WO2011139349A1 - Compositions for linking zinc finger modules - Google Patents

Compositions for linking zinc finger modules Download PDF

Info

Publication number
WO2011139349A1
WO2011139349A1 PCT/US2011/000758 US2011000758W WO2011139349A1 WO 2011139349 A1 WO2011139349 A1 WO 2011139349A1 US 2011000758 W US2011000758 W US 2011000758W WO 2011139349 A1 WO2011139349 A1 WO 2011139349A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
linkers
binding
domain
gap
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2011/000758
Other languages
English (en)
French (fr)
Inventor
David Paschon
Edward J. Rebar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sangamo Therapeutics Inc
Original Assignee
Sangamo Biosciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP19211724.0A priority Critical patent/EP3636766A1/en
Priority to CN201180022329.2A priority patent/CN102959087B/zh
Priority to HRP20200254TT priority patent/HRP20200254T1/hr
Priority to LTEP11777690.6T priority patent/LT2566972T/lt
Priority to DK11777690.6T priority patent/DK2566972T3/da
Priority to SI201131844T priority patent/SI2566972T1/sl
Priority to AU2011249019A priority patent/AU2011249019B2/en
Priority to PL11777690T priority patent/PL2566972T3/pl
Priority to KR1020187017770A priority patent/KR101974036B1/ko
Priority to CA2797189A priority patent/CA2797189C/en
Priority to JP2013509041A priority patent/JP5898179B2/ja
Priority to ES11777690T priority patent/ES2773052T3/es
Application filed by Sangamo Biosciences Inc filed Critical Sangamo Biosciences Inc
Priority to EP11777690.6A priority patent/EP2566972B1/en
Priority to KR1020127028770A priority patent/KR20130073887A/ko
Publication of WO2011139349A1 publication Critical patent/WO2011139349A1/en
Priority to IL222632A priority patent/IL222632B/en
Anticipated expiration legal-status Critical
Priority to CY20201100140T priority patent/CY1122636T1/el
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K19/00Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression

