KR102238589B1 - A composition for treating or preventing infection with avian influenza virus - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating avian influenza virus infectious diseases, and more specifically, it comprises a DNA aptamer having a hemagglutinin protein inhibitory activity by specifically binding to highly pathogenic avian influenza H5N1 It relates to a pharmaceutical composition.
The single-stranded DNA aptamer of the present invention not only specifically binds to avian influenza virus H5N1 at low concentrations, but also inhibits hemagglutinin. It is expected to be able to replace.

Description

Pharmaceutical composition for preventing or treating avian influenza virus infection disease {A composition for treating or preventing infection with avian influenza virus}

The present invention relates to a pharmaceutical composition for preventing or treating avian influenza virus infectious diseases, and more specifically, it comprises a DNA aptamer having a hemagglutinin protein inhibitory activity by specifically binding to highly pathogenic avian influenza H5N1 It relates to a pharmaceutical composition.

Avian influenza is a disease caused by infection with the Avian influenza virus, and is an infectious respiratory disease that mainly affects birds such as chickens and ducks. It is unlikely to be transmitted to humans, but once transmitted, the mortality rate is very high. Avian influenza is classified into low pathogenicity and high pathogenicity. Low pathogenicity has no disease or weak symptoms, and high pathogenicity causes serious disease and shows high mortality and can be transmitted to humans. Low pathogenicity can also cause genetic modification to become highly pathogenic. The cause of avian influenza infection in the human body occurs through contact with birds infected with the avian influenza virus. In particular, feces from virus-infected birds are the main vectors of infection.

From 2003 to 2018, more than 860 cases of human infection with highly pathogenic avian influenza virus H5N1 have been reported. Many of these cases occurred in people associated with birds that caused avian influenza, and human-to-human infections appear to be low. However, human infections show a high mortality rate, and medical circles around the world are watching the possibility of avian influenza turning into a human infectious disease in the future. Wild birds such as migratory birds, which are the main propagation factors of avian influenza, have weak clinical symptoms and do not die easily even if they are infected with ducks, so the rate and range of transmission is faster and wider. In Korea, it occurs most often in autumn and winter when humidity is low. Since the avian influenza virus is vulnerable to humidity, avian influenza outbreak occurred not only in Korea, but also in Japan and Europe, but due to the humidity and precipitation peculiar to the maritime climate, it has not become as serious as Korea.

The most common symptoms of avian influenza are respiratory symptoms such as cough and shortness of breath, and are accompanied by symptoms throughout the body such as fever, chills, and muscle pain. Avian influenza virus is cultured in a sample obtained from a suspected patient (mainly using secretions from the pharynx as a sample), or if the virus's DNA or antigen (a substance that stimulates the body's immune system to produce antibodies) is detected, avian influenza. It can be diagnosed as. The virus can also be detected in the patient's sputum or feces. In addition, it is diagnosed by checking for an increase in antibodies to the avian influenza virus through blood tests.

Avian influenza virus has subtypes of HA type and NA type. 18 types of HA and 11 types of NA are multiplied, and theoretically, 198 types of viruses exist. In particular, H5N1 type is best known for its high pathogenicity. Unlike other RNA viruses, the genome of influenza viruses has 8 segments, and these can be packaged by tying up different subtypes of genomes during packaging and infection of cells, so two or more different subtypes of influenza are one individual. Infecting the virus may lead to a completely different antigenic influenza. A highly pathogenic influenza virus that infects the human body may be born by mixing the highly pathogenic influenza that does not infect the human body with the influenza that infects the human body.

Currently, antiviral drugs such as amantadine and rimantadine are used as a treatment method for avian influenza. However, a new type of antiviral agent is needed because the number of resistant strains that are resistant to existing drugs is on the rise. In addition, existing vaccines cannot be effective if the prediction is wrong, and if they are introduced after discovery, there is a problem that it takes time to introduce, and it takes a long time until sufficient antibodies are produced. Therefore, it is necessary to develop a means to prevent virus infection in addition to the existing vaccine (KR 10-1010-0038258 A, etc.).

