WO2011146825A2 - Avian influenza h5n1 specific aptamers and their use - Google Patents
Avian influenza h5n1 specific aptamers and their use Download PDFInfo
- Publication number
- WO2011146825A2 WO2011146825A2 PCT/US2011/037323 US2011037323W WO2011146825A2 WO 2011146825 A2 WO2011146825 A2 WO 2011146825A2 US 2011037323 W US2011037323 W US 2011037323W WO 2011146825 A2 WO2011146825 A2 WO 2011146825A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- aptamer
- aptamers
- sample
- binding
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3517—Marker; Tag
Definitions
- Aptamers are artificial nucleic acid ligands, specifically generated against certain targets, such as amino acids, drugs, proteins or other organic or inorganic molecules. They can be generated by an in vitro selection process called SELEX (systematic evolution of ligands by exponential enrichment) which was first reported in 1990 (Robertson and Joyce, 1990. Selection in vitro of an RNA enzyme that specifically cleaves single-stranded DNA. Nature 344 (6265): 467; Tuerk and Gold, 1990. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249 (4968): 505-10; Ellington and Szostak, 1990.
- SELEX systematic evolution of ligands by exponential enrichment
- RNA molecules that bind specific ligands In vitro selection of RNA molecules that bind specific ligands. Nature 346 (6287): 818-22.). The selection procedure involves the iterative isolation of ligands out of the random sequence pool with affinity for a defined target molecule and PCR-based amplification of the selected RNA or DNA oligonucleotides after each round of selection.
- aptamers show a very high affinity for their targets, with dissociation constants typically from the micromolar to low picomolar range, comparable to those of some monoclonal antibodies, sometimes even better.
- aptamers may be used in assays that have traditionally used monoclonal antibodies including inhibition assays, diagnostic assays and binding assays.
- aptamers capable of binding avian influenza H5N1 and methods of using such aptamers for detection, diagnosis or treatment of H5N1 infection are provided herein.
- aptamers capable of binding to Avian Influenza Virus strain H5N1 are provided. These aptamers have higher affinity for H5N1 than for H5N2, H5N3, H5N9, H7N2, H2N2, or H9N2.
- the aptamers may have 10, 50, 100 fold or greater affinity for H5N1 as compared to these other influenza viruses.
- the aptamers include SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 or fragments thereof.
- compositions comprising the aptamers provided herein or a salt thereof are provided.
- a biosensor comprising any of the aptamers disclosed herein is provided.
- methods of determining whether a sample contains influenza virus H5N1 include contacting the sample with any of the aptamers disclosed herein and determining whether the aptamer bound to the sample. Aptamer binding to the sample is indicative of the presence of influenza virus H5N1 in the sample.
- Figure 1 is a depiction of a two dimensional structure of aptamer 1.
- Figure 2 is a depiction of a two dimensional structure of aptamer 2.
- Figure 3 is a depiction of a two dimensional structure of aptamer 3.
- Figure 4 is a flow diagram showing the procedure used to select the aptamers.
- Figure 5 is a photograph of a dot blot analysis of binding of selected aptamers after the 4 th , 8 th and 10 th round of selection to target avian influenza virus (ATV) H5N1 and to non-target AIV H5N2 and H7N2.
- ATV avian influenza virus
- Figure 6 is a photograph of a dot-ELISA analysis of binding of the three selected aptamers and a fourth previously disclosed aptamer to target ATV H5N1 and non-target AIVs including H5N2, H5N3, H5N9, H7N2, and H9N2.
- Figure 7 is a graph showing the overlay of the surface plasmon resonance (SP ) signals from the interaction between the hemaglutinin protein from H5N1 and aptamer 2.
- SP surface plasmon resonance
- Figure 8 is a graph showing the ability to quantitatively detect H5N1 using aptamer 2 using SPR.
- a strategy developed for genetic selection in vitro has allowed the isolation of nucleic acids that can bind target molecules with high affinity and specificity.
- the strategy involves isolation of rare nucleic acid molecules that have high affinity for a target molecule from a pool of random nucleic acids, with subsequent repeated rounds of selection and amplification. This procedure is called SELEX (systematic evolution of ligands and exponential enrichment) and is described in U.S. Patent Nos. 5,475,096 and 5,270,163, which are incorporated herein by reference in their entireties.
- oligonucleotide ligands aptamers
- aptamers over traditional antibodies for in vitro assays such as in diagnostic or biosensor based assays include: 1) the ability to be denatured/renatured multiple times (reusable), 2) stability in long term storage and the ability to be transported at ambient temperature, 3) the ability to adjust selection conditions to obtain aptamers with properties desirable for in vitro assay, 4) generation by chemical synthesis, resulting in little batch to batch variation, 5) selection through an in vitro process eliminating the use of animals, and 6) the ability to attach reporter molecules at precise locations (see O'Sullivan, C. ., "Aptasensors ⁇ the future of biosensing?” Anal. Bioanal. Chem. 372, 44-48 (2002)).
- aptamers with high affinity and specificity for AIV H5N1 were developed.
- the three aptamers are listed as SEQ ID NOs: 1-3 and their predicted two dimensional structures are shown in Figures 1-3.
- Each of the aptamers forms a stem-loop secondary structure.
- the aptamers were selected based on their ability to bind to killed H5N1 or hemaglutinin.
- the data in the Examples demonstrate that the aptamers can be labeled with biotin and binding to H5N1 can be detected using traditional dot blot analysis.
- aptamers can thus be incorporated into diagnostic assays or biosensors that traditionally use antibodies, receptor-ligand interactions or other affinity interactions to detect the presence or absence of targets, such as AIV, in samples.
- samples may include, but are not limited to food, water, environmental, or clinical samples.
- the aptamers described herein are capable of binding to AIV H5N1 with high affinity and specificity.
- the aptamers are capable of binding isolated hemaghitinin from H5N1 virus, as discussed more fully below the binding affinity of the aptamers is more complex than simply binding the hemaglutinin.
- the aptamers show higher affinity for H5N1 as compared to other H5 containing viruses.
- the aptamer likely recognizes or has a higher affinity for the hemaglutinin neuraminidase complex found in H5N1.
- the binding affinity for aptamer 2 was further characterized using surface plasmon resonance.
- aptamer 2 demonstrated strong binding with purified HA protein as well as inactivated H5N1 virus.
- Aptamer 1 and 3 are expected to have similar binding characteristics based on the similar results obtained in the dot-blot and dot-ELISA experiments. These binding characteristics are similar to those of antibody-antigen interactions for antibodies used in immunoassays or in biosensors. Those of skill in the art will appreciate that these aptamers may be used in assays similar to those in which antibodies are routinely used.
- the aptamers have higher affinity for H5N1 as compared to their affinity for other AIV subtypes including H5N2, H5N3, H5N9, H7N2, H2N2, and H9N2 as shown in the dot blot assays.
- the aptamers suitably have an affinity for H5N1 that is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 40, 50, 40, 80, 100, 150, 200, 250, 300, 400, 500 or 1,000 fold higher than that of at least one other influenza sub-type.
- aptamer 2 bound H5N1 with an RU of 136 and H5N2 with an RU of 33.
- the aptamer has such higher affinity for H5N1 than for any other influenza subtype or at least for the subtypes tested herein.
- the increased affinity for H5N1 as opposed to other subtypes allows for the detection of H5N1 in a background or sample that may contain or be contaminated with other AIV subtypes.
- the aptamers described herein are 73 or 74 nucleotides long, but fragments of these aptamers may also be useful and capable of binding H5N1.
- a fragment of the aptamers described herein may comprise at least 15 nucleotides, 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, or 70 nucleotides long.
- aptamers comprising a primary nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the primary nucleotide sequence shown in at least one of SEQ ID NOS: 1 -3 and retains the ability to bind H5N1 with higher affinity than at least one of H5N2, H5N3, H5N9, H7N2, H2N2, and H9N2 are also provided.
- the aptamers are comprised of nucleotides, modified nucleotides, or a combination thereof.
- the aptamers are DNA in the examples, but they can also be RNA, DNA/RNA hybrids or synthetic nucleotide analogs.
- Nucleic acid sequences may incorporate modified nucleotides to, e.g., stabilize the aptamers against degradation in vivo or in vitro. For example, resistance to nuclease degradation can be greatly increased by the incorporation of modifying groups at the 2'- position.
