WO2011102690A2 - 둥근잎유홍초 추출물을 함유하는 당뇨병 치료용 약학적 조성물 - Google Patents

둥근잎유홍초 추출물을 함유하는 당뇨병 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2011102690A2
WO2011102690A2 PCT/KR2011/001128 KR2011001128W WO2011102690A2 WO 2011102690 A2 WO2011102690 A2 WO 2011102690A2 KR 2011001128 W KR2011001128 W KR 2011001128W WO 2011102690 A2 WO2011102690 A2 WO 2011102690A2
Authority
WO
WIPO (PCT)
Prior art keywords
extract
round leaf
pharmaceutical composition
group
round
Prior art date
Application number
PCT/KR2011/001128
Other languages
English (en)
French (fr)
Other versions
WO2011102690A3 (ko
Inventor
정봉현
김문일
이소연
이의진
박경숙
배판기
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Priority to US13/579,743 priority Critical patent/US20130004596A1/en
Priority to MX2012009556A priority patent/MX2012009556A/es
Priority to AU2011216647A priority patent/AU2011216647B2/en
Priority to CN2011800142670A priority patent/CN102802651A/zh
Priority to JP2012553821A priority patent/JP5882915B2/ja
Priority to EP11744932.2A priority patent/EP2548565A4/en
Priority to NZ601904A priority patent/NZ601904A/en
Publication of WO2011102690A2 publication Critical patent/WO2011102690A2/ko
Publication of WO2011102690A3 publication Critical patent/WO2011102690A3/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/39—Convolvulaceae (Morning-glory family), e.g. bindweed
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/02—Drugs for disorders of the urinary system of urine or of the urinary tract, e.g. urine acidifiers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00—General protective or antinoxious agents
    • A61P39/06—Free radical scavengers or antioxidants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/30—Extraction of the material
    • A61K2236/33—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/30—Extraction of the material
    • A61K2236/33—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones
    • A61K2236/331—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones using water, e.g. cold water, infusion, tea, steam distillation, decoction

