예상된다. 상기 기능적 상동체의 효과는 L 4 후보자에 의해 감추어질 수도 있지만, L 4 후보자 및 기능적 상동체 사이에 재조합이 발생하는 시기는 밝혀졌다. 상기 결과는 저항성 표현형을 나타내는 L4segF&R에 대해 민감성 유전자형을 가지는 개체들을 설명하였다. 게다가, 예상하지 못한 재조합체가 몬산토 및 농우 교배주에서 발견되었다. L4segF&R를 이용하여 동형접합성 저항성 유전자형으로 분석된 총 49개의 개체들은 그들의 프로제니에서 예상하지 못한 이형접합성 표현형 결과를 나타낸 반면, 3개의 유전자좌 모두에서 이형접합성 유전자형을 가지는 19개의 개체는 그들의 모든 프로제니에서 동형접합성 저항성을 나타내었다. 토바모바이러스에 대해 민감성인 몬산토 교배주의 3개 개체들은 L4segF&R 마커에 대해 민감성 유전자형을 나타냈다. 상기 결과로부터 두 가지 추론사실을 이끌어냈다. 첫 번째로, L 4 후보 유전자 또는 기능적 유전자 상동체의 유전적 백그라운드는 토바모바이러스 저항성을 부여할 수도 있다. 두 번째로, 중복(duplication) 및/또는 전좌(translocation)가 L 4 후보 유전자 영역에 발생했었을 수도 있다. 모델 3번 및 4번에 나타난 바와 같이, L 4 유전자 영역은 도입되는 유전적 백그라운드에서 안정화할 수 없고, 토바모바이러스에 대한 저항성을 부여하는 영역은 전좌되어 교배 과정 동안 그의 기능을 상실할 수 있으며, 그 결과로서 이형접합성 표현형이 동형접합성 저항성 유전자형 개체의 프로제니에서 관찰되었다. 최종적으로, 모델 5번은 상이한 L 유전자좌의 중복 및 공존(co-existence)을 기초로 하여 모식화되었다. 상기의 경우, 이형접합성 유전자형은 모든 프로제니들이 동형접합성 저항성 표현형을 나타낼 때 검출되었다.
실시예 5: L 대립 형질 특이적 HRM 마커의 개발
다섯 가지 상이한 L 대립유전자 군인 L 0 , L 1 , L 2 , L 3 및 L 4 는 다섯 가지 토바모바이러스 병원형인 P0, P1, P1.2, P1.2.3 및 P1.2.3.4 와의 상호작용에 의해 결정되었다. L 3 또는 L 4 와 연관된 몇 가지 분자 마커가 개발되었지만, 모든 L 대립유전자를 구분하는 마커는 없었다. 1개의 L 3 대립유전자 및 6개의 L 후보 유전자인 L 1 , L 1a , L 1c , L 2 , L 2b 및 L 4 의 전체 서열은 보고되었다(Tomita et al., 2011 Mol Plant Microbe In 24:108-117). LRR 도메인의 뉴클레오티드 다양성은 일반적으로 NBS 도메인에 비해 더 높기 때문에, L4RP-1F&R, L4RP-2F&R 및 L4RP-3F&R로 표시된 3개의 마커 세트는 L 4 후보 유전자의 3' LRR 서열을 기초로 하여 고안되었으며, 3'end로 표시된 한 프라이머는 L 4 후보 유전자의 3' 말단 서열을 기초로 하여 고안되었다(도 3). 총 6개의 프라이머쌍 조합인 L4RP-1F/L4RP-1R, L4RP-2F/L4RP-2R, L4RP-3F/L4RP-3R, L4RP-1F/L4RP-2R, L4RP-2F/L4RP-3R 및 L4RP-3F/3'end는 각 L 대립유전자에 대해 동형접합성인 표지자 식물을 이용해 분석하였다. 본 발명자들은 상기 프라이머 세트를 이용해 PCR을 수행하였고, L4RP-3F/L4RP-3R 및 L4RP-3F/3'end 프라이머 세트를 제외하고는 모든 대립유전자에 대한 예상된 크기의 단일 밴드가 증폭되었다. L4RP-3F/L4RP-3R 프라이머 세트는 160 내지 400bp 범위에서 5개의 상이한 밴드를 증폭하였다. L4RP-3F/3'end 프라이머 세트는 동형접합성 L 0 유전자형에 대해 오직 1개의 약한 단일 밴드만을 증폭하였지만, 다른 모든 유전자형에 대해서는 분명하고 깨끗하게 증폭하였다.