- the nucleotides may comprise 2'-OH, 2'-F, 2 -deoxy, 2'-NH 2 , 2'-OMe, or 2 -methoxyethyl modifications.
- Those of skill in the art will appreciate that several methods may be used to generate aptamers comprising modified nucleotides.
- the aptamers may comprise at least one chemical modification.
- the aptamers may comprise at least one chemical modification.
- modification is selected from the group consisting of: a chemical substitution at a sugar position, a chemical substitution at an internucleotide linkage and a chemical substitution at a base position.
- the modification is selected from the group consisting of: incorporation of a modified nucleotide; a 3' cap; a 5' cap; conjugation to a high molecular weight, non- immunogenic compound; conjugation to a lipophilic compound; incorporation of a CpG motif; and incorporation of a phosphorothioate or phosphorodithioate into the phosphate backbone.
- the high molecular weight, non-immunogenic compound is preferably polyethylene glycol.
- the polyethylene glycol is methoxypolyethylene glycol (mPEG).
- the 3' cap is suitably an inverted deoxythymidine cap.
- the aptamers are connected to one or more PEG moieties, with or without one or more linkers.
- the PEG moieties may be any type of PEG moiety.
- the PEG moiety may be linear, branched, multiple branched, star shaped, comb shaped or a dendrimer.
- the PEG moiety may have any molecular weight.
- the PEG moiety has a molecular weight ranging from 5-100 kDa in size.
- the PEG moiety has a molecular weight ranging from 10-80 kDa in size.
- the PEG moiety has a molecular weight ranging from 20-60 kDa in size.
- the PEG moiety has a molecular weight ranging from 30-50 kDa in size.
- the PEG moiety has a molecular weight of 40 kDa in size.
- the same or different PEG moieties may be connected to an aptamer.
- the same or different linkers or no linkers may be used to connect the same or different PEG moieties to an aptamer.
- the aptamers may be connected to one or more PEG alternatives (rather than to one or more PEG moieties), with or without one or more linkers.
- PEG alternatives include, but are not limited to, polyoxazoline (POZ), PolyPEG, hydroxyethylstarch (HES) and albumin.
- POZ polyoxazoline
- HES hydroxyethylstarch
- the PEG alternative may be any type of PEG alternative, but it should function the same as or similar to a PEG moiety, i.e., to reduce renal filtration and increase the half-life of the aptamer.
- the same or different PEG alternatives may be connected to an aptamer.
- the same or different linkers or no linkers may be used to connect the same or different PEG alternatives to the aptamer.
- a combination of PEG moieties and PEG alternatives may be connected to the aptamer, with or without one or more of the same or different linkers.
- the aptamers may be connected to a PEG moiety, a PEG alternative or a label as described below via one or more linkers or spacers. However, the aptamers may be connected to a PEG moiety, PEG alternative or a label directly, without the use of a linker.
- the linker may be any type of molecule. Examples of linkers include, but are not limited to, amines, thiols and azides.
- the linkers can include a phosphate group.
- the linker is from a 5'-amine linker phosphoramidite. In some embodiments, the 5'-amine linker phosphoramidite comprises 2-18 consecutive C ⁇ groups.
- the 5'-amine linker phosphoramidite comprises 2-12 consecutive C ⁇ groups. In still other embodiments, the 5 -amine linker phosphoramidite comprises 4-8 consecutive CH 2 groups.
- One or more of the same or different linkers or no linkers may be used to connect one or more of the same or different PEG moieties, one or more of the same or different PEG alternatives or one or more label to the aptamer. Nucleotides in the aptamers may be modified with a label. The label is suitably detectable and may be radioactive, colorimetric, fluorescent, luminescent or chemiluminescent.
- the label may be part of a nucleotide forming a modified nucleotide within the aptamer or may be attached to the aptamer or to one of the nucleotides in the aptamer.
- a label could be incorporated in or attached to a nucleotide or to the apatmer using a variety of methods. Suitable labels can include, but are not limited to, the addition of biotin, avidin, thio, iodo, bromo, phosphor, fluoro, carboxyl, acrydite, cholesteryl-TEG,
- the nucleotides in the aptamer may also be modified to contain a radioactive label by incorporation of a radioactive molecule such as 32 P, 35 S, 3 H.
- the modifications described herein may affect aptamer stability, e.g., incorporation of a capping moiety may stabilize the aptamer against endonuclease degradation. Additionally, the modifications described herein may affect the binding affinity of an aptamer to its target, e.g., site specific incorporation of a modified nucleotide, conjugation to a PEG or incorporation of a label may affect binding affinity.
- binding affinity can be determined using a variety of art-recognized techniques, such as, e.g., functional assays, such as an ELISA, or binding assays in which labeled trace aptamer is incubated with varying target concentrations and complexes are captured on nitrocellulose and quantitated, to compare the binding affinities pre- and post-incorporation of a modification.
- functional assays such as an ELISA
- binding assays in which labeled trace aptamer is incubated with varying target concentrations and complexes are captured on nitrocellulose and quantitated
- the invention also includes compositions comprising at least one of the aptamers that binds to H5N1 described herein.
- the compositions include the aptamer or a salt thereof, alone or in combination, with one or more carriers, stabilizers or diluents.
- the aptamers may, optionally, be tethered or otherwise coupled together.
- the compositions may also include a non- aptamer agent.
- salt refers to salt forms of the active compound that are prepared with counter ions that may be non-toxic under the conditions of use and compatible with a stable formulation.
- salts of aptamers include hydrochlorides, sulfates, phosphates, acetates, fumarates, maleates and tartrates.
- aptamers may be useful as biological recognition elements in biosensor platforms and/or in vitro diagnostic assays. If the aptamers are to be used in biosensor applications, 5', 3', or internal modifications to the nucleotides can be used to bind the oligonucleotides to an electrochemical, optical, piezoelectric, magnetic, or calorimetric biosensor platform. Biosensors using affinity moieties, such as antibodies, capable of binding to an agent to be detected are well known to those skilled in the art. These biosensors may be adapted for use of the aptamers disclosed herein by substituting the aptamer for the affinity moiety, i.e. antibody or ligand traditionally used in the biosensor by those of skill in the art.
- affinity moieties such as antibodies
- the aptamers may also be modified to increase the stability of the aptamer. For example, 5', 3' or internal modifications may be made to the aptamer to protect the aptamer from degradation by nucleases or to increase the binding affinity for H5N1 as described above.
- the aptamers may be directly or indirectly bound to a solid support.
- the solid support may be comprised within a biosensor.
- the solid support may be a bead, such as a magnetic bead, a column, a microtiter plate, a chip, such as a microarray chip or glass chip, nanoparticles, such as gold or silver nanoparticles, or glassy electrode surfaces, such as carbon or gold/silver glassy electrode surfaces.
- Means of attaching or binding oligonucleotides, such as the aptamers disclosed herein, to a solid support are well known to those skilled in the art.
- the aptamers may be attached to the solid phase support via a linker.
- the disclosed aptamers may also employ a linker when coupled to a solid support.
- the linker may comprise one or more atoms that separate the solid support from the aptamer.
- the linker may be a standard 6-atom or a 15-atom linker such as TEG (tetraethylene glycol).
- linkers having any number of atoms separating the solid support from the oligomers can be employed, such as 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, 20-, 21-, 22-, 23-, 24-, or 25-atom linkers.
- the linker may be an
- oligonucleotide linker may comprise 1, 2, 3, 4, 5, 7, 10, 20, 30, 40, 50, 75 or 100 nucleotides added to the aptamer sequence.
- the linker may mediate the attachment of the aptamer to the solid support.
- the linker may also allow for a more efficient interaction between the aptamer and the target H5N1.
- Other suitable likers are disclosed above.
- Methods of detecting avian influenza virus subtype H5N1 are also provided.
- the methods comprise contacting a sample with the aptamers described above and determining whether the aptamer is capable of binding to the sample.
- Aptamer binding to the sample is indicative of the presence of H5N1 virus in the sample.
- Lack of aptamer binding to the sample is indicative of lack of H5N1 virus in the sample.
- the method may further include detecting the level of binding of the aptamer to AIV H5N1 in the sample.
