CN105969667A - Scenedesmus obliquus strain and separation purifying method, cultivation method and application thereof - Google Patents

Scenedesmus obliquus strain and separation purifying method, cultivation method and application thereof Download PDF

Info

Publication number
CN105969667A
CN105969667A CN201610502815.9A CN201610502815A CN105969667A CN 105969667 A CN105969667 A CN 105969667A CN 201610502815 A CN201610502815 A CN 201610502815A CN 105969667 A CN105969667 A CN 105969667A
Authority
CN
China
Prior art keywords
algae
culture medium
scenedesmus obliquus
concentration
sohncj2
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610502815.9A
Other languages
Chinese (zh)
Other versions
CN105969667B (en
Inventor
王赟
柯飞
王红强
屈二军
梁峰
杨雨彬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Henan University of Urban Construction
Original Assignee
Henan University of Urban Construction
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Henan University of Urban Construction filed Critical Henan University of Urban Construction
Priority to CN201610502815.9A priority Critical patent/CN105969667B/en
Publication of CN105969667A publication Critical patent/CN105969667A/en
Application granted granted Critical
Publication of CN105969667B publication Critical patent/CN105969667B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/89—Algae ; Processes using algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/12—Unicellular algae; Culture media therefor
    • C12N1/125—Unicellular algae isolates
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F3/00—Biological treatment of water, waste water, or sewage
    • C02F3/32—Biological treatment of water, waste water, or sewage characterised by the animals or plants used, e.g. algae
    • C02F3/322—Biological treatment of water, waste water, or sewage characterised by the animals or plants used, e.g. algae use of algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/02—Separating microorganisms from their culture media
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/12—Unicellular algae; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436—Fatty acid esters
    • C12P7/649—Biodiesel, i.e. fatty acid alkyl esters
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Biomedical Technology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Hydrology & Water Resources (AREA)
  • Environmental & Geological Engineering (AREA)
  • Water Supply & Treatment (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to a separation purifying method of a scenedesmus obliquus strain SoHNCJ2. The separation purifying method includes: diluting a sampled water sample, evenly coating a BG11 culture medium flat plate of 1.5-2% agar with the diluted water sample, and placing into a cultivation box for continuous illumination cultivation; using a toothpick to pick a single colony after the single colony grows on the flat plate, and cultivating the single colony on the BG11 flat plate by drawing a short streak; using an inoculation needle to perform separation and sterilizing on cultivated algae species by drawing a Z-shaped streak, and using a dilution and flat plate coating method to further purify the algae species; picking the single colony to draw a short streak, picking the short-streak colony to draw a Z-shaped streak, and alternating the process for 2-4 times to obtain the purified single colony. A cultivation method of the scenedesmus obliquus strain SoHNCJ2 is characterized in that the concentration of N or P of the fresh water cyanobacteria culture medium BG11 is lowered to 1/4 of the original concentration or increased to 3 times of the original concentration. The cultivated scenedesmus obliquus strain can grow continuously and fast under a low-concentration N source condition, algae cells can effectively accumulate a large amount of grease, and grease conversion production can be performed to produce biodiesel.

Description

A kind of scenedesmus obliquus algae strain and isolation and purification method, cultural method and application
Technical field
The invention belongs to microorganism and field of biological energy source, especially relate to a kind of scenedesmus obliquus algae strain and isolated and purified, cultivate, collection method and application thereof.
Background technology
Becoming increasingly prosperous along with socioeconomic, mankind's available resources is the most exhausted, and for the sustainable development of society, research direction has gradually been turned to regenerative resource by world government and relevant technical staff.
Because tellurian algae resource species enrich, wherein it is no lack of rich oil algae kind.Therefore from oil algae, extract the oils and fats production for biodiesel, to replace day by day exhausted petroleum resources, become the problem that scientific circles extremely pay close attention to.And the cultivation extracting method of the existing rich oil algae of prior art and relevant application thereof are open, but for its abundant application, the only a drop in the ocean.Therefore, the research to this kind of technology is still the most persistently being goed deep into and in expansion, still has substantial amounts of rich oil algae species, needs to go to find, needing to go to realize effectively cultivating and separating, needs go to carry out deep applied research.