Definitions

  • the present invention relates to a pharmaceutical composition for the treatment of diabetes mellitus and its complications containing round leaf safflower extract, and more particularly, to the pharmaceutical composition for preventing or treating diabetes and its complications containing the same, Or it relates to a pharmaceutical composition for delay and to a pharmaceutical composition for preventing or treating cancer.
  • Diabetes is a metabolic disorder of multiple etiologies that is characterized by chronic hyperglycemia due to a lack of insulin secretion or a lack of insulin action. Chronic metabolism is associated with prolonged abnormal high levels of glucose in the blood. Various complications arise from the disorder and subsequent chronic vascular damage.
  • Diabetes is a representative adult metabolic disease that affects about 5% of the world's population, resulting in huge human and economic losses. Most diabetics are taking oral treatments, but no safe treatments have been developed. Insulin resistance is known to be the most important mechanism, but the exact mechanism is not yet clear, but a combination of genetic predisposition and environment has been found to work.
  • NIDDM Non-insulin dependent diabetes
  • Insulin is necessary for patients whose blood sugar is not controlled by diet and oral hypoglycemic agents.
  • insulin is a protein, so it is hydrolyzed and inactivated in the digestive tract so that it cannot be consumed orally and must be injected intravenously or subcutaneously.
  • Oral hypoglycemic agents are used to regulate blood glucose levels in NIDDM patients by enhancing the sensitivity of the insulin receptors in the cells and stimulating the pancreas to promote insulin secretion.
  • oral therapies for the treatment of NIDDM can cause hypoglycemia, nausea, vomiting, diarrhea, rashes, and the like, and particularly serious side effects such as fatal lactic acidosis.
  • oral hypoglycemic agents may cause cardiovascular disorders or gastrointestinal and liver disorders over long periods of time, so prolonged use is not recommended.
  • diabetes After 10 years of diabetes, almost every organ in the body is damaged, causing complications. These complications include hypoglycemia, ketoacidosis, hyperosmotic non-ketone hyperglycemia, hyperglycemic coma, diabetic acidemia, hypoglycemia, and chronic complications include diabetic retinopathy, diabetic cataract, diabetic nephropathy, diabetic neuropathy, Cardiovascular complications and viral infections. Chronic diabetic nephropathy is the most important cause of hemodialysis treatment and end stage renal failure, and diabetic cataracts cause blindness and eventually death.
  • Mechanisms for inducing diabetic complications are largely described as nonenzymatic glycation of proein of proteins, polyol pathways, and the like.
  • Nonenzymatic glycation of protein refers to the condensation reaction of a group of amino acids such as lysine residues of a protein and reducing sugars without enzymatic reaction, that is, a miliad reaction, resulting in a final glycation product. do.
  • Non-enzymatic glycosylation of protein (1) an amino acid group such as a lysine residue of a protein and an aldehyde or ketone of a reducing sugar undergo a nucleophilic addition reaction without enzymatic action to form a Schiff base, an early product.
  • the final glycosylated product is an irreversible reaction product. Once produced, blood sugar is not degraded even when it returns to normal, but accumulates in the tissue during protein survival to abnormally change the structure and function of the tissue. Causes complications throughout the tissue.
  • glycated albumin one of the final glycation products produced by the reaction of glucose and various proteins, is an important factor in causing chronic diabetic nephropathy.
  • Glycosylated albumin enters renal glomeruli more easily than normal albumin without glycosylation, and high concentrations of glucose stimulate mesangium cells to increase extracellular matrix synthesis.
  • Excessly introduced glycated albumin and increased extracellular matrix result in fibrosis of the glomeruli. These mechanisms continue to damage the glomerulus, leading to the stage of extreme treatment methods such as hemodialysis or organ transplantation.
  • chronic diabetes has been reported to accumulate collagen in the arterial wall, basal membrane protein in the renal glomeruli combined with the final glycation product accumulates in the tissue.
  • glycosylation occurs in proteins such as basement membrane, plasma albumin, lens protein, fibrin, and collagen by non-enzymatic protein glycosylation reaction, and the resulting glycosylated product abnormally changes the structure and function of diabetic diabetic retinopathy.
  • chronic diabetes complications such as retinopathy, diabetic cataract, diabetic nephropathy, and diabetic neuropathy. Therefore, it has been found that it is very important to suppress the formation of the final glycation end products in order to delay, prevent or treat the development of diabetic complications.
  • the final glycation product overexpresses VEGF mRNA and protein, vascular endothelial growth factor, causing non-proliferative or proliferative diabetic retinopathy.
  • Abnormal neovascularization or pathogenic growth of neovascularization is associated with a number of conditions. Such conditions include diabetic retinopathy, psoriasis, exudative or wet senile macular degeneration (ARMD), rheumatoid arthritis and other inflammatory diseases, and most cancers.
  • VEGF is expressed at abnormally high levels and angiogenesis or increased permeability.
  • ARMD is a clinically important angiogenic disease.
  • the disease is characterized by the formation of neovascularization in the choroid of one or both eyes of the elderly, and is a major cause of blindness in industrialized countries.
  • Anti-angiogenic agents used in various therapies can only induce stoichiometric reductions of VEGF or VEGF receptors, and the effects of these agents are reduced by abnormally high concentrations of VEGF produced in diseased tissues.
  • the present inventors have diligently tried to find a natural herbal medicine with low side effects for the treatment of diabetes mellitus and its complications.
  • the round leaf Ipomoea Quamoclit extract inhibits VEGF in human retinal pigment epithelial cell line and promotes insulin secretion in pancreatic beta cell line.
  • An object of the present invention is to provide a round leaf Ipomoea Quamoclit extract, which is a natural herbal substance for the treatment of diabetes mellitus and its complications.
  • Another object of the present invention to provide a pharmaceutical composition for preventing or treating diabetes mellitus and its complications containing such round leaf Ipomoea Quamoclit extract.
  • Still another object of the present invention is to provide an anti-aging or delaying pharmaceutical composition containing the round leaf Ipomoea Quamoclit extract.
  • Still another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer, which contains the round leaf Ipomoea Quamoclit extract.
  • Still another object of the present invention is to provide a method for preparing the round-leaf oil vinegar extract.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of diabetes mellitus and its complications containing round leaf vinegar extract.
  • the present invention also provides a dietary supplement for preventing diabetes and its complications containing round leaf vinegar extract.
  • the present invention also provides an anti-aging or delaying pharmaceutical composition containing round leaf vinegar extract.
  • the present invention also provides an anti-aging or delaying health functional food containing round leaf vinegar extract.
  • the present invention also provides a pharmaceutical composition for the prevention or treatment of cancer containing round leaf Ipomoea Quamoclit extract.
  • the present invention also comprises the steps of: (a) cutting the outpost of round leaf vinegar to extract with a solvent selected from the group consisting of water, alcohols, organic solvents and mixtures thereof to obtain an extract; And (b) filtering the extract and concentrating under reduced pressure to provide a round leaf vinegar extract.
  • step (c) further comprising the step of (c) separating and purifying the round leaf Ipomoea Quamoclit extract obtained in step (b) using activated carbon, and concentrating under reduced pressure to obtain a round leaf Ipomoea Quamo extract.
  • step (c) separating and purifying the round leaf Ipomoea Quamoclit extract obtained in step (b) using activated carbon, and concentrating under reduced pressure to obtain a round leaf Ipomoea Quamo extract.
  • the present invention also provides a round leaf Ipomoea Quamoclit extract prepared by the above method and having a VEGF inhibitory effect, an insulin secretion promoting effect, a hypoglycemic effect, a urine protein reduction effect and a lens turbidity reduction effect.
  • the present invention also provides a method for preventing or treating diabetes mellitus and its complications, comprising the step of administering the round leaf Ipomoea Quamoclit extract to a subject.
  • the present invention also provides a method for preventing or delaying aging, comprising the step of administering the round leaf Ipomoea Quamoclit extract to a subject.
  • the present invention also provides a method for preventing or treating cancer, comprising the step of administering the round leaf Ipomoea Quamoclit extract to a subject.
  • the present invention also provides the use of the round leaf Ipomoea Quamoclit extract for the treatment and prevention of diabetes mellitus and its complications.
  • the present invention also provides the use of anti-aging or delaying the extract of the round leaf Ipomoea Quamoclit.
  • the present invention also provides a use of the round leaf Ipomoea Quamoclit extract for cancer prevention or treatment.
  • Figure 1 shows the effect of inhibiting the expression of VEGF (vascular endothelial growth factor) in round leaf Ipomoea Quamoclit extract according to the present invention human retinal pigment epithelial cell line.
  • VEGF vascular endothelial growth factor
  • Figure 2 shows that the round leaf Ipomoea Quamoclit extract according to the present invention inhibits VEGF protein production in human retinal pigment epithelial cell line.
  • Figure 3 is a graph showing that the round leaf Ipomoea Quamoclit extract according to the present invention promotes insulin protein production in mouse pancreatic beta cell line.
  • Figure 4 shows the effect of round leaf Ipomoea Quamoclit extract according to the present invention on the body weight of high fat diet mice.
  • Figure 5 shows the blood glucose suppression effect of the round leaf Ipomoea Quamoclit extract according to the present invention high-fat diet group diabetic complications.
  • Figure 6 shows the effect of reducing round urine protein extract urine protein in urine of high fat diet group diabetic complications model animals.
  • Figure 7 shows the effect of inhibiting blood sugar of round leaf Ipomoea Quamoclit extract according to the present invention in a diabetic model animal.
  • Figure 8 shows the effect of inhibiting glycated hemoglobin of round leaf Ipomoea Quamoclit extract according to the present invention.
  • Figure 9 shows the effect of reducing round leaf vinegar extract urine protein in the urine of the diabetic model animal.
  • Figure 10 shows the effect of reducing turbid turbidity of the mouse lens of the round leaf Ipomoea Quamoclit extract according to the present invention.
  • the present invention relates to a pharmaceutical composition for the prevention and treatment of diabetes mellitus and its complications, and a dietary supplement, containing the extract of round leaf vinegar from one aspect.
  • the round leaf vinegar ( Quomoclit angulata ) is a vine perennial herb of the calliphyllaceae , and is also called a tortilla .
  • Round leaf Ipomoea Quamoclit extract according to the present invention can be prepared using a known method.
  • water, an alcohol, an organic solvent, or a mixture thereof may be extracted with a solvent, preferably, extracted with water or an alcohol, and further purified using activated carbon.
  • the round leaf vinegar extract is 51 g of crushed round leaf vinegar every 2 hours using an ultrasonic extractor at room temperature using a solvent selected from the group consisting of water, an alcohol, an aqueous alcohol solution, an organic solvent and a mixed solution thereof. Every 15 minutes extracted 2-3 days.
  • the extracted extract was concentrated under reduced pressure with a vacuum rotary concentrator at room temperature, and then the extracted residue was dried with a vacuum freeze dryer to obtain a round leaf vinegar extract available in water.
  • round leaf Ipomoea Quamoclit extract was passed through a column filled with activated charcoal to adsorb the active ingredient of Round Leaf Ipomoea cava, and the column filled with activated carbon was washed with distilled water to remove non-adsorbed components.
  • an organic solvent such as 10 to 50% (v / v) ethanol is supplied to the activated carbon packed column from which the non-adsorbed component has been removed while increasing the concentration continuously or stepwise to elute the active ingredient of round leaf vinegar adsorbed on the activated carbon.
  • round leaf vinegar extract was obtained.
  • the round leaf vinegar extract thus purified was concentrated under reduced pressure at room temperature using a vacuum rotary concentrator, and the concentrated extract was freeze-dried in vacuo and then dissolved in water to obtain a round leaf vinegar extract dissolved in water.
  • a diabetic indicator it was confirmed with respect to body weight, blood sugar, and proteinuria.
  • Round leaf Ipomoea Quamoclit extract was administered for 4 weeks using mice with high fat diet obesity-induced round leaf Ipomoea Quamoclit and showed hypoglycemic activity, and proteinuria, an early sign in diabetic nephropathy, was reduced by reducing urine protein. By confirming the decrease, it was confirmed that the round leaf Ipomoea Quamoclit extract according to the present invention can prevent diabetes.
  • the round leaf Ipomoea Quamoclit was administered to diabetic mice (Male C57BL / Ks DB / DB mouse) for 12 weeks, the results showed that the blood glucose lowering activity, glycosylated hemoglobin was found to be lower.
  • diabetic mice Male C57BL / Ks DB / DB mouse
  • the early signs of proteinuria decreased by confirming that the round leaf Ipomoea Quamoclit extract can cure diabetes.
  • the round leaf Ipomoea Quamoclit extract according to the present invention has been confirmed that there is no liver toxicity through the mouse liver toxicity test, can be significantly improved, treated and prevent diabetes and its complications without toxicity through appropriate administration to mammals have.
  • prevention or treatment means any form of treating, preventing in advance, or improving or improving the state of health resulting from diabetes or its complications.
  • the round leaf Ipomoea Quamoclit extract can prevent or treat the complications associated with diabetes as well as such diabetes, such complications include chronic hyperglycemia, atherosclerosis, microangiopathy, kidney disease, heart disease, diabetic retinopathy and others. It can be characterized in that it is selected from the group consisting of a combination of one or more ocular diseases, in another embodiment of the present invention, to determine whether to suppress cataract which is one complication of diabetes mellitus, round leaf vinegar through the lens culture of the mouse It was found that the extract inhibited cataract production.
  • diabetes includes all types of diabetes such as type 1 diabetes, type 2 diabetes, adult type diabetes occurring in young people, seismic autoimmune diabetes, pancreatic diabetes, and the like.
  • Hyperglycemia hyperinsulinemia, ompaired glucose tolerance, impaired fasting glucose, dyslipidemia, hypertriglyceridemia or insulin resistance (insulin resistance) and the like.
  • ophthalmic diseases include all cataracts caused by diabetes such as cataracts, macular degeneration, extraocular palsy, iris cystitis, optic neuritis, glaucoma, retinal degeneration, fundus bleeding, refractive error, subconjunctival, and autosomal bleeding. it means.
  • the pharmaceutical composition according to the present invention may be provided as a pharmaceutical composition including round leaf vinegar extract as an essential ingredient, alone or as one or more pharmaceutically acceptable carriers, excipients or diluents. It may also be provided in admixture with known therapeutic agents for diabetes or its complications.
  • the amount of the round leaf Ipomoea Quamoclit extract of the present invention may vary depending on the age, sex and weight of the patient, but generally in an amount of 0.01 to 200 mg / kg, preferably 0.1 to 40 mg / kg once daily Can be administered in several divided doses.
  • the pharmaceutical composition may be included in an appropriate pharmaceutically effective amount according to the type of diabetes mellitus and complications, the severity thereof, the age, weight, health condition, sex, route of administration, and duration of treatment.
  • pharmaceutically acceptable refers to a composition that is physiologically acceptable and that, when administered to a human, typically does not cause an allergic reaction such as gastrointestinal disorders, dizziness, or the like.
  • Pharmaceutically acceptable carriers include, for example, carriers for oral administration such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like, and parenteral administration such as water, suitable oils, saline, aqueous glucose and glycols. And the like, and may further include stabilizers, preservatives, fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives.
  • Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid.
  • Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.
  • Other pharmaceutically acceptable carriers may be referred to those described in the following literature ( Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).
  • compositions of the invention can also be formulated using methods known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal.
  • the formulations may be in the form of powders, granules, tablets, emulsions, syrups, aerosols, soft or hard gelatin capsules, sterile injectable solutions, sterile powders.
  • the pharmaceutical composition of the present invention can be administered to mammals such as mice, mice, livestock, humans, and the like by various routes. All modes of administration can be expected, for example by oral, tissue, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or cerebrovascular injections.
  • the pharmaceutical composition of the present invention can be administered in parallel with a known compound having the effect of preventing or treating diabetes.
  • the present invention relates to a method for treating and preventing diabetes and its complications, comprising administering to a mammal a therapeutically effective amount of a pharmaceutical composition containing such round leaf vinegar extract.
  • the round leaf Ipomoea Quamoclit extract according to the present invention may be prepared in the form of food for the purpose of preventing or improving diabetes and its complications. Therefore, the present invention relates to a health functional food that is a food composition containing round leaf vinegar extract as an active ingredient.
  • the health functional food according to the present invention is a food composition, and includes all forms such as functional food, nutritional supplement, health food and food additives.
  • Health functional foods of this type can be prepared in various forms according to conventional methods known in the art.
  • the round leaf vinegar extract itself of the present invention can be prepared in the form of tea, juice and drink for drinking, or granulated, encapsulated and powdered.
  • Functional foods also include beverages (including alcoholic beverages), fruits and processed foods (e.g. canned fruit, canned foods, jams, marmalade, etc.), fish, meat and processed foods (e.g. ham, sausage corned beef, etc.), Breads and noodles (e.g.
  • the present invention relates to an anti-aging or delayed pharmaceutical composition and a nutraceutical containing a round leaf Ipomoea Quamoclit extract.
  • diabetes is closely related to oxidative stress.
  • Chronic hyperglycemia in diabetes increases the production of free radicals by various pathways such as autooxidation of glucose and glycosylation of proteins, and oxidative stress is increased by these highly reactive substances.
  • Round leaf Ipomoea Quamoclit extract of the present invention inhibits the production of advanced glycation end products (AGEs), it can be expected to reduce the oxidative stress caused by foreign substances to prevent aging and delay aging.
  • AGEs advanced glycation end products
  • Such pharmaceutical compositions may be provided including the aforementioned pharmaceutically acceptable carriers, excipients, and the like, or may be provided in admixture with conventionally known anti-aging agents.
  • the dosage of the round leaf vinegar extract may be different, may vary according to the age, sex, weight, administration period of the patient, etc. in various forms using a known technique. It may be formulated and may be administered through various routes of administration. Therefore, the present invention relates to an anti-aging or delaying method comprising the step of administering the round leaf Ipomoea Quamoclit extract to a subject.
  • the health functional food also includes a variety of forms, such as functional foods, nutritional supplements, health foods, food additives, etc. as a food composition, various forms, for example, the aforementioned round according to conventional methods known in the art It is produced in the form of tea, juice and drink, granulated, encapsulated and powdered, or the extract is used in beverages, fruits and processed foods, fish, meat and processed foods, breads, noodles, seasonings, etc. It can be provided by adding to food to manufacture.
  • the present invention relates to a pharmaceutical composition for preventing or treating cancer, which contains round leaf vinegar extract.
  • Round leaf vinegar extract of the present invention by inhibiting the production of the final glycation product can be expected to prevent cancer and / or therapeutic effects by inhibiting the cancer caused by foreign substances. It has been reported that the final glycation products cause aging and carcinogenesis ( Tokuda, H., et al., Book of Abstract of 53rd GA Congress joint with SIF, P076, 2005). By inhibiting the production of VEGF can be expected to prevent or treat the cancer.
  • such a cancer is one of diseases related to neovascularization induced by Vaicular Endothelial Growth Factor (VEGF), and the type of cancer is, for example, all types of cancers known in the art such as lung cancer, gastric cancer, liver cancer, and pancreatic cancer. It is to encompass.
  • the prevention or treatment of cancer means that the proliferation and metastasis of cancer can be prevented at the same time by inhibiting VEGF production, and further, the cancer can be prevented.
  • Such pharmaceutical compositions may be provided including the aforementioned pharmaceutically acceptable carriers, excipients, and the like, or may be provided in admixture with known cancer prevention and treatment agents.
  • the progress of the round leaf Ipomoea Quamoclit extract may vary, depending on the age, sex, weight, administration period of the patient, and the like in various forms using a known technique It can be administered through various routes of administration. Therefore, the present invention relates to a method for treating and preventing cancer, comprising the step of administering the round leaf Ipomoea Quamoclit extract to a subject.
  • the present invention provides a method for preparing an extract comprising: (a) slicing the outposts of round leaf vinegar and extracting them with a solvent selected from the group consisting of water, alcohols, organic solvents and mixtures thereof, and (b) Filtration of the extract, and concentrated under reduced pressure, to provide a round leaf vinegar extract comprising the step of obtaining a round leaf vinegar extract.
  • the organic solvent may be applied to any of known extraction solvents such as hexane, ether, benzene, ethyl acetate, chloroform, acetonitrile and methanol.
  • extraction solvents such as hexane, ether, benzene, ethyl acetate, chloroform, acetonitrile and methanol.
  • water and alcohol are used, but are not limited thereto.
  • the method further comprises the step of (c) separating and purifying the round leaf Ipomoea Quamoclit extract obtained in step (b) using activated carbon and concentrating under reduced pressure to further obtain a round leaf Ipomoea Quamo extract. It may be characterized by.
  • the method using such activated carbon is specifically, the concentrated liquid obtained by concentration under reduced pressure in the step (b) It is possible to use a method of eluting 50% of ethanol in a mobile phase by column chromatography packed with activated carbon and eluting with water.
  • the present invention relates to a round leaf Ipomoea Quamoclit extract prepared by the above method and having a VEGF inhibitory effect, a hypoglycemic effect, an insulin expression promoting effect and a urine protein reduction effect.
  • Round leaf yuchocho was collected in Seogwang-ri, Andeok-myeon, Namdeok, Jeju. 51g of roundleaf yuchochoen was extracted with 100% alcohol at room temperature for 15 minutes every 2 hours for 2 to 3 days. After extraction, the extract was concentrated under reduced pressure at room temperature with a vacuum rotary concentrator, and the extracted residue was dried with a vacuum freeze dryer, and 7 g of the dried round leaf vinegar extract was dissolved in water to 0.075 mg / ml.
  • VEGF vascular endothelial growth factor
  • ARPE 19 cell line (ATCC, USA) is DMEM; 10% FBS (Fetal bovine serum) was added to F12 media and cultured.
  • FBS Fetal bovine serum
  • the cells were plated at a concentration of 1 ⁇ 10 5 cells / plate on a 60 ⁇ plate, and 10% FBS serum-free was added to DMEM low glucose media for 24 hours, followed by DMEM low glucose. Change to the medium containing 25 mM and 30 mM glucose, and add the final concentrations of the round leaf vinegar extracts of Example 1 and 2 to 0.2 ⁇ g / ml, and then confirm the mRNA expression inhibition of VEGF.
  • the cells were cultured in time and incubated for 72 hours to confirm VEGF protein production.
  • the control group was treated with 5.5mM glucose, which was based on the cells that do not express VEGF, and when the 25mM and 30mM glucose were treated, the VEGF expression level was compared to compare the inhibitory ability of VEGF expression of the round-leaf oil extract.
  • the 25mM and 30mM glucose concentrations used in the experiments are the concentrations of conditions that optimize the expression of VEGF in each experiment.
  • RNA from ARPE 19 cells cultured by the above method was removed and then separated using TRIzol reagent (Invitrogen, USA), using the primers of SEQ ID NOs: 1 and 2, RT-PCR (reverse transcriptase). -Polymerase chain reaction was performed to confirm the expression of VEGF mRNA.
  • a culture solution of ARPE 19 cells cultured by the above method was obtained, and the amount of VEGF secreted using the VEGF ELISA kit (R & D, UK) was measured.
  • Min 6 cell line which is a mouse pancreatic beta cell line treated with the round-leafed Ipomoea Quamoclit extract prepared in Examples 1 and 2.
  • Min 6 (ATCC, USA) was cultured by adding 15% FBS (fetal bovine serum) to HDMEM media.
  • FBS fetal bovine serum
  • plate the cells at a concentration of 1 ⁇ 10 4 cells / plate in a 96 well plate add 15% FBS serum-free to DMEM high glucose media, and incubate for 72 hours and wash with PBS buffer After 2 hours of incubation in HBSS buffer solution, 25mM glucose was added to the HBSS buffer solution, and the round leaf vinegar extract was added to a final concentration of 0.2 ⁇ g / ml, and then incubated for 2 hours to confirm whether or not to promote insulin expression.
  • the control group was treated with 5.5mM glucose to control the insulin expression of the cell itself that did not induce insulin expression, and when the 25mM glucose treatment was confirmed, the degree of insulin expression was compared and analyzed for the promotion of insulin expression of round-leaf oil.
  • a culture solution of Min 6 cells cultured by the above method was obtained, and the amount of insulin secreted was measured using an insulin ELISA kit (R & D, UK).
  • an insulin ELISA kit R & D, UK
  • mice Five-week-old mice (Male C57BL / 6J, 19g, Coretech, Pyeongtaek) were purchased and used for experiments after adapting for one week under constant temperature (25 ° C.) and humidity (50%).
  • Four mice in each group were divided into two groups: the normal diet fed with normal feed and the high fat diet fed with high fat feed, and the general water fed with drinking water.
  • the experimental group fed high fat diet with high fat feed.
  • As a drinking water water diluted with 0.075 mg / ml concentration of the round leaf Ipomoea Quamoclit extract prepared in Example 1 was supplied.
  • Each control group and the experimental group were raised for 4 weeks. Changes in body weight and blood glucose were measured weekly, and urine was collected four weeks after administration to measure urine protein concentration.
  • the high-fat diet group showed higher blood sugar level than the general diet group, but the high-fat diet group had a significant drop effect in the water diluted with 0.075 mg / ml round leaf saponica extract. (FIG. 5).
  • Urine protein analysis was performed using ELISA kit (Exocell, America) to collect urine from mice that had been administered for 4 weeks.
  • the high-fat diet group showed an increase in urine protein as compared to the general diet group, but a significant decrease in the group fed with a diluted solution of 0.075 mg / ml round leaf vinegar to high-fat diet Seemed. This suggests that the urine protein concentration is reduced by improving the function of the kidney, which is characteristic of high-fat diet-induced mice.
  • mice and real diabetic mice were treated with the round leaf vinegar extract prepared in Example 2 to confirm the change in blood glucose, glycated hemoglobin and urine proteins, which are diabetes markers.
  • a 6-week-old mouse (Male C57BL / 6J mouse, 20g, central laboratory animal, Seoul) and a 6-week-old diabetic mouse (Male C57BL / Ks DB / DB mouse, 20g, central laboratory animal, Seoul) were purchased. °C and humidity (50%) was used for 1 week after adapting.
  • mice in each group were used for 12 weeks in the normal mouse control group, the diabetic mouse control group, and the round leaf lactose activated carbon extract prepared in Example 2, divided into groups fed with diluted water at a concentration of 0.1 mg / ml. Changes in blood glucose were measured every two weeks, and urine protein concentrations were measured every six weeks, and blood concentrations were measured by collecting blood after 12 weeks of breeding.
  • the diabetic mouse control group showed an elevated blood sugar level as compared to the normal mouse control group.
  • diabetic mice were supplied with water diluted with 0.1 mg / ml of round-leaf lactose. The group showed a significant drop effect.
  • Glycated hemoglobin is a glycosylated hemoglobin that is normally present in red blood cells. Glycated hemoglobin reflects average blood glucose levels over two to four months, which is useful for determining long-term glycemic control.
  • the group was supplied with water diluted with 0.1 mg / ml concentration of the round leaf Ipomoea Quamoclinic prepared in the normal mouse control group, the diabetic mouse control group, and Example 2 every 6 weeks. Blood was collected and measured using an ELISA kit (Cusabio biotech, Japan).
  • the diabetic mouse control group showed abnormally elevated blood glucose levels in the glycated hemoglobin level compared to the normal mouse control group, but diluted with 0.1 mg / ml round leaf lactose extract in diabetic mice.
  • the group fed with water showed a significantly lowering effect than the normal mouse control group.
  • the diabetic mouse control group showed an increase in urine protein compared to the normal mouse control group, but in the group of diabetic mice supplied with water diluted with 0.1 mg / ml round leaf vinegar Significantly decreased values.
  • mice and six-week-old diabetic mice were purchased and used for liver toxicity testing after one week of adaptation under constant temperature (25 ° C.) and humidity (50%).
  • mice Five mice were used in each group, and the mice were fed for 12 weeks by dividing the normal leaf control group, the diabetic mouse control group, and the round leaf whey extract prepared in Example 2 into the group supplied with diluted water at a concentration of 0.1 mg / ml. After breeding for 12 weeks, blood was collected and alanine transaminases were measured.
  • Alanine transaminase is an amino acid metabolic enzyme that is used as a representative test for diagnosis and follow-up. Maintaining concentrations of alanine transaminases suggests no liver damage.
  • mice Six-week-old mice (Male C57BL / 6J mouse, 20 g, central laboratory animals, Seoul) were purchased and used for liver toxicity testing after one week of adaptation under constant temperature (25 ° C) and humidity (50%).
  • mice per group Five mice per group were divided into a control group, a round leaf vinegar extract administration group prepared in Example 2, and administered three times at a concentration of 1000 mg / kg, and blood was collected to measure alanine transaminases concentration.
  • Alanine transaminases are amino acid metabolic enzymes that are used as representative tests for diagnosis and follow-up. Maintaining the concentration of alanine transaminases proves that there is no damage to the liver.
  • blood of the control group and the round leaf Ipomoea Quamoclit administration group was collected and measured using an ELISA kit (Cusabio biotech, Japan).
  • the round leaf Ipomoea Quamoclit administration group showed similar values as the control group, and it was confirmed that there was no liver toxicity by this extract.
  • mice The eyes of the mice were taken out and put in an iodine solution for a while to disinfect only the lenses. It was placed in M199 medium and cultured in a cell culture phase. Incubation with 20mM xylose in the medium may cause turbidity of the lens, and the turbidity of the lens was measured using a CCD camera.
  • composition according to the present invention exhibits an excellent effect on lowering blood sugar, promoting insulin secretion, inhibiting urine protein, and reducing lens turbidity, thereby having an excellent effect on preventing or treating diabetes and various complications.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Diabetes (AREA)
  • Medical Informatics (AREA)
  • Biotechnology (AREA)
  • Urology & Nephrology (AREA)
  • Nutrition Science (AREA)
  • Cardiology (AREA)
  • Polymers & Plastics (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Food Science & Technology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Endocrinology (AREA)
  • Biochemistry (AREA)
  • Toxicology (AREA)
  • Emergency Medicine (AREA)
  • Ophthalmology & Optometry (AREA)
  • Vascular Medicine (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Abstract