Definitions

  • the present disclosure is in the fields of genome and protein engineering.
  • Zinc-fmger proteins with recognition regions that are engineered to bind to selected target sites are regularly linked to other zinc- finger proteins as well as to regulatory domains and used to modify gene expression and genomic target sites.
  • artificial nucleases comprising DNA binding domains operably linked to cleavage domains have been used for targeted alteration of genomic sequences, including, insertion of exogenous sequences, inactivation of one or more endogenous genes, creation of organisms e.g., animal or crops) and cell lines with altered gene expression patterns, and the like. See, e.g., U.S. Patent Publication Nos.
  • Zinc-finger protein modules e.g., engineered zinc fingers of one or more fingers
  • TGEKP SEQ ID NO: 1
  • flexible linkers See, U.S. Patent Nos. 6,479,626; 6,903,185; 7,153,949 and U.S. Patent Publication No.
  • linkers for use in linking DNA-binding modules
  • fusion proteins for example zinc-finger proteins comprising these linkers which are in turn fused to regulatory domains such as transcriptional regulatory domains or to nucleases.
  • the disclosure also provides methods of using these fusion proteins and compositions thereof for modulation of gene expression, targeted cleavage of cellular DNA (e.g., endogenous cellular chromatin) in a region of interest and/or homologous
  • linkers comprising 5 or more amino acids between the last residue of the amino (N)-terminal finger (typically the carboxy (C)-terminal zinc-coordinating residue) and the first residue of the C-terminal finger (typically the first (N-terminal)- conserved aromatic residue), for example 7-17 amino acids.
  • the linker comprises an N-terminal residue, a C-terminal residue, and residues internal to the terminal residues, and further wherein the N-terminal residue or internal residues comprises at least one proline residue, for example a linker comprising the amino acid sequence X N"term -X n -X c"term , wherein X is any amino acid residue, X n comprises at least 3 amino acid residues and at least one of X N"term and X n comprises a proline residue.
  • the linker comprises at least two proline residues (e.g., 2, 3, 4 or more).
  • the linker comprises at least one proline residue and at least one basic residue (e.g., Arg, His or Lys). In other embodiments, where the linker comprises at least two basic residue (e.g., Arg, His or Lys). In certain embodiments, the linker is one shown in any of Tables 4, 5, 6, 9, 10, 1 1 or 13.
  • fusion polypeptides comprising a linker as described herein are provided.
  • polynucleotides encoding any of the linkers or fusion proteins as described herein are provided.
  • cells comprising any of the polypeptides (e.g., fusion polypeptides) and/or polynucleotides as described herein are also provided.
  • polypeptides e.g., fusion polypeptides
  • polynucleotides as described herein are also provided.
  • organisms e.g. mammals, fungi and plants
  • polypeptides e.g. fusion polypeptides
  • polynucleotides as described herein are also provided.
  • a fusion protein can be expressed in a cell, e.g., by delivering the fusion protein to the cell or by delivering a polynucleotide encoding the fusion protein to a cell. If the polynucleotide is DNA, it is then transcribed and translated to generate the fusion protein. If delivered as an RNA molecule, it is then immediately translated, thus generating the fusion protein. Methods for polynucleotide and polypeptide delivery to cells are presented elsewhere in this disclosure.
  • Figure 1 A shows the amino acid sequence of each host ZFP (F1-F4 of ZFP 8196 shown in SEQ ID NO: 130; SEQ ID NO: 131 ; SEQ ID NO: 129; SEQ ID NO: 129; SEQ ID NO: 129; SEQ ID NO: 129; SEQ ID NO: 129; SEQ ID NO: 129; SEQ ID NO: 129; SEQ ID NO: 129; SEQ ID NO: 129; SEQ ID NO: 131 ;
  • FIG 2A shows the phage pool selected from the ZFP8196 library using a target with a lbp inserted base (ATAAACTGdCAAAAGGC (SEQ ID NO:33) (Table 2A)) that was tested for binding to each ZFP8196 target in Table 2C.
  • Figure 2B shows the phage pool selected from the ZFP7263 library using a target with a lbp inserted base
  • FIG. 2C shows the phage pool selected from the ZFP7264 library using a target with a lbp inserted base
  • FIG. 2D shows the phage pool selected from the ZFP8196 library using a target with a 2bp inserted base
  • Figure 3 panels A and B show linkers selected for target sites containing the indicated gap.
  • Figure 3 A shows linker sequences selected for skipping a 1 bp gap in the context of ZFP8196, ZFP7263, and ZFP7264 (SEQ ID NOs: 142 to 166).
  • Figure 3B shows linker sequences (SEQ ID NOs:167 to 174) for skipping a 2 bp gap in the context of ZFP8196.
  • Selected linkers are enriched for proline and arginine (shaded). Length preferences are also apparent and depend on the number of skipped bases.
  • FIG 4 panels A through E are graphs depicting gap selectivity for linkers selected to skip 1 basepair in the zinc finger protein designated ZFP8196.
  • ELISA scores were normalized to the parent, non-skipping linker on its non-gapped target site.
  • Gap sequence refers to the identity of the base(s) between the module subsites where (-) indicates the nongapped target.
  • Figures 4A-4C depict results from three of the 1 bp gap skipping linkers, (linkers referred to as If (SEQ ID NO:54), Id (SEQ ID NO:56) and lc (SEQ ID NO:55)).
  • Figure 4D shows results with a standard flexible linker that has previously been shown to enable modification of an endogenous locus in human cells (TGGGGSQKP, SEQ ID NO:2) (See Hockemeyer et al. (2009) Nature Biotechnology 27:851-857) and Figure 4E depicts the results for a previously published flexible linker (LRQKDERP, SEQ ID NO:3) (See Kim JS & Pabo CO (1998) Proc Natl Acad Sci USA 95(6):2812-2817).
  • the selected linkers lc, Id and If ( Figures 4A-4C) all show clear preferences for the four target sites with a single base pair gap whereas the control linkers in Figures 4D and 4E show less effective overall binding and little gap selectivity.
  • Figure 5 panels A through D are graphs depicting gap selectivity for linkers selected to skip 1 base pair in ZFP7264.
  • Figures 5 A to 5C depict the results from an ELISA testing of the le linker (SEQ ID NO: 12) in the ZFP7264 background.
  • Figure 5 A shows the results for the le linker, selected to skip a 1 bp gap between the module subsites.
  • Figure 5B shows the results for a standard flexible linker
  • FIG. 5B shows the results for a the flexible linker LRQKDERP (SEQ ID NO:3).
  • ELISA scores are normalized to the parent, nonskipping ZFP7264 on its non-gapped target.
  • "Gap sequence” is the identity of the skipped base(s) between the module subsites where (-) indicates the nongapped target.
  • Figure 5D shows an expanded version of the data from Figure 5B where the ELISA score range is 0-0.6 as compared to 0-5 in the other panels.
  • Figure 6, panels A through F are graphs depicting gap selectivity for the linkers selected to skip 2bp in ZFP8196.
  • Figures 6 A to 6E depict the results from an ELISA testing the linkers selected to skip a 2 bp gap between the module subsites in the ZFP8196 background.
  • Figures 6A through 6C show the results for the selected linkers 2f (SEQ ID NO:69), 2d (SEQ ID NO:70) and 2e (SEQ ID NO:71), whereas Figures 6D shows the results for a previously published flexible linker
  • Figure 6E shows the results for a standard flexible linker (TGGGGSGGSQKP (SEQ ID NO: 14)).
  • Figure 6F shows an expanded version of the data shown in Figure 6E where the ELISA score range is 0- 0.1 as compared to 0-1 in the other panels.
  • "Gap sequence" is the identity of the base(s) between the module subsites where (-) indicates the nongapped target.
  • the selected linkers ( Figures 6A-6C) demonstrate a clear preference for a 2 bp gap as compared to a 1 bp gap or no gap whereas the control linkers in Figures 6D and 6E show less effective overall binding and little gap selectivity.
  • FIG 7, panels A and B depict a summary of ELISA data from a study designed to analyze the portability of the 1 bp skipping linkers to different ZFP backgrounds. Twelve different ZFPs were tested (indicated as ZFP1, ZFP2 etc.).
  • Figure 7 A shows ELISA scores normalized to standard positive control ZFPs that have been shown to efficiently modify an endogenous IL2Ry locus when used as ZFNs (Umov et al. (2005) Nature 435(7042):646-651).
  • Figure 7B shows all scores further normalized to each parent ZFP bearing the standard flexible linker
  • FIG 8 panels A and B, depict a summary of ELISA data from a study designed to analyze the portability of the 2 bp skipping linkers to different ZFP backgrounds. Six different ZFPs were tested (indicated as ZFP13, ZFP14 etc.).
  • Figure 8A shows ELISA scores normalized to standard positive control ZFPs that have been shown to efficiently modify an endogenous IL2Ry locus when used as ZFNs (Urnov et al. (2005) Nature 435(7042):646-651).
  • Figure 8B shows all scores further normalized to each parent ZFP bearing the standard flexible linker
  • linkers 2f (SEQ ID NO:69), 2d (SEQ ID NO:70) and 2e (SEQ ID NO:71) led to a general increase in ELISA score of 1.9-2.4 fold over the flexible linker.
  • Figure 9, panels A and B depict results of endogenous gene modification studies, as determined by CEL-I assays, with ZFNs containing selected linkers.
  • Figures 9A and 9B depict example gels used to determine ZFN nuclease activity at endogenous loci by the CEL-I assay (measuring non-homologous end joining (NHEJ) activity, SurveyorTM, Transkaryotic) to determine if linkers as described herein can be used in the context of different ZFNs.
  • NHEJ non-homologous end joining
  • the gel shown in Figure 9A depicts the results from the le (SEQ ID NO: 12), If (SEQ ID NO:54), Id (SEQ ID NO:56), and lc (SEQ ID NO:55) linkers in the ZFN3 and ZFN4
  • the gel shown in Figure 9B depicts the results from the 2f, 2d and 2e linkers in the ZFN14 background. Percent gene modification by NHEJ, "Gene mod. (%)", is indicated at the bottom of the lanes.
  • the negative control, "neg” is a sample transfected with a GFP bearing plasmid.
  • the results from the ZFNs using a standard flexible linker (TGGGGSQKP (SEQ ID NO:2) for Figure 9A and TGGGGSGGSQKP (SEQ ID NO: 14) for Figure 9B) are shown in the lanes labeled "C". Unlabeled lanes contain samples of ZFNs bearing other linkers that were not further developed in these studies.
  • the data in the gels demonstrates that the linkers as described herein significantly increase levels of gene modification as compared to the flexible linkers.
  • Figure 10 panels A and B depict a summary of gene modification studies for ZFNs as described above for Figure 9 containing the indicated linkers selected to skip lbp.
  • Figure 10A is the quantitation of the percent gene modification for each ZFN with the set of five linkers tested (flexible, le (SEQ ID NO: 12), If (SEQ ID NO:54), Id (SEQ ID NO:56), and lc (SEQ ID NO:55)).
  • Figure 10B shows this same data normalized to the flexible linker (TGGGGSQKP, SEQ ID NO:2) and also shows the average increase in gene modification across all the active ZFN pairs. Samples produced using high expression conditions (see Example 3) are highlighted in grey.
  • ZFNs bearing exemplary linkers that improved the level of gene modification by >2-fold are underlined in Figure 10B.
  • ZFNs bearing linkers le SEQ ID NO: 12
  • If SEQ ID NO:54
  • Id SEQ ID NO:56
  • lc SEQ ID NO:55
  • FIG 11, panels A and B depict a summary of gene modification studies as described for Figure 9, for ZFNs containing the indicated linkers selected to skip a 2 bp gap between the module subsites of the 6 host ZFNs.
  • Figure 1 1 A is the quantitation of the percent of gene modification for each ZFN with the set of four linkers tested (flexible, 2f (SEQ ID NO:69), 2d (SEQ ID NO:70) and 2e (SEQ ID NO:71)).
  • Figure 1 IB shows this same data normalized to the flexible linker
  • Figure 12 shows the amino acid sequence of the host ZFP8196 used for the secondary selection for linkers spanning a 2-bp gap. Amino acids are designated by single letter code. The sequence is listed in the amino terminal -> carboxy terminal direction, so that the amino terminus of the protein is the first methionine of finger 1, and the carboxy terminus is the final serine of finger 4.
  • "Fl” SEQ ID NO: 130
  • "F2” SEQ ID NO: 131
  • F3 SEQ ID NO: 132
  • F4 SEQ ID NO: 133
  • the linker library was generated by replacing codons for two residues in the central linker with a mixture of five to seven fully randomized codons, followed by one codon randomized to obtain either phenylalanine (F), lysine (L), or tyrosine (Y) residues, and the final three codons were fixed to be arginine (R), proline (P), and proline (P).
  • Library codons are denoted by (NNS) 5-7 and (F/L/Y).
  • FIG 13 A shows the phage pool selected from the ZFP8196 library using a target with a 2bp inserted gap ( ATAAACTGdbC AA AAGGC (SEQ ID NO:34) (Table 2A)) tested for binding to each ZFP8196 target in Table 2C.
  • Each test also included a control target for one other host ZFP to rule out nonspecific binding to DNA as well as a negative control sample which did not include a target site.
  • the % of phage which successfully bound each target is indicated.
  • the phage pool was from the sixth round of selection.
  • compositions for linking DNA-binding domains, particularly zinc-finger modules, to other zinc-finger modules are compositions for linking DNA-binding domains, particularly zinc-finger modules, to other zinc-finger modules.
  • the linkers described herein allow preferential and/or selective binding of targets bearing gaps between module subsites of 1 or 2 bp.
  • the linkers are also capable of binding targets bearing 1, or 2 bp gaps at higher affinities than current linker designs.
  • Exemplary linkers are shown in Tables 11 and 13.
  • certain linkers described herein significantly increase the ability to design zinc-finger proteins which bind to specific target sites, thereby increasing the activity of fusion proteins
  • compositions disclosed herein employ, unless otherwise indicated, conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA and related fields as are within the skill of the art. These techniques are fully explained in the literature. See, for example, Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL,
  • nucleic acid refers to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form.
  • polynucleotide refers to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form.
  • these terms are not to be construed as limiting with respect to the length of a polymer.
  • the terms can encompass known analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties (e.g., phosphorothioate backbones).
  • an analogue of a particular nucleotide has the same base-pairing specificity; i.e., an analogue of A will base-pair with T.
  • polypeptide peptide
  • protein protein
  • amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of a corresponding naturally-occurring amino acids.
  • a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.
  • “conservatively modified variations” of a particular amino acid sequence refers to amino acid substitutions of those amino acids that are not critical for protein activity or substitution of amino acids with other amino acids having similar properties (e.g., acidic, basic, positively or negatively charged, polar or non-polar, etc.) such that the substitutions of even critical amino acids do not substantially alter activity.
  • Conservative substitution tables providing functionally similar amino acids are well known in the art. See, e.g., Creighton (1984) Proteins, W. H. Freeman and Company.
  • individual substitutions, deletions or additions which alter, add or delete a single amino acid or a small percentage of amino acids in an encoded sequence are also “conservatively modified variations.”
  • Binding refers to a sequence-specific, non-covalent interaction