Summary of the invention
The present invention is directed to prior art not enough, it is proposed that the isolated and purified and cultural method of a kind of scenedesmus obliquus algae strain, and be applied to be studied.From field acquisition water sample, obtain a kind of scenedesmus obliquus algae strain SoHNCJ2(by cultivation, separation, purificationScenedesmus obliquus), and carried out preservation, its deposit number is CCTCC NO:M 2016253, Classification And Nomenclature: Scenedesmus obliquus SoHNCJ2, preservation date is on May 6th, 2016, and depositary institution is China typical culture collection center, address: China. Wuhan. and Wuhan University.
The technical solution adopted in the present invention:
One strain scenedesmus obliquus algae strain SoHNCJ2, its deposit number is CCTCC NO:M2016253, and preservation date is on May 6th, 2016, and depositary institution is China typical culture collection center.
A kind of isolation and purification method of scenedesmus obliquus algae strain SoHNCJ2 as above, 1) it is uniformly coated on the BG11 culture medium flat plate of 1.5-2% agar after the water sample dilution of collection, it is placed in incubator and carries out continuous illumination cultivation；2) treat that growing single algae on flat board falls behind, fall on BG11 flat board, draw short-term with toothpick picking list algae and cultivate；3) gained is drawn algae kind Inoculating needle that short-term cultivates again draw Z-shaped and carry out the separation of algae kind and degerming, be then further purified algae kind by the method for dilution painting flat board；4) picking list algae falls to drawing and obtains pure single algae after short-term and picking short-term algae fall to drawing Z line alternately 2～4 times and fall；Described culture medium uses Fresh Watcr Blue Algae culture medium BG11.
The cultural method of a kind of scenedesmus obliquus as above, is reduced to the N concentration of Fresh Watcr Blue Algae culture medium BG11 original 1/4, i.e. use the BG11 culture medium of 1/4N concentration, and composition and the consumption of described BG11 culture medium are as follows:
NaNO3, 0.375g
K2HPO4, 0.04g
MgSO4.7H2O, 0.075g
CaCl2.7H2O, 0.036g
Na2CO3, 0.02g
Citric acid, 0.006g
Ferric citrate, 0.006g
Trace element solution, A5 1mL
Distilled water is used to be settled to 1000mL.
The cultural method of a kind of scenedesmus obliquus as above, increases to the N concentration of Fresh Watcr Blue Algae culture medium BG11 original three times, i.e. uses the BG11 culture medium of 3N concentration, and composition and the consumption of described BG11 culture medium are as follows:
NaNO3, 4.5g
K2HPO4, 0.04g
MgSO4.7H2O, 0.075g
CaCl2.7H2O, 0.036g
Na2CO3, 0.02g
Citric acid, 0.006g
Ferric citrate, 0.006g
Trace element solution, A5 1mL
Distilled water is used to be settled to 1000mL.
The cultural method of a kind of scenedesmus obliquus as above, increases to the P concentration of Fresh Watcr Blue Algae culture medium BG11 original three times, i.e. uses the BG11 culture medium of 3P concentration, and composition and the consumption of described BG11 culture medium are as follows:
NaNO3, 1.5g
K2HPO4, 0.12g
MgSO4.7H2O, 0.075g
CaCl2.7H2O, 0.036g
Na2CO3, 0.02g
Citric acid, 0.006g
Ferric citrate, 0.006g
Trace element solution, A5 1mL
Distilled water is used to be settled to 1000mL.
The cultural method of described scenedesmus obliquus, makes algae strain in temperature 15～40 DEG C, light intensity 500～2500lux, growing under conditions of pH7-9, cultivate to the logarithmic growth later stage, frustule is complete natural subsidence in 6～12h, pour out the culture medium on upper strata, i.e. obtain the algae solution of high concentration.