본 발명은 둥근잎유홍초 추출물을 함유하는 당뇨병 및 그 합병증 치료용 약학적 조성물에 관한 것으로, 보다 상세하게는, 둥근잎유홍초 추출물 및 이를 함유하는 당뇨병 및 그 합병증 예방 또는 치료용 약학적 조성물, 노화방지 또는 지연용 약학적 조성물 및 암 예방 또는 치료용 약학적 조성물에 관한 것이다. 본 발명에 따른 조성물은 우수한 혈당강하, 인슐린 분비촉진, 뇨단백 저해작용 및 수정체 혼탁도 감소효과를 나타내어, 당뇨병 및 이로 인한 각종 합병증의 예방 또는 치료에 탁월한 효과를 가진다.

Description

둥근잎유홍초 추출물을 함유하는 당뇨병 치료용 약학적 조성물
본 발명은 둥근잎유홍초 추출물을 함유하는 당뇨병 및 그 합병증 치료용 약학적 조성물에 관한 것으로, 보다 상세하게는, 둥근잎유홍초 추출물 및 이를 함유하는 당뇨병 및 그 합병증 예방 또는 치료용 약학적 조성물, 노화방지 또는 지연용 약학적 조성물 및 암 예방 또는 치료용 약학적 조성물에 관한 것이다.
당뇨병(diabetes)은 인슐린의 분비 결함 또는 인슐린 작용의 결함에서 기인한 만성 고혈당증(hyperglycemia)의 특징을 나타내는 다중적 병인의 대사장애를 말하며, 혈중의 포도당이 비정상적으로 높은 상태가 장기간 지속될 경우 만성적인 대사장애와 이에 따른 만성적 혈관손상으로 다양한 합병증이 발생한다.
당뇨병은 대표적인 성인성 대사질환으로 세계인구의 약 5%가 앓고 있으며, 그로 인한 인명적, 경제적 손실은 실로 막대하다. 당뇨병 환자의 대부분은 경구용 치료제를 복용하고 있으나, 현재까지 안전한 치료제가 개발되어 있지 않은 실정이다. 인슐린 저항성(insulin resistance)이 가장 중요한 기전적 원인으로 알려져 있지만, 정확한 기전은 아직 확실하지 않으며, 다만 유전적인 소인과 환경의 복합적인 원인이 작용하는 것으로 밝혀져 있다.
당뇨병은 전 세계적으로 3번째로 심각한 질병으로 2010년까지 약 2억 5천만명의 당뇨병환자가 예상되며, 국내의 경우에도 계속적인 증가가 예견되고 있다. 국내 사망원인 중 7번째로 높으며, 전체 당뇨병환자의 90% 이상을 차지하고 있는 인슐린 비의존성 당뇨병(non-insulin dependent diabetes, NIDDM)은 주로 40대 이후에 발병되어 성인형 당뇨병이라 불리며 인슐린을 충분히 생성시키지 못하거나 적절히 이용하지 못함으로써 야기되는 대사 장애이다. NIDDM의 발병 원인은 명확히 밝혀져 있지는 않지만, 서양화된 식생활 및 생활방식 등의 환경적 요인과 비만 및 운동 부족과 같은 유전적인 요인이 모두 작용하는 것으로 생각되어진다. NIDDM은 보통 식이요법 및 운동요법으로 치료를 먼저 시도하고, 이 방법에 의한 치료 효과가 충분치 않은 경우, 일반적으로 약물들이 이용되는데 많은 경우 인슐린이 사용된다.
인슐린은 식사요법과 경구 혈당강하제로 혈당이 조절되지 않는 환자에게 필요하나, 인슐린은 단백질이므로 소화관에서는 가수 분해되어 비활성화되므로 구강으로는 섭취할 수 없고 정맥이나 피하 내에 주사하여야 한다는 단점이 있다.
경구 혈당 강하제는 세포의 인슐린 수용체의 감도를 향상시키고 췌장을 자극하여 인슐린의 분비를 촉진시키므로 NIDDM환자의 혈당을 조절하는 데에 사용된다.
그러나, NIDDM의 치료를 위한 경구 치료법은 저혈당증, 구역질, 구토, 설사, 발진 등을 일으킬 수 있으며, 특히 치명적인 젖산 산증과 같은 심각한 부작용을 야기할 수 있다. 이 외에도 경구 혈당 강하제는 장기간 사용시 심혈관계 장해나 위 장관 및 간의 장해를 유발시키므로 장시간의 사용은 권장되지 않는다.
이와 같은 결점 및 부작용으로 인하여 현재의 치료제 중 만족스러운 효능을 나타내고 동시에 안전성이 높아 부작용 측면에서도 안심할 수 있어 모든 당뇨병 환자에게 적용될 수 있는 약물이 거의 없기 때문에 당뇨병 특히 NIDDM을 치료하기 위한 보다 효율적인 약물의 개발이 절실히 요구되고 있다.
당뇨병에 걸린 후 10년이 지나면 체내의 거의 모든 기관이 손상을 받아 합병증이 유발된다. 이러한 합병증으로 급성 병증에는 저혈당증, 케톤산혈증, 고삼투압성 비케톤성 고혈당증, 고혈당성 혼수, 당뇨병성 산혈증, 저혈당증 등이 있으며 만성 합병증에는 당뇨병성 망막증, 당뇨성 백내장, 당뇨병성 신질환, 당뇨병성 신경장해, 심혈관계 합병증, 바이러스 감염 등이 있다. 만성 당뇨성 신증은 혈액 투석 치료 및 말기 신부전의 가장 중요한 원인이 되고 있으며, 당뇨성 백내장은 실명을 초래하고 결국엔 죽음에 이른다.
이러한 당뇨합병증을 유발하는 기전으로는 크게 단백질의 비효소적 당화반응(nonenzymatic glycation of proein), 폴리올 경로(polyol pathway) 등으로 설명되고 있다.
단백질의 비효소적 당화반응(nonenzymatic glycation of protein)이란, 단백질의 리신 잔기 등의 아미노산 그룹과 환원당이 효소작용 없이 축합반응 즉 밀리아드 반응이 발생하는 것으로, 이 반응의 결과로 최종 당화산물이 생성된다. 단백질의 비효소적 당화반응은 (1)단백질의 리신 잔기 등의 아미노산 그룹과 환원당의 알데히드 또는 케톤이 효소작용 없이 친핵성 첨가 반응을 하여 초기 단계 산물인 쉬프염기(schiff base)를 형성하고, 상기 쉬프염기와 인접한 케토아민 어닥트(ketoamine adduct)가 서로 축합하여 가역적인 아마도리(amadori)형의 조기 당화산물이 생성되는 단계와 (2)고혈당 상태가 지속되어 가역적인 아마도리형의 조기 당화산물이 분해되지 않고 재배열(rearrangement)되어 단백질과 교차결합(cross-linking)하여 비가역적인 최종 당화산물이 생성되는 단계로 나눌 수 있다.
가역적인 아마도리형의 조기 당화산물과 달리 최종 당화산물은 비가역적인 반응 산물이므로, 일단 생성되면 혈당이 정상으로 회복되어도 분해되지 않고 단백질 생존기간 동안 조직에 축적되어 조직의 구조와 기능을 비정상적으로 변화시켜 조직 곳곳에서 합병증을 유발시킨다.
예를 들면, 포도당과 여러 종류의 단백질이 반응하여 생성된 최종 당화산물 중 하나인 당화 알부민은 만성 당뇨성 신증을 일으키는 중요한 요인으로 작용한다. 당화 알부민은 당화가 진행되지 않은 정상 알부민에 비해 더 용이하게 신사구체 세포 내로 유입되고, 고농도의 포도당은 메산지움 세포를 자극하여 세포외 기질(extracellular matrix) 합성을 증가시킨다. 과도하게 유입된 당화 알부민과 증가된 세포외 기질로 인하여 신사구체의 섬유화가 야기된다. 이와 같은 기전으로 신사구체가 계속 손상 받게 되어 혈액투석 또는 장기이식 등의 극단적인 치료방법을 쓸 수밖에 없는 단계에 이르게 되는 것이다. 또한, 만성 당뇨로 인하여 동맥벽에서는 콜라겐이, 신사구체에서는 기저막성 단백질이 최종 당화산물과 결합되어 조직에 축적됨이 보고된바 있다.
이처럼 비효소적 단백질 당화반응에 의하여 기저막, 혈장 알부민, 수정체 단백질, 피브린, 콜라겐 등의 단백질에서 당화가 일어나며, 생성된 최종 당화산물이 조직의 구조와 기능을 비정상적으로 변화시켜 당뇨성 망막병증(diabetic retinopathy), 당뇨성 백내장(diabetic cataract), 당뇨성 신증(diabetic nephropathy), 당뇨성 신경병증(diabetic neuropathy) 등의 만성 당뇨합병증을 유발시킨다. 따라서, 당뇨합병증의 발병을 지연하거나 예방 또는 치료하기 위해서는 최종당화산물의 형성을 억제하는 것이 매우 중요함이 밝혀졌다.
또한, 최종 당화산물은 혈관내피세포 성장인자인 VEGF mRNA와 단백질을 과발현하여 비증식성 또는 증식성 당뇨병성 망막병증을 유발한다. 비정상적인 신생혈관형성 또는 신생 혈관의 병리적(pathogenic) 성장은 다수의 상태와 관련되어 있다. 이러한 상태는 당뇨병성 망막병증, 건선, 삼출성 또는 젖은형(wet) 노인성 황반변성(ARMD), 류마티스 관절염 및 기타 염증성 질환, 및 대부분의 암을 포함한다. 이러한 상태와 관련된 질병에 걸린 조직 또는 종양에서 VEGF는 비정상적인 높은 수준으로 발현되고 혈관신생 또는 혈관투과성이 증가되어 있다. 특히, ARMD는 임상적으로 중요한 혈관신생질환이다. 이 질환은 노인의 한쪽 눈 또는 양쪽 눈의 맥락막에서 신생혈관이 형성되는 것을 특징으로 하며, 산업화된 국가에서 실명의 주요 요인이 되고 있다. 여러 치료요법에서 사용된 항-신생혈관형성 제제는 단지 VEGF 또는 VEGF 수용체의 화학량적 감소를 유도할 수 있고, 이들 제제의 효과는 질병에 걸린 조직에서 비정상적인 고농도로 생성된 VEGF에 의해서 감소된다.
이에, 본 발명자들은 당뇨병 및 그로 인한 합병증 치료를 위한 부작용이 적은 천연 생약물질을 찾고자 예의 노력한 결과, 둥근잎유홍초 추출물이 사람 망막색소 상피 세포주에서 VEGF를 억제하는 동시에 췌장 베타 세포주에서 인슐린 분비를 촉진시키는 역할을 하고, 고지방식이군 마우스 및 당뇨 모델 마우스에 둥근잎유홍초 추출물을 함께 섭취시키는 경우, 당뇨 지표가 감소한다는 것을 확인하고, 본 발명을 완성하게 되었다.
발명의 요약
본 발명의 목적은 당뇨병 및 그로 인한 합병증 치료를 위한 천연 생약물질인 둥근잎유홍초 추출물을 제공하는데 있다.
본 발명의 다른 목적은 이러한 둥근잎유홍초 추출물을 함유하는 당뇨병 및 그 합병증 예방 또는 치료용 약학적 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 둥근잎유홍초 추출물을 함유하는 노화방지 또는 지연용 약학적 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 둥근잎유홍초 추출물을 함유하는 암 예방 또는 치료용 약학적 조성물을 제공하는데 있다.
본 발명의 또 다른 목적은 상기 둥근잎유홍초 추출물의 제조방법을 제공하는데 있다.
상기 목적을 달성하기 위하여, 본 발명은 둥근잎유홍초 추출물을 함유하는 당뇨병 및 그 합병증 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명은 또한, 둥근잎유홍초 추출물을 함유하는 당뇨병 및 그 합병증 예방용 건강기능식품을 제공한다.
본 발명은 또한, 둥근잎유홍초 추출물을 함유하는 노화방지 또는 지연용 약학적 조성물을 제공한다.
본 발명은 또한, 둥근잎유홍초 추출물을 함유하는 노화방지 또는 지연용 건강기능식품을 제공한다.
본 발명은 또한, 둥근잎유홍초 추출물을 함유하는 암 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명은 또한, (a) 둥근잎유홍초의 전초를 세절하여 물, 알코올, 유기용매 및 이들의 혼합물로 구성되는 군에서 선택되는 용매로 추출하여 추출액을 수득하는 단계; 및 (b) 상기 추출액을 여과하고, 감압농축하여, 둥근잎유홍초 추출물을 수득하는 단계를 포함하는 둥근잎유홍초 추출물의 제조방법을 제공한다.
본 발명에 있어서, (c) 상기 (b)단계에서 수득한 둥근잎유홍초 추출물을 활성탄을 이용하여 분리정제하고, 감압 농축하여 둥근잎유홍초 추출물을 수득하는 단계를 추가로 더 포함하는 것을 특징으로 할 수 있다.
본 발명은 또한, 상기 방법으로 제조되고, VEGF 억제효과, 인슐린 분비 촉진 효과, 혈당강하효과, 뇨단백 감소효과 및 수정체 혼탁도 감소효과를 가지는 둥근잎유홍초 추출물을 제공한다.
본 발명은 또한, 상기 둥근잎유홍초 추출물을 대상에 투여하는 단계를 포함하는, 당뇨병 및 그 합병증 예방 또는 치료방법을 제공한다.
본 발명은 또한, 상기 둥근잎유홍초 추출물을 대상에 투여하는 단계를 포함하는, 노화 방지 또는 지연방법을 제공한다.
본 발명은 또한, 상기 둥근잎유홍초 추출물을 대상에 투여하는 단계를 포함하는, 암 예방 또는 치료방법을 제공한다.
본 발명은 또한, 상기 둥근잎유홍초 추출물의 당뇨병 및 그 합병증의 치료 및 예방의 용도를 제공한다.
본 발명은 또한, 상기 둥근잎유홍초 추출물의 노화 방지 또는 지연의 용도를 제공한다.
본 발명은 또한, 상기 둥근잎유홍초 추출물의 암 예방 또는 치료의 용도를 제공한다.
본 발명의 다른 특징 및 구현예는 다음의 상세한 설명 및 첨부한 특허청구범위로부터 더욱 명백해 질 것이다.
도 1은 본 발명에 따른 둥근잎유홍초 추출물이 사람 망막색소 상피 세포주에서 VEGF(vascular endothelial growth factor)의 발현을 억제하는 효과를 확인한 것이다.
도 2는 본 발명에 따른 둥근잎유홍초 추출물이 사람 망막색소 상피 세포주에서 VEGF 단백질 생산을 저해하는 것을 나타낸 것이다.
도 3은 본 발명에 따른 둥근잎유홍초 추출물이 마우스 췌장 베타 세포주에서 인슐린 단백질 생산을 촉진시키는 것을 나타낸 그래프이다.
도 4는 본 발명에 따른 둥근잎유홍초 추출물이 고지방식이군 마우스의 체중에 미치는 영향을 나타낸 것이다.
도 5는 본 발명에 따른 둥근잎유홍초 추출물이 고지방식이군 당뇨합병증 모델 동물의 혈당 억제효과를 나타낸 것이다.
도 6은 본 발명에 따른 둥근잎유홍초 추출물이 고지방식이군 당뇨합병증 모델 동물의 소변내 뇨 단백 감소효과를 나타낸 것이다.
도 7은 본 발명에 따른 둥근잎유홍초 추출물이 당뇨 모델 동물의 혈당 억제효과를 나타낸 것이다.
도 8은 본 발명에 따른 둥근잎유홍초 추출물이 당뇨 모델 동물의 당화 혈색소 억제효과를 나타낸 것이다.
도 9는 본 발명에 따른 둥근잎유홍초 추출물이 당뇨 모델 동물의 소변내 뇨 단백 감소효과를 나타낸 것이다.
도 10은 본 발명에 따른 둥근잎유홍초 추출물이 마우스 수정체의 혼탁도 감소효과를 나타낸 것이다.
발명의 상세한 설명 및 구체적인 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법 및 이하에 기술하는 실험 방법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
이하, 본 발명을 상세히 설명한다.
본 발명은 일 관점에서, 둥근잎유홍초 추출물을 함유하는 당뇨병 및 그 합병증 예방 또는 치료용 약학적 조성물 및 건강기능식품에 관한 것이다.
본 발명에서 사용된 둥근잎유홍초(Quamoclit angulata)는 통화식물목 메꽃과의 덩굴성 한해살이 풀로서, 능조라라고도 한다. 열대 아메리카 원산이며 주로 관상용으로 재배되고 있으며, 덩굴은 나팔꽃처럼 자라면서 왼쪽으로 감아 올라가는 특징이 있다. 전초의 길이는 3m 내외이다. 잎은 어긋나고 잎자루가 길며 심장 모양 원형이다. 잎 끝이 갑자기 뾰족해지며 밑부분의 양쪽 끝이 뾰족한 각으로 된다. 꽃은 8∼9월에 피고 노란빛을 띤 홍색이며 긴 꽃대 끝에 3∼5개씩 달린다. 꽃은 나팔꽃을 축소시킨 것과 같은 모양이고 꽃받침·수술은 각각 5개씩이며 암술은 1개이다. 열매는 삭과로 둥글고 9월에 익으며 꽃받침이 남아 있다. 유홍초와 비슷하지만 잎이 갈라지지 않는다.