  • macromolecules e.g., between a protein and a nucleic acid.
  • components of a binding interaction need be sequence-specific (e.g., contacts with phosphate groups in a DNA backbone), as long as the interaction as a whole is
  • a "binding protein” is a protein that is able to bind non-covalently to another molecule.
  • a binding protein can bind to, for example, a DNA molecule (a DNA- binding protein), an RNA molecule (an RNA-binding protein) and/or a protein molecule (a protein-binding protein).
  • a protein-binding protein it can bind to itself (to form homodimers, homotrimers, etc.) and/or it can bind to one or more molecules of a different protein or proteins.
  • a binding protein can have more than one type of binding activity. For example, zinc finger proteins have DNA-binding, RNA-binding and protein- binding activity.
  • a "zinc finger DNA binding protein” (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion.
  • the term zinc finger DNA binding protein is often abbreviated as zinc finger protein or ZFP.
  • Zinc finger binding domains e.g., recognition regions of zinc fingers
  • Zinc finger binding domains can be "engineered” to bind to a predetermined nucleotide sequence.
  • methods for engineering zinc finger proteins are design and selection.
  • a designed zinc finger protein is a protein not occurring in nature whose
  • Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. See, for example, US Patents 6,140,081 ; 6,453,242; and 6,534,261 ;
  • a "selected" zinc finger protein is a protein not found in nature whose production results primarily from an empirical process such as phage display, interaction trap or hybrid selection. See e.g., US 5,789,538; US 5,925,523; US 6,007,988;
  • a “regulatory domain” or “functional domain” refers to a protein or a protein domain that has transcriptional modulation activity when tethered to a DNA binding domain, i.e., a ZFP.
  • a regulatory domain is covalently or non- covalently linked to a ZFP (e.g., to form a fusion molecule) to effect transcription modulation.
  • Regulatory domains can be activation domains or repression domains.
  • Activation domains include, but are not limited to, VP 16, VP64 and the p65 subunit of nuclear factor Kappa-B.
  • Repression domains include, but are not limited to, KOX, KRAB MBD2B and v-ErbA.
  • Additional regulatory domains include, e.g., transcription factors and co-factors (e.g., MAD, ERD, SID, early growth response factor 1, and nuclear hormone receptors), endonucleases, integrases, recombinases, methyltransferases, histone acetyltransferases, histone deacetylases etc.
  • Activators and repressors include co-activators and co-repressors (see, e.g., Utley et al., Nature 394:498-502 (1998)).
  • a ZFP can act alone, without a regulatory domain, to effect transcription modulation.
  • Regulatory domains also can be nucleases, such as cleavage domains or cleavage half-domains.
  • Cleavage refers to the breakage of the covalent backbone of a DNA molecule. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. DNA cleavage can result in the production of either blunt ends or staggered ends. In certain
  • fusion polypeptides are used for targeted double-stranded DNA
  • a "cleavage half-domain” is a polypeptide sequence which, in
  • first and second cleavage half-domains; "+ and - cleavage half-domains” and “right and left cleavage half-domains” are used interchangeably to refer to pairs of cleavage half- domains that dimerize.
  • An "engineered cleavage half-domain” is a cleavage half-domain that has been modified so as to form obligate heterodimers with another cleavage half- domain (e.g., another engineered cleavage half-domain). See, also, U.S. Patent
  • Chromatin is the nucleoprotein structure comprising the cellular genome.
  • Cellular chromatin comprises nucleic acid, primarily DNA, and protein, including histones and non-histone chromosomal proteins. The majority of
  • eukaryotic cellular chromatin exists in the form of nucleosomes, wherein a
  • nucleosome core comprises approximately 150 base pairs of DNA associated with an octamer comprising two each of histones H2A, H2B, H3 and H4; and linker DNA (of variable length depending on the organism) extends between nucleosome cores.
  • a molecule of histone HI is generally associated with the linker DNA.
  • chromatin is meant to encompass all types of cellular nucleoprotein, both prokaryotic and eukaryotic. Cellular chromatin includes both chromosomal and episomal chromatin.
  • a "chromosome,” is a chromatin complex comprising all or a portion of the genome of a cell.
  • the genome of a cell is often characterized by its karyotype, which is the collection of all the chromosomes that comprise the genome of the cell.
  • the genome of a cell can comprise one or more chromosomes.
  • An "episome” is a replicating nucleic acid, nucleoprotein complex or other structure comprising a nucleic acid that is not part of the chromosomal karyotype of a cell.
  • Examples of episomes include plasmids and certain viral genomes.
  • An "accessible region” is a site in cellular chromatin in which a target site present in the nucleic acid can be bound by an exogenous molecule which recognizes the target site. Without wishing to be bound by any particular theory, it is believed that an accessible region is one that is not packaged into a nucleosomal structure. The distinct structure of an accessible region can often be detected by its sensitivity to chemical and enzymatic probes, for example, nucleases.
  • a "target site” or “target sequence” is a nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule will bind, provided sufficient conditions for binding exist.
  • the sequence 5'-GAATTC-3 ' is a target site for the Eco RI restriction endonuclease.
  • a “module subsite” is a nucleic acid sequence that defines a portion of a nucleic acid to which a zinc-finger module (e.g. 1, 2, 3 or more zinc fingers) within a larger zinc-finger DNA binding protein will bind, provided sufficient conditions for binding exist.
  • a zinc-finger module e.g. 1, 2, 3 or more zinc fingers
  • exogenous molecule is a molecule that is not normally present in a cell, but can be introduced into a cell by one or more genetic, biochemical or other methods. "Normal presence in the cell" is determined with respect to the particular developmental stage and environmental conditions of the cell. Thus, for example, a molecule that is present only during embryonic development of muscle is an exogenous molecule with respect to an adult muscle cell. Similarly, a molecule induced by heat shock is an exogenous molecule with respect to a non-heat-shocked cell.
  • An exogenous molecule can comprise, for example, a functioning version of a malfunctioning endogenous molecule, a malfunctioning version of a normally- functioning endogenous molecule or an ortholog (functioning version of endogenous molecule from a different species).
  • An exogenous molecule can be, among other things, a small molecule, such as is generated by a combinatorial chemistry process, or a macromolecule such as a protein, nucleic acid, carbohydrate, lipid, glycoprotein, lipoprotein, polysaccharide, any modified derivative of the above molecules, or any complex comprising one or more of the above molecules.
  • Nucleic acids include DNA and RNA, can be single- or double-stranded; can be linear, branched or circular; and can be of any length. Nucleic acids include those capable of forming duplexes, as well as triplex-forming nucleic acids. See, for example, U.S. Patent Nos. 5,176,996 and 5,422,251.
  • Proteins include, but are not limited to, DNA-binding proteins, transcription factors, chromatin remodeling factors, methylated DNA binding proteins, polymerases, methylases, demethylases, acetylases, deacetylases, kinases, phosphatases, integrases, recombinases, ligases, topoisomerases, gyrases and helicases.
  • an exogenous molecule can be the same type of molecule as an endogenous molecule, e.g., an exogenous protein or nucleic acid.
  • an exogenous nucleic acid can comprise an infecting viral genome, a plasmid or episome introduced into a cell, or a chromosome that is not normally present in the cell.
  • lipid-mediated transfer i.e., liposomes, including neutral and cationic lipids
  • electroporation direct injection
  • cell fusion cell fusion
  • particle bombardment particle bombardment
  • calcium phosphate co-precipitation DEAE-dextran- mediated transfer
  • viral vector-mediated transfer i.e., viral vector-mediated transfer.
  • an "endogenous" molecule is one that is normally present in a particular cell at a particular developmental stage under particular environmental conditions.
  • an endogenous nucleic acid can comprise a chromosome, the genome of a mitochondrion, chloroplast or other organelle, or a naturally- occurring episomal nucleic acid.
  • Additional endogenous molecules can include proteins, for example, transcription factors and enzymes.
  • a "fusion" molecule is a molecule in which two or more subunit molecules are linked, preferably covalently.
  • the subunit molecules can be the same chemical type of molecule, or can be different chemical types of molecules.
  • Examples of the first type of fusion molecule include, but are not limited to, fusion proteins (for example, a fusion between a . ZFP DNA-binding domain and a cleavage domain) and fusion nucleic acids (for example, a nucleic acid encoding the fusion protein described supra).
  • Examples of the second type of fusion molecule include, but are not limited to, a fusion between a triplex-forming nucleic acid and a polypeptide, and a fusion between a minor groove binder and a nucleic acid.
  • Fusion protein in a cell can result from delivery of the fusion protein to the cell or by delivery of a polynucleotide encoding the fusion protein to a cell, wherein the polynucleotide is transcribed, and the transcript is translated, to generate the fusion protein.
  • Trans-splicing, polypeptide cleavage and polypeptide ligation can also be involved in expression of a protein in a cell. Methods for polynucleotide and polypeptide delivery to cells are presented elsewhere in this disclosure.
  • Gene expression refers to the conversion of the information, contained in a gene, into a gene product.
  • a gene product can be the direct
  • Gene products also include RNAs which are modified, by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristilation, and glycosylation.
  • Modulation of gene expression refers to a change in the activity of a gene. Modulation of expression can include, but is not limited to, gene activation and gene repression. Gene inactivation refers to any reduction in gene expression as compared to a cell that does not include a ZFP as described herein. Thus, gene inactivation may be partial or complete.
  • Eukaryotic cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells and human cells (e.g., T-cells).
  • a "region of interest” is any region of cellular chromatin, such as, for example, a gene or a non-coding sequence within or adjacent to a gene, in which it is desirable to bind an exogenous molecule. Binding can be for the purposes of targeted DNA cleavage and/or targeted recombination.
  • a region of interest can be present in a chromosome, an episome, an organellar genome ⁇ e.g., mitochondrial, chloroplast), or an infecting viral genome, for example.
  • a region of interest can be within the coding region of a gene, within transcribed non-coding regions such as, for example, leader sequences, trailer sequences or introns, or within non-transcribed regions, either upstream or downstream of the coding region.
  • a region of interest can be as small as a single nucleotide pair or up to 20,000 nucleotide pairs in length, or any integral value of nucleotide pairs, or up to the length of a chromosome.
  • a region is interest does not need to comprise only contiguous nucleic acid sequences.
  • operative linkage and "operatively linked” (or “operably linked”) are used interchangeably with reference to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components.
  • a transcriptional regulatory sequence such as a promoter
  • a transcriptional regulatory sequence is operatively linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors.
  • transcriptional regulatory sequence is generally operatively linked in cis with a coding sequence, but need not be directly adjacent to it.
  • an enhancer is a transcriptional regulatory sequence that is operatively linked to a coding sequence, even though they are not contiguous.
  • the term "operatively linked" can refer to the fact that each of the components performs the same function in linkage to the other component as it would if it were not so linked.
  • the ZFP DNA-binding domain and the cleavage domain are in operative linkage if, in the fusion polypeptide, the ZFP DNA-binding domain portion is able to bind its target site and/or its binding site, while the cleavage domain is able to cleave DNA in the vicinity of the target site.
  • a "functional fragment" of a protein, polypeptide or nucleic acid is a protein, polypeptide or nucleic acid whose sequence is not identical to the full-length protein, polypeptide or nucleic acid, yet retains one of more of the functions of the full-length protein, polypeptide or nucleic acid.
  • a functional fragment can possess more, fewer, or the same number of residues as the corresponding native molecule, and/or can contain one ore more amino acid or nucleotide substitutions.
  • DNA-binding function of a polypeptide can be determined, for example, by filter-binding, electrophoretic mobility-shift, or immunoprecipitation assays. DNA cleavage can be assayed by gel electrophoresis. See Ausubel et al, supra.
  • the ability of a protein to interact with another protein can be determined, for example, by co-immunoprecipitation, two- hybrid assays or complementation, both genetic and biochemical. See, for example, Fields et al (1989) Nature 340:245-246; U.S. Patent No. 5,585,245 and PCT WO 98/44350.
  • Described herein are amino acid sequences that fuse (link) DNA- binding modules (e.g. , zinc-finger modules) to each other.
  • the zinc-finger modules fused using the linkers described herein may contain 1, 2, 3, 4 or even more zinc fingers.
  • the zinc-finger modules contain 1, 2, or 3 zinc fingers, which when linked together form a 3 or more finger zinc-finger protein.
  • the linker sequences described herein extend between the last residue of the a-helix in a zinc finger and the first residue of the ⁇ -sheet in the next zinc finger .
  • the linker sequence therefore joins together two zinc fingers.
  • the last (C- terminal) amino acid in a zinc finger is the C-terminal zinc-coordinating residue
  • an aromatic residue e.g., Phe
  • threonine is the first residue in the linker
  • proline is the last residue of the linker.
  • the canonical linker sequence for Zif268 is TG(E/Q)(K/R)P (SEQ ID NO: 129). See, e.g., U.S. Patent Nos. 6,479,626; 6,903,185 and 7,153,949.
  • the linkers are made using recombinant nucleic acids encoding the linker and the nucleic acid binding modules, which are fused via the linker amino acid sequence.
  • the linkers may also be made using peptide synthesis and then linked to the nucleic acid binding modules.
  • linkers described herein are more rigid than the linkers previously used, and allow efficient binding of each zinc finger module to its target site only when subsites are separated by a specific number of base pairs.
  • the linkers described herein include at least one internal or N-terminal proline residue, namely a proline residue not at the C- terminal of the linker.
  • the linkers described herein have the following general amino acid structure:
  • X is any amino acid residue
  • X n comprises at least 3 amino acid residues and at least one of x N"term and X n comprises a proline residue.
  • Non-limiting examples of such linkers are shown in Tables 4, 5, 6, 9, 10, 11 or 13.