As a result of research efforts through the SELEX process to discover an aptamer specific for avian influenza virus, the present inventors selected a DNA aptamer that specifically binds to avian influenza virus H5N1 and inhibits hemagglutination of H5N1, and based on this, The present invention has been completed.

Accordingly, an object of the present invention is to provide a composition for preventing or treating avian influenza virus H5N1 infection disease, comprising a DNA aptamer consisting of a nucleotide sequence consisting of SEQ ID NO: 4 or SEQ ID NO: 5.

However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems that are not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention as described above, the present invention provides a composition for preventing or treating avian influenza virus H5N1 infection disease, comprising a DNA aptamer consisting of a nucleotide sequence consisting of SEQ ID NO: 4 or SEQ ID NO: 5. .

In one embodiment of the present invention, the composition may be a pharmaceutical composition, an animal feed additive, an animal feed composition, or a health functional food composition.

In another embodiment of the present invention, the composition may inhibit the activity of hemagglutinin.

The single-stranded DNA aptamer of the present invention not only specifically binds to avian influenza virus H5N1 at low concentrations, but also inhibits hemagglutinin. It is expected to be able to replace.

1 shows the results of secondary structure analysis of DNA aptamers (HBA1, HBA2) according to the present invention.
Figure 2 shows the results of the analysis of the binding strength of the DNA aptamer (HBA1, HBA2) and avian influenza virus H5N1 according to the present invention.
3 is a result of analyzing the detection limit of the DNA aptamer (HBA1, HBA2) according to the present invention through the fluorescence recovery signal measurement according to the H5N1 virus concentration.
4 shows the results of analyzing the binding specificity of DNA aptamers (HBA1, HBA2) according to the present invention.
5 shows the results of confirming the ability of the avian influenza virus H5N1 to inhibit hemagglutination of DNA aptamers (HBA1, HBA2) according to the present invention.
6 shows the results of comparing the hemagglutination inhibitory activity of the DNA aptamer (HBA1) according to the present invention against other types of avian influenza virus.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for preventing or treating avian influenza virus H5N1 infection disease, comprising a DNA aptamer consisting of a nucleotide sequence consisting of SEQ ID NO: 4 or SEQ ID NO: 5.

The term "avian influenza virus" used in the present invention refers to a virus that can cause avian influenza in chickens, ducks, wild birds, etc., and the virus is in the genes of HA and NA in the outer membrane. Accordingly, HA is divided into 18 types and NA is divided into 11 types, and the serotypes are diverse. In the present invention, the avian influenza virus may preferably be a highly pathogenic avian influenza virus H5N1.

In the present invention, "viral infectious disease" refers to a disease that can be caused by viral infection. Preferably, it may be one or more selected from the group consisting of flu, Reye syndrome, lung disease, and blood cell disease caused by avian influenza virus H5N1, and the flu is accompanied by high fever, cough, abdominal pain, and muscle pain, and the Reye syndrome is liver It causes dysfunction, and the lung disease exhibits symptoms similar to asthma, and the blood cell disease may be characterized by causing dyspnea.

The term "DNA aptamer" used in the present invention refers to a DNA nucleic acid molecule capable of binding to a specific molecule with high affinity and specificity.

The term "aptamer" as used in the present invention is a small molecule probe that has a short length (20-60 nucleotides) that can bind to various kinds of target ligands from a specific compound to a protein with high affinity and specificity. It means a fragment of a stranded nucleic acid. The development of aptamer can be done in vitro through a method called SELEX (Systematic Evolution of Ligands by Exponential enrichment).