본 발명에 따른 둥근잎유홍초 추출물은 공지의 방법을 사용하여 제조할 수 있다. 예를 들어, 물, 알코올, 유기 용매, 또는 이들의 혼합물을 용매로 추출될 수 있으며, 바람직하게는, 물 또는 알코올을 이용하여 추출할 수 있으며, 추가적으로 활성탄을 이용하여 분리정제 할 수 있다.
본 발명의 일 양태에서, 둥근잎유홍초 추출물은 파쇄한 둥근잎유홍초 51g을 물, 알코올, 알코올 수용액, 유기용매 및 그 혼합용액으로 구성된 군에서 선택되는 용매를 이용하여 실온에서 초음파 추출기로 매2시간 마다 15분씩 2~3일 추출하였다. 상기 추출된 추출물은 상온에서 진공 회전 농축기로 감압 농축시킨 다음, 추출된 잔사를 진공 동결 건조기로 건조한 후에 물로 가용한 둥근잎유홍초 추출물을 얻었다.
또한, 상기 수득된 둥근잎유홍초 추출물은 활성탄이 충진된 컬럼에 통과시켜 둥근잎유홍초의 유효성분을 흡착시키고, 활성탄이 충진된 컬럼을 증류수로 세척하여 비 흡착성분을 제거하였다. 이와 같이 비 흡착성분이 제거된 활성탄 충진 컬럼에 10~50%(v/v) 에탄올 등의 유기용매를 연속적 또는 단계적으로 농도를 높여가며 공급하여 활성탄에 흡착된 둥근잎유홍초의 유효성분을 용출시켜 분리정제한 다음, 둥근잎유홍초 추출물을 수득하였다. 이와 같이 정제된 둥근잎유홍초 추출물은 진공 회전 농축기를 이용하여 상온에서 감압 농축하고, 상기 농축된 추출물을 진공 동결 건조시킨 다음, 물로 가용시켜 물에 용해된 둥근잎유홍초 추출물을 수득하였다.
본 발명의 일 실시예에서는, 당뇨 지표로써, 체중, 혈당, 단백뇨에 관하여 확인하였다. 둥근잎유동초 추출물을 고지방식이법으로 비만이 유도된 마우스를 이용하여 둥근잎유홍초를 4주간 투여한 결과, 혈당 강하 활성을 나타냄을 확인할 수 있었고, 뇨단백의 감소를 통해 당뇨병성 신증에서는 초기 징후인 단백뇨가 감소함을 확인함으로써, 본 발명에 따른 둥근잎유홍초 추출물이 당뇨병을 예방할 수 있음을 확인하였다.
본 발명의 다른 실시예에서는, 둥근잎유홍초 추출물을 당뇨병 마우스(Male C57BL/Ks DB/DB mouse)를 이용하여 둥근잎유홍초를 12주간 투여한 결과, 혈당 강하 활성을 나타냄을 확인할 수 있었고, 당화 혈색소의 수치가 낮아짐을 확인할 수 있었다. 또한 뇨단백의 감소를 통해 당뇨병성 신증에서 초기 징후인 단백뇨가 감소함을 확인함으로써, 이러한 둥근잎유홍초 추출물이 당뇨병을 치료할 수 있음을 확인하였다.
또한, 본 발명에 따른 둥근잎유홍초 추출물은 마우스 간 독성 검사를 통해, 간 독성이 없음을 확인하였으므로, 포유동물에 적절한 투여를 통해 독성 없이 당뇨병 및 그 합병증을 유의적인 수준으로 개선, 치료 및 예방할 수 있다.
여기서, “예방 또는 치료”란, 당뇨병 또는 그 합병증을 치료하거나, 미리 예방하거나, 또는 당뇨병 또는 그 합병증으로 인한 건강 상태를 호전시키거나 개선시키는 모든 형태를 의미한다.
또한, 둥근잎유홍초 추출물은 이러한 당뇨병뿐만 아니라, 당뇨병에 따른 합병증을 예방 또는 치료할 수 있으며, 상기 합병증으로는, 만성 고혈당증, 아테롬성 동맥경화증, 미세혈관병증, 신장질환, 심장질환, 당뇨병성 망막증 및 그외 하나 이상의 안과질환의 조합으로 구성된 군에서 선택되는 것을 특징으로 할 수 있고, 본 발명의 또 다른 실시예에서는, 당뇨병의 일 합병증인 백내장 억제 여부를 확인하기 위하여, 마우스의 렌즈 배양을 통하여 둥근잎유홍초 추출물이 백내장 생성을 억제시킴을 확인하였다.
여기서, 당뇨병은 제1형 당뇨, 제2형 당뇨, 젊은이에게 발생하는 성인형 당뇨병, 지진성 자가면역성 당뇨병, 췌장 당뇨병 등의 모든 종류의 당뇨병을 포함하는 것이며, 당뇨병 이외에도, 당뇨병 관련 질환으로써, 합병증으로써 위에서 언급한 고혈당증 (hyperglycemia), 고인슐린혈증 (hyperinsulinemia), 내당능 이상 (ompaired glucose tolerance), 공복혈당장애 (impaired fasting glucose), 지질대사이상 (dyslipidemia), 고중성지방혈증 (hypertriglyceridemia) 또는 인슐린 저항 (insulin resistance) 등을 포함하는 것이다.
여기서, 안과질환은 당뇨병성 망막증 이외에도, 백내장, 황반변성증, 외안근 마비, 홍채 모양체염, 시신경염, 녹내장, 망막퇴행, 안저출혈, 굴절이상, 결막하, 초자체 출혈 등 당뇨병으로 인하여 유발되는 모든 안과질환을 의미한다.
본 발명에 따른 약학적 조성물은 둥근잎유홍초 추출물을 필수 성분으로 하되, 이를 단독으로 포함하거나, 하나 이상의 약학적으로 허용되는 담체, 부형제 또는 희석제를 포함하여 약학적 조성물로 제공될 수 있으며, 종래에 알려져있는 당뇨병 또는 그 합병증의 치료물질과 혼합하여 제공될 수도 있다. 본 발명의 둥근잎유홍초 추출물의 사용량은 환자의 나이, 성별, 체중에 따라 달라질 수 있으나, 일반적으로 0.01 내지 200 mg/kg의 양, 바람직하게는 0.1 내지 40 mg/kg의 양을 일일 1회 내지 수회로 나누어 투여할 수 있다. 또한, 당뇨병 및 합병증의 종류, 이의 중증정도, 환자의 연령, 체중, 건강상태, 성별, 투여 경로 및 치료 기간 등에 따라 적절한 약학적으로 유효한 양으로 약학적 조성물에 포함될 수 있다.
상기에서 "약학적으로 허용되는"이란 생리학적으로 허용되고 인간에게 투여될 때, 통상적으로 위장 장애, 현기증과 같은 알레르기 반응 또는 이와 유사한 반응을 일으키지 않는 조성물을 말한다. 약학적으로 허용되는 담체로는 예를 들면, 락토스, 전분, 셀룰로스 유도체, 마그네슘 스테아레이트, 스테아르산 등과 같은 경구 투여용 담체 및 물, 적합한 오일, 식염수, 수성글루코스 및 글리콜 등과 같은 비경구 투여용 담체 등이 있으며 안정화제, 보존제, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제 및 방부제 등을 추가로 포함할 수 있다. 적합한 안정화제로는 아황산수소나트륨, 아황산나트륨 또는 아스코르브산과 같은 항산화제가 있다. 적합한 보존제로는 벤즈알코늄 클로라이드, 메틸- 또는 프로필-파라벤 및 클로로부탄올이 있다. 그 밖의 약학적으로 허용되는 담체로는 다음의 문헌에 기재되어 있는 것을 참고로 할 수 있다(Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).
또한 본 발명의 약학적 조성물은 포유동물에 투여된 후 활성 성분의 신속, 지속 또는 지연된 방출을 제공할 수 있도록 당업계에 공지된 방법을 사용하여 제형화될 수 있다. 제형은 분말, 과립, 정제, 에멀젼, 시럽, 에어로졸, 연질 또는 경질 젤라틴 캅셀, 멸균 주사 용액, 멸균 분말의 형태일 수 있다.
본 발명의 약학적 조성물은 쥐, 생쥐, 가축, 인간 등의 포유동물에 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구, 조직, 직장 또는 정맥, 근육, 피하, 자궁내 경막 또는 뇌혈관내 주사에 의해 투여될 수 있다. 또한, 본 발명의 약학적 조성물은 당뇨병의 예방 또는 치료하는 효과를 가지는 공지의 화합물과 병행하여 투여할 수 있다.
따라서, 본 발명은 이러한 둥근잎유홍초 추출물을 함유한 약학적 조성물의 치료학적 유효량을 포유동물에 투여하는 단계를 포함하는 당뇨병 및 그 합병증을 치료 및 예방하는 방법에 관한 것이다.
또한, 본 발명에 따른 둥근잎유홍초 추출물은 당뇨병 및 그 합병증의 예방 또는 개선의 목적으로 식품의 형태로 제조될 수 있다. 따라서 본 발명은 둥근잎유홍초 추출물을 유효성분으로 함유하는 식품 조성물인 건강기능식품에 관한 것이다.
본 발명에 따른 건강 기능 식품은 식품 조성물로써, 기능성 식품(functional food), 영양 보조제(nutritional supplement), 건강식품(health food) 및 식품 첨가제(food additives) 등의 모든 형태를 포함한다. 상기 유형의 건강 기능 식품은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다. 예를 들면, 건강식품으로는 본 발명의 둥근잎유홍초 추출물 자체를 차, 주스 및 드링크의 형태로 제조하여 음용하도록 하거나, 과립화, 캡슐화 및 분말화하여 섭취할 수 있다. 또한, 기능성 식품으로는 음료(알콜성 음료 포함), 과실 및 그의 가공식품(예: 과일통조림, 병조림, 잼, 마멀레이드 등), 어류, 육류 및 그 가공식품(예: 햄, 소시지 콘비프 등), 빵류 및 면류(예: 우동, 메밀국수, 라면, 스파게티, 마카로니 등), 과즙, 각종 드링크, 쿠키, 엿, 유제품(예: 버터, 치즈 등), 식용식물유지, 마가린, 식물성 단백질, 레토르트 식품, 냉동식품, 각종 조미료(예: 된장, 간장, 소스 등) 등에 본 발명의 둥근잎유홍초 추출물을 첨가하여 제조할 수 있다.
본 발명은 다른 관점에서, 둥근잎유홍초 추출물을 함유하는 노화방지 또는 지연용 약학적 조성물 및 건강 기능 식품에 관한 것이다.
당뇨병과 당뇨 합병증에 관련된 연구에서 당뇨병이 산화적 스트레스와 밀접한 관련이 있음이 보고 되고 있다. 당뇨병에서 나타나는 만성적인 고혈당은 포도당의 자동산화, 단백질 당화 등 다양한 경로에 의해 유리기의 생성을 증가시키고, 반응성이 높은 이들 물질에 의해 산화적 스트레스가 높아진다. 본 발명의 둥근잎유홍초 추출물은 최종 당화산물(advanced glycation end products, AGEs)의 생성을 억제하여, 이물질에 의한 산화적 스트레스 유발을 감소시켜 노화방지 및 노화를 지연시키는 효과를 기대할 수 있다.
이러한 약학적 조성물은 앞서 언급한 약학적으로 허용되는 담체, 부형제 등을 포함하여 제공될 수 있으며, 종래에 알려져 있는 노화 지연, 방지물질과 혼합하여 제공될 수도 있다. 또한, 노화의 정도, 목적하는 효과의 정도에 따라 둥근잎유홍초 추출물의 투여량이 상이할 수 있으며, 환자의 나이, 성별, 체중, 투여 기간 등에 따라 달라질 수 있고, 공지의 기술을 이용하여 다양한 형태로 제형화될 수 있으며, 다양한 투여경로를 통해 투여가능하다. 따라서, 본 발명은 상기 둥근잎유홍초 추출물을 대상에 투여하는 단계를 포함하는 노화 방지 또는 지연 방법에 관한 것이다. 아울러, 상기 건강 기능식품 또한, 식품조성물로써 기능성 식품, 영양보조제, 건강 식품, 식품 첨가제 등의 다양한 형태를 포함하는 것이며, 당업계에 공지된 통상적인 방법에 따라 다양한 형태, 예컨대, 앞서 언급한 둥근잎유홍초 추출물 자체를 차, 주스, 드링크의 형태로 제조하거나, 과립화, 캡슐화, 분말화 하거나, 이러한 추출물을 음료, 과실 및 가공식품, 어류, 육류 및 그 가공식품, 빵류, 면류, 조미료 등 각종 식품에 첨가하여 제조함으로써 제공될 수 있다.
본 발명은 또 다른 관점에서, 둥근잎유홍초 추출물을 함유하는 암 예방 또는 치료용 약학적 조성물에 관한 것이다.
본 발명의 둥근잎유홍초 추출물은 최종 당화산물생성을 억제하여 이물질에 의한 암 유발을 억제시켜 암 예방 및/또는 치료 효과를 기대할 수 있다. 최종 당화산물이 노화와 발암(carcinogenesis)을 유발함이 이미 보고되었는바 (Tokuda, H., et al., Book of Abstract of 53rd GA Congress joint with SIF, P076, 2005)., 둥근잎유홍초 추출물이 VEGF 생성을 저해함으로 암 예방 또는 치료적 효과를 기대할 수 있다.
본 발명에 있어서, 이러한 암은 VEGF (Vaicular Endothelial Growth Factor)에 의해 유도된 신생혈관 형성과 관련된 질환의 하나로써, 암의 종류는 예컨대, 폐암, 위암, 간암, 췌장암 등 종래 알려져 있는 모든 종류의 암을 포괄하는 것이다. 또한, 암의 예방 또는 치료라는 것은, VEGF 생성을 저해함으로써 암의 증식 및 전이를 동시에 막을 수 있으며, 더 나아가서는, 암을 예방할 수 있음을 의미한다.
이러한 약학적 조성물은 앞서 언급한 약학적으로 허용되는 담체, 부형제 등을 포함하여 제공될 수 있으며, 종래에 알려져 있는 암 예방, 치료 물질과 혼합하여 제공될 수도 있다. 또한, 암의 종류, 암의 진행 정도에 따라 둥근잎유홍초 추출물의 투여량이 상이할 수 있으며, 환자의 나이, 성별, 체중, 투여 기간 등에 따라 달라질 수 있고, 공지의 기술을 이용하여 다양한 형태로 제형화될 수 있으며, 다양한 투여경로를 통해 투여가능하다. 따라서, 본 발명은 상기 둥근잎유홍초 추출물을 대상에 투여하는 단계를 포함하는 암 치료 및 예방 방법에 관한 것이다.
본 발명은 또 다른 관점에서, (a) 둥근잎유홍초의 전초를 세절하여 물, 알코올, 유기용매 및 이들의 혼합물로 구성되는 군에서 선택되는 용매로 추출하여 추출액을 수득하는 단계 및 (b) 상기 추출액을 여과하고, 감압농축하여, 둥근잎유홍초 추출물을 수득하는 단계를 포함하는 둥근잎유홍초 추출물의 제조방법에 관한 것이다.
상기 (a) 단계에서 유기 용매는 헥산, 에테르, 벤젠, 아세트산에틸, 클로로포름, 아세토나이트릴, 메탄올 등 종래 알려진 추출 용매라면 어느것 이든 적용 가능하다. 본 발명의 일 실시예에서는 물 및 알코올이 사용되었으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 방법은, (c) 상기 (b)단계에서 수득한 둥근잎유홍초 추출물을 활성탄을 이용하여 분리정제하고, 감압 농축하여 둥근잎유홍초 추출물을 수득하는 단계를 추가로 더 포함하는 것을 특징으로 할 수 있다.
상기 (c) 단계에서는, 활성탄을 이용하여 둥근잎유홍초의 유효성분을 회수, 여과하고, 감압농축하는 단계로써, 이러한 활성탄을 이용하는 방법은 구체적으로, 상기 (b) 단계에서 감압 농축하여 얻어진 농축액을 물에 현탁하여, 활성탄이 충진된 컬럼크로마토그래피에 의해 에탄올50%를 이동상으로 용출시켜 분리 정제하는 방법을 이용할 수 있다.
또한, 본 발명은 상기 방법으로 제조되고, VEGF 억제효과, 혈당강하효과, 인슐린 발현 촉진효과 및 뇨단백 감소효과를 가지는 둥근잎유홍초 추출물에 관한 것이다.
실시예
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1: 둥근잎유홍초 추출물의 제조
둥근잎유홍초는 제주 남군 안덕면 서광리에서 채집하였고, 둥근잎유홍초 51g을 알코올 100%로 실온에서 초음파 추출기로 매 2시간 마다 15분씩 2~3일 추출하였다. 추출한 후 추출물을 진공 회전 농축기로 상온에서 감압 농축한 후 추출된 잔사를 진공 동결 건조기로 건조한 후 건조된 둥근잎유홍초 추출물 7g을 물에 0.075 mg/ml이 되도록 용해하였다.
실시예 2: 활성탄을 이용한 둥근잎유홍초 추출물의 제조
