WO2011085642A1

WO2011085642A1 - Chlamydomonas strain and uses thereof

Info

Publication number: WO2011085642A1
Application number: PCT/CN2011/000067
Authority: WO
Inventors: 吴洪; 黄龙耀; 李青; 吴义诚
Original assignee: 新奥科技发展有限公司
Priority date: 2010-01-15
Filing date: 2011-01-17
Publication date: 2011-07-21
Also published as: CN101892159A; CN101892159B

Abstract

A Chlamydomonas strain is provided. The strain is identified as a novel strain, and its deposit number is CGMCC No.3577. The lipid content of said strain is high, thus it can be used for preparing biodiesel, animal feed and edible oil.

Description

A strain of Chlamydomonas and its application

The invention belongs to the field of bioenergy, and particularly relates to a chlamydia and application thereof for preparing biodiesel. More specifically, the present invention relates to a new Chlamydomonas strain with good oil content and can be used for preparing biodiesel. Application of feed or cooking oil. Background technique

With the worsening environmental degradation, controlling vehicle emissions and the greenhouse effect, protecting the natural environment on which humans depend is an urgent problem for mankind. At the same time, global energy demand continues to expand, and the search for renewable clean energy that can replace oil in the energy structure is currently a hot spot.

Microalgae is a kind of low-altitude plant that grows in water and is widely distributed. It is a solar-driven cell factory that absorbs CO ₂ and converts light energy into fat or through efficient photosynthesis of microalgae cells. The chemical energy of a compound such as starch, and emits 0 ₂ . Microalgae is the most efficient plant with the highest photosynthetic efficiency. It is also the fastest growing plant in nature, and some microalgae can be grown in high-salt, high-alkali waters, making full use of tidal flats, saline-alkali land, and deserts. In scale cultivation, non-agricultural water such as seawater, saline-alkali water, and industrial wastewater can also be used for cultivation, and co _{2 in} industrial waste gas can also be utilized. The use of microalgae to produce biodiesel can solve the outstanding problems of the current use of plant raw materials to develop biodiesel, the impact of climate change on yield and the increase in crop prices. Therefore, microalgae biodiesel has become a potential energy research hotspot as a renewable and clean energy source.

Chlamydomonas is also known as "single algae". Chlorella, Glomerulaceae, Chlamydomonas in the genus Chlamydomae. The algae are single cells, spherical or ovoid, with two equal-length flagella on the front end that can swim. There are two telescopic bubbles at the base of the flagella; another at the near front end of the cell, there is a red eye point. The chromophore has a large cup shape with a starch core. Asexual reproduction produces zoospores; sexual reproduction is homozygous, heterozygous and egg-like. Under unfavorable living conditions, the cells stop swimming and undergo multiple divisions. The outer thick gel sheaths form a temporary group called "indefinite group". When the environment improves, the cells in the group produce flagella and the sheath breaks out. Among them, Chlamydomonas reinhardtii is a single-celled eukaryotic dinoflagellate, a model organism that studies a variety of life activities (such as photosynthesis, circadian rhythm, and phototaxis), and yeast. Cells have many characteristics of co-words and are known as "photosynthetic yeasts". There are a lot of reports on the research on the gene of Chlamydomonas, such as the patent CN200610026203.3 Chlamydomonas red fluorescent marker protein gene CrmRFP its synthesis method and its eukaryotic expression vector construction method, CN200810066705.8 transgenic rhein expressing human tissue kallikrein Method for constructing Chlamydomonas, CN 200610018306.5 - A method for producing a foreign gene expression system of Chlamydomonas reinhardtii and a method for constructing PHB transgenic algae, but no report on the production of biodiesel by Chlamydomonas, the present invention provides a high oil content Chlamydomonas, which can be further genetically engineered. Summary of the invention

It is an object of the present invention to provide a Chlamydomonas solani and its use in the field of bioenergy.