- the level of binding of the aptamer to the sample is indicative of the amount of H5N1 virus present in the sample.
- the methods may be quantitative and allow for detection not only of the presence or absence of H5N1 in the sample, but also allow for determination of the amount or number of H5N1 virus particles in the sample.
- Samples for use in the methods include food, water, environmental or clinical samples.
- Clinical samples include any sample taken from an organism or subject, including, but not limited to a blood, urine, saliva, tissue, or cellular sample.
- the subject may be a human, chicken, turkey (poultry), pig, cow, or other domestic animal.
- the method may be used to determine if an individual subject is infected with H5N1 virus.
- DNA oligonucleotides that were screened using SELEX had the formula (5'- CCGGAATTCCTAATACGACTC (SEQ ID NO: 4)-N 74 - TATTGAAAACGCGGCCGCGG (SEQ ID NO: 5)-3') with N 74 representing the randomized oligonucleotides being screened. Unless otherwise mentioned all oligonucleotides were synthesized by IDT (Integrated DNA Technologies).
- the DNA library was first passed through a nitrocellulose filter (mixed cellulose ester, hydrophilic membrane from Millipore) three times prior to the election cycle to eliminate DNAs that bind nitrocellulose non-specifically.
- the resulting DNA candidate aptamer pool was mixed with the target and incubated for one hour at room temperature with shaking.
- Full-length recombinant Influenza Hemagglutinin (HA) (Protein Science Corporation, Meriden, CT) was used as the target in the first four rounds of SELEX selection.
- killed H5N1 virus (Scotland 59 H5N1 from USDA- APHIS National Veterinary Services Laboratories with a titer of 128 HA units) was used as the target.
- the mixture of the DNA library and the target was passed through a filter capable of capturing complexes of the aptamer bound to the protein/viral target while allowing free aptamer to pass through- Only the nucleic acids that revealed affinity and specificity towards the AIV HA or the entire killed AIV H5N1 depending on the selection cycle were captured on the filter, while most of the DNA library was washed away through the filter.
- the filters were washed with binding buffer (50 mM Tris-HCl, pH 7.5, 25 mM NaCl, 5 mM MgCl 2 , 10 mM dithiothreitol (DTT)).
- the DNA-aptamer candidates were eluted from the filter with elution buffer (0.4 M sodium acetate, 5 mM EDTA, and 7 M urea, pH 5.5), and amplified by PCR amplification.
- the forward primer used was called DL-F (5 '-CCGGAATTCCTAATACGACTC-3 ' (SEQ ID NO: 6)) and reverse primer used was called DL-R (5'- CCGCGGCCGCGTTTTC A ATA-3 ' (SEQ ID NO: 7)).
- the primers were used to amplify double strand aptamer candidates, and convert to single stranded DNA (ss-DNA) by asymmetric PCR.
- the resulting ssDNA was then used for the next selection cycle.
- the PCR products were also monitored after each round of selection by running a small portion of the PCR product on a 6% TBE gel.
- the molar ratio of HA/AIV to DNA was increased from 1 :20 to 1 :500 (Table 1).
- a 350- ⁇ 1 aliquot of the PCR product was allowed to bind to the next 50- ⁇ 1 HA/AIV and, the elution amplification process was repeated 14 times to select for high affinity aptamers.
- biotin modified DNA aptamers were obtained for testing after the 4 th , 8 th or 10 th rounds of SELEX selection.
- the biotin labeled DNA product from the 4 th , 8 th and 10 th SELEX cycle was then used in a conventional Dot Blot analysis, as shown in Fig. 5, to test the affinity of binding between the DNA aptamers and target ATV H5N1.
- the dot blots were prepared by allowing 5 1 of the indicated virus (with titer of 128 HA units) to air dry on a nitrocellulose membrane.
- the membranes were then blocked for 15-30 minutes with blocking buffer (2.5% w/v casein, 0.15 M NaCl, 0.01 M Tris, 0.02% Thimerosal; pH 7.6).
- the biotin labeled DNA product from the indicated SELEX cycle was added at a 1 : 1 ratio in blocking buffer to the membrane and incubated for 45 minutes.
- the membranes were washed three times for five minutes each with blocking buffer to remove unbound aptamer.
- the membrane was then incubated for 90 minutes with peroxidase-labeled streptavidin (diluted 1 :2,500 with blocking buffer), then washed again three times for five minutes each with blocking buffer.
- the membrane was treated with substrate (Pierce Supersignal West Dura Extended Duration) for 5 minutes and chemiluminescence dots were detected using a charge-coupled device (CCD) camera (LAS 1000 plus) (Fuji Photo Co., Ltd., Tokyo, Japan 106-8620).
- substrate Pierce Supersignal West Dura Extended Duration
- chemiluminescence dots were detected using a charge-coupled device (CCD) camera (LAS 1000 plus) (Fuji Photo Co., Ltd., Tokyo, Japan 106-8620).
- CCD charge-coupled device
- PCR amplicons obtained from the last two cycles were cloned into the pGEM- T easy vector (Promega Corp., Madison, WI) and transformed into JM109 competent cells using standard protocols.
- the detailed ligation procedure was comprised as follows. Each litigation reaction contained 5 ⁇ of 2x Rapid Litigation Buffer for T4 DNA Ligase, 1 ⁇ of pGEM-T Easy Vector (50ng), 1 ⁇ of T4 DNA Ligase (3 Weiss units/ ⁇ ). Two litigation reactions used 5 ⁇ of the product from the 13 th and 14 th selection cycle. A no insert control and a positive control insert were added to two parallel litigation reactions.
- a number of transformant colonies (10-20) obtained using the PCR amplicons were randomly chosen from each enriched pool after the 13 and 14 cycle and used for plasmid purification.
- Single-stranded individual labeled aptamers were obtained from each plasmid template using PCR with biotin labeled primers.
- the resulting biotin modified aptamers were further characterized by Dot-blot to determine the affinity and specificity of the aptamers for the target AIV H5N1. Then, based on the test results, the best candidates were chosen for DNA sequencing. Three different sequences (monoclonal aptamers) were obtained.
- Dot-ELISA results using the selected aptamer 1, aptamer 2 and aptamer 3 are shown in Fig. 6.
- a previously published ATV aptamer sequence selected for its ability to bind H5N1 hemaglutinin was used as a control (Cheng et al., 2008 Biochem Biophys Research Communication 366:670-674).
- Non-target AIV subtypes H5N2, H5N3, H5N9, H7N2 and H9N2 obtained from ADL, Pennsylvania State University
- the Dot ELISA test strips were prepared by allowing 1 of each test virus to air dry on nitrocellulose membranes.
- the membranes were blocked with blocking buffer as described above for 15-30 minutes prior to addition of a 1:3 dilution of the biotin-labeled single stranded aptamer in blocking buffer for 45 minutes.
- the membranes were washed three times for five minutes with blocking buffer prior to adding 200 ⁇ 1 of streptavidin- alkaline phosphatase at a 1 :500 dilution for 25 minutes. After the strips dried the signal was developed by adding BCIP/NBT substrate to the strips for about 5 minutes prior to air drying and analysis.
- the surface plamon resonance (SPR) instrument SensiQ (ICx Nomadics, Oklahoma City, Ok) and neutravidin modified sensor chips (BioCap) were used to test the affinity and specificity of aptamer 2 (SEQ ID NO: 2). All experiments were conducted at 25 °C with a flow rate of 10 ⁇ /min.
- the running buffer used for the experiments was PBS (lOmM, pH 7.4).
- 10 mM NaOH (40 ⁇ ) were used for regeneration to remove the bound target protein HA (Hemagglutinin) or AIV H5N1.
- the full-length glycosylated recombinant HA protein of the subtype H5N1 with concentration of 524 ⁇ g mL was purchased from Protein Science Corporation (Meriden, CT).
- the protein was produced in insect cells using the baculovirus expression vector system and purified to >90% purity under conditions that preseve its biological activity and tertiary structure.
- Inactivated ATV H5N1 sample (Scotland 59 H5N1) was obtained from USDA-APHIS National Veterinary Services Laboratories (NVSL, Ames, I A).
- Immobilization of the selected aptamer (aptamer number 2) on SPR chip surface was carried out by using the biotin-neutravidin method.