Aptamers are considered to be nucleic acid molecules having properties similar to antibodies in that they have high avidity and selectivity at the level of nanomolar to picomolar to target substances. On the other hand, compared to antibodies, aptamers have several advantages: (1) chemical synthesis is easy, and because it is a relatively small and simple molecule, various necessary modifications are possible, and (2) selectivity and affinity through the SELEX process. The degree can be maximized, (3) high purity because it is made by chemical synthesis, (4) it is possible to develop aptamers for toxins that are difficult to produce antibodies by injection into animals, and (5) it is stable against heat and can be used at room temperature. Long-term storage is also possible, and (6) rarely causes an immune response in vivo.

The central principle of SELEX is the concept of evolution, in which only individuals with specific traits survive among a large number of randomly present individuals, and these surviving individuals increase their share in the group and finally dominate the group. Very similar. However, the individual in SELEX is a single-stranded nucleic acid, and the final selection is made based on the binding power of the aptamer to a specific ligand. Therefore, first, a nucleic acid library having a large number of random sequences must be created, and a separation process that can select individuals with high binding power to specific ligands expected to exist in this library is required. Amplification is required to increase the ratio in the nucleic acid pool and amplify to proceed with selection of the next round. Typically, 10 ¹⁴ - 10 ¹⁵ The degree of different sequence, i.e., the process of obtaining a single-stranded DNA pool (pool) from the library has a diversity is necessary. Various methods are used for this, but in general, a method of amplifying only one strand using asymmetric PCR, a bead wrapped with streptavidin after attaching biotin to the end of one strand of double-stranded DNA. The method of selectively separating only one strand using (bead) and the method of leaving only a single strand by decomposing the strand with a phosphate group at the 5'end using λ-exonuclease are most commonly used. In the present invention, a single-stranded DNA pool was secured using asymmetric PCR.

The library thus created is bound to the target ligand to proceed with a selection process to select an aptamer with high binding power. When the target material is a small molecule, it is usually immobilized to beads, resins, or plates through covalent bonds, and then an affinity column is made using them. After inducing binding by flowing a nucleic acid library on this column, the nucleic acids that do not bind to the ligand are removed by washing with a buffer. The aptamers bound to the ligand immobilized on the column are obtained by washing with a buffer having a low salinity or a solution containing the ligand. When the target material is a protein, an aptamer bound to the protein is usually separated using a nitrocellulose filer. Using these methods, aptamers having an affinity for the ligand can be obtained. Usually, 5-15 cycles of selection-amplification process can be repeated to obtain an aptamer with high affinity. When the selection process is completed, the amplified DNA is cloned, the sequence is confirmed from individual clones through sequence analysis, and the aptamer is synthesized to measure the affinity and binding strength with the target material.

In the present invention, the DNA aptamer may be included in a form in which the nucleotide sequence of SEQ ID NO: 4 or 5 is chemically or physically modified in any one or more of individual nucleotides constituting the nucleotide sequence. For example, any one or more of the individual nucleotides constituting the nucleotide sequence of SEQ ID NO: 4 or 5 is phosphorothioate DNA, phosphorodithioate DNA, phosphoroamidate DNA, amide-linked DNA, MMI-linked DNA, 2'-O-methyl RNA, alpha-DNA and methylphosphonate DNA, sugar modified nucleotides such as 2'-O-methyl RNA, 2'-fluoro RNA, 2'-amino RNA, 2'- O-alkyl DNA, 2'-O-allyl DNA, 2'-O-alkynyl DNA, hexose DNA, pyranosyl RNA and anhydrohexitol DNA, and nucleotides with base modifications such as C-5 substituted Pyrimidine (Substituents are fluoro-, bromo-, chloro-, iodo-, methyl-, ethyl-, vinyl-, formyl-, ethityl-, propynyl-, alkynyl-, thiazoryl-, already Dazoryl-, pyridyl- included), 7-deazapurine having a C-7 substituent (substituents are fluoro-, bromo-, chloro-, iodo-, methyl-, ethyl-, vinyl-, formyl -, alkynyl-, alkenyl-, thiazolyl-, imidazoryl-, pyridyl-), inosine or diaminopurine, and the like.