In one aspect, the present invention provides a strain of Chlamydomonas strain OQA-0l (CMam _y domo surface sp. DQA-01), deposited at the General Microbiology Center of the China Microbial Culture Collection Management Committee, and has a deposit number of CGMCC No. 3577 . The Chlamydomonas algae powder has an oil content of 10%----50% of the dry weight, and the oil can be made into biodiesel, feed or edible oil; the Chlamydomonas solani is a new species belonging to the genus Chlamydomonas. Named DQA-01, it is very similar to the phylogenetic tree of Chlamydomo reinhardtii, which is a microalgae model organism in genetic engineering. It can provide materials for genetic engineering of energy microalgae. In one embodiment, the Chlamydomonas strain DQA-01 is cultured at a temperature in the range of 15-35 °C, preferably at a temperature of 23 °C. In one embodiment, the Chlamydomonas strain DQA-01 is controlled to have a light intensity of 50---200 μηιο1/ηι ² .3 during the cultivation process. In one embodiment, the Chlamydomonas strain accumulates oil and fat under the induction of light intensity 150-30 (^mol/m ² .s. In one embodiment, the Chlamydomonas strain is first at 6 (Vmol/m) ^2. _S culture, the light intensity is increased to 12 (mol/m ² .s on day 3, and the light intensity is increased to 200 μιηο 1 /ηι ² .5 on day 7. In one embodiment, the algae Plant DQA-01 adjusts the pH of the medium between 7-9, preferably pH 7.2, during the culture.

In another aspect, the invention provides a method of screening the oil-coated algae, the method comprising the steps of:

1) Collecting algae, selecting contaminated rivers, lakes or marshes containing a variety of algae, using algae collectors for algae collection;

2) Separating and purifying the algae species, and separating the various algae species mixed together by a dilution plating method or a capillary method to obtain a pure algae strain of a single algae species; 3) Algae culture and oil induction, the pure algae strain is cultured in BG11 medium at 25 ° C, and when the concentration of algae reaches 1-8 g / 1, the light is enhanced to induce oil;

4) Determination of oil content, the algae after the oil-induced induction were stained with Nile Red, and observed under a fluorescence microscope, and the algae species with more fluorescence were selected to obtain the algae species with higher oil content. In one embodiment, the method further comprises the step of identifying the algal species of the pure algae strain, and determining the position of the algal species in the phylogenetic tree by a combination of morphology and molecular means. In another aspect, the present invention provides a method of producing biodiesel, the method being characterized by using the Chlamydomonas strain DQA-01 provided by the present invention.

In another aspect, the present invention provides a method of producing a vocabulary, the method being characterized by using the Chlamydomonas strain DQA-01 provided by the present invention.

In another aspect, the present invention provides a method of producing an edible oil, the method being characterized by using the Chlamydomonas strain DQA-01 provided by the present invention.

In another aspect, the present invention provides a method of genetically engineering a Chlamydomonas strain, the method characterized by using the Chlamydomonas strain DQA-01 provided by the present invention.

In yet another aspect, the present invention provides the use of the Chlamydomonas strain DQA-01 for the preparation of biodiesel, feed or edible oil.

In still another aspect, the present invention provides the use of the Chlamydomonas strain DQA-01 for the preparation of a genetically modified strain of algae.

In still another aspect, the present invention provides a feed prepared from the Chlamydomonas strain DQA-01 provided by the present invention.

In still another aspect, the present invention provides an edible oil prepared from the algae strain DQA-01 provided by the present invention.

In still another aspect, the present invention provides a biodiesel characterized in that it is prepared by culturing the Chlamydomonas strain DQA-01 provided by the present invention and separating the oil therefrom.

The algae body of the present invention is a single cell, spherical or ovoid, and has two equal-length flagella at the front end, which can swim. There are two telescopic bubbles at the base of the flagella; another at the near front end of the cell, there is a red eye point. The chromophore has a large cup shape with a starch core. Asexual reproduction produces zoospores; sexual reproduction is homozygous, heterozygous and egg-like. Under unfavorable living conditions, the cells stop swimming and undergo multiple divisions. The outer thick gel sheaths form a temporary group called "indefinite group". When the environment improves, the cells in the group produce flagella and the sheath breaks out. Its ITS sequence for algae identification is ( GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGA

CGCCGTACG AGCCTGGGTCGCCTGCCCAATTAATTATTAATTAATT

GAACGCAGCGAAATGCGATACGTAGTGCGAATTGCAGAAATACGTG AATCATCGAATCTTTGAACGCAAATTGCGCTCGAGGCTTCGGCCAAG

TGTGCATGCAAGCGGAGCTGGCTGTCTCGGCCCCTCGTAAAACAGG

TGCCGGGTCTGCTGAAGTACAGAGGTTGATGCATGGACCCGCTCATG

GGCCTCAA TGGGTAGGCAACTCGTTGCTAATGCTTTAGTTGATGGC

GAACTTAAGC ATATCAATAAGCGGAGGA ) (SEQ ID NO: 1 ), which is 89% similar to the closest Chlamydomonas callosa, is a new species of Chlamydomonas.