- the SPR chip was pre-coated with neutravidin, and then biotin-labeled aptamer with concentration of 1 mM was injected for 10 min (10 ⁇ /min, 25 °C) and then followed by 5 min biotin (10 ⁇ ) blocking. After washing with running buffer, the chip was ready for binding measurements. Aptamer was immobilized on Channel 1 whereas Channel 2 without aptamer immobilization was used as a reference channel. The immobilization of aptamer resulted in increase of SPR signal by 997 RU.
- HA proteins with different concentrations (2, 5, 10, 20 and 40 ⁇ g/mL) were injected onto the sensor chip and the affinity binding was monitored for 2 min followed by washing with running buffer.
- RU resonance units
- An overlay of the sensor SPR signals from the interactions between HA and the selected aptamer is shown in Figure 7.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Provided herein are aptamers with higher affinity and specificity for avian influenza vims H5N I as compared to other influenza subtypes. Also provided are compositions comprising the aptamers and methods of using the aptamers. In particular, methods of detecting avian influenza virus H5N1 in a sample or in a subject are provided.
Description
AVIAN INFLUENZA H5N1 SPECIFIC APTAMERS AND THEIR USE
CROSS-REFERENCE TO RELATED APPLICATIONS
This patent application claims the benefit of priority of United States Provisional Patent Application No. 61/346,561, filed May 20, 2010, which is incorporated herein by reference in its entirety.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
This invention was made with United States government support awarded by the National Science Foundation grant number 0932661. The United States may have certain rights in this invention.
SEQUENCE LISTING A Sequence Listing accompanies this application and is incorporated herein by reference in its entirety. The Sequence Listing was filed with the application as a text file on May 20, 2011.
INTRODUCTION
Aptamers are artificial nucleic acid ligands, specifically generated against certain targets, such as amino acids, drugs, proteins or other organic or inorganic molecules. They can be generated by an in vitro selection process called SELEX (systematic evolution of ligands by exponential enrichment) which was first reported in 1990 (Robertson and Joyce, 1990. Selection in vitro of an RNA enzyme that specifically cleaves single-stranded DNA. Nature 344 (6265): 467; Tuerk and Gold, 1990. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249 (4968): 505-10; Ellington and Szostak, 1990. In vitro selection of RNA molecules that bind specific ligands. Nature 346 (6287): 818-22.). The selection procedure involves the iterative isolation of ligands out of the random sequence pool with affinity for a defined target molecule and PCR-based amplification of the selected RNA or DNA oligonucleotides after each round of selection.
Aptamers show a very high affinity for their targets, with dissociation constants typically from the micromolar to low picomolar range, comparable to those of some monoclonal
antibodies, sometimes even better. Thus aptamers may be used in assays that have traditionally used monoclonal antibodies including inhibition assays, diagnostic assays and binding assays.
SUMMARY
Aptamers capable of binding avian influenza H5N1 and methods of using such aptamers for detection, diagnosis or treatment of H5N1 infection are provided herein. In one aspect, aptamers capable of binding to Avian Influenza Virus strain H5N1 are provided. These aptamers have higher affinity for H5N1 than for H5N2, H5N3, H5N9, H7N2, H2N2, or H9N2. The aptamers may have 10, 50, 100 fold or greater affinity for H5N1 as compared to these other influenza viruses. The aptamers include SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3 or fragments thereof.
In another aspect, compositions comprising the aptamers provided herein or a salt thereof are provided.
In yet another aspect, a biosensor comprising any of the aptamers disclosed herein is provided.
In a further aspect, methods of determining whether a sample contains influenza virus H5N1 are provided. The methods include contacting the sample with any of the aptamers disclosed herein and determining whether the aptamer bound to the sample. Aptamer binding to the sample is indicative of the presence of influenza virus H5N1 in the sample.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a depiction of a two dimensional structure of aptamer 1.
Figure 2 is a depiction of a two dimensional structure of aptamer 2.
Figure 3 is a depiction of a two dimensional structure of aptamer 3.
Figure 4 is a flow diagram showing the procedure used to select the aptamers.
Figure 5 is a photograph of a dot blot analysis of binding of selected aptamers after the 4th, 8th and 10th round of selection to target avian influenza virus (ATV) H5N1 and to non-target AIV H5N2 and H7N2.
Figure 6 is a photograph of a dot-ELISA analysis of binding of the three selected aptamers and a fourth previously disclosed aptamer to target ATV H5N1 and non-target AIVs including H5N2, H5N3, H5N9, H7N2, and H9N2.
Figure 7 is a graph showing the overlay of the surface plasmon resonance (SP ) signals from the interaction between the hemaglutinin protein from H5N1 and aptamer 2.
Figure 8 is a graph showing the ability to quantitatively detect H5N1 using aptamer 2 using SPR.
DETAILED DESCRIPTION
A strategy developed for genetic selection in vitro has allowed the isolation of nucleic acids that can bind target molecules with high affinity and specificity. The strategy involves isolation of rare nucleic acid molecules that have high affinity for a target molecule from a pool of random nucleic acids, with subsequent repeated rounds of selection and amplification. This procedure is called SELEX (systematic evolution of ligands and exponential enrichment) and is described in U.S. Patent Nos. 5,475,096 and 5,270,163, which are incorporated herein by reference in their entireties. It has proved to be extremely useful for the isolation of tight- binding oligonucleotide ligands (aptamers) for a number of target molecules, such as nucleic acid-binding proteins, non-nucleic acid-binding proteins, and certain small molecules.
The advantages of using aptamers over traditional antibodies for in vitro assays such as in diagnostic or biosensor based assays include: 1) the ability to be denatured/renatured multiple times (reusable), 2) stability in long term storage and the ability to be transported at ambient temperature, 3) the ability to adjust selection conditions to obtain aptamers with properties desirable for in vitro assay, 4) generation by chemical synthesis, resulting in little batch to batch variation, 5) selection through an in vitro process eliminating the use of animals, and 6) the ability to attach reporter molecules at precise locations (see O'Sullivan, C. ., "Aptasensors~the future of biosensing?" Anal. Bioanal. Chem. 372, 44-48 (2002)).
Using these procedures, three aptamers with high affinity and specificity for AIV H5N1 were developed. The three aptamers are listed as SEQ ID NOs: 1-3 and their predicted two dimensional structures are shown in Figures 1-3. Each of the aptamers forms a stem-loop secondary structure. The aptamers were selected based on their ability to bind to killed H5N1 or hemaglutinin. The data in the Examples demonstrate that the aptamers can be labeled with biotin and binding to H5N1 can be detected using traditional dot blot analysis. These aptamers can thus be incorporated into diagnostic assays or biosensors that traditionally use antibodies, receptor-ligand interactions or other affinity interactions to detect the presence or absence of
targets, such as AIV, in samples. Such samples may include, but are not limited to food, water, environmental, or clinical samples.
The aptamers described herein are capable of binding to AIV H5N1 with high affinity and specificity. The aptamers are capable of binding isolated hemaghitinin from H5N1 virus, as discussed more fully below the binding affinity of the aptamers is more complex than simply binding the hemaglutinin. The aptamers show higher affinity for H5N1 as compared to other H5 containing viruses. The aptamer likely recognizes or has a higher affinity for the hemaglutinin neuraminidase complex found in H5N1. The binding affinity for aptamer 2 was further characterized using surface plasmon resonance. Aptamer 2 had an association rate (Ka) of 4.69 x l04 (M-1 s-1) and a dissociation rate (Kd) of 2.18 x 104 (s-1). The equilibrium association constant
(KA) was 2.85 x 108 (M-1 ). Thus, aptamer 2 demonstrated strong binding with purified HA protein as well as inactivated H5N1 virus. Aptamer 1 and 3 are expected to have similar binding characteristics based on the similar results obtained in the dot-blot and dot-ELISA experiments. These binding characteristics are similar to those of antibody-antigen interactions for antibodies used in immunoassays or in biosensors. Those of skill in the art will appreciate that these aptamers may be used in assays similar to those in which antibodies are routinely used.