In addition, the DNA aptamer may include a variant of the nucleotide sequences of SEQ ID NO: 4 or 5. The variant is a nucleotide sequence having a functional property similar to that of the nucleotide sequences, although the sequence is different from the nucleotide sequences of SEQ ID NO: 4 or 5, and is 70% or more from the nucleotide sequence of SEQ ID NO: 4 or 5, preferably 80% or more, more preferably 90%, 91%, 92%, 93%, 94%, 95% or more, most preferably 96%, 97%, 98%, 99% or more sequence homology The branch may be a nucleotide sequence.

The pharmaceutical composition according to the present invention includes the DNA aptamer as an active ingredient, and may further include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is commonly used in formulation, and includes, but is limited to, saline, sterile water, Ringer's solution, buffered saline, cyclodextrin, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome, and the like. It is not, and other conventional additives such as antioxidants and buffers may be further included as needed. In addition, diluents, dispersants, surfactants, binders, lubricants, and the like may be additionally added to prepare injectable formulations such as aqueous solutions, suspensions, emulsions, and the like, pills, capsules, granules, or tablets. The pharmaceutical composition of the present invention is not particularly limited in its dosage form, but may be formulated as an oral preparation, injection, inhalation, or external preparation for skin.

The pharmaceutical composition of the present invention can be administered orally or parenterally (for example, intravenous, subcutaneous, intraperitoneal or topical application) according to a desired method, and the dosage is It depends on the degree, drug form, administration route and time, but may be appropriately selected by those skilled in the art.

In an embodiment of the present invention, a single-stranded DNA aptamer capable of specifically binding to avian influenza virus, more specifically, avian influenza virus H5N1 was selected by the SELEX method, and the binding strength and specificity to avian influenza virus were confirmed. As a result, it was directly confirmed that the DNA aptamer according to the present invention exhibits a nanomolarity (nM) level of avidity, and significantly higher reactivity compared to other subtypes of viruses (H1N1, H5N6, H9N2).

In another embodiment of the present invention, as a result of confirming the antiviral effect of the DNA aptamer according to the present invention through Hemagglutination inhibition assay, the DNA aptamer according to the present invention inhibits other subtypes of viruses (H1N1, H5N6, H9N2). While there was no effect, it was confirmed that only hemagglutination of H5N1 was significantly inhibited.

From the results of the above examples, it was verified that the DNA aptamer according to the present invention specifically binds to H5N1 and inhibits hemagglutination of H5N1. Therefore, the DNA aptamer according to the present invention prevents, improves, and prevents avian influenza virus H5N1 infection. Or it may be used as various compositions to be treated, such as antiviral agents, health functional food compositions, animal medicines, animal feed additives, disinfectants, and the like.

Thus, as another aspect of the present invention, the present invention comprises a DNA aptamer consisting of a nucleotide sequence consisting of SEQ ID NO: 4 or SEQ ID NO: 5, an animal feed additive for the prevention or treatment of avian influenza virus H5N1 infectious disease, or comprising the same It provides a composition for animal feed.

Animal feed additives and composition for animal feed of the present invention may further contain various supplements as auxiliary components such as amino acids, inorganic salts, vitamins, antibiotics, antibacterial substances, antioxidants, anti-fungal enzymes, and living microorganism preparations, and other feed additives. It may be administered in combination with.

In the present invention, the method of feeding animals may be in the form of feed additives, fermented foods, freeze-dried preparations, etc., and may be determined by those skilled in the art, and feeding methods, types of feeding animals, age, weight, and pathology It can also be varied depending on factors such as condition, rate of excretion, and responsiveness. In the present invention, the fed animals may be mammals other than humans, preferably livestock, and more preferably poultry.