  • the linkers described herein also typically include at least two basic residues, for example one or more arginine residues, one or more histidine residues, one or more lysine residues or combinations thereof.
  • the linkers of the invention can be any length, typically 5 or more amino acids in length. In certain embodiments, the linkers are 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or even more amino acids length.
  • the DNA binding domain comprises a zinc-finger protein.
  • the zinc- finger protein is non-naturally occurring in that it is engineered to bind to a target site of choice. See, for example, Beerli et al. (2002) Nature Biotechnol. 20: 135-141 ; Pabo et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan et al. (2001) Nature Biotechnol. 19:656-660; Segal et al. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo et al. (2000) Curr.
  • An engineered zinc-finger binding domain can have a novel binding specificity, compared to a naturally-occurring zinc-finger protein.
  • Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using databases comprising triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, for example, co-owned U.S. Patents 6,453,242 and 6,534,261, incorporated by reference herein in their entireties.
  • Exemplary selection methods including phage display and two-hybrid systems, are disclosed in US Patents 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; as well as WO 98/37186;
  • zinc-finger domains and/or multi-finger zinc-finger proteins may be linked together using any suitable linker sequences, including for example, linkers of 5 or more amino acids in length. See, also, U.S. Patent Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary linker sequences 6 or more amino acids in length.
  • the proteins described herein may include any combination of suitable linkers between the individual zinc fingers of the protein.
  • the DNA-binding domain may be derived from a nuclease.
  • the recognition sequences of homing endonucleases and meganucleases such as ⁇ -Scel, ⁇ -Ceul, Pl-Pspl, PI-Sce, I-ScelV, l-Csml, l-Panl, I- Scell, l-Ppol, I-SceIII, I-Oel, I-73 ⁇ 4vI, I-7evII and I-TevIII are known. See also U.S. Patent No. 5,420,032; U.S. Patent No. 6,833,252; Belfort et al. (1997) Nucleic Acids Res.
  • Patent Publication No. 20070117128 is a Patent Publication No. 20070117128.
  • the DNA binding domain is an engineered domain from a TAL effector (TALE) derived from the plant pathogen Xanthomonas (see, Miller et al. (2010) Nature Biotechnology, Dec 22 [Epub ahead of print]; Boch et al, (2009) Science 29 Oct 2009 (10.1126/science.l 17881) and Moscou and
  • TALE TAL effector
  • Zinc-finger modules linked as described herein are often expressed with an exogenous domain (or functional fragment thereof) as fusion proteins.
  • Common regulatory domains for addition to the ZFP include, e.g., transcription factor domains (activators, repressors, co-activators, co-repressors), silencers, oncogenes (e.g., myc, jun, fos, myb, max, mad, rel, ets, bcl, myb, mos family members etc.); DNA repair enzymes and their associated factors and modifiers; DNA rearrangement enzymes and their associated factors and modifiers; chromatin associated proteins and their modifiers (e.g.
  • kinases e.g., methyltransferases, topoisomerases, helicases, ligases, kinases, phosphatases, polymerases, endonucleases
  • DNA modifying enzymes e.g., methyltransferases, topoisomerases, helicases, ligases, kinases, phosphatases, polymerases, endonucleases
  • An exemplary functional domain for fusing with a DNA-binding domain such as, for example, a ZFP, to be used for repressing expression of a gene is a KRAB repression domain from the human KOX-1 protein (see, e.g., Thiesen et al, New Biologist 2, 363-374 (1990); Margolin et al, Proc. Natl. Acad. Sci. USA 91, 4509-4513 (1994); Pengue et al, Nucl. Acids Res. 22:2908-2914 (1994); Witzgall et al, Proc. Natl. Acad. Sci. USA 91, 4514-4518 (1994).
  • MBD-2B methyl binding domain protein 2B
  • Another useful repression domain is that associated with the v-ErbA protein. See, for example, Damm, et al. (1989) Nature 339:593-597; Evans (1989) Int. J. Cancer Suppl. 4:26-28; Pain et al. (1990) New Biol. 2:284-294; Sap et al. (1989) Nature 340:242-244; Zenke et al. (1988) Cell 52:107-119; and Zenke et al. (1990) Cell 61:1035-1049.
  • MBD-2B methyl binding domain protein 2B
  • Additional exemplary repression domains include, but are not limited to, KRAB (also referred to as "KOX"), SID, MBD2, MBD3, members of the DNMT family (e.g., DNMT1, DNMT3A, DNMT3B), Rb, and MeCP2. See, for example, Bird et al. (1999) Cell 99:451-454; Tyler et al. (1999) Cell 99:443-446; Knoepfler et al. (1999) Cell 99:447-450; and Robertson et al. (2000) Nature Genet. 25:338-342.
  • Additional exemplary repression domains include, but are not limited to, ROM2 and AtHD2A. See, for example, Chem et al. (1996) Plant Cell 8:305-321; and Wu et al. (2000) Plant J. 22:19-27.
  • Suitable domains for achieving activation include the HSV VP 16 activation domain (see, e.g., Hagmann et al., J. Virol. 71, 5952-5962 (1997)) nuclear hormone receptors (see, e.g., Torchia et al., Curr. Opin. Cell. Biol. 10:373-383 (1998)); the p65 subunit of nuclear factor kappa B (Bitko and Barik, J. Virol.
  • VP64 Seifpal et al., EMBO J. 11, 4961-4968 (1992)
  • Additional exemplary activation domains include, but are not limited to, VP 16, VP64, p300, CBP, PCAF, SRC1 PvALF, AtHD2A and ERF-2. See, for example, Robyr et al. (2000) Mol.
  • Additional exemplary activation domains include, but are not limited to, OsGAI, HALF-1, CI, API, ARF-5,-6,-7, and -8, CPRFl, CPRF4, MYC- RP/GP, and TRAB 1. See, for example, Ogawa et al. (2000) Gene 245 :21 -29;
  • the regulatory domain comprises a nuclease
  • Such engineered nucleases can be used to create a double- strand break (DSB) in a target nucleotide sequence, which increases the frequency of donor nucleic acid introduction via homologous recombination at the targeted locus (targeted integration) more than 1000-fold.
  • DSB double- strand break
  • NHEJ non-homologous end joining
  • Nucleases can be used for a wide variety of purposes such as for cell line engineering as well as for therapeutic applications.
  • Cleavage domains of the fusion proteins disclosed herein can be obtained from any endonuclease or exonuclease.
  • Exemplary endonucleases from which a cleavage domain can be derived include, but are not limited to, restriction endonucleases and homing endonucleases. See, for example, 2002-2003 Catalogue, New England Biolabs, Beverly, MA; and Belfort et al. (1997) Nucleic Acids Res.
  • Additional enzymes which cleave DNA are known (e.g., SI Nuclease; mung bean nuclease; pancreatic DNase I; micrococcal nuclease; yeast HO endonuclease; see also Linn et al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993).
  • SI Nuclease mung bean nuclease
  • pancreatic DNase I micrococcal nuclease
  • yeast HO endonuclease see also Linn et al. (eds.) Nucleases, Cold Spring Harbor Laboratory Press, 1993.
  • One or more of these enzymes (or functional fragments thereof) can be used as a source of cleavage domains and cleavage half-domains.
  • a cleavage half-domain can be derived from any nuclease or portion thereof, as set forth above, that requires dimerization for cleavage activity.
  • two fusion proteins are required for cleavage if the fusion proteins comprise cleavage half-domains.
  • a single protein comprising two cleavage half- domains can be used.
  • the two cleavage half-domains can be derived from the same endonuclease (or functional fragments thereof), or each cleavage half-domain can be derived from a different endonuclease (or functional fragments thereof).
  • the target sites for the two fusion proteins are preferably disposed, with respect to each other, such that binding of the two fusion proteins to their respective target sites places the cleavage half-domains in a spatial orientation to each other that allows the cleavage half-domains to form a functional cleavage domain, e.g., by dimerizing.
  • the near edges of the target sites are separated by 5-8 nucleotides or by 15-18 nucleotides.
  • any integral number of nucleotides or nucleotide pairs can intervene between two target sites (e.g., from 2 to 50 nucleotide pairs or more).
  • the site of cleavage lies between the target sites.
  • Restriction endonucleases are present in many species and are capable of sequence-specific binding to DNA (at a recognition site), and cleaving DNA at or near the site of binding.
  • Certain restriction enzymes e.g., Type IIS
  • Fok I catalyzes double-stranded cleavage of DNA, at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other. See, for example, US Patents 5,356,802; 5,436,150 and 5,487,994; as well as Li et al.
  • fusion proteins comprise the cleavage domain (or cleavage half-domain) from at least one Type IIS restriction enzyme and one or more zinc finger binding domains, which may or may not be engineered.
  • An exemplary Type IIS restriction enzyme whose cleavage domain is separable from the binding domain, is Fok I. This particular enzyme is active as a dimer. Bitinaite et al. (1998) Proc. Natl. Acad. Sci. USA 95: 10,570-10,575.
  • the portion of the Fok I enzyme used in the disclosed fusion proteins is considered a cleavage half-domain.
  • two fusion proteins each comprising a Fokl cleavage half-domain, can be used to reconstitute a catalytically active cleavage domain.
  • a single polypeptide molecule containing a zinc finger binding domain and two Fok I cleavage half-domains can also be used. Parameters for targeted cleavage and targeted sequence alteration using zinc fmger-Fok I fusions are provided elsewhere in this disclosure.
  • a cleavage domain or cleavage half-domain can be any portion of a protein that retains cleavage activity, or that retains the ability to multimerize (e.g., dimerize) to form a functional cleavage domain.
  • the cleavage domain comprises one or more engineered cleavage half-domain (also referred to as dimerization domain mutants) that minimize or prevent homodimerization, as described, for example, in U.S. Patent Publication Nos. 20050064474 and 20060188987 and in U.S. Application No.
  • Exemplary engineered cleavage half-domains of Fok I that form obligate heterodimers include a pair in which a first cleavage half-domain includes mutations at amino acid residues at positions 490 and 538 of Fok I and a second cleavage half-domain includes mutations at amino acid residues 486 and 499.
  • a mutation at 490 replaces Glu (E) with Lys
  • the engineered cleavage half-domains described herein were prepared by mutating positions 490 (E ⁇ K) and 538 (I ⁇ K) in one cleavage half-domain to produce an engineered cleavage half-domain designated "E490K:I538K” and by mutating positions 486 (Q ⁇ E) and 499 (I ⁇ L) in another cleavage half-domain to produce an engineered cleavage half-domain designated "Q486E:I499L".
  • the engineered cleavage half-domains described herein are obligate heterodimer mutants in which aberrant cleavage is minimized or abolished. See, e.g., Example 1 of WO 07/139898.
  • the engineered cleavage half-domain comprises mutations at positions 486, 499 and 496 (numbered relative to wild-type FokT), for instance mutations that replace the wild type Gin (Q) residue at position 486 with a Glu (E) residue, the wild type Iso (I) residue at position 499 with a Leu (L) residue and the wild-type Asn (N) residue at position 496 with an Asp (D) or Glu (E) residue (also referred to as a "ELD” and "ELE" domains, respectively).
  • mutations at positions 486, 499 and 496 numbered relative to wild-type FokT
  • the engineered cleavage half-domain comprises mutations at positions 490, 538 and 537 (numbered relative to wild-type FokT), for instance mutations that replace the wild type Glu (E) residue at position 490 with a Lys (K) residue, the wild type Iso (I) residue at position 538 with a Lys (K) residue, and the wild-type His (H) residue at position 537 with a Lys (K) residue or a Arg (R) residue (also referred to as "KKK” and "KKR” domains, respectively).
  • the engineered cleavage half-domain comprises mutations at positions 490 and 537 (numbered relative to wild-type FokT), for instance mutations that replace the wild type Glu (E) residue at position 490 with a Lys (K) residue and the wild-type His (H) residue at position 537 with a Lys (K) residue or a Arg (R) residue (also referred to as "KIK” and "KIR” domains, respectively).
  • E wild type Glu
  • H His
  • R Arg
  • Engineered cleavage half-domains described herein can be prepared using any suitable method, for example, by site-directed mutagenesis of wild-type cleavage half-domains (Fok I) as described in U.S. Patent Publication No.
  • nucleases may be assembled in vivo at the nucleic acid target site using so-called "split-enzyme” technology (see e.g. U.S. Patent Publication No. 20090068164).
  • split-enzyme e.g. U.S. Patent Publication No. 20090068164.
  • Components of such split enzymes may be expressed either on separate expression constructs, or can be linked in one open reading frame where the individual components are separated, for example, by a self-cleaving 2A peptide or IRES sequence.
  • Components may be individual zinc finger binding domains or domains of a meganuclease nucleic acid binding domain.
  • Fusion molecules are constructed by methods of cloning and biochemical conjugation that are well known to those of skill in the art. Fusion molecules comprise a DNA-binding domain and a functional domain (e.g., a transcriptional activation or repression domain). Fusion molecules also optionally comprise nuclear localization signals (such as, for example, that from the SV40 medium T-antigen) and epitope tags (such as, for example, FLAG and
  • Fusion proteins are designed such that the translational reading frame is preserved among the components of the fusion.
  • the fusion molecule is typically formulated with a pharmaceutically acceptable carrier, as is known to those of skill in the art. See, for example, Remington's Pharmaceutical Sciences, 17th ed., 1985; and co-owned WO 00/42219. Kits
  • kits comprising any of the linkers described herein and/or for performing any of the above methods.
  • the kits typically contain a linker sequence as described herein (or a polynucleotide encoding a linker as described herein).
  • the kit may supply the linker alone or may provide vectors into which a DNA-binding domain and/or nuclease of choice can be readily inserted into.
  • the kits can also contain cells, buffers for transformation of cells, culture media for cells, and/or buffers for performing assays.
  • the kits also contain a label which includes any material such as instructions, packaging or advertising leaflet that is attached to or otherwise accompanies the other components of the kit.
  • the disclosed linkers are advantageously used to enhance the repertoire of target sites for engineered zinc-finger proteins.
  • the linkers described herein facilitate binding to desired target sites when the module subsites are not adjacent.
  • the linkers described distinguish between various module subsite separations (e.g., 0, 1 and 2 base pair gaps), they reduce binding of ZFPs to improper target sites.
  • a ZFP with a flexible linker designed to skip 2 basepairs e.g.
  • TGGGGSGGSQKP (SEQ ID NO: 14) is able to bind to target sites with either 0, 1, or 2 basepairs between the module subsites.
  • This same ZFP with a 2bp-skipping linker as described herein should bind well to a target with 2 basepairs between the module subsites, but should not be able to bind efficiently to targets with 0 or 1 basepairs between module subsites (improper or unintended target sites).
  • linkers described herein can be used in any application for which zinc-finger proteins are currently used, including, but not limited to zinc-finger transcription factors (ZFP-TFs) for modulation of gene expression and/or in zinc- finger nucleases (ZFNs) for cleavage.
  • ZFP-TFs zinc-finger transcription factors
  • ZFNs zinc- finger nucleases