The inventors have deposited the Chlamydomonas DQA-01 W^Chlamydomo Li sp. DQA-Ol) on January 6, 2010 at the General Microbiology Center of the China Microbial Culture Collection Management Committee (No. 1 Beichen West Road, Chaoyang District, Beijing) No. 3, referred to as CGMCC, has a deposit number of CGMCC No. 3577. Effect of the invention

The Chlamydomonas strain isolated according to the present invention can accumulate oil which accounts for more than 20% by dry weight in the case of high light, and the oil has good fluidity and is a good quality fat. This strain of Chlamydomonas has its own characteristics of relatively high oil and fat, and it will be of great significance to use microengineering biodiesel to break through the problems of low yield and high cost of existing energy microalgae. DRAWINGS

Figure 1 is a phylogenetic tree constructed based on the ITS and 5.8S partial sequences of DQA-01 strains. Figure 2 is a photomicrograph of DQA-01 algae strain

Figure 3 is a fluorescence micrograph of Nile red staining of DQA-01 algae strain.

Figure 4 is a comparison of the DQA-01 algae ITS sequence with the Chlamydomonas callosa in the genebank. The inventiveness of the present invention:

Chlamydomonas, which is currently used for genetic engineering, is a species of algae that does not produce oil or produces very little oil, while other strains with high oil content are more difficult to genetically engineer than algae.

The microalgae provided in the present invention not only produces oil, but also a species of the genus Chlamydomae, and provides an operationally simple material for the genetic modification of the microalgae producing diesel. Preferred embodiments of the present invention will now be described by way of specific embodiments. However, the scope of protection of the present invention is not limited by the embodiments. detailed description

Example 1 Screening of the oil-bearing algae strain

Take the water from the Daqi area after dilution with sterile water. After 400 times microscope observation, the cell concentration is about 800-1200/ml. Use a capillary to take about 1ul of algae solution and inoculate it in 48 holes. In a plate containing BG11 medium, culture was carried out at 25 ° C and light intensity of 50 μπι _Ο 1 / ιη ² . _δ . When a certain cell concentration was reached, microscopic observation was performed to select only the wells of the single-algae strain. Laying the plate to obtain a single algae strain.

The pure algae strain was cultured in BG11 medium at 25 ° C and light intensity of 5 (^mol/m ² .s. When the concentration of algae reached 3 g/l, the tube was opened to make the light intensity reach 250 mol/m ² . _S for oil induction;

The single-algae strain was stained with Nile Red, and the oil in the algae was stained with color, and observed under a fluorescence microscope (see Fig. 3). The algae strain with high fluorescence was selected, which is a strain with high oil content. The isolated algae strain with higher oil content was named DQA-01.

Example 2 Determination of the classification of algal species on the phylogenetic tree

The identification of the strain of the algae is combined with shape identification and molecular identification. Shape identification (see Figure 2): The above-mentioned isolated strain DQA-01 was observed on a 1000-fold microscope and found to be single-celled, spherical or ovate, with two equal-length flagella at the front end, capable of swimming. There are two telescopic bubbles at the base of the flagella; another at the near front end of the cell, there is a red eye point. The chromophore has a large cup shape with a starch core. Asexual reproduction produces zoospores; sexual reproduction is homozygous, heterozygous and egg-like. Under unfavorable living conditions, the cells stop swimming and undergo multiple divisions, and the outer thick colloidal sheath forms a temporary group called "indefinite group". Searching for "Chinese freshwater algae--systems, classifications and ecology", it was found that the algae were classified in the same form as Chlorophyta, Chlorophyceae, Chlorella, Chlamydomonas, and Chlamydomonas.

Molecular identification:

A, amplification of its ITS and 5.8S partial nucleotide sequences from isolated Chlamydomonas

The DQA-01 algae genomic DNA cultured for 4 days was extracted by CTAB method. Take a certain amount of cells, add a proper amount of CTAB buffer after grinding, homogenize, add an equal volume of phenol: chloroform extraction, equal volume of isopropanol precipitation, wash with 75 % ethanol and dissolve in a certain volume of sterile double distilled water, The concentration and purity were measured by an ultraviolet spectrophotometer.

ITS sequence amplification was performed using a universal primer for eukaryotic ITS amplification (primer synthesis was synthesized by Shanghai Shenggong Bioengineering Co., Ltd.).

Primer 1 5, GGAAGTAAAAGTCGTAACAAGG 3,

Primer 2 5, GCATATC AATAAGCGGAGGA 3,

Take 1 μΐ of total DNA as a template. The amplification conditions were as follows: denaturation at 94 °C for 5 min, then 94 V 40 s, 56 °C for 40 s, 72 °C for 2 min 30 cycles, and finally 72 °C for 10 min. The amplified product was detected by 1.0% agarose gel electrophoresis, and a about 750 bp fragment was obtained by PCR amplification. The sequence is shown as SEQ ID NO: 1.