The examples demonstrate that the aptamers have great selectivity for H5N1 over other influenza subtypes. In particular, the aptamers have higher affinity for H5N1 as compared to their affinity for other AIV subtypes including H5N2, H5N3, H5N9, H7N2, H2N2, and H9N2 as shown in the dot blot assays. The aptamers suitably have an affinity for H5N1 that is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 40, 50, 40, 80, 100, 150, 200, 250, 300, 400, 500 or 1,000 fold higher than that of at least one other influenza sub-type. Of the subtypes tested using surface plasmon resonance, no detectable binding of aptamer 2 to H5N9, H7N2, H2N2 and H9N2 was observed (0 RU). Binding of aptamer 2 to H5N2 was detectable, but the affinity was over 4 fold lower than binding to H5N1. In the Examples, aptamer 2 bound H5N1 with an RU of 136 and H5N2 with an RU of 33. Suitably, the aptamer has such higher affinity for H5N1 than for any other influenza subtype or at least for the subtypes tested herein. The increased affinity for H5N1 as opposed to other subtypes allows for the detection of H5N1 in a background or sample that may contain or be contaminated with other AIV subtypes.
The aptamers described herein are 73 or 74 nucleotides long, but fragments of these aptamers may also be useful and capable of binding H5N1. A fragment of the aptamers described herein may comprise at least 15 nucleotides, 20 nucleotides, 25 nucleotides, 30 nucleotides, 35 nucleotides, 40 nucleotides, 45 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, or 70 nucleotides long. In addition, aptamers comprising a primary nucleotide sequence that has at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the primary nucleotide sequence shown in at least one of SEQ ID NOS: 1 -3 and retains the ability to bind H5N1 with higher affinity than at least one of H5N2, H5N3, H5N9, H7N2, H2N2, and H9N2 are also provided.
The aptamers are comprised of nucleotides, modified nucleotides, or a combination thereof. The aptamers are DNA in the examples, but they can also be RNA, DNA/RNA hybrids or synthetic nucleotide analogs. Nucleic acid sequences may incorporate modified nucleotides to, e.g., stabilize the aptamers against degradation in vivo or in vitro. For example, resistance to nuclease degradation can be greatly increased by the incorporation of modifying groups at the 2'- position. For example, the nucleotides may comprise 2'-OH, 2'-F, 2 -deoxy, 2'-NH2, 2'-OMe, or 2 -methoxyethyl modifications. Those of skill in the art will appreciate that several methods may be used to generate aptamers comprising modified nucleotides.
The aptamers may comprise at least one chemical modification. Suitably, the
modification is selected from the group consisting of: a chemical substitution at a sugar position, a chemical substitution at an internucleotide linkage and a chemical substitution at a base position. Alternatively, the modification is selected from the group consisting of: incorporation of a modified nucleotide; a 3' cap; a 5' cap; conjugation to a high molecular weight, non- immunogenic compound; conjugation to a lipophilic compound; incorporation of a CpG motif; and incorporation of a phosphorothioate or phosphorodithioate into the phosphate backbone. The high molecular weight, non-immunogenic compound is preferably polyethylene glycol. In some embodiments, the polyethylene glycol is methoxypolyethylene glycol (mPEG). The 3' cap is suitably an inverted deoxythymidine cap.
In some embodiments, the aptamers are connected to one or more PEG moieties, with or without one or more linkers. The PEG moieties may be any type of PEG moiety. For example, the PEG moiety may be linear, branched, multiple branched, star shaped, comb shaped or a
dendrimer. In addition, the PEG moiety may have any molecular weight. Suitably, the PEG moiety has a molecular weight ranging from 5-100 kDa in size. Suitably, the PEG moiety has a molecular weight ranging from 10-80 kDa in size. Suitably, the PEG moiety has a molecular weight ranging from 20-60 kDa in size. Suitably, the PEG moiety has a molecular weight ranging from 30-50 kDa in size. Suitably, the PEG moiety has a molecular weight of 40 kDa in size. The same or different PEG moieties may be connected to an aptamer. The same or different linkers or no linkers may be used to connect the same or different PEG moieties to an aptamer.
Alternatively, the aptamers may be connected to one or more PEG alternatives (rather than to one or more PEG moieties), with or without one or more linkers. Examples of PEG alternatives include, but are not limited to, polyoxazoline (POZ), PolyPEG, hydroxyethylstarch (HES) and albumin. The PEG alternative may be any type of PEG alternative, but it should function the same as or similar to a PEG moiety, i.e., to reduce renal filtration and increase the half-life of the aptamer. The same or different PEG alternatives may be connected to an aptamer. The same or different linkers or no linkers may be used to connect the same or different PEG alternatives to the aptamer. Alternatively, a combination of PEG moieties and PEG alternatives may be connected to the aptamer, with or without one or more of the same or different linkers.
The aptamers may be connected to a PEG moiety, a PEG alternative or a label as described below via one or more linkers or spacers. However, the aptamers may be connected to a PEG moiety, PEG alternative or a label directly, without the use of a linker. The linker may be any type of molecule. Examples of linkers include, but are not limited to, amines, thiols and azides. The linkers can include a phosphate group. Suitably, the linker is from a 5'-amine linker phosphoramidite. In some embodiments, the 5'-amine linker phosphoramidite comprises 2-18 consecutive Cな groups. In other embodiments, the 5'-amine linker phosphoramidite comprises 2-12 consecutive Cな groups. In still other embodiments, the 5 -amine linker phosphoramidite comprises 4-8 consecutive CH2 groups. One or more of the same or different linkers or no linkers may be used to connect one or more of the same or different PEG moieties, one or more of the same or different PEG alternatives or one or more label to the aptamer.
Nucleotides in the aptamers may be modified with a label. The label is suitably detectable and may be radioactive, colorimetric, fluorescent, luminescent or chemiluminescent. The label may be part of a nucleotide forming a modified nucleotide within the aptamer or may be attached to the aptamer or to one of the nucleotides in the aptamer. Those of skill in the art will appreciate that a label could be incorporated in or attached to a nucleotide or to the apatmer using a variety of methods. Suitable labels can include, but are not limited to, the addition of biotin, avidin, thio, iodo, bromo, phosphor, fluoro, carboxyl, acrydite, cholesteryl-TEG,
Digoxigenin or amino groups. The nucleotides in the aptamer may also be modified to contain a radioactive label by incorporation of a radioactive molecule such as 32P, 35S, 3H.
The modifications described herein may affect aptamer stability, e.g., incorporation of a capping moiety may stabilize the aptamer against endonuclease degradation. Additionally, the modifications described herein may affect the binding affinity of an aptamer to its target, e.g., site specific incorporation of a modified nucleotide, conjugation to a PEG or incorporation of a label may affect binding affinity. The effect of such modifications on binding affinity can be determined using a variety of art-recognized techniques, such as, e.g., functional assays, such as an ELISA, or binding assays in which labeled trace aptamer is incubated with varying target concentrations and complexes are captured on nitrocellulose and quantitated, to compare the binding affinities pre- and post-incorporation of a modification.
The invention also includes compositions comprising at least one of the aptamers that binds to H5N1 described herein. In some embodiments, the compositions include the aptamer or a salt thereof, alone or in combination, with one or more carriers, stabilizers or diluents. In embodiments where the composition includes at least two aptamers the aptamers may, optionally, be tethered or otherwise coupled together. The compositions may also include a non- aptamer agent.
As used herein, the term salt refers to salt forms of the active compound that are prepared with counter ions that may be non-toxic under the conditions of use and compatible with a stable formulation. Examples of salts of aptamers include hydrochlorides, sulfates, phosphates, acetates, fumarates, maleates and tartrates.
These aptamers may be useful as biological recognition elements in biosensor platforms and/or in vitro diagnostic assays. If the aptamers are to be used in biosensor applications, 5', 3',
or internal modifications to the nucleotides can be used to bind the oligonucleotides to an electrochemical, optical, piezoelectric, magnetic, or calorimetric biosensor platform. Biosensors using affinity moieties, such as antibodies, capable of binding to an agent to be detected are well known to those skilled in the art. These biosensors may be adapted for use of the aptamers disclosed herein by substituting the aptamer for the affinity moiety, i.e. antibody or ligand traditionally used in the biosensor by those of skill in the art. The aptamers may also be modified to increase the stability of the aptamer. For example, 5', 3' or internal modifications may be made to the aptamer to protect the aptamer from degradation by nucleases or to increase the binding affinity for H5N1 as described above.