  • the disclosed linkers can be used in any ZFP or ZFN for any method in which specifically targeted modulation or cleavage is desirable.
  • ZFP-TFs and ZFNs can be used to treat genetic diseases, infections (viral or bacterial), to generate cell lines, animals and or plants in which desired genes are activated, repressed, targeted by homologous recombination and/or knocked-in or out.
  • the linkers described herein can also be used to more efficiently clone DNA and in genome modifications facilitated by ZFNs, which is broadly applicable in many areas of biotechnology and basic science.
  • ZFPs "ZFP7263”, “ZFP7264” and “ZFP8196” (see U.S. Patent Publication Nos. 20050064474 for 7263 and 7264 and 20080159996 for 8196), which each contained four fingers. Recognition helices of each finger for each host ZFP are provided in Table 1, while the full sequence of each host ZFP is provided in Figure 1A.
  • Insertions comprised a gap between the binding sequences for the second and third fingers of the host protein that must be bridged by a longer linker to enable efficient binding (Table 2 A). Insertions consisted of a mixture of bases in order to favor the selection of linkers with no intrinsic base specificity. Five selection cycles were performed.
  • a counterselection was employed with a 1000-fold molar excess of binding sites that were nonbiotinylated and that contained non-targeted gap lengths (i.e. if phage were selected using a target sequence with a lbp gap length, the counterselection comprised targets with 0, 2, 3 and 4 bp gaps; if phage were selected using a target sequence with a 2bp gap length, the counterselection comprised targets with 0, 1 and 3 and 4 bp gaps- see Table 2B). [0099] Phage pools from the fifth round of selection were screened for the ability to selectively bind sequences bearing the targeted gap length, and these studies revealed gap selective binding (Figure 2).
  • phage pools selected to skip a 1 bp gap in the context of ZFP8196 showed a 25-fold preference for targets bearing a Ibp gap as compared to no gap.
  • Phage pools selected to skip a 1 bp gap in the context of ZFP7263 showed a 26-fold preference for targets bearing a Ibp gap as compared to no gap.
  • Phage pools selected to skip a 1 bp gap in the context of ZFP7264 showed a 5.5-fold preference targets bearing a Ibp gap as compared to no gap.
  • Each of these pools also exhibited little or no binding to targets bearing longer gap lengths (2, 3 or 4 bp).
  • Phage pools selected to skip a 2 bp gap in the context of ZFP8196 showed a 7-fold preference for targets bearing 2 bp gap as compared to a Ibp gap as well as a >30-fold preference over targets bearing 0, 3 and 4 bp gaps.
  • Table 2A Tar et sites used for selection
  • Table 2A Target sites used for selections.
  • Duplex DNA target sites used in phage studies had the general form of: TAT AAT(X)n. l8 TTCACAGTCAGTCCACACGTC, (SEQ ID NO:67) where (X)i 7- i 8 was replaced with sequences listed in the table.
  • DNA duplexes were made by extending a primer that annealed to the italicized sequence and which was biotinylated at its 5' end.
  • Underlined bases indicate the binding sequences for the four fingers of each host ZFP, while lowercase bases indicate inserted nucleotides (or "gap” bases) that must be spanned by the selected linkers.
  • Degeneracy codes for gap bases are as follows: “d” denotes a mix of A, G, and T; “b” denotes a mix of C, G, and T; “h” denotes a mix of A, C, and T; and “v” denotes a mix of A, C, and G.
  • Table 2B Com etitor sites used durin selection
  • Duplex DNA competitor sites had the general form ⁇ : ⁇ AAT(X) i6 . 2 oTTCACAGTCAGTCCACACGTC, (SEQ ID NO:67) where (X)i 6-20 was replaced with sequences listed in the table.
  • DNA duplexes were made by extending a (non-biotinylated) primer that annealed to the italicized sequence. Underlined bases indicate the binding sequences for the four fingers of each host ZFP, while lowercase bases indicate inserted nucleotides (or "gap" bases).
  • Degeneracy codes for gap bases are as follows: “d” denotes a mix of A, G, and T; “b” denotes a mix of C, G, and T; “h” denotes a mix of A, C, and T; and “v” denotes a mix of A, C, and G.
  • Table 2C Tar ets used for ha e ool a selectivit studies
  • Table 2C Targets used for phage pool gap selectivity studies.
  • Duplex DNA sites used in phage pool gap selectivity studies had the general form of: TATAAT(X)i 6- IQTTCACAGTCAGTCCACACGTC, (SEQ ED NO:67) where (X)i 6-20 was replaced with sequences listed in the table.
  • DNA duplexes were made by extending a biotinylated primer that annealed to the italicized sequence. Underlined bases indicate the binding sequences for the four fingers of each host ZFP, while lowercase bases indicate inserted nucleotides (or "gap" bases).
  • Degeneracy codes for gap bases are as follows: “d” denotes a mix of A, G, and T; “b” denotes a mix of C, G, and T; “h” denotes a mix of A, C, and T; and “v” denotes a mix of A, C, and G.
  • Figure 3 A presents linkers selected for skipping 1 bp gaps in the context of all three host proteins, while Figure 3B shows linkers selected for skipping 2 bp in the context of the "ZFP8196" host.
  • the sequencing results revealed a strong compositional bias in the selected linkers towards proline- and arginine-rich sequences. Clear linker length trends were also apparent: although the starting libraries encoded
  • linker lengths approximately equal proportions of 11 different linker lengths (2-12 residues), selected linkers featured narrower distributions of from 5-8 residues (for the lbp gap) or 9-1 1 residues (for the 2bp gap).
  • ZFPs bearing the linkers listed in Figure 3 A were subcloned, expressed as free protein using an in vitro transcription-translation kit, and evaluated by ELIS A for binding to targets bearing insertions of 0, 1 or 2 bp opposite the selected linker. Targets for these studies are listed in Table 3.
  • Nine additional control proteins were generated by replacing the central linker of each host ZFP with three alternative, previously characterized, linker sequences which collectively represented the state of the art for spanning lbp. The sequences of these control linkers were LRQKDERP (SEQ ID
  • Table 3 shows the targets used for ELISA studies of ZFPs selected to skip a lbp gap. Duplex DNA sites used these studies had the general form
  • TTAG(X)i 6-]8 TATC (SEQ ID NO:94) where (X) 16- i8 was replaced with sequences listed in the table.
  • Each duplex DNA target was made by annealing a complementary oligonucleotide bearing a biotin at its 5' end. Underlines indicate the binding sequences for the four fingers of each host ZFP, while lowercase letters indicate inserted nucleotides (or "gap" bases). [0103] The results of these studies are provided in Tables 4, 5 and 6, with each table listing data for proteins derived from a different host ZFP. Table 4 provides data for ZFP8196-derived proteins; Table 5 provides data for ZFP7263-derived proteins; and Table 6 provides data for ZFP7264-derived proteins.
  • binding data for the host ZFP is listed in the top row, followed by binding data for three control proteins in rows 2-4, followed by data for the ZFPs selected from the phage display libraries.
  • the values are normalized to the ELISA signal obtained from the binding of the parent ZFP to its unmodified target.
  • each set of proteins exhibited a similar pattern of binding behavior, in three key respects: First, each parent ZFP bound well to its unmodified target (the "0- bp gap” target in Tables 4, 5 and 6) but not to any variant bearing inserts of 1 or 2 bp. This was expected since the parental linkers (either TGEKP (SEQ ED NO:l) (for ZFP8196) or TGSQKP (SEQ ED NO:72) (for ZFP7263 and ZFP7264)) are too short to span any additional inserted base.
  • TGEKP SEQ ED NO:l
  • TGSQKP SEQ ED NO:72
  • the phage- selected ZFPs bound with much higher affinity to targets bearing a 1 bp insert as well as with a much higher level of discrimination against binding targets containing no inserted base. These proteins were also very selective for binding targets with a lbp insert vs targets bearing a 2bp insert.
  • a ATAAACTGaCAAAAGGC (SEQ ID NO:73)
  • ZFPs with selected linkers were evaluated for in vivo cleavage activity at various target sites using the yeast screening assay described in International Patent Publication WO 2009/042163. As these experiments are more labor intensive, they were performed on fewer ZFPs. For these studies, six ZFPs from Table 5 and five ZFPs from Table 6 were assembled into constructs that enabled expression as zinc finger nucleases (ZFNs) as described in WO 2007/139982. In vivo activity was then measured by evaluating MEL-1 secretion from yeast strains having various target sites. The target sequences used for these studies are provided in Tables 7 and 8, and included variations of the 7263 and 7264 binding sites with central insertions of 0, 1-, or 2-bp.
  • Table 7 Targets used for yeast screening assay of ZFPs selected to skip a lbp
  • Reporter plasmids bearing nuclease target sites were constructed essentially as described in International Patent Publication WO 2009/042163, except that nuclease target cassettes had the general form of
  • Reporter plasmids bearing nuclease target sites were constructed essentially as described in International Patent Publication WO 2009/042163, except that nuclease target cassettes had the general form of
  • Tables 9 and 10 Data for these experiments are shown in Tables 9 and 10, with each table listing data for proteins derived from a different host ZFN.
  • Table 9 provides data for 7263-derived ZFNs and Table 10 provides data for 7264-derived ZFNs.
  • nuclease activity data for the host ZFN is listed in the top row, followed by nuclease activity data for one control protein in row 2, followed by data for the ZFPs selected from the phage display libraries. Since ZFP7263 and ZFP7264 are two halves of the same zinc-finger nuclease dimer, the data for the host ZFN is the same in each table.
  • target sites used for selection contained degenerate bases in the gap in order to favor the selection of linkers that exhibited no inherent preference for particular gap sequences.
  • the data shown in figures 4 and 5 suggest that this selection strategy was successful: proteins bearing the exemplary linkers exhibit little variation in binding among targets with gap bases of A, G, C or T. Moreover, the minor amount of variation that is observed is mirrored in the results obtained with control flexible liners (see, e.g., Figure 5D for flexible linker (TGGGGSQKP) (SEQ ID NO:2)) indicating that variation is a property of the flanking fingers.
  • TGGGGSGGSQKP SEQ ID NO: 14
  • LRQKDGGGSERP SEQ ED NO:68
  • ELISA scores were normalized to the score of the 8196 ZFP bound to its non-gapped target site.
  • Exemplary linkers were chosen based on their ELISA behavior in a similar fashion to the 1 bp-skipping linkers. These exemplary linkers were designated “2d”, “2e", and "2f ' .
  • a ATAAACTGaCAAAAGGC (SEQ ID NO:73)
  • AA ATAAACTGaaCAAAAGGC (SEQ ID NO:113) AC ATAAACTGacCAAAAGGC (SEQ ID NO:114) AG ATAAACTGaaCAAAAGGC (SEQ ID NO:1 15) AT ATAAACTGatCAAAAGGC (SEQ ID NO:116) CA ATAAACTGcaCAAAAGGC (SEQ ID NO:1 17) CC ATAAACTGccCAAAAGGC (SEQ ID NO:118) CG ATAAACTGcaCAAAAGGC (SEQ ID NO:1 19) CT ATAAACTGctCAAAAGGC (SEQ ID NO:120) GA ATAAACTGaaCAAAAGGC (SEQ ID NO: 21 ) GC ATAAACTGacCAAAAGGC (SEQ ID NO:122) GG ATAAACTGaaCAAAAGGC (SEQ ID NO:123) GT ATAAACTGatCAAAAGGC (SEQ ID NO: 124) TA ATAAACTGta
  • ATAAACTGttCAAAAGGC (SEQ ID NO:128)
  • Table 12 Duplex DNA target sites used in ELISA characterization studies had the general form of: TTAG(X) 16- i 8 TATC, (SEQ ID NO:94) where (X)i 6- is was replaced with sequences listed in the table. DNA duplexes were made by annealing
  • Oligonucleotides complementary to the sequences listed in the table contained a 5' biotin. Underlined bases indicate the binding sequences for the four fingers of each host ZFP, while lowercase bases indicate inserted nucleotides (or "gap" bases).
  • ZFNs were then tested for their ability to induce double-stranded breaks at endogenous loci. Briefly, a plasmid encoding the 18 ZFNs (ZFP- o&I fusions) described above (Example 3) were paired with their appropriate partner ZFNs and introduced into K562 cells by transfection using the AmaxaTM
  • Nucleofection kit as specified by the manufacturer. To determine the ZFN activity at the target locus as measured by the level of non-homologous end joining (NHEJ), CEL-I mismatch assays were performed essentially as per the manufacturer's instructions (Transgenomic SURVEYORTM). Cells were harvested and chromosomal DNA prepared using a QuickextractTM Kit according to manufacturer's directions (Epicentre®). The appropriate region of the target locus was PCR amplified using AccuprimeTM Taq High-fidelity DNA polymerase (Invitrogen) followed by treatment with the CEL-I enzyme.
  • NHEJ non-homologous end joining
  • Example gels generated for the CEL-1 assay are shown in Figure 9.
  • Figure 9A shows screening data for ZFN3 and ZFN4 (ZFNs skipping 1 basepair) as the host ZFN whereas
  • Figure 9B shows the screening data for ZFN 14 (ZFN skipping 2 basepairs) as the host ZFN.
  • the data for all the 1 bp skipping exemplary linkers is summarized in Figure 10 (ZFN1-ZFN12).
  • Some of the ZFNs were expressed using a high expression condition. The high expression is obtained post-transfection by incubating cells at 37°C for 24 hours and then incubating at 30°C for 48 hours before genomic DNA was isolated. The ZFNs utilizing this condition are highlighted in Figure 10.
  • Example 5 Secondary selections for a 2-bp skipping linker
  • a secondary set of libraries were constructed based on information obtained from the initial selections for a 2-bp skipping linker (Example 3 and Figure 3). These libraries fixed the three carboxy-terminal residues of the linker as RPP (lysine, proline, proline) and randomized the remaining amino-terminal residues.
  • RPP lysine, proline, proline
  • the library design is shown in Figure 12.
  • ZFPs with the selected linkers showed clear preferences for a 2 basepair gap over both the 1 basepair and non-gapped target sites.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Virology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Saccharide Compounds (AREA)
  • Contacts (AREA)
  • Solid-Sorbent Or Filter-Aiding Compositions (AREA)
PCT/US2011/000758 2010-05-03 2011-05-02 Compositions for linking zinc finger modules Ceased WO2011139349A1 (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
CN201180022329.2A CN102959087B (zh) 2010-05-03 2011-05-02 用于连接锌指模块的组合物
HRP20200254TT HRP20200254T1 (hr) 2010-05-03 2011-05-02 Pripravci za povezivanje modula cink fingera
LTEP11777690.6T LT2566972T (lt) 2010-05-03 2011-05-02 Kompozicijos, skirtos cinko pirštu modulių susiejimui
DK11777690.6T DK2566972T3 (da) 2010-05-03 2011-05-02 Sammensætninger til at forbinde zinkfinger-moduler
SI201131844T SI2566972T1 (sl) 2010-05-03 2011-05-02 Sestavki za povezovanje modulov cinkovega prsta
AU2011249019A AU2011249019B2 (en) 2010-05-03 2011-05-02 Compositions for linking zinc finger modules
PL11777690T PL2566972T3 (pl) 2010-05-03 2011-05-02 Kompozycje do wiązania modułów z motywem palca cynkowego
CA2797189A CA2797189C (en) 2010-05-03 2011-05-02 Compositions for linking zinc finger modules
KR1020187017770A KR101974036B1 (ko) 2010-05-03 2011-05-02 아연 핑거 모듈을 연결하기 위한 조성물
EP19211724.0A EP3636766A1 (en) 2010-05-03 2011-05-02 Compositions for linking zinc finger modules
ES11777690T ES2773052T3 (es) 2010-05-03 2011-05-02 Composiciones para unir módulos de dedos de cinc
JP2013509041A JP5898179B2 (ja) 2010-05-03 2011-05-02 ジンクフィンガーモジュールを連結するための組成物
EP11777690.6A EP2566972B1 (en) 2010-05-03 2011-05-02 Compositions for linking zinc finger modules
KR1020127028770A KR20130073887A (ko) 2010-05-03 2011-05-02 아연 핑거 모듈을 연결하기 위한 조성물
IL222632A IL222632B (en) 2010-05-03 2012-10-23 Preparations for linking modules with zinc finger
CY20201100140T CY1122636T1 (el) 2010-05-03 2020-02-14 Συνθεσεις για τη συνδεση στοιχειων με δακτυλους ψευδαργυρου