B, cloned nucleotide sequence homology search

The obtained ITS and 5.8S partial sequences of DQA were transcribed into the GenBank database for BLAST alignment. The results showed that the internal transcriptional spacer 1 (ITS1), 5.8S ribosomal RNA and internal transcription of Cammydomonas cfl//o with ACCESSION number U66945 The spacer 2 (ITS2) sequence has a high similarity of 89% (see Figure 4), the Chlamydomonas callosa sequence, l-.217b is the ITS 1 sequence, and 218-378 is the 5.8S ribosomal RNA gene sequence, 377- 625 is the ITS2 sequence. C, according to the above sequence to make a phylogenetic tree, see Figure 1.

Sequence similarity analysis was performed on the ITS partial sequence of the strain DQA using the BLAST tool in the NCBI database. A part of the homologous sequence and the ITS partial sequence of the strain were selected by the clustaLx software package for sequence homologous evolution alignment to form a multiple sequence matching arrangement matrix. Then, using the Mega4.0 software, the Neighbor-joining algorithm is used, and the bootstraps value of the self-expanding data set is 1000 to construct the phylogenetic tree.

Based on the morphology and results of ITS blast, DQA-01 is defined as a new species of Chlamydomonas - Chlamydomonas Sp.

The inventor has deposited the algae strain on the General Microbiology Center of the China Microbial Culture Collection Management Committee on January 6, 2010 (No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, referred to as CGMCC), and its deposit number is CGMCC. No.3577.

Example 3 Accumulation of Chlamydomonas oil

The algal species in the logarithmic growth phase are inoculated into the prepared medium, and growth culture and fat-induced culture are carried out by adjusting the light intensity. The medium and general method for carrying out the accumulation of Chlamydomonas oil are as follows:

A, medium preparation:

Medium preparation according to the following BG11 formula

NaN0 ₃ 0.8--1.5 g/1

K ₂ HP0 ₄ . 3H ₂ 0 0.02—0.08 g/1

MgS0 ₄ ·7Η ₂ Ο 0.075 g/1

CaCl ₂ . 2Η ₂ Ο 0.036 g/1

Citric acid 0.006 g/1

Ferric ammonium citrate 0.006 g/1

EDTA (dinatrium-salt) 0.001 g/1

Na ₂ C0 ₃ 0.02 g/1

A5 + Co solution * 1ml Deionized water 919ml

* Composition of A5 + Co solution

Add to 1000 ml of deionized water

H ₃ B0 ₃ 2.86g

MnCl ₂ . H ₂ 0 1.81g

ZnSO ₄ . 7H ₂ 0 0.222g

CuS0 ₄ . 5 H ₂ 0 0.079g

Na ₂ Mo0 ₄ . 2H ₂ 0 0.390g

Co(NO ₃ ) ₂ .6H ₂ 0 0.049g

B, vaccination

The Chlamydomonas strain DQA-01 green swimming cells were seeded in the configured medium to achieve a cell density of OD ₇₅ . It is between 0.2 and 0.8.

C, training

The light intensity of the culture process is controlled at 50-200μηκ)1/ιη ² . _δ , and the algae strain is kept uniform in the medium by aeration, the temperature is regulated in the range of 15-35 ° C, and the culture medium is passed through the culture medium. Pass the carbon dioxide and adjust the pH of the medium between 7-9.

D, oil accumulation induction

From the 5th day of cultivation, the light intensity was increased to make the light intensity 150-300 m _O l / _m ² .s. In this stage, Chlamydomonas began to accumulate oil. .

E, harvesting algae

When the culture progressed to the 12th day, when the color of the algae liquid turned yellow or milky, the algae liquid was collected, and the algal mud was obtained by centrifugation or natural sedimentation, and the algal mud was dried at 100 °C. Algae powder oil content accumulation and determination

The culture was carried out according to the above procedure, and the initial seeding cell density OD _75Q was 0.5, and BG11 medium was used, wherein the concentration of NaNO ₃ was 0.9 g/l, the concentration of K ₂ HPO ₄ 3H ₂ 0 was 0.04 g/l, and the light intensity was 6 ( ^mol/m ² .s, pH 7.2, the temperature is maintained at around 23 ° C, the light intensity is increased to 12 (^ mol / m ² .s on the third day, the light intensity is increased to 20 on the 7th day ( ^mol/m ² .s, cultivated to the first

12 days, when the color of the algae liquid turns yellow or milky, collect the algae liquid, by centrifugation or natural sedimentation The algal mud was obtained, and the algal mud was dried at 100 °C.