Described scenedesmus obliquus algae strain SoHNCJ2, it is mass propgation in 1/4N BG11 culture medium, grows unaffected, and fat content is the highest, it is thus achieved that oil-containing frustule in the application turned in esterified production biodiesel.
Described scenedesmus obliquus algae strain SoHNCJ2, the content of polyunsaturated fatty acid of the scenedesmus obliquus SoHNCJ2 that its mass propgation obtains is higher, for the interpolation of animal feed.
Described scenedesmus obliquus algae strain SoHNCJ2, it grows unaffected in 3N and 3P culture medium, the application in organic contamination sewage disposal of its cultural method.
Beneficial effects of the present invention:
1, the scenedesmus obliquus of the present invention can grow continuously and healthily under the conditions of the N source of low concentration, cost-effective.Under relatively low N concentration conditions, frustule can effectively accumulate a large amount of oils and fats, it is possible to carries out turning esterified production biodiesel.
2, the cultural method of scenedesmus obliquus algae strain SoHNCJ2 of the present invention, frustule can in 6～12h natural subsidence, it is not necessary to adding flocculant, collection method is simple, cost-effective, reduces the pollution to environment.
3, the cultural method of scenedesmus obliquus algae strain SoHNCJ2 of the present invention, in frustule, in oils and fats, content of polyunsaturated fatty acid is high, it is possible to as the direct nourishing additive agent of animal feed.
4, the cultural method of scenedesmus obliquus algae strain SoHNCJ2 of the present invention, is applied to organic contamination sewage disposal, has certain water body purification effect, can reduce the eutrophication of water body.Because scenedesmus has stronger patience to organic pollution, therefore can add a certain proportion of organic contamination sewage, both purifying water bodies in the medium, reduce again cost.
Accompanying drawing explanation
Fig. 1 is the present invention isolated and purified frustule frustule form schematic diagram under high power microscope；
Fig. 2 is the phylogenetic analysis of the isolated and purified algae strain 16SrDNA sequence of the present invention；
Fig. 3 is the present invention isolated and purified algae strain growth curve under different N concentration；
Fig. 4 is natural subsidence schematic diagram after the present invention isolated and purified algae strain mass propgation；
Fig. 5 is the present invention isolated and purified scenedesmus obliquus growth curve in high N, P concentration.
Detailed description of the invention
Embodiment 1
One strain scenedesmus obliquus algae strain SoHNCJ2, its deposit number is CCTCC NO:M2016253, and preservation date is on May 6th, 2016, and depositary institution is China typical culture collection center.
Embodiment 2
The isolation and purification method of a kind of scenedesmus obliquus algae strain SoHNCJ2, comprises the steps:
1) be setting Lake Reservoir multipoint acquisition water sample from Xincheng District, Pingdingshan City, be uniformly coated on after the water sample of collection is diluted 1.5～2% agar BG11 culture medium flat plate on, be placed in incubator and carry out continuous illumination cultivation；
2) treat that growing single algae on flat board falls behind, fall on BG11 flat board, draw short-term with toothpick picking list algae and cultivate；
3) gained is drawn algae kind Inoculating needle that short-term cultivates again draw Z-shaped and carry out the separation of algae kind and degerming, be then further purified algae kind by the method for dilution painting flat board；
4) picking list algae falls to drawing and obtains the purest single algae after short-term and picking short-term algae fall to drawing Z line alternately 2～4 times and fall.
Culture medium uses Fresh Watcr Blue Algae culture medium BG11.
The authentication method of isolated and purified scenedesmus obliquus algae strain SoHNCJ2:
1) frustule identification of morphology:
Frustule is being observed under 1000 times of optical microscopes, frustule form as shown in Figure 1: frustule yellow green, in oval, mostly being 2 cells to arrange in pairs, cell wall smooths, the lunge of cell two ends tool bending, intracellular have a large amount of particulate matter, chromatoplast Zhousheng, has 1 pyrenoids.Individual cells size: long 6-8um, wide 2-3um, it is initially identified as scenedesmus.