PCR 후, HRM 분석은 표지자 식물을 이용하여 모든 프라이머 세트에 대해 수행되었다. 융해 곡선 패턴이 MS 및 SP 집단 유래 L 1 의 2개의 독립적인 공급원 사이에서 다형성(polymorphism)을 지속적으로 각각 나타내었으므로, 본 발명자들은 L4RP-3F/3'end를 이용하여 증폭산물(amplicon)의 서열을 분석했고, MS 유래 L 1 및 SP 유래 L 1 의 서열이 확실히 다르며, L 1a (AB523373) 및 L 1 (AB523372)와 각각 일치한다는 것을 발견하였다(데이터 미제시). 따라서, 본 발명자들은 6개의 L 대립유전자로 표지자 식물을 표시하였다. HRM 분석에 의해 시험된 모든 프라이머 조합을 이용한 6개 유전자형의 스크리닝 결과, 오직 2개의 프라이머 세트(L4RP-3F/ L4RP-3R 및 L4RP-3F/3'end)만이 6개의 모든 대립 형질을 구분할 수 있었다(도 4). L4RP-3F/3'end 프라이머 세트의 경우, L 0 에 대해 증폭이 잘 되지 않았으므로, L 0 의 융해 곡선 패턴은 상대적으로 불안정하였다. L 0 는 다른 L 대립유전자에 비해 늦은 증폭 형광 신호에 의해 검출될 수 있다. 다른 L 대립유전자의 형광 신호는 23~28 주기에서부터 증가한 반면, L 0 의 형광 신호는 37~39 주기에서부터 증가하였다. 비록 다수의 밴드가 L4RP-3F/L4RP-3R에 의해 증폭된 다양한 상동성 서열로부터 유래하였다 할지라도, 상기 마커의 HRM 융해 곡선 결과는 매우 안정적이었고, 신뢰성 있는 유전자형 결과를 나타내었다.
육종자(breeder)들은 각 대립 형질의 동형접합성 유전자형뿐만 아니라 교배주를 선별할 이형접합성 유전자형도 검출할 수 있는 분자 마커를 필요로 하였다. 적용된 교배 프로그램에서 상이한 L 대립유전자를 구분하는 본 발명의 마커의 용도를 증명하기 위해, 본 발명자들은 6개의 부계 유전자형 각각의 DNA를 혼합함으로써 가능한 모든 이형접합성 조합을 인위적으로 제조하였다. 총 10 및 15개의 인공 이형접합성 유전자형이 제조되었고, L4RP-3F/ L4RP-3R 및 L4RP-3F/3'end 프라이머 세트를 각각 이용하여 이에 해당하는 동형접합성 부계 유전자형과 함께 HRM 분석을 수행하였다. L4RP-3F/L4RP-3R 프라이머 세트는 모든 이형접합성 타입을 구분한 반면, L4RP-3F/3'end 프라이머 세트는 MS 유래의 L 1 와 혼합된 인공적인 이형접합성을 제외하고 나머지 이형접합성 타입을 구분하였다(도 5).
본 발명자들은 L4RP-3F/ L4RP-3R 및 L4RP-3F/3'end 프라이머 세트를 이용하여 시판 교배주(Enza Zaden)에 대해 맹시험(blind test)을 추가로 수행하였다. 상기 교배주는 L 0 , L 1 , L 3 및 L 4 대립유전자에 대해 동형접합성인 91개의 개체로 이루어졌다. 상기 두 마커는 상기 4개의 상이한 L 대립유전자를 성공적으로 검출하였고, L 1 의 오직 1개 개체만이 상기 프라이머 세트를 이용하여 잘못된 대립유전자에 지정되었다.