Determination of the content of algae oil after drying, the method of determination: Take 50mg or 100mg freeze-dried algae powder in a small glass bottle with a volume of 15-20ml with a Telfnon screw cap, then place a small magnetic rod, add 2 - 4ml 10% DMS0- Methanol solution, 40 °C sand bath (sanded beaker placed on a constant temperature heating magnetic stirrer) for 5 minutes; then magnetically stirred for 4 minutes at 4 Torr, centrifuged at 3500 rpm, transfer supernatant The liquid is in another vial. The remaining algae residue was further added with 1 : 1 diethyl ether, n-hexane 4- 8 ml, magnetically stirred at 4 ° C for 1 hour, centrifuged at 3500 rpm, and the supernatant was transferred to the above-mentioned vial. The above process can be repeated until the algal residue turns white. Add pure water to the above combined extracts to make the ratio of four (water, DMSO-Methanol. diethyl ether, n-hexane) 1: 1 : 1 : 1, shake the phase separation, transfer the organic phase to another small glass bottle In the hood, the nitrogen is blown into a concentrated liquid, and then transferred to a previously weighed 1.5 ml plastic centrifuge tube, and then dried to a constant weight with nitrogen, and the tube weight after constant weight is weighed. The tube weight is subtracted from the previously weighed centrifuge tube to obtain the weight of the fat, and then the weight of the oil is divided by the weight of the algal powder, and the total content of the oil is calculated to be 31% of the dry weight of the algal powder.

Take 25mg - 100mg of algae powder and extract it according to the above method, dissolve it with hexamethylene hydride, and analyze it by gas chromatography using Agilent 6820 gas chromatograph (chromatographic conditions: carrier gas: nitrogen flow rate lml/min, hydrogen flow rate 30ml/min, air flow rate 300ml) /min, inlet temperature: 280 °C, detector temperature: 280 °C, detector type: FID, analytical method: internal standard method, inlet type: split/splitless inlet), grease group The fractions are as shown in Table 1 below.

Table 1 Table of total lipid components of samples determined by gas chromatography (component content is percentage by weight)

The Chlamydomonas in the present invention has a certain oil content and can be used for refining biodiesel; the algae species is a species under the genus Chlamydomonas, which is the same genus as the Chlamydomonas reinhardtii which has done a lot of genetic research. There are many similarities in evolution, so it is possible to use the research experience of C. reinhardtii to genetically engineer the Chlamydomonas solani, which will help the research on the genetic modification of energy microalgae.

Claims

a strain of algae

3⁄4 DQA-01), deposited at the General Microbiology Center of the China Microbial Culture Collection Management Committee, and its deposit number is CGMCC No.3577.

2. Chlamydomonas strain according to claim 1, characterized in that it is cultured at a temperature ranging from 15 to 35 °C.

3. The Chlamydomonas strain according to claim 1, characterized in that the light intensity is controlled to be 50--20 (^mol/m ² .s) during the cultivation.

Chlamydomonas sp strain according to claim 1, characterized in that the light intensity 150-300μιηο1 / ιιι under ^2.8 are induced fat accumulation.

The Chlamydomonas strain according to claim 1, characterized in that the pH of the medium is adjusted to be between 7 and 9 during the cultivation.

6. Use of the Chlamydomonas strain of any of claims 1-5 for the preparation of biodiesel, feed or edible oil.

7. Use of the Chlamydomonas strain of any of claims 1-5 for the preparation of a genetically modified strain of algae.

8. A method of producing biodiesel, the method characterized by producing the Chlamydomonas strain of any one of claims 1-5.

9. A method of isolating the microalgal strain of claim 1 comprising the steps of:

1) Algae collection: Select contaminated rivers, lakes or marshes with a variety of algae, and use algae collectors for algae collection;

2) Separation and purification of algae: The mixed algae species are separated by a dilution plating method or a capillary method to obtain a pure algae strain of a single algae species;

3) Algae cultivation and oil induction: The pure algae strain is cultured in BG11 medium at 25 °C. When the concentration of algae reaches lg/l-8g/l, the light intensity is 150-300μηιο/ιη ² .3 Conducting oil and fat induction;

4) Determination of oil content: The algae after the oil-induced induction were stained with Nile Red, and observed under a fluorescent microscope. The algae species with more fluorescence were selected to quickly obtain algae with higher oil content.