2) 16S rDNA Molecular Identification:
Using CTAB method to extract genomic DNA, method is as follows: first by 2 × CTAB at 65 degree of pre-stand-by heats；12000rpm is centrifuged collection 1.5mL or more grows to the frustule of late log phase in eppendorf pipe；Broken cell, adds the 2 × CTAB of about 100 μ L and a small amount of quartz sand vortex concussion, adds 2 × CTAB of about 300 μ L preheatings, is placed in 65 degree of temperature bath 0.5-2h；It is cooled to room temperature, adds 400 μ L chloroforms: isoamyl alcohol (24:1), reverse mixing milkiness shape, 12000rpm is centrifuged 10min, supernatant proceeds in new eppendorf pipe, adds 5M NaCl and the dehydrated alcohol of 2 times of volumes of 1/5 volume ,-20 degree sedimentation after mixing.12000rpm is centrifuged 10min, abandons supernatant, and the precipitation obtained adds the ethanol of 500 μ L 70%, centrifugal 3min, abandons supernatant.The STb gene obtained is dissolved in appropriate volume aquesterilisa or TE buffer after super-clean bench dries.
With frustule genomic DNA as template, by primer 18S-1:(5 ＇-TGGTTGATCCTGCCAGTAGTC-3 ＇) and 18S-2:(5 ＇-TGATCCTTCTGCAGGTTCACC-3 ＇) carry out PCR amplification.The PCR reaction system of 50 μ L includes: 10 × Taq buffer 5 μ L, MgCl24 μ L, 2.5mM dNTPs 1 μ L, ExTaq enzyme (Fermentas) the 0.5 μ L of 5U/ μ L, each 500pmol of primer, 1 μ L genomic DNA.PCR course of reaction is: 94 degree of denaturations 6min, followed by 30 circulations (94 degree of 30sec, 55 degree of 30sec, 72 degree of 2min), is finally 72 degree and extends 10min.
The PCR primer that amplification obtains detects with the agarose gel electrophoresis of 0.8%, after detection amplification obtains purpose fragment, then separates with the agarose gel electrophoresis of 0.8%, reclaims test kit (Bioflux) with gel and reclaim purification purpose fragment.The description provided according to actual box operates, and basic process is as follows: cut the adhesive tape containing purpose fragment, is added thereto to isopyknic Extraction buffer, 55 degree of temperature bath about 10min；Going to after sample is cooled to room temperature in purification column, 6000rpm is centrifuged 1min, outwells the waste liquid in collecting pipe；Add 500 μ L Extraction buffer 12000rpm and be centrifuged 1min, outwell the waste liquid in collecting pipe；Add 750 μ L Washing buffer 12000rpm and be centrifuged 1min, outwell the waste liquid in collecting pipe；Then 12000rpm is centrifuged 1min to Washing buffer and eliminates；Purification column is placed in clean 1.5mL centrifuge tube, adds the aquesterilisa of 30 μ L preheatings or TE buffer on purification column, place 12000rpm after 1min and be centrifuged 1min, reclaim the DNA of purification and be sent to the raw work in Shanghai and check order.Sequencing result carries out Blast analysis on NCBI, identifies the kind belonging to algae strain.