제주 남군 안덕면 서광리에서 채집한 둥근잎유홍초 50g을 세절하고, 상기 세절된 둥근잎유홍초에 물을 용매로 실온에서 초음파 추출기로 매 2시간 마다 15분씩 2~3일 추출하였다. 상기 추출된 추출액을 여과한 다음, 감압농축하여 농축액을 수득하였다. 상기 농축액을 물에 현탁하여 활성탄이 충진된 컬럼크로마토그라피에 의해 에탄올 50%을 이동상으로 용출시켜 분리정제하고, 상기 분리정제된 둥근잎유홍초 추출물을 감압농축시킨 다음, 상기 농축된 둥근잎유홍초 추출물 5g에 물을 가용하여 둥근잎유홍초 추출물의 농도가 20mg/ml이 되도록 용해시켰다.
실험예 1: 둥근잎유홍초 전초 추출물의 VEGF 억제능 확인
실시예 1과 실시예 2에서 제조된 둥근잎유홍초 추출물로 처리된 사람 망막 색소 상피 세포주인 ARPE 19 세포주에서 당뇨성 망막병증 등의 당뇨 합병증을 유발하는 혈관내피세포 성장인자(VEGF)의 억제능을 확인하였다.
ARPE 19 세포주(ATCC, USA)는 DMEM; F12 media에 10% FBS(Fetal bovine serum)를 첨가하여 배양하였다. ARPE 19 세포주에서 VEGF mRNA와 단백질의 발현을 유도하기 위해 60Φ 플레이트에 1×105 cell/플레이트 농도로 세포를 도말하여 DMEM low glucose media에 10% FBS무혈청을 첨가하여 24시간 배양 후 DMEM low glucose media에 25mM 및 30 mM glucose를 첨가한 배양액으로 바꾸고, 실시예 1과 실시예 2의 둥근잎유홍초 추출물의 최종 농도가 0.2 ㎍/ml되도록 첨가한 후, VEGF의 mRNA발현억제를 확인하기 위하여는 24시간 배양하였으며, VEGF 단백질 생산을 확인하기 위하여 72시간 배양하였다. 이때 대조군으로 5.5mM glucose를 처리하여 VEGF가 발현되지 않는 세포 자체를 기준으로 하고, 25mM 및 30mM glucose를 처리하였을 때 VEGF 발현 정도를 확인하여 둥근잎유홍초 추출물의 VEGF 발현 억제능을 비교하였다. 실험에 사용하는 25mM 및 30mM glucose농도는 각각의 실험에서 VEGF의 발현 유도를 최적으로 하는 조건의 농도이다.
(1) VEGF mRNA 발현 억제 효능
상기 방법으로 배양된 ARPE 19 세포에서 total RNA를 분리하기 위하여, 배지를 제거한 후 TRIzol reagent(Invitrogen, USA)를 사용하여 분리하였고, 서열번호 1~2의 프라이머를 이용하여, RT-PCR(reverse transcriptase-polymerase chain reaction)을 수행하여, VEGF mRNA의 발현을 확인하였다.
그 결과, 도 1에 나타난 바와 같이, 실시예 1에서 제조된 둥근잎유홍초 추출물을 처리한 실험군에서 VEGF mRNA 발현이 억제되는 것을 확인하였다.
서열번호 1:TTGCCTTGCTGCTCTACCTC
서열번호 2:AAATGCTTTCTCCGCTCTGA
(2) VEGF 분비 단백질 발현 저해 효능
상기 방법으로 배양된 ARPE 19 세포의 배양액을 수득하여, VEGF ELISA kit(R＆D, UK)을 이용하여 분비되는 VEGF의 양을 측정하였다.
그 결과, 도 2에 나타난 바와 같이, 실시예 1과 실시예 2에서 제조된 둥근잎유홍초 추출물을 처리한 실험군에서 VEGF 발현이 감소됨을 확인하였다.
실험예 2: 둥근잎유홍초 추출물의 인슐린 분비 촉진 확인
실시예 1과 실시예 2에서 제조된 둥근잎유홍초 추출물로 처리된 마우스 췌장 베타 세포주인 Min 6 세포주에서 인슐린 분비 촉진 여부를 확인하였다.
Min 6(ATCC, USA)은 HDMEM media에 15% FBS(fetal bovine serum)를 첨가하여 배양하였다. Min 6 세포주에서 인슐린 발현을 유도하기 위해 96 well 플레이트에 1× 104 cell/플레이트 농도로 세포를 도말하여 DMEM high glucose media에 15% FBS무혈청을 첨가하여 72시간 배양 후 PBS 완충용액으로 세척하고 HBSS 완충 용액에 2시간 배양 후 25mM glucose를 첨가한 HBSS 완충용액으로 바꾸고 둥근잎유홍초 추출물을 최종 농도가0.2 ㎍/ml되도록 첨가한 후, 인슐린 발현 촉진 여부를 확인하기 위해 2시간 배양하였다. 이때 대조군으로 5.5mM glucose를 처리하여 인슐린 발현이 유도 되지 않는 세포자체의 인슐린 기준점으로 하고, 25mM glucose를 처리하였을 때 인슐린 발현 되는 정도를 확인하여 둥근잎유홍초 추출물이 인슐린 발현을 촉진을 비교 분석하였다. 상기 방법으로 배양된 Min 6 세포의 배양액을 수득하여, 인슐린 ELISA kit(R＆D, UK)을 이용하여 분비되는 인슐린의 양을 측정하였다. 그 결과, 도 3에 나타난 바와 같이 인슐린 발현이 증가됨을 확인할 수 있었으며, 특히 실시예 2의 활성탄을 이용하여 제조된 둥근잎유홍초 추출물의 경우, 더 높은 인슐린 분비능을 나타내었다.
실험예 3: 둥근잎유홍초 추출물의 처리에 의한 마우스 당뇨 지표 변화측정
정상 마우스에 실시예 1에서 제조된 둥근잎유홍초 추출물을 처리함으로써, 당뇨 지표로써, 체중, 혈당 및 뇨단백의 변화를 살펴보았다.
5주령의 마우스(Male C57BL/6J, 19g, 코아텍, 평택)를 구입하여 일정한 온도(25℃)와 습도(50%)하에서 1주간 적응시킨 후 실험에 사용하였다. 마우스를 각 군당 4마리로 하여 대조군으로는 일반 사료를 먹이로 하는 일반식이군, 고지방 사료를 먹는 고지방식이군으로 나누고 음용수로는 일반물을 공급하였고, 실험군으로는 고지방 사료를 먹는 고지방식이에 음용수로 실시예 1에서 제조된 둥근잎유홍초 추출물을 0.075 mg/ml 농도로 희석한 물을 공급하였다. 각 대조군과 실험군을 4주간 사육하였다. 매주 체중과 혈당의 변화를 측정하였고, 또한 투여 4주 후 뇨를 채취하여 뇨단백 농도를 측정하였다.
그 결과, 도 4에 나타난 바와 같이, 둥근잎유홍초 추출물을 섭취한 실험군의 체중은 고지방식이군과 비교하여 유의적으로 감소하였다.
혈당변화에 있어서는, 고지방식이군은 일반식이군과 비교하여 혈당이 상승되어 나타났으나, 고지방식이에 둥근잎유홍초 추출물 0.075 mg/ml 농도로 희석한 물을 공급한 군에서는 유의적인 강하효과를 보였다(도 5).
당뇨병 환자들의 경우 신장과 심장 합병증이 동반되는 경우가 흔하다. 단백뇨(proteinuria)가 감소했다는 것은 신장 기능이 회복되었다는 것을 의미한다. 둥근잎유홍초 추출물의 신장에 미치는 영향을 관찰하기 위한 뇨단백 분석은 둥근잎유홍초 추출물을 4주간 투여한 마우스의 뇨를 채취하여 ELISA 키트(Exocell, America)를 이용하여 측정하였다.
그 결과, 도 6에 나타난 바와 같이, 고지방식이군은 일반식이군과 비교시 뇨단백의 상승을 보였으나 고지방식이에 둥근잎유홍초 0.075 mg/ml 농도로 희석한물을 공급한 군에서 유의적인 감소를 보였다. 이는 고지방식이로 당뇨병이 유도된 마우스에서 특징적으로 나타나는 신장의 기능을 개선시킴으로써 뇨단백 농도가 감소된 것을 시사하는 것이다.
실험예 4: 둥근잎유홍초 추출물의 처리에 의한 당뇨병 마우스의 당뇨 지표 관찰 실험
정상 마우스와 실제 당뇨병 마우스에 실시예 2에서 제조된 둥근잎유홍초 추출물을 처리함으로써, 당뇨 지표인 혈당, 당화혈색소 및 뇨단백의 변화를 확인하였다.
6주령의 마우스(Male C57BL/6J mouse, 20g, 중앙실험동물, 서울)와 6주령의 당뇨병 마우스(Male C57BL/Ks DB/DB mouse, 20g, 중앙실험동물, 서울)를 구입하여 일정한 온도(25℃)와 습도(50%)하에서 1주간 적응시킨 후 실험에 사용하였다.
마우스를 각 군당 5마리로 하여 정상 마우스 대조군, 당뇨병 마우스 대조군,실시예 2에서 제조된 둥근잎유홍초 활성탄 추출물을 0.1 mg/ml 농도로 희석한 물을 공급한 군으로 나누어 12주간 사육하였다. 2주 마다 혈당의 변화를 측정하였고, 또한 6주 마다 뇨를 채취하여 뇨단백 농도를 측정하였고, 12주간 사육한 후 혈액을 채취하여 당화 혈색소 농도를 측정하였다.
그 결과 혈당 변화에 있어서는, 도 7에 나타난 바와 같이, 당뇨병 마우스 대조군은 정상 마우스 대조군과 비교하여 혈당이 상승되어 나타났으나, 당뇨병 마우스에 둥근잎유홍초 0.1mg/ml 농도로 희석한 물을 공급한 군에서는 유의적인 강하효과를 보였다.
당뇨를 치료받는 환자에게 발생하는 합병증을 줄이기 위해서는 혈당 수치를 적절한 수준으로 유지하는 것이 중요하다. 한 시점에서 측정하는 혈당 수치는 여러 요인들에 의해 변동이 생길 수 있기 때문에 장기간의 혈당 조절 추이를 파악할 목적으로 가장 널리 사용되는 검사가 당화 혈색소(HbA1c)이다. 당화 혈색소는 적혈구에 정상적으로 존재하는 혈색소에 당이 결합된 형태로 혈당이 높게 유지되었을 경우에 당화 혈색소 수치 또한 높아진다. 당화 혈색소는 2~4 개월 동안의 평균 혈당 수치를 반영하므로 장기간의 혈당 조절 정도를 파악하는데 유용하다.
둥근잎유홍초 활성탄 추출물의 당화 혈색소에 대한 영향을 확인하기 위해 6주에 한번씩 정상 마우스 대조군, 당뇨병 마우스 대조군, 실시예 2에서 제조된 둥근잎유홍초를 0.1 mg/ml 농도로 희석한 물을 공급한 군의 혈액을 채취하여 ELISA 키트(Cusabio biotech, Japan)를 이용하여 측정하였다.
그 결과, 도 8 에 나타난 바와 같이, 당화 혈색소의 수치에서 당뇨병 마우스 대조군은 정상 마우스 대조군과 비교하여 혈당이 비정상적인 상승된 수치를 나타났으나, 당뇨병 마우스에 둥근잎유홍초 추출물 0.1mg/ml 농도로 희석한 물을 공급한 군에서는 정상 마우스 대조군과 유의하게 강하효과를 보였다.
당뇨병 환자들의 경우 신장과 심장 합병증이 동반되는 경우가 흔하다. 단백뇨(proteinuria)가 감소했다는 것은 신장 기능이 회복되었다는 것을 의미한다. 둥근잎유홍초 추출물의 신장에 미치는 영향을 관찰하기 위해 뇨단백을 분석 실험을 실시하였다. 실시예 2에서 제조된 둥근잎유홍초 추출물을 12주간 투여한 마우스의 뇨를 채취하여 ELISA 키트(Exocell, America)를 이용하여 측정하였다.
그 결과, 도 9에 나타난 바와 같이, 당뇨병 마우스 대조군은 정상 마우스 대조군과 비교하여 뇨단백이 상승된 수치를 나타났으나, 당뇨병 마우스에 둥근잎유홍초 0.1mg/ml 농도로 희석한 물을 공급한 군에서는 유의적으로 감소되는 수치를 나타냈다.
실험예 5: 당뇨병 마우스의 간 독성 검사
6주령의 마우스와 6주령의 당뇨병 마우스를 구입하여 일정한 온도(25℃)와 습도(50%)하에서 1주간 적응시킨 후 간 독성 검사에 사용하였다.
마우스를 각 군당 5마리로 하여 정상 마우스 대조군, 당뇨병 마우스 대조군, 실시예 2에서 제조된 둥근잎유홍초 추출물을 0.1 mg/ml 농도로 희석한 물을 공급한 군으로 나누어 12주간 사육하였다. 12주간 사육한 후 혈액을 채취하여 알라닌 트랜스아미네이즈 농도를 측정하였다.
알라닌 트랜스아미네이즈는 아미노산의 대사효소로써 진단 및 경과 관찰의 대표적인 검사로 활용된다. 알라닌 트랜스아미네이즈의 농도가 유지되었다는 것은 간의 손상이 없다는 것을 시사한다.
둥근잎유홍초 추출물의 간에 대한 영향을 확인하기 위해 12주간 사육한 후 정상 마우스 대조군, 당뇨병 마우스 대조군, 실시예 2에서 제조된 둥근잎유홍초 추출물을 0.1 mg/ml 농도로 희석한 물을 공급한 군의 혈액을 채취하여 ELISA 키트(Cusabio biotech, Japan)를 이용하여 알라닌 트랜스아미네이즈 농도 변화를 측정하였다.
그 결과, 아래 표 1 에 나타난 바와 같이 당뇨병 마우스 대조군에 당뇨병 마우스에 둥근잎유홍초 추출물이 0.1mg/ml 농도로 희석된 물을 공급한 군이 정상 마우스 대조군과 유사한 수치를 나타내어 이 추출물에 의한 간 독성이 없는 것으로 확인되었다.
표 1 당뇨병 마우스에서 12주 투여후의 간 독성 측정 결과
그룹 알라닌트랜스아미네이즈 농도
마우스 대조군(C57BL/6L) 35.97±2.73
당뇨병 마우스 대조군(C57BL/KsDB/DB) 37.28±1.89
당뇨병 마우스 실험군(C57BL/KsDB/DB): 실시예 2에서 제조된 둥근잎유홍초 투여 35.90±1.32
(단위: IU/L)
실험예 6: 마우스의 간 독성 검사
6주령의 마우스(Male C57BL/6J mouse, 20g, 중앙실험동물, 서울)를 구입하여 일정한 온도(25℃)와 습도(50%)하에서 1주간 적응시킨 후 간 독성 검사에 사용하였다.
마우스를 각 군당 5마리로 하여 대조군, 실시예 2에서 제조된 둥근잎유홍초 추출물 투여군으로 나누어 1000mg/kg 농도로 3회 투여한 후 혈액을 채취하여 알라닌 트랜스아미네이즈 농도를 측정하였다.
알라닌 트랜스아미네이즈는 아미노산의 대사효소로써 진단 및 경과 관찰의 대표적인 검사로 활용된다. 알라닌 트랜스아미네이즈의 농도가 유지되었다는 것은 간의 손상이 없다는 것을 증명한다. 둥근잎유홍초 추출물의 간에 대한 영향을 확인하기 위해 대조군, 둥근잎유홍초 추출물 투여군의 혈액을 채취하여 ELISA 키트(Cusabio biotech, Japan)를 이용하여 측정하였다.
그 결과, 아래 표 2에 나타난 바와 같이 둥근잎유홍초 추출물 투여군이 대조군과 유사한 수치를 나타내어 이 추출물에 의한 간 독성이 없는 것으로 확인되었다.
표 2 마우스 독성 측정 결과
그룹 알라닌트랜스아미네이즈 농도
마우스 대조군(C57BL/6J) 37.57±1.52
마우스 실험군: 실시예 2에서 제조된 둥근잎유홍초 100mg/kg 투여 38.18±1.58
실험예 7: 마우스의 렌즈 배양실험
당뇨환자의 경우에는 백내장이 일찍 시작하며 또한 빨리 악화하여 시력이 급속히 떨어진다. 당뇨병에 걸리면 수정체에 불투명 현상이 촉진된다. 이에 렌즈 배양 실험을 통하여 당뇨성 백내장 생성 억제 효능을 조사하였다.
마우스의 안구를 적출해 요오드 용액에 넣어 잠시 소독 후 렌즈만을 적출하였다. M199 배지에 넣고 세포배양기에서 배양하였다. 배지에 20mM xylose를 넣어 배양하면 수정체의 혼탁도를 유발할 수 있고, CCD camera를 이용하여 수정체의 혼탁도를 측정하였다.
그 결과, 도 10에 나타난 바와 같이, 백내장 유발을 억제하는 물질로 알려진 quercetin(쿼시틴)을 처리한 양성 대조군보다 실시예 2에서 제조된 둥근잎유홍초 활성탄추출물 투여군에서 수정체 혼탁도가 더 억제됨이 확인되었다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
본 발명에 따른 조성물은 우수한 혈당강하, 인슐린 분비촉진, 뇨 단백 저해작용 및 수정체 혼탁도 감소효과를 나타내어, 당뇨병 및 이로 인한 각종 합병증의 예방 또는 치료에 탁월한 효과를 가진다.
전자서열 첨부하였음.