The aptamers may be directly or indirectly bound to a solid support. The solid support may be comprised within a biosensor. The solid support may be a bead, such as a magnetic bead, a column, a microtiter plate, a chip, such as a microarray chip or glass chip, nanoparticles, such as gold or silver nanoparticles, or glassy electrode surfaces, such as carbon or gold/silver glassy electrode surfaces. Means of attaching or binding oligonucleotides, such as the aptamers disclosed herein, to a solid support are well known to those skilled in the art. The aptamers may be attached to the solid phase support via a linker.
The disclosed aptamers may also employ a linker when coupled to a solid support. The linker may comprise one or more atoms that separate the solid support from the aptamer. Thus, for example, the linker may be a standard 6-atom or a 15-atom linker such as TEG (tetraethylene glycol). Accordingly, linkers having any number of atoms separating the solid support from the oligomers can be employed, such as 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, 20-, 21-, 22-, 23-, 24-, or 25-atom linkers. Alternatively, the linker may be an
oligonucleotide linker. An oligonucleotide linker may comprise 1, 2, 3, 4, 5, 7, 10, 20, 30, 40, 50, 75 or 100 nucleotides added to the aptamer sequence. The linker may mediate the attachment of the aptamer to the solid support. The linker may also allow for a more efficient interaction between the aptamer and the target H5N1. Other suitable likers are disclosed above.
Methods of detecting avian influenza virus subtype H5N1 are also provided. The methods comprise contacting a sample with the aptamers described above and determining whether the aptamer is capable of binding to the sample. Aptamer binding to the sample is indicative of the presence of H5N1 virus in the sample. Lack of aptamer binding to the sample is
indicative of lack of H5N1 virus in the sample. The method may further include detecting the level of binding of the aptamer to AIV H5N1 in the sample. The level of binding of the aptamer to the sample is indicative of the amount of H5N1 virus present in the sample. Thus, the methods may be quantitative and allow for detection not only of the presence or absence of H5N1 in the sample, but also allow for determination of the amount or number of H5N1 virus particles in the sample. Samples for use in the methods include food, water, environmental or clinical samples. Clinical samples include any sample taken from an organism or subject, including, but not limited to a blood, urine, saliva, tissue, or cellular sample. The subject may be a human, chicken, turkey (poultry), pig, cow, or other domestic animal. The method may be used to determine if an individual subject is infected with H5N1 virus.
The following examples are meant to be illustrative and not to limit the scope of the invention. All references cited are incorporated by reference herein in their entireties.
EXAMPLES SELEX technology was used as described in detail below to obtain aptamers with high- affinity and specificity for H5N1 Influenza. An outline of the process used is schematically explained in Fig. 4. A pool or library of DNA oligonucleotides containing a region of randomized nucleotides 73-74 nt in length flanked by constant sequences for binding of primers for PCR (polymerase chain reaction) served as the starting material for the process. The 5' constant region used the sequence: 5 '-CCGGAATTCCTAATACGACTC- 3 ' (SEQ ID NO: 4). The 3' constant region used the sequence: 5' - TATTGAAAACGCGGCCGCGG -3' (SEQ ID NO: 5). Thus the DNA oligonucleotides that were screened using SELEX had the formula (5'- CCGGAATTCCTAATACGACTC (SEQ ID NO: 4)-N74- TATTGAAAACGCGGCCGCGG (SEQ ID NO: 5)-3') with N74 representing the randomized oligonucleotides being screened. Unless otherwise mentioned all oligonucleotides were synthesized by IDT (Integrated DNA Technologies).
In each selection cycle, the DNA library was first passed through a nitrocellulose filter (mixed cellulose ester, hydrophilic membrane from Millipore) three times prior to the election cycle to eliminate DNAs that bind nitrocellulose non-specifically. The resulting DNA candidate aptamer pool was mixed with the target and incubated for one hour at room temperature with
shaking. Full-length recombinant Influenza Hemagglutinin (HA) (Protein Science Corporation, Meriden, CT) was used as the target in the first four rounds of SELEX selection. For the remaining rounds of selection, killed H5N1 virus (Scotland 59 H5N1 from USDA- APHIS National Veterinary Services Laboratories with a titer of 128 HA units) was used as the target. Then, the mixture of the DNA library and the target was passed through a filter capable of capturing complexes of the aptamer bound to the protein/viral target while allowing free aptamer to pass through- Only the nucleic acids that revealed affinity and specificity towards the AIV HA or the entire killed AIV H5N1 depending on the selection cycle were captured on the filter, while most of the DNA library was washed away through the filter. The filters were washed with binding buffer (50 mM Tris-HCl, pH 7.5, 25 mM NaCl, 5 mM MgCl2, 10 mM dithiothreitol (DTT)). The DNA-aptamer candidates were eluted from the filter with elution buffer (0.4 M sodium acetate, 5 mM EDTA, and 7 M urea, pH 5.5), and amplified by PCR amplification. The forward primer used was called DL-F (5 '-CCGGAATTCCTAATACGACTC-3 ' (SEQ ID NO: 6)) and reverse primer used was called DL-R (5'- CCGCGGCCGCGTTTTC A ATA-3 ' (SEQ ID NO: 7)). The primers were used to amplify double strand aptamer candidates, and convert to single stranded DNA (ss-DNA) by asymmetric PCR. The resulting ssDNA was then used for the next selection cycle. The PCR products were also monitored after each round of selection by running a small portion of the PCR product on a 6% TBE gel.
Table 1: Concentrations of HA rotein/AIV and DNA used in the se ection cycle
Subsequent selection cycles were similar to the first cycle with the exception that the stringency of selection was increased to promote competition between binding species.
Therefore, as the cycles progress, the molar ratio of HA/AIV to DNA (including pool DNA, nonspecific DNA) was increased from 1 :20 to 1 :500 (Table 1). For each round a 350-μ1 aliquot of the PCR product was allowed to bind to the next 50-μ1 HA/AIV and, the elution amplification process was repeated 14 times to select for high affinity aptamers.
Using a biotin modified primer during the PCR amplification, biotin modified DNA aptamers were obtained for testing after the 4th, 8th or 10th rounds of SELEX selection. The biotin labeled DNA product from the 4th, 8th and 10th SELEX cycle was then used in a conventional Dot Blot analysis, as shown in Fig. 5, to test the affinity of binding between the DNA aptamers and target ATV H5N1. Briefly, the dot blots were prepared by allowing 5 1 of the indicated virus (with titer of 128 HA units) to air dry on a nitrocellulose membrane. The membranes were then blocked for 15-30 minutes with blocking buffer (2.5% w/v casein, 0.15 M NaCl, 0.01 M Tris, 0.02% Thimerosal; pH 7.6). The biotin labeled DNA product from the indicated SELEX cycle was added at a 1 : 1 ratio in blocking buffer to the membrane and incubated for 45 minutes. The membranes were washed three times for five minutes each with blocking buffer to remove unbound aptamer. The membrane was then incubated for 90 minutes with peroxidase-labeled streptavidin (diluted 1 :2,500 with blocking buffer), then washed again three times for five minutes each with blocking buffer. The membrane was treated with substrate (Pierce Supersignal West Dura Extended Duration) for 5 minutes and chemiluminescence dots were detected using a charge-coupled device (CCD) camera (LAS 1000 plus) (Fuji Photo Co., Ltd., Tokyo, Japan 106-8620).
The specificity of binding was also determined by assessing the cross-interaction with non-target AIV subtype H5N2 and H7N2 (ADL, Pennsylvania State University). Dot Blot results (Fig. 5.) clearly showed that as the number of SELEX cycles increased the selected aptamers displayed stronger binding to the target, ATV H5N1, with an increase of dot size and intensity. No cross-interaction was observed with non-target AIV subtype H5N2 or H7N2.
In order to isolate, identify and evaluate individual aptamers enriched from the last two selection cycles, PCR amplicons obtained from the last two cycles were cloned into the pGEM- T easy vector (Promega Corp., Madison, WI) and transformed into JM109 competent cells using
standard protocols. The detailed ligation procedure was comprised as follows. Each litigation reaction contained 5 μΐ of 2x Rapid Litigation Buffer for T4 DNA Ligase, 1 μΐ of pGEM-T Easy Vector (50ng), 1 μΐ of T4 DNA Ligase (3 Weiss units/μΐ). Two litigation reactions used 5 μΐ of the product from the 13th and 14th selection cycle. A no insert control and a positive control insert were added to two parallel litigation reactions.