The 16SrDNA sequence (sequencing result) of isolated and purified algae strain is as follows:
>SoHNCJ2
CGCAGGGCGGCAGCTACACATGCAAGTCGAACGAGATCTTTTTCTTGTGCCGTTCCGCGGACCAAGAGAAAGATTGCAGTGGCGGACGGGTGAGGAACACGTAAGAACTTACCTTTTGGCGGGGGATAACATCGGGAAACTGTTGCTAATACCCCATAATGCTGAGGAGCGAAAGGGAAACCACCAAAAGAGAGGCTTGCGTCTGATTAGCTAGTTGGCGGAGGTAAATGCTCCCCAAGGCGACGATCAGTAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATTTTCCACAATGGGCGAAAGCCTGATGGAGCAATACCGCGTGAGGGATGACGGATCGTGGTCTGTAAACCTCTTTTCTTAAGGAAGAATCAATGACGGTACTTAAGGAATAAGCACCGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGGGGGTGCAAGCGTTGTCCGGAATGATTGGGCGTAAAGCATCTGTAGGTGGTTCTTCAAGTCGACTGTTAAAGCCCAGGGCTTAACTTTGGAGAAGCGGTCGAGTACTTAGGGACTTGAGTTTGGTAGGGGTAGAGGGAATTCCTAGTGGAGCGGTGAAATGCACAGAGATTAGGAAGAACACCGAGGGCGAAAGCACTCTACTGGGCCACAACTGACACTGAGAGATGAAAGTTGGGGGAGCGAAAAGGATTAGATACCCTTGTAGTCCCAACTGTAAACGATGGATACTAAGTGCTGGCAAAACCAGTGCTGTAGCTAACGCGTTAAGTATCCCGCCTGGGGAGTATGCTCGCAAGAGTGAAACTCAAAGGAATTGACGGGAACTGGCACAAGCGGTGGATTATGCGGGTTTAATTCGATGATACACGAAGAACCTTACCATGGATTGACATGCTCATAACTTCTGAGAGATCGGGACGGTGCCCGTTTTCAAACACGGGAGTTGAGACACAGGTGGTGCATGGCTGTCGTCAGCTCGTGCCGTGAGGTGTCGAGTTAAGTCTTTAAACGAGCGCAACCCTTATCTTTTGCTACCACTTTTTTGAAAAGAACTCAAAAGAGACTGCCGCGTAATCGGGAGGCATGAGAGGATGACGTCAGTCAGCATGCCCGTACATCATGGGCCTACCGCGTACTACATGCAAGAACAATAGGACCGAACTCGGGAGGGGGGAAGCATCTAGCTAACTTTGTTCTCTCAGTTCGGAATTGAAAGT
Following table is isolated and purified algae strain 16S rDNA sequence alignment result:
Sequence alignment result shows, the 16S rDNA sequence of isolated and purified algae strain SoHNCJ2 is the highest with the similarity of scenedesmus obliquus, reaches 90%.
Fig. 2 is the phylogenetic analysis of the isolated and purified algae strain 16S rDNA sequence of the present invention.Phylogenetic analysis result shows, isolated and purified algae strain is nearest with the evolutionary relationship of scenedesmus obliquus.
Embodiment 3
The present embodiment be described scenedesmus obliquus algae strain SoHNCJ2 large-scaled culture method and for turn an esterified production biodiesel process.
1. the cultivation of frustule
Culture medium prescription: the N concentration of Fresh Watcr Blue Algae culture medium BG11 is reduced to original 1/4, is the culture medium of 1/4N BG11.Culture medium prescription: NaNO3, 0.375g；K2HPO4, 0.04g；MgSO4.7H2O, 0.075g；CaCl2.7H2O, 0.036g；Na2CO3, 0.02g；Citric acid, 0.006g；Ferric citrate, 0.006g；Trace element solution A5 1mL；Above-mentioned each composition employing distilled water is settled to 1000mL.
Trace element solution A5:H3BO4, 2.86g；MnCl2.4H2O, 1.81g；ZnSO4, 0.222g；Na2MoO4, 0.39g；CuSO4.5H2O, 0.079g；Co(NO3)2.6H2O, 49.4g.
Frustule cultivation temperature 30 DEG C, light intensity 2000lux.
The impact that algae strain is grown by 2.1/4N concentration
Configuration 1/4N concentration and normal BG11 fluid medium, load 300nL culture medium in every 500mL triangular flask.Algal species cultivation is to logarithmic growth after date, after centrifugal collection washed once, is inoculated in the culture medium of different N concentration, and adjusting initial OD values is about 0.05, is then placed into 30 DEG C, cultivates under conditions of 2000lux, is shaken every day twice, measured OD every three days730Light absorption value.