Claims (16)

  1. 둥근잎유홍초 추출물을 함유하는 당뇨병 및 그 합병증 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서, 상기 추출물은 물, 알코올, 유기용매 및 이들의 혼합물로 구성되는 군에서 선택되는 용매로 추출되는 것을 특징으로 하는 당뇨병 및 그 합병증 예방 또는 치료용 약학적 조성물.
  3. 제1항에 있어서, 합병증은 만성 고혈당증, 아테롬성 동맥경화증, 미세혈관병증, 신장질환, 심장질환, 당뇨병성 망막증 및 그외 하나 이상의 안과질환의 조합으로 구성된 군에서 선택되는 것을 특징으로 하는 당뇨병 및 그 합병증 예방 또는 치료용 약학적 조성물.
  4. 둥근잎유홍초 추출물을 함유하는 당뇨병 및 그 합병증 예방용 건강기능식품.
  5. 제4항에 있어서, 상기 추출물은 물, 알코올, 유기용매 및 이들의 혼합물로 구성되는 군에서 선택되는 용매로 추출되는 것을 특징으로 하는 당뇨병 및 그 합병증 예방용 건강기능식품.
  6. 제4항에 있어서, 합병증은 만성 고혈당증, 아테롬성 동맥경화증, 미세혈관병증, 신장질환, 심장질환, 당뇨병성 망막증 및 그외 하나 이상의 안과질환의 조합으로 구성된 군에서 선택되는 것을 특징으로 하는 당뇨병 및 그 합병증 예방용 건강기능식품.
  7. 다음 단계를 포함하는 둥근잎유홍초 추출물의 제조방법:
    (a) 둥근잎유홍초의 전초를 세절하여 물, 알코올, 유기용매 및 이들의 혼합물로 구성되는 군에서 선택되는 용매로 추출하여 추출액을 수득하는 단계; 및
    (b) 상기 추출액을 여과하고, 감압농축하여, 둥근잎유홍초 추출물을 수득하는 단계.
  8. 제7항에 있어서, (c) 상기 (b)단계에서 수득한 둥근잎유홍초 추출물을 활성탄을 이용하여 분리정제하고, 감압 농축하여 둥근잎유홍초 추출물을 수득하는 단계를 추가로 더 포함하는 것을 특징으로 하는 방법.
  9. 제8항에 있어서, 상기 (c)단계의 분리정제는 활성탄이 충진된 컬럼크로마토그라피를 이용하는 것을 특징으로 하는 둥근잎유홍초 추출물의 제조방법.
  10. 제7항 내지 제9항 중 어느 한 항의 방법으로 제조되고, VEGF 억제효과, 인슐린 분비 촉진효과, 혈당강하효과, 뇨단백 감소효과 및 수정체 혼탁도 감소효과를 가지는 둥근잎유홍초 추출물.
  11. 둥근잎유홍초 추출물을 함유하는 노화방지 또는 지연용 약학적 조성물.
  12. 제11항에 있어서, 상기 추출물은 물, 알코올, 유기용매 및 이들의 혼합물로 구성되는 군에서 선택되는 용매로 추출되는 것을 특징으로 하는 노화방지 또는 지연용 약학적 조성물.
  13. 둥근잎유홍초 추출물을 함유하는 노화방지 또는 지연용 건강 기능 식품.
  14. 제13항에 있어서, 상기 추출물은 물, 알코올, 유기용매, 및 이들의 혼합물로 구성되는 군에서 선택되는 용매로 추출되는 것을 특징으로 하는 노화방지 또는 지연용 건강 기능 식품.
  15. 둥근잎유홍초 추출물을 함유하는 암 예방 또는 치료용 약학적 조성물.
  16. 제15항에 있어서, 상기 추출물은 물, 알코올, 유기용매 및 이들의 혼합물로 구성되는 군에서 선택되는 용매로 추출되는 것을 특징으로 하는 암 예방 또는 치료용 약학적 조성물.
PCT/KR2011/001128 2010-02-19 2011-02-21 둥근잎유홍초 추출물을 함유하는 당뇨병 치료용 약학적 조성물 WO2011102690A2 (ko)