A number of transformant colonies (10-20) obtained using the PCR amplicons were randomly chosen from each enriched pool after the 13 and 14 cycle and used for plasmid purification. Single-stranded individual labeled aptamers were obtained from each plasmid template using PCR with biotin labeled primers. The resulting biotin modified aptamers were further characterized by Dot-blot to determine the affinity and specificity of the aptamers for the target AIV H5N1. Then, based on the test results, the best candidates were chosen for DNA sequencing. Three different sequences (monoclonal aptamers) were obtained.
(1) 5'-
GACGGGTAACGTATGTTTTACATTACGAAATTTAGAGCACCCTTACAGCGAG ACTCGTTGACCTGTAGCAGTG-3 ' (SEQ ID NO: 1)
(2) 5'-
GTGTGCATGGATAGCACGTAACGGTGTAGTAGATACGTGCGGGTAGGAAGAA AGGGAA ATAGTTGTCCTGTTG-3 ' (SEQ ID NO:2)
(3) 5'- GGCCGAATTGGTTCGTCGAGCGAGTCACACCAACAATGCTGCGATAGAAACT TCGTACGAGCTTTCTTACGCTG -3' (SEQ ID NO:3)
The predicted 2D structures of the above three sequences are shown in Figs. 1, 2 and 3, respectively.
Dot-ELISA results using the selected aptamer 1, aptamer 2 and aptamer 3 are shown in Fig. 6. A previously published ATV aptamer sequence selected for its ability to bind H5N1 hemaglutinin was used as a control (Cheng et al., 2008 Biochem Biophys Research Communication 366:670-674). Non-target AIV subtypes H5N2, H5N3, H5N9, H7N2 and H9N2 (obtained from ADL, Pennsylvania State University) were also tested to check the specificity of the binding of the aptamers to H5N1. The Dot ELISA test strips were prepared by allowing 1
of each test virus to air dry on nitrocellulose membranes. The membranes were blocked with blocking buffer as described above for 15-30 minutes prior to addition of a 1:3 dilution of the biotin-labeled single stranded aptamer in blocking buffer for 45 minutes. The membranes were washed three times for five minutes with blocking buffer prior to adding 200μ1 of streptavidin- alkaline phosphatase at a 1 :500 dilution for 25 minutes. After the strips dried the signal was developed by adding BCIP/NBT substrate to the strips for about 5 minutes prior to air drying and analysis.
The Dot-ELISA results indicated that the developed monoclonal aptamers had high specificity for the target H5N1 virus. No cross-interaction was observed for other ATV subtypes tested including H5N2, H5N3, H5N9, H7N2 and H9N2. Thus, the three aptamers developed herein have higher affinity for killed H5N1 than a previously reported aptamer and also have higher affinity for H5N1 than they do for other AIV subtypes, specifically H5N2, H5N3, H5N9, H7N2 and H9N2.
The surface plamon resonance (SPR) instrument SensiQ (ICx Nomadics, Oklahoma City, Ok) and neutravidin modified sensor chips (BioCap) were used to test the affinity and specificity of aptamer 2 (SEQ ID NO: 2). All experiments were conducted at 25 °C with a flow rate of 10 μΐ/min. The running buffer used for the experiments was PBS (lOmM, pH 7.4). 10 mM NaOH (40 μΐ) were used for regeneration to remove the bound target protein HA (Hemagglutinin) or AIV H5N1. The full-length glycosylated recombinant HA protein of the subtype H5N1 with concentration of 524 μg mL was purchased from Protein Science Corporation (Meriden, CT). The protein was produced in insect cells using the baculovirus expression vector system and purified to >90% purity under conditions that preseve its biological activity and tertiary structure. Inactivated ATV H5N1 sample (Scotland 59 H5N1) was obtained from USDA-APHIS National Veterinary Services Laboratories (NVSL, Ames, I A).
Immobilization of the selected aptamer (aptamer number 2) on SPR chip surface was carried out by using the biotin-neutravidin method. The SPR chip was pre-coated with neutravidin, and then biotin-labeled aptamer with concentration of 1 mM was injected for 10 min (10 μΐ/min, 25 °C) and then followed by 5 min biotin (10 μΜ) blocking. After washing with running buffer, the chip was ready for binding measurements. Aptamer was immobilized on
Channel 1 whereas Channel 2 without aptamer immobilization was used as a reference channel. The immobilization of aptamer resulted in increase of SPR signal by 997 RU.
HA proteins with different concentrations (2, 5, 10, 20 and 40 μg/mL) were injected onto the sensor chip and the affinity binding was monitored for 2 min followed by washing with running buffer. The analytical signal, recorded in resonance units (RU), was computed as the difference between the aptamer and corresponding reference channel. We evaluated the affinity binding of HA protein to the selected aptamer by injecting increasing concentrations of HA over the aptamer and reference surfaces. In this way, the portion of the SPR signal that was attributed to specific affinity binding could be calculated by subtracting the non-specific binding and bulk refractive index effects detected on the reference surface from the total SPR signal measured on the aptamer surface. An overlay of the sensor SPR signals from the interactions between HA and the selected aptamer is shown in Figure 7. As expected, injection of higher HA concentrations resulted in an increase of the SPR signal. Analysis of data for interaction between HA and aptamer; association and dissociation rate constants (Ka and Ka), and equilibrium association constants (KA) were calculated by a 1:1 [Langmuir] fitting model using the Qdata analysis software. The calculated Ka and Kd was 4.69xl04 (M-1 s-1) and 2.18xl04 (s-1), respectively, and the KA was 2.85x108 (M-1), indicating strong binding between the HA protein and the selected aptamer.
Further experiments were conducted to study the binding between the selected aptamer and the H5N1 virus. The inactivated AI H5N1 virus with different titers of 0.064, 0.128, 0.32 and 0.64 HAU in buffer solution was tested using SPR. The result is shown in Figure 8. The Standard Deviation (SDs) was indicated as error bars in the figure. A linear relationship was found and the linear regression equation is described as: y = 208.39x + 2.2347 (R2=0.9969), where y (SPR signal) was expressed in RU and x (virus titer) in HAU. The result showed that the selected aptamer could be used as a ligand to detect target AIV H5N1.
The specificity was investigated by testing non-target AI virus H5N2, H5N9, H9N2, H7N2 and H2N2 with titer of 0.64 HAU. No detectable signal was obtained with AIV H5N9, H9N2, H7N2 and H2N2. However, 33 RU SPR signal was observed for AIV H5N2, showing some cross-interaction with AI subtype H5N2.
Claims
1. An aptamer capable of binding to Avian Influenza Virus strain H5N 1 , wherein the aptamer has higher affinity for H5N1 than for H5N2, H5N3, H5N9, H7N2, H2N2, or H9N2.
2. The aptamer of claim 1 , wherein the aptamer comprises SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, a fragment of SEQ ID NO: 1, a fragment of SEQ ID NO: 2, or a fragment of SEQ ID NO: 3.
3. The aptamer of claim 2, wherein the aptamer is SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
4. The aptamer of any of claims 1-3, wherein the aptamer has 3 fold higher affinity for H5N1 than for avian influenza virus H5N2.
5. The aptamer of any of claims 1-3, wherein the aptamer has 10 fold higher affinity for H5N1 than for avian influenza virus H5N2, H5N3, H5N9, H7N2, H2N2, or H9N2.
6. The aptamer of any of claims 1-5, wherein the aptamer is attached to or comprises a label.
7. The aptamer of claim 6, wherein the label is radioactive, fluorescent or
chemiluminescent.
8. The aptamer of claim 6, wherein the label is biotin, avidin, thio, iodo, bromo, phosphor, fluoro, amino, carboxyl, acrydite, cholesteryl-TEG, digoxigenin.
9. The aptamer of any of claims 1-8, wherein the aptamer is coupled to a solid support.
10. The aptamer of claim 9, wherein the solid support is a bead, a nanoparticle or a glassy electrode surface.
11. The aptmmer of any of claims 1-10, wherein the aptamer has at least one chemical modification.
12. The aptamer of claim 11 , wherein the chemical modification increases the stability of the aptamer.
13. The aptamer of any of claims 1-12, wherein the aptamer has higher affinity for H5N1 than for any of H5N2, H5N3, H5N9, H7N2, H2N2, and H9N2.