Claims (7)

  1. 서열번호 1 및 2의 올리고뉴클레오티드 프라이머 세트; 서열번호 7 및 8의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 7 및 9의 올리고뉴클레오티드 프라이머 세트로 구성되는 군으로부터 선택된 하나 이상의 올리고뉴클레오티드 프라이머 세트를 포함하는 Pepper mild mottle virus (PMMoV)에 대해 저항성을 갖는 고추 품종을 선별하기 위한 올리고뉴클레오티드 프라이머 세트.
  2. 제1항에 있어서, 서열번호 1 및 2의 올리고뉴클레오티드 프라이머 세트; 서열번호 7 및 8의 올리고뉴클레오티드 프라이머 세트; 및 서열번호 7 및 9의 올리고뉴클레오티드 프라이머 세트를 포함하는 PMMoV에 대해 저항성을 갖는 고추 품종을 선별하기 위한 올리고뉴클레오티드 프라이머 세트.
  3. 제1항 또는 제2항의 올리고뉴클레오티드 프라이머 세트 및 증폭 반응을 수행하기 위한 시약을 포함하는, PMMoV에 대해 저항성을 갖는 고추 품종을 선별하기 위한 키트.
  4. 제3항에 있어서, 상기 증폭 반응을 수행하기 위한 시약은 DNA 폴리머라제, dNTPs, 및 버퍼를 포함하는 것인 키트.
  5. 고추 시료에서 게놈 DNA를 분리하는 단계;
    상기 분리된 게놈 DNA를 주형으로 하고, 제1항 또는 제2항의 올리고뉴클레오티드 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및
    상기 증폭 산물을 검출하는 단계를 포함하는, PMMoV에 대해 저항성을 갖는 고추 품종을 선별하기 위한 방법.
  6. 제5항에 있어서, 상기 증폭된 표적 서열은 형광, 인광 또는 방사성을 발하는 물질로 표지되어 있는 것인 방법.
  7. 제5항에 있어서, 상기 증폭 산물의 검출은 DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행되는 것인 방법.
PCT/KR2011/003833 2010-05-25 2011-05-25 ＰＭＭｏＶ 저항성 고추 품종을 선별하기 위한 프라이머 세트, 방법 및 키트 WO2011149267A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20100048368 2010-05-25
KR10-2010-0048368 2010-05-25

Publications (3)

Publication Number Publication Date
WO2011149267A2 true WO2011149267A2 (ko) 2011-12-01
WO2011149267A3 WO2011149267A3 (ko) 2012-04-26
WO2011149267A9 WO2011149267A9 (ko) 2012-06-14

Family

ID=45004563

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/003833 WO2011149267A2 (ko) 2010-05-25 2011-05-25 ＰＭＭｏＶ 저항성 고추 품종을 선별하기 위한 프라이머 세트, 방법 및 키트

Country Status (2)

Country Link
KR (1) KR101242426B1 (ko)
WO (1) WO2011149267A2 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102000469B1 (ko) 2018-06-19 2019-07-16 대한민국 고추 ＴＳＷＶ 병 저항성 유전자 Ｔｓｗ 특이적 프라이머 세트 및 이의 용도

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2006246838A (ja) * 2005-03-14 2006-09-21 Iwate Prefecture トバモウイルスに対するｌ抵抗性遺伝子型の識別方法
US20070234441A1 (en) * 2004-10-01 2007-10-04 De Ruiter Seeds R&D B.V. Pmmov resistant capsicum plants

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070234441A1 (en) * 2004-10-01 2007-10-04 De Ruiter Seeds R&D B.V. Pmmov resistant capsicum plants
JP2006246838A (ja) * 2005-03-14 2006-09-21 Iwate Prefecture トバモウイルスに対するｌ抵抗性遺伝子型の識別方法

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
SAKANOTO, M. ET AL.: 'A primer-introduced restriction analysis-PCR-based method to analyse Pepper mild mottle virus populations in plants and field soil with respect to virus mutations that break L3 gene-mediated resistance of Capsicum plaints' PLANT PATHOLOGY vol. 57, 21 March 2008, pages 825 - 833 *
TSUDA, S. ET AL.: 'Characterization of a Pepper Mild Mottle Tobamovirus Strain Capable of Overcoming the L3 Gene-Mediated Resistrance, Distinct from the Resistance-Breaking Italian Isolate' MOLECULAR PLANT-MICROBE INTERACTIONS vol. 4, April 1999, pages 327 - 331 *
YANG, H. B. ET AL.: 'Development of SNP markers linked to the L locus in Capsium spp. by a comparative genetic analysis' MOL. BREEDING vol. 24, 21 July 2009, pages 433 - 446 *