Hereinafter, a preferred embodiment is presented to aid the understanding of the present invention. However, the following examples are provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[ Example ]

Example 1: specifically binding to avian influenza virus Single strand DNA aptamer screening ( SELEX )

1-1. PCR through Single strand Synthesis of DNA library

A single-stranded DNA aptamer capable of specifically binding to avian influenza virus (H5N1) from a random single-stranded DNA library (Bioneer, Deajeon, Korea) consisting of approximately 7.2 × 10 ^{14 different DNA sequences was prepared by the SELEX method.} Were selected. In order to discover a specific binding aptamer using an attenuated virus, a random DNA library is first required. For this, a single-stranded DNA library (5'-ATGCGGATCCCGCGC(N) ₃₀ GCGCGAAGCTTGCGC-3') (SEQ ID NO: 1) _{including 30} randomly constructed nucleotide sequences ((N) 30) was used for this purpose. To amplify the template DNA library, two primers were prepared and synthesized, and specific primer sequence information is shown in Table 1 below.

division Sequence (5'-3') Forward primer ATGC CGCGC GGATCC (BamH including Ⅰ site) (SEQ ID NO: 2) Reverse primer GCGC AAGCTT CGCGC (including Hind Ⅲ site) (SEQ ID NO: 3)

In order to obtain only single-stranded DNA, the template DNA library was amplified by asymmetric PCR using 100uM of forward primer and 10uM of reverse primer. The PCR product was confirmed by electrophoresis on a 2.5% agarose gel.

1-2. Single strand DNA library extraction

After PCR was performed, the'Crush and Soak' method was used to separate the single-stranded DNA library. The PCR product obtained in Example 1-1 was electrophoresed on a 12% native gel to separate double-stranded and single-stranded DNA. After electrophoresis, DNA was stained with EtBr, the single-stranded DNA band was cut out, and the cut-out gel _{was crushed in Crush and Soak buffer (500 mM NH 4} OAc, 0.1% SDS, 0.1 mM EDTA) to extract single-stranded DNA. The extract was centrifuged to separate the solid gel, purified through ethanol precipitation, etc., and quantified using a UV/Vis spectrophotometer and used for SELEX.

1-3. Specifically binding to avian influenza virus Aptamer Selection

In order to screen for an aptamer that specifically binds to avian influenza virus (H5N1) using the single-stranded DNA extracted in Example 1-2, SELEX, an In Vitro selection of oligonucleotide, was used. Performed.

More specifically, a concentrated filter was used as a method modified from the existing SELEX method. When the virus and aptamer bind, the size of the membrane becomes larger than the size of the membrane, so it cannot pass through the membrane and remains on the top of the membrane, and the unbound single-stranded DNA passes through the membrane and can be separated. For this purpose, ultrafiltration (30 kDa cutting membrane included, Millipore) is used to react H5N1 and single-stranded DNA at room temperature for the reaction time of each round, and single-stranded DNA not bound to H5N1 through centrifugation is used as a membrane. It was separated by passing it underneath, and the residue that did not pass through the membrane and remained on the top was amplified through PCR to obtain only a DNA sequence that binds to H5N1 through 12% native DNA electrophoresis, and proceeded to the next round. At this time, when H5N1 and single-stranded DNA were combined, single-stranded DNA, which is expected to bind with high binding force even under extreme conditions, was obtained through the concentration of protein and single-stranded DNA according to buffer conditions, binding time, and binding conditions. Selection conditions are shown in Table 2 below.

The cloning process was performed to analyze the sequence of the single-stranded DNA obtained through the final 7 rounds of SELEX process. After amplifying single-stranded DNA into double-stranded DNA using the same concentration of primers, it was intended to be inserted into pET 28a vector, a vector for bacterial expression with T7 promoter for sequence analysis. Restriction enzymes BamHI and HindIII were selected and treated, respectively, and genes were obtained using DNA ligase for insertion of the gene sequence into the expression vector.

As a result, 16 single-stranded DNA aptamers were finally selected, among which two aptamers with a high frequency were selected and named as HBA1 (H5N1 Binding Aptamer) and HBA2, and the specific nucleotide sequence is shown in Table 3 below. I got it.