Fig. 3 show the present invention isolated and purified algae strain growth curve under different N concentration.As it is shown on figure 3, the dense reduction of N does not affect the growth rate of frustule, frustule continues logarithmic growth, illustrates that scenedesmus obliquus is resistant to relatively low N concentration, saves N source when large-scale culture, reduces cost.
3. the collection of frustule
Frustule can settle in 6-12h completely as shown in Figure 4, and the collection method therefore used is natural subsidence, and collection method is simple, it is not necessary to add any flocculant.
4. the extracting method of oils and fats
Cultivate the microalgae to plateau, centrifugal frustule of collecting, dry to constant weight, extract total fat in accordance with the following methods, weigh the weight of total fat, then calculate the percentage rate of oils and fats for 80 DEG C.
Oils and fats is extracted by the method for chloroform/methanol extraction.6000rpm is centrifuged 10min and collects frustule；Abandon supernatant, add the chloroform/methanol of the 1:1 of 1mL, vortex oscillation 1-2min；Add the phosphoric acid mixed liquor of the KCl+0.2mol/L of the 1mol/L of 0.3mL, vibration, make PHASE SEPARATION；6000rpm is centrifuged 10min, takes off layer chloroform in weighing botle；It is placed in fume hood and dries up solvent, weigh the weight of oils and fats.
N concentration in culture medium Fat content
1/4N 26.54%
1N 15.42%
In the BG11 culture medium of 1/4N concentration, intracellular oil and fat accumulation increases, and up to 27%, being significantly higher than BG11 culture medium, therefore 1/4N BG11 culture medium mass propgation scenedesmus obliquus can be used for the extraction of oils and fats, prepares biodiesel, reduce the use of N simultaneously, cost-effective, reduce the pollution to water body.
Embodiment 4
The present embodiment is the large-scaled culture method of described scenedesmus obliquus algae strain SoHNCJ2 and adds application for animal feed polyunsaturated fatty acid.
Configuration 1/4N, 3N, 3P concentration and normal BG11 fluid medium, load 300nL culture medium in every 500mL triangular flask.Algal species cultivation is to logarithmic growth after date, after centrifugal collection washed once, is inoculated in the culture medium of different N, P concentration, cultivates to plateau and collect frustule, and lyophilization is used for Analysis of Fatty Acids Composition
Analysis of Fatty Acids Composition
Oils and fats extracts: in collection frond to 10mL centrifuge tube.Adding 3mL extracting solution (chloroform: methanol=2:1, containing 0.5mg/mL 2,6-di-tert-butyl-4-methy phenol), test tube gentle agitation is overnight.5000rpm is centrifuged 5min, separates cell debris and oils and fats extracting solution.Cell debris soaks with 3mL extracting solution again, and test tube gentle agitation overnight, separates cell debris and oils and fats extracting solution again.Merging the oils and fats that the extracting solution of twice i.e. extracts, dry up with nitrogen, 4 DEG C preserve to use when analyzing.
Methyl esterification of fatty acid and detection:
The esterification reaction of organic acid of fatty acid uses sulfuric acid-methanol heating to carry out.The detection of fatty acid uses gas chromatography, detecting system: Agilent 7890A type gas chromatograph, fid detector；Chromatographic column:
HP-5 elastic quartz (30m × 0.32mm).Temperature programming: initial temperature 210 DEG C, keeps 9min, 20 DEG C/min to heat up, heats up 240 DEG C, keep 13min.Inner mark method ration, internal standard substance is behenic acid.
Fatty acid analysis result is as shown in the table:
Analysis of Fatty Acids Composition result shows that polyunsaturated fatty acid octadecadienoic acid and trienic acid content are higher, it is possible to be directly appended in animal feed under different N, P concentration condition of culture, to improve the unsaturated fatty acid content in animal feed.
Embodiment 5
The application in organic contamination sewage disposal of the cultural method of described scenedesmus obliquus algae strain SoHNCJ2.