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US34372910P 2010-05-03 2010-05-03
US61/343,729 2010-05-03

Publications (1)

Publication Number Publication Date
WO2011139349A1 true WO2011139349A1 (en) 2011-11-10

Family

ID=44903931

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2011/000758 Ceased WO2011139349A1 (en) 2010-05-03 2011-05-02 Compositions for linking zinc finger modules

Country Status (18)

Country Link
US (2) US8772453B2 (https=)
EP (2) EP2566972B1 (https=)
JP (1) JP5898179B2 (https=)
KR (2) KR101974036B1 (https=)
CN (1) CN102959087B (https=)
AU (1) AU2011249019B2 (https=)
CA (1) CA2797189C (https=)
CY (1) CY1122636T1 (https=)
DK (1) DK2566972T3 (https=)
ES (1) ES2773052T3 (https=)
HR (1) HRP20200254T1 (https=)
HU (1) HUE048072T2 (https=)
IL (1) IL222632B (https=)
LT (1) LT2566972T (https=)
PL (1) PL2566972T3 (https=)
PT (1) PT2566972T (https=)
SI (1) SI2566972T1 (https=)
WO (1) WO2011139349A1 (https=)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020072684A1 (en) * 2018-10-02 2020-04-09 Sangamo Therapeutics, Inc. Engineered genetic modulators
WO2020219726A1 (en) 2019-04-23 2020-10-29 Sangamo Therapeutics, Inc. Modulators of chromosome 9 open reading frame 72 gene expression and uses thereof
WO2021067871A1 (en) 2019-10-02 2021-04-08 Sangamo Therapeutics, Inc. Zinc finger protein transcription factors for repressing alpha-synuclein expression
WO2021067864A1 (en) 2019-10-02 2021-04-08 Sangamo Therapeutics, Inc. Zinc finger protein transcription factors for treatment of prion disease
WO2021151012A1 (en) 2020-01-22 2021-07-29 Sangamo Therapeutics, Inc. Zinc finger protein transcription factors for repressing tau expression
WO2022072826A1 (en) 2020-10-02 2022-04-07 Sangamo Therapeutics, Inc. Novel zinc finger protein transcription factors for repressing alpha-synuclein expression
US11504389B2 (en) 2016-12-01 2022-11-22 Sangamo Therapeutics, Inc. Tau modulators and methods and compositions for delivery thereof
WO2023122722A1 (en) 2021-12-22 2023-06-29 Sangamo Therapeutics, Inc. Novel zinc finger fusion proteins for nucleobase editing
US11834686B2 (en) 2018-08-23 2023-12-05 Sangamo Therapeutics, Inc. Engineered target specific base editors
US12318427B2 (en) 2018-10-02 2025-06-03 Sangamo Therapeutics, Inc. Methods and compositions for modulation of tau proteins

Families Citing this family (70)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120196370A1 (en) 2010-12-03 2012-08-02 Fyodor Urnov Methods and compositions for targeted genomic deletion
AU2011281062B2 (en) 2010-07-21 2015-01-22 Board Of Regents, The University Of Texas System Methods and compositions for modification of a HLA locus
WO2012094132A1 (en) 2011-01-05 2012-07-12 Sangamo Biosciences, Inc. Methods and compositions for gene correction
US9161995B2 (en) 2011-07-25 2015-10-20 Sangamo Biosciences, Inc. Methods and compositions for alteration of a cystic fibrosis transmembrane conductance regulator (CFTR) gene
CA3099582A1 (en) 2011-10-27 2013-05-02 Sangamo Biosciences, Inc. Methods and compositions for modification of the hprt locus
WO2013130824A1 (en) 2012-02-29 2013-09-06 Sangamo Biosciences, Inc. Methods and compositions for treating huntington's disease
US10648001B2 (en) 2012-07-11 2020-05-12 Sangamo Therapeutics, Inc. Method of treating mucopolysaccharidosis type I or II
JP6329537B2 (ja) 2012-07-11 2018-05-23 サンガモ セラピューティクス, インコーポレイテッド 生物学的薬剤の送達のための方法および組成物
SG10201701601WA (en) 2012-08-29 2017-04-27 Sangamo Biosciences Inc Methods and compositions for treatment of a genetic condition
WO2014071070A1 (en) 2012-11-01 2014-05-08 Pacific Biosciences Of California, Inc. Compositions and methods for selection of nucleic acids
US9290800B2 (en) 2013-03-15 2016-03-22 Pacific Biosciences Of California, Inc. Targeted rolling circle amplification
CN105263312A (zh) 2013-04-05 2016-01-20 美国陶氏益农公司 用于在植物基因组内整合外源序列的方法和组合物
CA3131284C (en) 2013-08-28 2023-09-19 David Paschon Compositions for linking dna-binding domains and cleavage domains
EP3441468B1 (en) 2013-10-17 2021-05-19 Sangamo Therapeutics, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
US10117899B2 (en) 2013-10-17 2018-11-06 Sangamo Therapeutics, Inc. Delivery methods and compositions for nuclease-mediated genome engineering in hematopoietic stem cells
WO2015070212A1 (en) 2013-11-11 2015-05-14 Sangamo Biosciences, Inc. Methods and compositions for treating huntington's disease
DK3492593T3 (da) 2013-11-13 2021-11-08 Childrens Medical Center Nukleasemedieret regulering af genekspression
US10072066B2 (en) 2014-02-03 2018-09-11 Sangamo Therapeutics, Inc. Methods and compositions for treatment of a beta thalessemia
CN106459894B (zh) 2014-03-18 2020-02-18 桑格摩生物科学股份有限公司 用于调控锌指蛋白表达的方法和组合物
US10435685B2 (en) 2014-08-19 2019-10-08 Pacific Biosciences Of California, Inc. Compositions and methods for enrichment of nucleic acids
AU2016261927B2 (en) 2015-05-12 2022-04-07 Sangamo Therapeutics, Inc. Nuclease-mediated regulation of gene expression
US9957501B2 (en) 2015-06-18 2018-05-01 Sangamo Therapeutics, Inc. Nuclease-mediated regulation of gene expression
AU2016291778B2 (en) 2015-07-13 2021-05-06 Sangamo Therapeutics, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
BR112018012235A2 (pt) 2015-12-18 2018-12-04 Sangamo Therapeutics Inc rompimento alvejado do receptor de células de mhc
EP3389677B1 (en) 2015-12-18 2024-06-26 Sangamo Therapeutics, Inc. Targeted disruption of the t cell receptor
WO2017123757A1 (en) 2016-01-15 2017-07-20 Sangamo Therapeutics, Inc. Methods and compositions for the treatment of neurologic disease
KR20180101442A (ko) 2016-02-02 2018-09-12 상가모 테라퓨틱스, 인코포레이티드 Dna-결합 도메인 및 절단 도메인을 연결시키기 위한 조성물
KR102455249B1 (ko) 2016-08-24 2022-10-17 상가모 테라퓨틱스, 인코포레이티드 가공된 표적 특이적 뉴클레아제
EP3995574A1 (en) 2016-08-24 2022-05-11 Sangamo Therapeutics, Inc. Regulation of gene expression using engineered nucleases
KR102712926B1 (ko) 2016-10-20 2024-10-07 상가모 테라퓨틱스, 인코포레이티드 파브리병의 치료를 위한 방법 및 조성물
WO2018081775A1 (en) 2016-10-31 2018-05-03 Sangamo Therapeutics, Inc. Gene correction of scid-related genes in hematopoietic stem and progenitor cells
MX2019011772A (es) 2017-04-03 2020-01-09 Encoded Therapeutics Inc Expresion transgenica selectiva de tejidos.
CN110799492B (zh) 2017-04-28 2023-06-27 爱康泰生治疗公司 用于递送核酸的新型羰基脂质和脂质纳米颗粒制剂
US11655275B2 (en) 2017-05-03 2023-05-23 Sangamo Therapeutics, Inc. Methods and compositions for modification of a cystic fibrosis transmembrane conductance regulator (CFTR) gene
US11512287B2 (en) 2017-06-16 2022-11-29 Sangamo Therapeutics, Inc. Targeted disruption of T cell and/or HLA receptors
AU2018313167A1 (en) 2017-08-08 2020-02-27 Sangamo Therapeutics, Inc. Chimeric antigen receptor mediated cell targeting
BR112020008568A2 (pt) 2017-11-09 2020-10-06 Sangamo Therapeutics, Inc. modificação genética de gene de proteína contendo sh2 indutível por citoquina (cish)
EP3717505A4 (en) 2017-12-01 2021-12-01 Encoded Therapeutics, Inc. GENENICALLY MODIFIED DNA-BINDING PROTEINS
CA3089587A1 (en) 2018-02-08 2019-08-15 Sangamo Therapeutics, Inc. Engineered target specific nucleases
US11421007B2 (en) * 2018-04-18 2022-08-23 Sangamo Therapeutics, Inc. Zinc finger protein compositions for modulation of huntingtin (Htt)
US11690921B2 (en) 2018-05-18 2023-07-04 Sangamo Therapeutics, Inc. Delivery of target specific nucleases
KR20210060533A (ko) 2018-09-18 2021-05-26 상가모 테라퓨틱스, 인코포레이티드 프로그램화된 세포 사멸 1 (pd1) 특이적 뉴클레아제
IL281615B2 (en) 2018-09-21 2026-01-01 Acuitas Therapeutics Inc Systems and methods for producing lipid nanoparticles and liposomes
CA3116576A1 (en) 2018-10-18 2020-04-23 Acuitas Therapeutics, Inc. Lipids for lipid nanoparticle delivery of active agents
PT3908568T (pt) 2019-01-11 2024-09-30 Acuitas Therapeutics Inc Lípidos para a administração de agentes ativos por nanopartículas lipídicas
AU2019428629A1 (en) 2019-02-06 2021-01-28 Sangamo Therapeutics, Inc. Method for the treatment of mucopolysaccharidosis type I
CA3132167A1 (en) 2019-04-02 2020-10-08 Weston P. MILLER IV Methods for the treatment of beta-thalassemia
JP2022533713A (ja) 2019-05-21 2022-07-25 サンガモ セラピューティクス, インコーポレイテッド 調節性t細胞における制御された導入遺伝子発現
PL3976798T3 (pl) 2019-05-29 2026-04-07 Encoded Therapeutics, Inc. Kompozycje i sposoby selektywnej regulacji genów
WO2021028359A1 (en) 2019-08-09 2021-02-18 Sangamo Therapeutics France Controlled expression of chimeric antigen receptors in t cells
WO2021087361A1 (en) 2019-11-01 2021-05-06 Sangamo Therapeutics, Inc. Zinc finger nuclease variants for treating or preventing lysosomal storage diseases
US20230174612A1 (en) * 2020-04-09 2023-06-08 The Regents Of The University Of California Notch receptors with zinc finger-containing transcriptional effector
ES3054438T3 (en) 2020-07-16 2026-02-03 Acuitas Therapeutics Inc Cationic lipids for use in lipid nanoparticles
US12152251B2 (en) 2020-08-25 2024-11-26 Kite Pharma, Inc. T cells with improved functionality
CN116261594A (zh) 2020-09-25 2023-06-13 桑格摩生物治疗股份有限公司 用于核碱基编辑的锌指融合蛋白
KR20240011120A (ko) 2020-12-22 2024-01-25 크로마 메디슨, 인크. 후성유전학적 편집을 위한 조성물 및 방법
CA3237482A1 (en) 2021-11-03 2023-05-11 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Precise genome editing using retrons
CA3242402A1 (en) 2021-12-16 2023-06-22 Acuitas Therapeutics, Inc. Lipids for use in lipid nanoparticle formulations
WO2023141602A2 (en) 2022-01-21 2023-07-27 Renagade Therapeutics Management Inc. Engineered retrons and methods of use
IL316722A (en) 2022-05-01 2024-12-01 Chroma Medicine Inc Compositions and methods for epigenetic regulation of PCSK9 expression
EP4544058A1 (en) 2022-06-23 2025-04-30 Chroma Medicine, Inc. Compositions and methods for epigenetic regulation of ciita expression
US20250387518A1 (en) 2022-06-23 2025-12-25 Nchroma Bio, Inc. Compositions and methods for epigenetic regulation of b2m expression
JP2025524455A (ja) 2022-06-23 2025-07-30 エヌクロマ・バイオ,インコーポレーテッド Trac発現のエピジェネティック調節のための組成物及び方法
WO2024044723A1 (en) 2022-08-25 2024-02-29 Renagade Therapeutics Management Inc. Engineered retrons and methods of use
IL319704A (en) 2022-09-23 2025-05-01 Nchroma Bio Inc Compositions and methods for epigenetic regulation of HBV gene expression
WO2024081879A1 (en) 2022-10-14 2024-04-18 Chroma Medicine, Inc. Compositions and methods for epigenetic regulation of cd247 expression
AU2024270764A1 (en) 2023-05-15 2025-12-04 Nchroma Bio, Inc. Compositions and methods for epigenetic regulation of hbv gene expression
WO2024238700A1 (en) 2023-05-15 2024-11-21 Chroma Medicine, Inc. Compositions and methods for epigenetic regulation of hbv gene expression
AU2024335327A1 (en) 2023-09-01 2026-03-26 Renagade Therapeutics Management Inc. Gene editing systems, compositions, and methods for treatment of vexas syndrome
WO2025174765A1 (en) 2024-02-12 2025-08-21 Renagade Therapeutics Management Inc. Lipid nanoparticles comprising coding rna molecules for use in gene editing and as vaccines and therapeutic agents