Name Sequence (5'-3') Frequency HBA 1 ATGCGGATCCCGCGCGCAGTGCCGGGTGCCGAACCTACATTGCATGCGCGAAGCTTGCGC
(SEQ ID NO: 4) 12/30 HBA 2 ATGCGGATCCCGCGCGGGTCTGAGGAGTGCGCGGTGCCAGTGAGTGCGCGAAGCTTGCGC
(SEQ ID NO: 5) 18/30

Example 2: Aptamer Secondary structure analysis

The secondary structure of the aptamer selected according to Example 1 was analyzed. The secondary structure was analyzed through the M-fold web server, and the results are shown in FIG. 1. As shown in FIG. 1, it was confirmed that HBA1 and HBA2 each had a stem-loop structure excluding the primer portion.

Example 3: Selected DNA With aptamer Attenuated Avian influenza virus ( H5N1 ) Of cohesion analysis

In order to analyze the characteristics of the aptamers (HBA1, HBA2) selected according to Example 1, an aptamer sequence to which FAM (6-Carboxyfluorescein) was linked was ordered and synthesized. The binding force was measured using the properties of graphene oxide quenching fluorescence by the FRET phenomenon. More specifically, the fluorescence was reduced by binding the selected aptamer (0-500 nM) for 15 minutes using a concentration of 0.25 ug/ul of graphene oxide. Next, the virus was treated with 1 HAU, reacted at room temperature for 30 minutes, and then centrifuged and analyzed for fluorescence using the solution remaining in the supernatant to measure the binding force.

As a result, as shown in FIG. 2, as the concentration of the aptamer increased, the intensity of fluorescence recovered by the H5N1 virus of 1 HAU increased, and it was confirmed that saturation was achieved at 250 nM. In addition, as a result of calculating the dissociation constant through non-linear fitting using Origin, it was measured as HBA1-70 nM and HBA2-122 nM, and it was confirmed that all of them had a nanomolarity (nM) level of binding strength.

Example 4: Selected DNA Aptamer Limit of detection analysis

After reacting reduced graphene oxide at a concentration of 0.25 mg/ml and 500 nM aptamers (HBA1, HBA2), the fluorescence intensity of the recovered aptamer was measured by treating the concentration of H5N1 virus differently in each tube at 0-0.8 HAU. As a result, the detection limit of the aptamer sequence for H5N1 virus was analyzed.

As the concentration of the H5N1 virus increases, the fluorescence signal saturated and the fluorescence intensity recovered in detail in a small concentration range were measured. As shown in FIG. 3, HBA1 is 0-0.8 HBA2 is 0-0.8 in the concentration range of HAU. A straight line graph could be obtained in the concentration range of HAU. Through this, it was confirmed that HBA1 and HBA2 aptamers have detection limits of 0.08 and 0.1HAU, respectively.

Example 5: Selected DNA Aptamer Check binding specificity

In order to confirm the binding specificity of the aptamers (HBA1, HBA2) selected according to Example 1 to the H5N1 virus, based on the virus of 2 HAU, which is 20 times the detection limit of the H5N1 virus, other viruses and aptamers and The binding force of was compared.

In the same manner, the reduced graphene oxide and the aptamer were adsorbed through stirring at room temperature, and the fluorescence signal of the aptamer recovered by processing different types of viruses was measured. Three viruses were used: H1N1, a virus that differs only from Haemagglutinin, H5N6, a virus that differs only from Neuraminidase, and H9N2 viruses that differ in both Haemagglutinin and Neuraminidase.

As a result of comparing the fluorescence recovery signal for other viruses (H9N2, H5N6, H1N1) based on H5N1, as shown in FIG. 4, in the case of other viruses, recovery of a fluorescence signal that is very low compared to the extent of fluorescence recovery for H5N1 Showed. In addition, when H5N1 is based on 100%, all other viruses exhibited a low binding force of 0-20%, and showed a fluorescence intensity similar to that of Blank, an allantoic fluid, so that the DNA aptamers according to the present invention are specifically for H5N1 virus. It could be confirmed that it was combined.