14. A composition comprising the aptamer of any of claims 1-13 or a salt thereof.
15. The composition of claim 14, further comprising a carrier or diluent.
16. A biosensor comprising the aptamer of any of claims 1-13.
17. A method of determining whether a sample contains influenza virus H5N1 comprising: contacting the sample with the aptamer of any of claims 1-13; and
determining whether the aptamer bound to the sample, wherein aptamer binding to the sample is indicative of the presence of influenza virus H5N1 in the sample.
18. The method of claim 17, further comprising detecting the level of binding of the aptamer to the sample.
19. The method of claim 18, wherein the level of binding of the aptamer to the sample is indicative of the amount of influenza virus H5N1 in the sample.
20. The method of claim 18 or 19, wherein the method is quantitative.
The method of any of claims 17-20, wherein the sample is from a subject.
22. The method of claim 21 , wherein the method allows determination of whether the subject is infected with H5N1.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US34656110P | 2010-05-20 | 2010-05-20 | |
| US61/346,561 | 2010-05-20 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2011146825A2 true WO2011146825A2 (en) | 2011-11-24 |
| WO2011146825A3 WO2011146825A3 (en) | 2012-01-19 |
Family
ID=44992358
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2011/037323 Ceased WO2011146825A2 (en) | 2010-05-20 | 2011-05-20 | Avian influenza h5n1 specific aptamers and their use |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2011146825A2 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013183383A1 (en) * | 2012-06-04 | 2013-12-12 | Necソフト株式会社 | Nucleic acid molecule binding to influenza virus and use therefor |
| JP2014233276A (en) * | 2013-06-04 | 2014-12-15 | 独立行政法人産業技術総合研究所 | Detection and surveillance of highly pathogenic avian influenza virus |
| KR20180020373A (en) * | 2016-08-18 | 2018-02-28 | 건국대학교 산학협력단 | Nucleic acid aptamer specifically binding to H5 subtype avian influenza virus and Diagnosis method of H5 subtype avian influenza virus using the same |
| KR101841262B1 (en) | 2015-10-08 | 2018-03-22 | 고려대학교 산학협력단 | Nucleic Acid Aptamer Capable of Specifically Binding to AI Virus and Uses Thereof |
| KR20200109792A (en) * | 2019-03-14 | 2020-09-23 | 한양대학교 산학협력단 | A composition for treating or preventing infection with avian influenza virus |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| USH2191H1 (en) * | 2000-10-24 | 2007-06-05 | Snp Consortium | Identification and mapping of single nucleotide polymorphisms in the human genome |
| AU2006276813A1 (en) * | 2005-07-01 | 2007-02-15 | Arbor Vita Corporation | Methods and compositions for diagnosis and treatment of influenza |
-
2011
- 2011-05-20 WO PCT/US2011/037323 patent/WO2011146825A2/en not_active Ceased
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013183383A1 (en) * | 2012-06-04 | 2013-12-12 | Necソフト株式会社 | Nucleic acid molecule binding to influenza virus and use therefor |
| CN104364375A (en) * | 2012-06-04 | 2015-02-18 | 日本电气方案创新株式会社 | Nucleic acid molecule binding to influenza virus and use therefor |
| JPWO2013183383A1 (en) * | 2012-06-04 | 2016-01-28 | Necソリューションイノベータ株式会社 | Nucleic acid molecules that bind to influenza virus and uses thereof |
| EP2857514A4 (en) * | 2012-06-04 | 2016-02-24 | Nec Solution Innovators Ltd | Nucleic acid molecule binding to influenza virus and use therefor |
| JP2014233276A (en) * | 2013-06-04 | 2014-12-15 | 独立行政法人産業技術総合研究所 | Detection and surveillance of highly pathogenic avian influenza virus |
| KR101841262B1 (en) | 2015-10-08 | 2018-03-22 | 고려대학교 산학협력단 | Nucleic Acid Aptamer Capable of Specifically Binding to AI Virus and Uses Thereof |
| KR20180020373A (en) * | 2016-08-18 | 2018-02-28 | 건국대학교 산학협력단 | Nucleic acid aptamer specifically binding to H5 subtype avian influenza virus and Diagnosis method of H5 subtype avian influenza virus using the same |
| KR101887876B1 (en) * | 2016-08-18 | 2018-08-13 | 한국과학기술연구원 | Nucleic acid aptamer specifically binding to H5 subtype avian influenza virus and Diagnosis method of H5 subtype avian influenza virus using the same |
| US10751359B2 (en) | 2016-08-18 | 2020-08-25 | Korea Institute Of Science And Technology | Nucleic acid aptamer specifically binding to avian influenza virus subtype H5 and method of detecting avian ifluenza virus subtype H5 using the same |
| KR20200109792A (en) * | 2019-03-14 | 2020-09-23 | 한양대학교 산학협력단 | A composition for treating or preventing infection with avian influenza virus |
| KR102238589B1 (en) * | 2019-03-14 | 2021-04-08 | 한양대학교 산학협력단 | A composition for treating or preventing infection with avian influenza virus |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2011146825A3 (en) | 2012-01-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9562907B2 (en) | Aptamers screening method based on graphene without target immobilization and the aptamers obtained from the method | |
| KR101841046B1 (en) | Novel reduced graphene oxide-based aptasensor for detecting kanamycin and use thereof | |
| WO2011146825A2 (en) | Avian influenza h5n1 specific aptamers and their use | |
| US20160251660A1 (en) | Nucleic acid aptamer capable of specifically binding to tebuconazole, mefenacet and inabenfide, and use therof | |
| CN114127282A (en) | Method for screening aptamer and immunoassay method using aptamer | |
| KR101263450B1 (en) | DNA aptamer binding to kanamycin with specificity | |
| US10751359B2 (en) | Nucleic acid aptamer specifically binding to avian influenza virus subtype H5 and method of detecting avian ifluenza virus subtype H5 using the same | |
| US20120295811A1 (en) | Aptamers directed against the matrix protein-1 of type a influenza viruses and uses thereof | |
| US20220112499A1 (en) | Aptamers against imatinib | |
| JP2022514629A (en) | Aptamer for irinotecan | |
| KR102474286B1 (en) | A dna aptamer specifically biding to severe fever with thrombocytopenia syndrome virus and immunoassay using the aptamer | |
| KR101678946B1 (en) | Nucleic Acid Aptamer Capable of Specifically Binding to 25-hydroxy Vitamin D3 and Uses Thereof | |
| KR101841262B1 (en) | Nucleic Acid Aptamer Capable of Specifically Binding to AI Virus and Uses Thereof | |
| KR101612882B1 (en) | Nucleic Acid Aptamer Capable of Specifically Binding to Iprobenfos and Uses thereof | |
| JP2025503670A (en) | Aptamers for detecting variants of a target analyte, methods for their production and use - Patents.com | |
| KR101384178B1 (en) | Aptamer specific to influenza virus ns1 protein and pharmaceutical composition comprising the same | |
| KR20130032128A (en) | Dna aptamers for porcine reproductive and respiratory syndrome(prrs) virus | |
| CN115058426A (en) | A nucleic acid molecular probe that specifically recognizes SARS-CoV-19 and its screening method, detection product and application | |
| KR101616524B1 (en) | Aptamer having specific binding ability for vaspin and Biosensor Using therof | |
| CN116064553B (en) | Two DNA aptamers that specifically recognize Omicron and Delta mutants | |
| KR20250106684A (en) | DNA Aptamer Specifically Binding to Envelope Protein of SARS-CoV-2 and Uses Thereof | |
| Kakoti | Aptamer: An Emerging Biorecognition System | |
| US20140141446A1 (en) | Aptamers That Are Specific for Immunoglobulin-Binding Cell Wall Proteins | |
| WO2025240962A1 (en) | Aptamer based binding-induced conformational switching sensors and uses thereof | |
| TWI465566B (en) | Method and kit for preparing a specific aptamer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11784314 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 11784314 Country of ref document: EP Kind code of ref document: A2 |