Also Published As

Publication number Publication date
WO2011149267A9 (ko) 2012-06-14
KR101242426B1 (ko) 2013-03-12
KR20110129358A (ko) 2011-12-01
WO2011149267A3 (ko) 2012-04-26

Similar Documents

Publication Publication Date Title
Leal-Bertioli et al. Identification of candidate genome regions controlling disease resistance in Arachis
Wu et al. SNP-based pool genotyping and haplotype analysis accelerate fine-mapping of the wheat genomic region containing stripe rust resistance gene Yr26
Wanchana et al. A rapid construction of a physical contig across a 4.5 cM region for rice grain aroma facilitates marker enrichment for positional cloning
Amano et al. High-resolution mapping of zym, a recessive gene for Zucchini yellow mosaic virus resistance in cucumber
Galli et al. High-resolution genetic map of the Rvi15 (Vr2) apple scab resistance locus
CN105695478B (zh) 调节植物株型和产量的基因及其应用
WO2018101781A1 (ko) 알로에 베라, 알로에 사포나리아 및 알로에 생장의 엽록체 게놈 및 핵 리보솜 dna 서열의 완전 해독 기반 종 식별 마커와 프라이머 세트 및 이의 용도
Ando et al. Introgression of a novel ug99-effective stem rust resistance gene into wheat and development of Dasypyrum villosum chromosome-specific markers via genotyping-by-sequencing (GBS)
CN108456740A (zh) 一个水稻稻瘟病抗性位点‘Pi-jx’及其Indel标记引物和育种应用
Ozias-Akins et al. Genomics resources for peanut improvement
CN108456743A (zh) 与大豆开花期和成熟期相关的snp标记及其检测引物、方法与应用
KR101410329B1 (ko) Ｔｓｗｖ 저항성 고추 품종을 선별하기 위한 프라이머 세트, 방법 및 키트
WO2011149267A2 (ko) ＰＭＭｏＶ 저항성 고추 품종을 선별하기 위한 프라이머 세트, 방법 및 키트
KR101432281B1 (ko) 캡시컴 안늄의 종내집단을 이용한 ｓｓｒ 마커 및 유전자 연관지도
CN111485031A (zh) 水稻分子标记dof8及其应用、一种利用水稻分子标记dof8鉴别粳稻和籼稻的方法
KR101432283B1 (ko) 캡시컴 안늄의 종내집단을 이용한 ｓｓｒ 마커 및 유전자 연관지도
KR101432284B1 (ko) 캡시컴 안늄의 종내집단을 이용한 ｓｓｒ 마커 및 유전자 연관지도
KR101432287B1 (ko) 캡시컴 안늄의 종내집단을 이용한 ｓｓｒ 마커 및 유전자 연관지도
KR20130138000A (ko) ＰｅｐＭｏＶ 저항성 고추 품종을 선별하기 위한 프라이머 세트, 방법 및 키트
KR102438610B1 (ko) 시들음병 저항성 또는 감수성 무 품종을 판별하기 위한 프라이머 세트 조성물 및 이의 용도
Han et al. Pre-breeding of spontaneous Robertsonian translocations for density planting architecture by transferring Agropyron cristatum chromosome 1P into wheat
Ozias-Akins and Steven B. Cannon
Xu et al. Mapping and characterization of rust resistance genes Lr53 and Yr35 introgressed from Aegilops species
Yaoyao et al. Simultaneously mapping loci related to two plant architecture traits by Phenotypic Recombination BSA/BSR in peanut (Arachis hypogaea L.)
Xu et al. Fine mapping and characterization of rust resistance genes Lr53 and Yr35 introgressed from Aegilops species

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11786899

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11786899

Country of ref document: EP

Kind code of ref document: A2