Example 6: Selected Aptamer Hemagglutination of the sequence ( hemagglutination ) Inhibitory ability Verification

In order to confirm the avian influenza inhibitory ability of the aptamers (HBA1, HBA2) selected according to Example 1, it was confirmed whether the avian influenza virus surface protein, hemagglutinin, inhibits hemagglutination, which is the ability to aggregate red blood cells. .

In the experimental method, when red blood cells are put into the round bottom plate, the red blood cells sink and appear in the form of red dots, and when the virus is added to the red blood cells, the virus combines with the red blood cells to form a grid, resulting in a hemagglutination phenomenon that spreads the red color. . In addition, when aptamer and virus are added to red blood cells, the aptamer binds to the virus and inhibits the binding of the virus to red blood cells, thereby inhibiting hemagglutination, resulting in red dots. Using this principle, it was confirmed whether aptamer inhibits hemagglutination of avian influenza virus.

As a result, as shown in Figure 5, it was confirmed that the 60mer library not specific to H5N1 had no inhibitory effect, whereas HBA1 significantly inhibited hemagglutination in H5N1 virus from 6.25uM to 11.25uM. On the other hand, it was confirmed that HBA2 had a somewhat insignificant effect on hemagglutination inhibition than HBA1.

Example 7: against other viruses HBA1 Red blood cell aggregation ( hemagglutination ) Inhibitory ability Comparative verification

The analysis was conducted in the same manner as in Example 6 to see if HBA1, which has excellent ability to inhibit hemagglutination of H5N1 virus through the above example, inhibits hemagglutination in other subtypes of viruses (H1N1, H5N6, H9N2).

As a result, as shown in FIG. 6, it was confirmed that HBA1 did not show an inhibitory effect on other subtypes of viruses (H1N1, H5N6, H9N2).

From the above results, it was found that the DNA aptamer according to the present invention specifically binds to H5N1 and inhibits hemagglutination of H5N1.

The above description of the present invention is for illustrative purposes only, and those of ordinary skill in the art to which the present invention pertains will be able to understand that other specific forms can be easily modified without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and are not limiting.

<110> Industry-University Cooperation Foundation Hanyang University <120> A composition for treating or preventing infection with avian influenza virus <130> PD19-011 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> ssDNA library template sequence <400> 1 atgcggatcc cgcgcnnnnn nnnnnnnnnn nnnnnnnnnn nnnnngcgcg aagcttgcgc 60 60 <210> 2 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for the library amplification <400> 2 atgcggatcc cgcgc 15 <210> 3 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for the library amplification <400> 3 gcgcaagctt cgcgc 15 <210> 4 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> HBA 1 aptamer <400> 4 atgcggatcc cgcgcgcagt gccgggtgcc gaacctacat tgcatgcgcg aagcttgcgc 60 60 <210> 5 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> HBA 2 aptamer <400> 5 atgcggatcc cgcgcgggtc tgaggagtgc gcggtgccag tgagtgcgcg aagcttgcgc 60 60

Claims (4)

As a pharmaceutical composition for the prevention or treatment of avian influenza virus H5N1 infection disease, comprising a DNA aptamer consisting of the nucleotide sequence of SEQ ID NO: 4, the aptamer is contained in a concentration of 6.25 μM to 11.25 μM, and hemagglutination in H5N1 virus ( Hemagglutination), characterized in that to inhibit, pharmaceutical composition. delete As an animal feed additive for the prevention or treatment of avian influenza virus H5N1 infection disease, comprising a DNA aptamer consisting of the nucleotide sequence of SEQ ID NO: 4, the aptamer is contained in a concentration of 6.25 μM to 11.25 μM, and erythrocyte aggregation in H5N1 virus Characterized in that inhibit (hemagglutination), animal feed additives. delete

Images