Priority Applications (7)

Application Number Priority Date Filing Date Title
US13/579,743 US20130004596A1 (en) 2010-02-19 2011-02-21 Pharmaceutical composition for treating diabetes containing quamoclit angulata extract
MX2012009556A MX2012009556A (es) 2010-02-19 2011-02-21 Composicion farmaceutica para tratar la diabetes, que contiene extracto de quamoclit angulata.
AU2011216647A AU2011216647B2 (en) 2010-02-19 2011-02-21 Pharmaceutical composition for treating diabetes containing Quamoclit angulata extracts
CN2011800142670A CN102802651A (zh) 2010-02-19 2011-02-21 含有圆叶茑萝提取物的糖尿病治疗用药物组合物
JP2012553821A JP5882915B2 (ja) 2010-02-19 2011-02-21 丸葉留紅草抽出物を含有する糖尿病治療用医薬組成物
EP11744932.2A EP2548565A4 (en) 2010-02-19 2011-02-21 PHARMACEUTICAL COMPOSITION FOR THE TREATMENT OF DIABETES CONTAINING QUAMOCLIT ANGULATA EXTRACTS
NZ601904A NZ601904A (en) 2010-02-19 2011-02-21 Pharmaceutical composition for treating diabetes containing quamoclit angulata extracts

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2010-0014977 2010-02-19
KR20100014977 2010-02-19

Publications (2)

Publication Number Publication Date
WO2011102690A2 true WO2011102690A2 (ko) 2011-08-25
WO2011102690A3 WO2011102690A3 (ko) 2012-01-19

Family

ID=44483501

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/001128 WO2011102690A2 (ko) 2010-02-19 2011-02-21 둥근잎유홍초 추출물을 함유하는 당뇨병 치료용 약학적 조성물

Country Status (9)

Country Link
US (1) US20130004596A1 (ko)
EP (1) EP2548565A4 (ko)
JP (1) JP5882915B2 (ko)
KR (1) KR101322881B1 (ko)
CN (2) CN102802651A (ko)
AU (1) AU2011216647B2 (ko)
MX (1) MX2012009556A (ko)
NZ (1) NZ601904A (ko)
WO (1) WO2011102690A2 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2013240317A (ja) * 2012-05-18 2013-12-05 China Medical Univ ポリペプチド、ポリペプチドをコードする核酸分子、及びポリペプチドの使用
EP2746280A1 (en) * 2011-08-18 2014-06-25 Korea Research Institute of Bioscience and Biotechnology Novel compound isolated from quamoclit, and composition for preventing or treating diabetes containing the compound as an active ingredient

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130020623A (ko) * 2011-08-17 2013-02-27 한국생명공학연구원 유홍초 추출물을 함유하는 당뇨합병증 예방 또는 치료용 조성물
KR101605343B1 (ko) * 2011-08-17 2016-03-22 주식회사 나노바이오텍 유홍초 추출물 또는 유홍초 유래 화합물을 함유하는 항암 또는 항산화 조성물
KR101679117B1 (ko) * 2013-05-24 2016-11-24 주식회사 나노바이오텍 유홍초속 식물 유래 신규 화합물 및 이를 유효성분으로 포함하는 당뇨병의 예방 또는 치료용 조성물
KR20160098568A (ko) 2015-02-09 2016-08-19 순천향대학교 산학협력단 둥근잎유홍초 추출물을 함유하는 항염증 약학조성물 및 식품조성물

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10317528B4 (de) * 2003-04-16 2006-12-28 Martin-Luther-Universität Halle-Wittenberg Verfahren zur Herstellung von Calysteginen
US20050084547A1 (en) * 2003-09-12 2005-04-21 Phytomyco Research Corporation Natural product based apoptosis inducers
US20080268113A1 (en) * 2004-05-26 2008-10-30 Toshio Kadowaki Activated Carbon Composition and Method for Decolorizing Liquid by Using the Same

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
"Remington's Pha,rmaceutical Sciences", 1995, MACK PUBLISHING COMPANY
See also references of EP2548565A4
TOKUDA, H. ET AL.: "Book of Abstract of 53rd GA Congress joint with SIF", 2005

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2746280A1 (en) * 2011-08-18 2014-06-25 Korea Research Institute of Bioscience and Biotechnology Novel compound isolated from quamoclit, and composition for preventing or treating diabetes containing the compound as an active ingredient
US20140179622A1 (en) * 2011-08-18 2014-06-26 Korea Research Institute Of Bioscience And Biotechnology Novel compound isolated from quamoclit, and composition for preventing or treating diabetes containing the compound as an active ingredient
CN104125958A (zh) * 2011-08-18 2014-10-29 韩国生命工学研究院 从茑萝属分离的新型化合物以及作为有效成分包含该新型化合物的用于预防或治疗糖尿病的组合物
EP2746280A4 (en) * 2011-08-18 2015-01-14 Korea Res Inst Of Bioscience NOVEL COMPOUND ISOLATED FROM QUAMOCLIT, AND COMPOSITION FOR PREVENTING OR TREATING DIABETES CONTAINING THE COMPOUND AS AN ACTIVE SUBSTANCE
US9487596B2 (en) * 2011-08-18 2016-11-08 Nanobiotech Co., Ltd. Compound isolated from quamoclit, and composition for preventing or treating diabetes containing the compound as an active ingredient
JP2013240317A (ja) * 2012-05-18 2013-12-05 China Medical Univ ポリペプチド、ポリペプチドをコードする核酸分子、及びポリペプチドの使用
US9029326B2 (en) 2012-05-18 2015-05-12 China Medical University Polypeptides, nucleic acid molecule encoding polypeptides, and uses of polypeptides
JP2015145361A (ja) * 2012-05-18 2015-08-13 中國醫藥大學 ポリペプチド、ポリペプチドをコードする核酸分子、及びポリペプチドを含む医薬組成物

Also Published As

Publication number Publication date
AU2011216647A1 (en) 2012-09-20
WO2011102690A3 (ko) 2012-01-19
KR101322881B1 (ko) 2013-11-13
CN102802651A (zh) 2012-11-28
NZ601904A (en) 2014-10-31
KR20110095835A (ko) 2011-08-25
EP2548565A2 (en) 2013-01-23
EP2548565A4 (en) 2013-10-02
JP5882915B2 (ja) 2016-03-09
MX2012009556A (es) 2013-01-29
AU2011216647B2 (en) 2014-02-13
JP2013520411A (ja) 2013-06-06
CN107007649A (zh) 2017-08-04
US20130004596A1 (en) 2013-01-03

Similar Documents

Publication Publication Date Title
WO2011102690A2 (ko) 둥근잎유홍초 추출물을 함유하는 당뇨병 치료용 약학적 조성물
WO2013025073A2 (ko) 유홍초 추출물을 함유하는 당뇨합병증 예방 또는 치료용 조성물
WO2010107170A1 (ko) 대사성질환 치료용 조성물
KR101631589B1 (ko) 팥꽃나무 추출물로부터 분리된 화합물을 포함하는 신경퇴행성 질환 예방 또는 치료용 약학적 조성물
KR101908772B1 (ko) 상지 열수추출물과 oxyresveratrol을 유효성분으로 함유하는 항당뇨 기능성 조성물 및 그 제조방법
WO2018106009A1 (ko) 단풍잎 추출물 또는 이의 분획물을 포함하는 염증성 안구질환 예방 또는 치료용 조성물
KR20110087422A (ko) 까실쑥부쟁이 추출물을 포함하는 당뇨합병증 치료 또는 예방용 조성물
WO2014077425A1 (ko) 오동나무 추출물을 포함하는 당뇨합병증의 예방 또는 치료용 약학적 조성물 및 건강기능식품
WO2013100292A1 (ko) 당뇨병 또는 당뇨합병증 예방 또는 치료용 조성물
EP2746280B1 (en) Novel compound isolated from quamoclit, and composition for preventing or treating diabetes containing the compound as an active ingredient
WO2013025074A2 (ko) 유홍초 추출물 또는 유홍초 유래 화합물을 함유하는 항암 또는 항산화 조성물
WO2018190638A1 (ko) 쥐눈이콩 추출물을 포함하는 각막 질환의 예방 또는 치료용 조성물
WO2013111924A1 (ko) 넓패 유래 신규 화합물 및 이의 용도
KR102474858B1 (ko) 잡곡 혼합물을 포함하는 항당뇨용 조성물
US20150246088A1 (en) Pharmaceutical composition for treating diabetes containing quamoclit angulata extract
KR101219185B1 (ko) 신규 바이페닐 화합물 또는 이의 약학적으로 허용 가능한 염, 이의 제조방법 및 이를 유효성분으로 함유하는 당뇨 합병증의 예방 또는 치료용 약학적 조성물
WO2014077424A1 (ko) 까치박달 추출물을 포함하는 당뇨합병증의 예방 또는 치료용 약학적 조성물 및 건강기능식품
KR20210151693A (ko) β-젠티오비오실 패오니플로린을 유효성분으로 포함하는 대사증후군 예방, 치료 또는 개선용 조성물
WO2014163262A1 (ko) 고추씨 추출물을 포함하는 비만치료 또는 예방용 조성물
KR20150091771A (ko) 바다포도 추출물을 포함하는 당뇨병 치료 또는 예방용 조성물
CN104125958B (zh) 从茑萝属分离的化合物以及作为有效成分包含该化合物的用于预防或治疗糖尿病的组合物
KR101043633B1 (ko) 펩타이드를 유효 성분으로 포함하는 당뇨 치료 또는 예방용 조성물
KR20190036338A (ko) 고들빼기 추출물을 포함하는 간 보호용 조성물
JP2017036279A (ja) Ｇｌｐ−１分泌促進剤
JP2014091706A (ja) Ｇｌｐ−１分泌促進剤

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201180014267.0

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11744932

Country of ref document: EP

Kind code of ref document: A2

REEP Request for entry into the european phase

Ref document number: 2011744932

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 7198/CHENP/2012

Country of ref document: IN

Ref document number: 2011744932

Country of ref document: EP

Ref document number: MX/A/2012/009556

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2012553821

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2011216647

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 13579743

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2011216647

Country of ref document: AU

Date of ref document: 20110221

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112012020807

Country of ref document: BR

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112012020807

Country of ref document: BR

ENPW Started to enter national phase and was withdrawn or failed for other reasons

Ref document number: 112012020807

Country of ref document: BR