Citations (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4512110A (en) 1981-12-10 1985-04-23 Timesavers, Inc. Endless abrasive belts
US5420032A (en) 1991-12-23 1995-05-30 Universitge Laval Homing endonuclease which originates from chlamydomonas eugametos and recognizes and cleaves a 15, 17 or 19 degenerate double stranded nucleotide sequence
US5789538A (en) 1995-02-03 1998-08-04 Massachusetts Institute Of Technology Zinc finger proteins with high affinity new DNA binding specificities
WO1998037186A1 (en) 1997-02-18 1998-08-27 Actinova Limited In vitro peptide or protein expression library
WO1998053057A1 (en) 1997-05-23 1998-11-26 Gendaq Limited Nucleic acid binding polypeptide library
US5925523A (en) 1996-08-23 1999-07-20 President & Fellows Of Harvard College Intraction trap assay, reagents and uses thereof
GB2338237A (en) 1997-02-18 1999-12-15 Actinova Ltd In vitro peptide or protein expression library
US6007988A (en) 1994-08-20 1999-12-28 Medical Research Council Binding proteins for recognition of DNA
WO2000027878A1 (en) 1998-11-09 2000-05-18 Gendaq Limited Screening system for zinc finger polypeptides for a desired binding ability
US6140466A (en) 1994-01-18 2000-10-31 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
US6242568B1 (en) 1994-01-18 2001-06-05 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
WO2001088197A2 (en) 2000-05-16 2001-11-22 Massachusetts Institute Of Technology Methods and compositions for interaction trap assays
US6410248B1 (en) 1998-01-30 2002-06-25 Massachusetts Institute Of Technology General strategy for selecting high-affinity zinc finger proteins for diverse DNA target sites
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
WO2002077227A2 (en) 2000-11-20 2002-10-03 Sangamo Biosciences, Inc. Iterative optimization in the design of binding proteins
US6479626B1 (en) 1998-03-02 2002-11-12 Massachusetts Institute Of Technology Poly zinc finger proteins with improved linkers
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US20030119023A1 (en) 2000-01-24 2003-06-26 Yen Choo Nucleic acid binding polypeptides characterized by flexible linkers connected nucleic acid binding modules
US6599692B1 (en) 1999-09-14 2003-07-29 Sangamo Bioscience, Inc. Functional genomics using zinc finger proteins
US6689558B2 (en) 2000-02-08 2004-02-10 Sangamo Biosciences, Inc. Cells for drug discovery
US20040197892A1 (en) * 2001-04-04 2004-10-07 Michael Moore Composition binding polypeptides
US6833252B1 (en) 1992-05-05 2004-12-21 Institut Pasteur Nucleotide sequence encoding the enzyme I-SecI and the uses thereof
US20050064474A1 (en) 2003-08-08 2005-03-24 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US20060063231A1 (en) 2004-09-16 2006-03-23 Sangamo Biosciences, Inc. Compositions and methods for protein production
US7067317B2 (en) 2000-12-07 2006-06-27 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
US20060188987A1 (en) 2003-08-08 2006-08-24 Dmitry Guschin Targeted deletion of cellular DNA sequences
US20070059795A1 (en) * 2003-09-19 2007-03-15 Michael Moore Engineered zinc finger proteins for regulation of gene expression
US20070117128A1 (en) 2005-10-18 2007-05-24 Smith James J Rationally-designed meganucleases with altered sequence specificity and DNA-binding affinity
US20070134796A1 (en) 2005-07-26 2007-06-14 Sangamo Biosciences, Inc. Targeted integration and expression of exogenous nucleic acid sequences
US7253273B2 (en) 2004-04-08 2007-08-07 Sangamo Biosciences, Inc. Treatment of neuropathic pain with zinc finger proteins
US7262054B2 (en) 2002-01-22 2007-08-28 Sangamo Biosciences, Inc. Zinc finger proteins for DNA binding and gene regulation in plants
US20070218528A1 (en) 2004-02-05 2007-09-20 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US20080015164A1 (en) 2006-05-19 2008-01-17 Sangamo Biosciences, Inc. Methods and compositions for inactivation of dihydrofolate reductase
US20080070306A1 (en) * 1994-08-20 2008-03-20 Sangamo Biosciences, Inc. Regulated gene expression in plants
US20080159996A1 (en) 2006-05-25 2008-07-03 Dale Ando Methods and compositions for gene inactivation
US20080188000A1 (en) 2006-11-13 2008-08-07 Andreas Reik Methods and compositions for modification of the human glucocorticoid receptor locus
US20080299580A1 (en) 2007-04-26 2008-12-04 Sangamo Biosciences, Inc. Targeted integration into the PPP1R12C locus
US20090007300A1 (en) * 2000-01-21 2009-01-01 Barbas Iii Carlos F Synthetic zinc finger protein encoding sequences and methods of producing the same

Family Cites Families (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5422251A (en) 1986-11-26 1995-06-06 Princeton University Triple-stranded nucleic acids
US5176996A (en) 1988-12-20 1993-01-05 Baylor College Of Medicine Method for making synthetic oligonucleotides which bind specifically to target sites on duplex DNA molecules, by forming a colinear triplex, the synthetic oligonucleotides and methods of use
US5356802A (en) 1992-04-03 1994-10-18 The Johns Hopkins University Functional domains in flavobacterium okeanokoites (FokI) restriction endonuclease
US5487994A (en) 1992-04-03 1996-01-30 The Johns Hopkins University Insertion and deletion mutants of FokI restriction endonuclease
US5436150A (en) 1992-04-03 1995-07-25 The Johns Hopkins University Functional domains in flavobacterium okeanokoities (foki) restriction endonuclease
DE69534629D1 (de) 1994-01-18 2005-12-29 Scripps Research Inst Derivate von zinkfingerproteinen und methoden
US5585245A (en) 1994-04-22 1996-12-17 California Institute Of Technology Ubiquitin-based split protein sensor
US6342345B1 (en) 1997-04-02 2002-01-29 The Board Of Trustees Of The Leland Stanford Junior University Detection of molecular interactions by reporter subunit complementation
GB9710807D0 (en) 1997-05-23 1997-07-23 Medical Res Council Nucleic acid binding proteins
US6140081A (en) 1998-10-16 2000-10-31 The Scripps Research Institute Zinc finger binding domains for GNN
US20020061512A1 (en) 2000-02-18 2002-05-23 Kim Jin-Soo Zinc finger domains and methods of identifying same
US20060268407A1 (en) 2000-07-07 2006-11-30 Fergason James L Display system using two displays and polarization direction rotation for showing high-resolution and three-dimensional images and method and use of a DBEF beam splitter
JP2002060786A (ja) 2000-08-23 2002-02-26 Kao Corp 硬質表面用殺菌防汚剤
GB0108491D0 (en) 2001-04-04 2001-05-23 Gendaq Ltd Engineering zinc fingers
JP2005500061A (ja) 2001-08-20 2005-01-06 ザ スクリップス リサーチ インスティテュート Cnnについての亜鉛フィンガー結合ドメイン
JP2006513694A (ja) * 2002-06-11 2006-04-27 ザ スクリップス リサーチ インスティテュート 人工転写因子
WO2005061705A1 (en) * 2003-12-23 2005-07-07 Toolgen, Inc. Regulation of prokaryotic gene expression with zinc finger proteins
CA2607104A1 (en) 2005-05-05 2006-11-16 The Arizona Board Of Regents On Behalf Of The University Of Arizona Sequence enabled reassembly (seer) - a novel method for visualizing specific dna sequences
EP2027262B1 (en) 2006-05-25 2010-03-31 Sangamo Biosciences Inc. Variant foki cleavage half-domains
EP2188384B1 (en) 2007-09-27 2015-07-15 Sangamo BioSciences, Inc. Rapid in vivo identification of biologically active nucleases
EP2456877A4 (en) 2009-07-24 2012-05-30 Sigma Aldrich Co Llc METHOD OF GENOMIC PROCESSING

Patent Citations (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4512110A (en) 1981-12-10 1985-04-23 Timesavers, Inc. Endless abrasive belts
US5420032A (en) 1991-12-23 1995-05-30 Universitge Laval Homing endonuclease which originates from chlamydomonas eugametos and recognizes and cleaves a 15, 17 or 19 degenerate double stranded nucleotide sequence
US6833252B1 (en) 1992-05-05 2004-12-21 Institut Pasteur Nucleotide sequence encoding the enzyme I-SecI and the uses thereof
US6140466A (en) 1994-01-18 2000-10-31 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
US6242568B1 (en) 1994-01-18 2001-06-05 The Scripps Research Institute Zinc finger protein derivatives and methods therefor
US20080070306A1 (en) * 1994-08-20 2008-03-20 Sangamo Biosciences, Inc. Regulated gene expression in plants
US6007988A (en) 1994-08-20 1999-12-28 Medical Research Council Binding proteins for recognition of DNA
US6013453A (en) 1994-08-20 2000-01-11 Medical Research Council Binding proteins for recognition of DNA
US5789538A (en) 1995-02-03 1998-08-04 Massachusetts Institute Of Technology Zinc finger proteins with high affinity new DNA binding specificities
US5925523A (en) 1996-08-23 1999-07-20 President & Fellows Of Harvard College Intraction trap assay, reagents and uses thereof
US6200759B1 (en) 1996-08-23 2001-03-13 President And Fellows Of Harvard College Interaction trap assay, reagents and uses thereof
GB2338237A (en) 1997-02-18 1999-12-15 Actinova Ltd In vitro peptide or protein expression library
WO1998037186A1 (en) 1997-02-18 1998-08-27 Actinova Limited In vitro peptide or protein expression library
WO1998053057A1 (en) 1997-05-23 1998-11-26 Gendaq Limited Nucleic acid binding polypeptide library
US6410248B1 (en) 1998-01-30 2002-06-25 Massachusetts Institute Of Technology General strategy for selecting high-affinity zinc finger proteins for diverse DNA target sites
US20070149770A1 (en) * 1998-03-02 2007-06-28 Massachusetts Institute Of Technology Poly zinc finger proteins with improved linkers
US6479626B1 (en) 1998-03-02 2002-11-12 Massachusetts Institute Of Technology Poly zinc finger proteins with improved linkers
US7153949B2 (en) 1998-03-02 2006-12-26 Massachusetts Institute Of Technology Nucleic acid encoding poly-zinc finger proteins with improved linkers
US6903185B2 (en) 1998-03-02 2005-06-07 Massachusetts Institute Of Technology Poly zinc finger proteins with improved linkers
WO2000027878A1 (en) 1998-11-09 2000-05-18 Gendaq Limited Screening system for zinc finger polypeptides for a desired binding ability
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6599692B1 (en) 1999-09-14 2003-07-29 Sangamo Bioscience, Inc. Functional genomics using zinc finger proteins
US20090007300A1 (en) * 2000-01-21 2009-01-01 Barbas Iii Carlos F Synthetic zinc finger protein encoding sequences and methods of producing the same
US20030119023A1 (en) 2000-01-24 2003-06-26 Yen Choo Nucleic acid binding polypeptides characterized by flexible linkers connected nucleic acid binding modules
US6689558B2 (en) 2000-02-08 2004-02-10 Sangamo Biosciences, Inc. Cells for drug discovery
WO2001088197A2 (en) 2000-05-16 2001-11-22 Massachusetts Institute Of Technology Methods and compositions for interaction trap assays
WO2002077227A2 (en) 2000-11-20 2002-10-03 Sangamo Biosciences, Inc. Iterative optimization in the design of binding proteins
US7067317B2 (en) 2000-12-07 2006-06-27 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
US20040197892A1 (en) * 2001-04-04 2004-10-07 Michael Moore Composition binding polypeptides
US7262054B2 (en) 2002-01-22 2007-08-28 Sangamo Biosciences, Inc. Zinc finger proteins for DNA binding and gene regulation in plants
US20060188987A1 (en) 2003-08-08 2006-08-24 Dmitry Guschin Targeted deletion of cellular DNA sequences
US20050064474A1 (en) 2003-08-08 2005-03-24 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US20070059795A1 (en) * 2003-09-19 2007-03-15 Michael Moore Engineered zinc finger proteins for regulation of gene expression
US20070218528A1 (en) 2004-02-05 2007-09-20 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US7253273B2 (en) 2004-04-08 2007-08-07 Sangamo Biosciences, Inc. Treatment of neuropathic pain with zinc finger proteins
US20060063231A1 (en) 2004-09-16 2006-03-23 Sangamo Biosciences, Inc. Compositions and methods for protein production
US20070134796A1 (en) 2005-07-26 2007-06-14 Sangamo Biosciences, Inc. Targeted integration and expression of exogenous nucleic acid sequences
US20070117128A1 (en) 2005-10-18 2007-05-24 Smith James J Rationally-designed meganucleases with altered sequence specificity and DNA-binding affinity
US20080015164A1 (en) 2006-05-19 2008-01-17 Sangamo Biosciences, Inc. Methods and compositions for inactivation of dihydrofolate reductase
US20080159996A1 (en) 2006-05-25 2008-07-03 Dale Ando Methods and compositions for gene inactivation
US20080188000A1 (en) 2006-11-13 2008-08-07 Andreas Reik Methods and compositions for modification of the human glucocorticoid receptor locus
US20080299580A1 (en) 2007-04-26 2008-12-04 Sangamo Biosciences, Inc. Targeted integration into the PPP1R12C locus

Non-Patent Citations (26)

* Cited by examiner, † Cited by third party
Title
ARGAST ET AL., J. MOL. BIOL., vol. 280, 1998, pages 345 - 353
ASHWORTH ET AL., NATURE, vol. 441, 2006, pages 656 - 659
BEERLI ET AL., NATURE BIOTECHNOL., vol. 20, 2002, pages 135 - 141
BELFORT ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3379 - 3388
BOCH ET AL., SCIENCE, 29 October 2009 (2009-10-29)
CHEVALIER ET AL., MOLEC. CELL, vol. 10, 2002, pages 895 - 905
CHOO ET AL., CURR. OPIN. STRUCT. BIOL., vol. 10, 2000, pages 411 - 416
DUJON ET AL., GENE, vol. 82, 1989, pages 115 - 118
EPINAT ET AL., NUCLEIC ACIDS RES., vol. 31, 2003, pages 2952 - 2962
GIMBLE ET AL., J. MOL. BIOL., vol. 263, 1996, pages 163 - 180
GOGOS ET AL.: "Sequence Discrimination by Altematively Spliced Isoforms of a DNA Binding Zinc =inger Domain.", SCIENCE., vol. 257, no. 5078, 1992, pages 1951 - 1955, XP002112929 *
HOFFMANN ET AL.: "A New Coactivator Function for Zac1?s C2H2 Zinc Finger DNA-Binding Domain in Selectively Controlling PCAF Activity.", MOL CELL BIOL., vol. 28, no. 19, 2008, pages 6078 - 6093, XP055073992 *
ISALAN ET AL., NATURE BIOTECHNOL., vol. 19, 2001, pages 656 - 660
JASIN, TRENDS GENET, vol. 12, 1996, pages 224 - 228
MANIATIS ET AL.: "Molecular Cloning: A Laboratory Manual", 1991, COLD SPRING HARBOR LABORATORY PRESS
MARGOLIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 4509 - 4513
MILLER ET AL., NATURE BIOTECHNOLOGY, 22 December 2010 (2010-12-22)
MORELLET ET AL.: "Conformational behaviour of the active and inactive forms of the nucleocapsid NCp7 of HIV-1 studied by 1H NMR.", J MOL BIOL., vol. 235, no. 1, 1994, pages 287 - 301, XP055073990, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/pubmed?term=Conformational%20behaviour%20of%20the%20active%20and%20inactive%20forms%20of%20the%20nucleocapsid%20NCp7%20of%20HIV-1%20studied%20by%201H%20NMR> [retrieved on 20110908] *
MOSCOU; BOGDANOVE, SCIENCE, 29 October 2009 (2009-10-29)
PABO ET AL., ANN. REV. BIOCHEM., vol. 70, 2001, pages 313 - 340
PAQUES ET AL., CURRENT GENE THERAPY, vol. 7, 2007, pages 49 - 66
PENGUE ET AL., NUCL. ACIDS RES., vol. 22, 1994, pages 2908 - 2914
PERLER ET AL., NUCLEIC ACIDS RES., vol. 22, 1994, pages 1125 - 1127
See also references of EP2566972A4
SEGAL ET AL., CURR. OPIN. BIOTECHNOL., vol. 12, 2001, pages 632 - 637
THIESEN ET AL., NEW BIOLOGIST, vol. 2, 1990, pages 363 - 374

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11504389B2 (en) 2016-12-01 2022-11-22 Sangamo Therapeutics, Inc. Tau modulators and methods and compositions for delivery thereof
US11834686B2 (en) 2018-08-23 2023-12-05 Sangamo Therapeutics, Inc. Engineered target specific base editors
WO2020072684A1 (en) * 2018-10-02 2020-04-09 Sangamo Therapeutics, Inc. Engineered genetic modulators
US12318427B2 (en) 2018-10-02 2025-06-03 Sangamo Therapeutics, Inc. Methods and compositions for modulation of tau proteins
WO2020219726A1 (en) 2019-04-23 2020-10-29 Sangamo Therapeutics, Inc. Modulators of chromosome 9 open reading frame 72 gene expression and uses thereof
US12139517B2 (en) 2019-04-23 2024-11-12 Sangamo Therapeutics, Inc. Modulators of chromosome 9 open reading frame 72 gene expression and uses thereof
WO2021067871A1 (en) 2019-10-02 2021-04-08 Sangamo Therapeutics, Inc. Zinc finger protein transcription factors for repressing alpha-synuclein expression
WO2021067864A1 (en) 2019-10-02 2021-04-08 Sangamo Therapeutics, Inc. Zinc finger protein transcription factors for treatment of prion disease
WO2021151012A1 (en) 2020-01-22 2021-07-29 Sangamo Therapeutics, Inc. Zinc finger protein transcription factors for repressing tau expression
WO2022072826A1 (en) 2020-10-02 2022-04-07 Sangamo Therapeutics, Inc. Novel zinc finger protein transcription factors for repressing alpha-synuclein expression
WO2023122722A1 (en) 2021-12-22 2023-06-29 Sangamo Therapeutics, Inc. Novel zinc finger fusion proteins for nucleobase editing

Also Published As

Publication number Publication date
EP2566972B1 (en) 2020-01-15
PT2566972T (pt) 2020-03-02
CA2797189C (en) 2020-05-26
JP5898179B2 (ja) 2016-04-06
JP2013527765A (ja) 2013-07-04
EP2566972A4 (en) 2014-01-01
EP3636766A1 (en) 2020-04-15
PL2566972T3 (pl) 2020-06-29
CN102959087A (zh) 2013-03-06
CY1122636T1 (el) 2021-03-12
ES2773052T3 (es) 2020-07-09
DK2566972T3 (da) 2020-02-17
IL222632B (en) 2018-12-31
US20110287512A1 (en) 2011-11-24
EP2566972A1 (en) 2013-03-13
US8772453B2 (en) 2014-07-08
HRP20200254T1 (hr) 2020-05-29
KR20180077284A (ko) 2018-07-06
IL222632A0 (en) 2012-12-31
KR101974036B1 (ko) 2019-04-30
LT2566972T (lt) 2020-03-10
US20140287500A1 (en) 2014-09-25
SI2566972T1 (sl) 2020-04-30
CA2797189A1 (en) 2011-11-10
CN102959087B (zh) 2015-04-29
KR20130073887A (ko) 2013-07-03
US9163245B2 (en) 2015-10-20
HUE048072T2 (hu) 2020-05-28
AU2011249019B2 (en) 2015-01-22

Similar Documents

Publication Publication Date Title
AU2011249019B2 (en) Compositions for linking zinc finger modules
AU2011249019A1 (en) Compositions for linking zinc finger modules
US20240229079A9 (en) Engineered target specific nucleases
US10646543B2 (en) Methods and compositions for treating trinucleotide repeat disorders
US9522936B2 (en) Engineered transcription activator like effector (TALE) proteins
HK40026462A (en) Compositions for linking zinc finger modules
HK1182417A (en) Compositions for linking zinc finger modules
HK1182417B (en) Compositions for linking zinc finger modules
HK1193768A (en) Zinc finger fusion proteins for repressing a huntington gene
HK1193768B (en) Zinc finger fusion proteins for repressing a huntington gene

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201180022329.2

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11777690

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2797189

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 20127028770

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2013509041

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2011777690

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2011249019

Country of ref document: AU

Date of ref document: 20110502

Kind code of ref document: A