Configuration 3N and 3P concentration and normal BG11 fluid medium, load 300nL culture medium in every 500mL triangular flask.Algal species cultivation is to logarithmic growth after date, after centrifugal collection washed once, is inoculated in the culture medium of high N, P concentration, and adjusting initial OD values is about 0.05, is then placed into 30 DEG C, cultivates under conditions of 2000lux, be shaken every day twice, measured OD every three days730Light absorption value.
As shown in Figure 5: scenedesmus obliquus growth rate in N, P of high concentration is basically identical at later stages with BG11 culture medium medium-rate, growth rate in high N concentration cultures is even slightly above common BG11 culture medium, and high N, P concentration that tiltedly raw algae is resistant in organic sewage is described.Additionally, high N, P concentration as shown in the table does not has significant impact to fat content in frustule.
N, P concentration in culture medium Fat content
3N 23.16%
3P 21.39%
Therefore in incubation, add a certain proportion of organic sewage, both saved cost, and purified water body.The cell collected can be used for again oils and fats and extracts, and turns esterified production biodiesel.

Claims (10)

1. a strain scenedesmus obliquus algae strain SoHNCJ2, its deposit number is CCTCC NO:M2016253, and preservation date is on May 6th, 2016, and depositary institution is China typical culture collection center.
2. the isolation and purification method of a scenedesmus obliquus algae strain SoHNCJ2 as claimed in claim 1, it is characterised in that:
1) it is uniformly coated on the BG11 culture medium flat plate of 1.5-2% agar after the water sample of collection being diluted, is placed in incubator and carries out continuous illumination cultivation；
2) treat that growing single algae on flat board falls behind, fall on BG11 flat board, draw short-term with toothpick picking list algae and cultivate；
3) gained is drawn algae kind Inoculating needle that short-term cultivates again draw Z-shaped and carry out the separation of algae kind and degerming, be then further purified algae kind by the method for dilution painting flat board；
4) picking list algae falls to drawing and obtains pure single algae after short-term and picking short-term algae fall to drawing Z line alternately 2～4 times and fall；
Described culture medium uses Fresh Watcr Blue Algae culture medium BG11.
3. the cultural method of a scenedesmus obliquus as claimed in claim 1, it is characterised in that: the N concentration of Fresh Watcr Blue Algae culture medium BG11 being reduced to original 1/4, i.e. uses the BG11 culture medium of 1/4 N concentration, composition and the consumption of described BG11 culture medium are as follows:
NaNO­3, 0.375g
K2HPO4, 0.04g
MgSO4 .7H2O, 0.075g
CaCl2.7H2O, 0.036g
Na2CO3, 0.02g
Citric acid, 0.006g
Ferric citrate, 0.006g
Trace element solution, A5 1 mL
Distilled water is used to be settled to 1000 mL.
4. the cultural method of a scenedesmus obliquus as claimed in claim 1, it is characterised in that: the N concentration of Fresh Watcr Blue Algae culture medium BG11 increasing to original three times, i.e. uses the BG11 culture medium of 3N concentration, composition and the consumption of described BG11 culture medium are as follows:
NaNO­3, 4.5g
K2HPO4, 0.04g
MgSO4 .7H2O, 0.075g
CaCl2.7H2O, 0.036g
Na2CO3, 0.02g
Citric acid, 0.006g
Ferric citrate, 0.006g
Trace element solution, A5 1 mL
Distilled water is used to be settled to 1000 mL.
5. the cultural method of a scenedesmus obliquus as claimed in claim 1, it is characterised in that: the P concentration of Fresh Watcr Blue Algae culture medium BG11 increasing to original three times, i.e. uses the BG11 culture medium of 3P concentration, composition and the consumption of described BG11 culture medium are as follows:
NaNO­3, 1.5g
K2HPO4, 0.12g
MgSO4 .7H2O, 0.075g
CaCl2.7H2O, 0.036g
Na2CO3, 0.02g
Citric acid, 0.006g
Ferric citrate, 0.006g
Trace element solution, A5 1 mL
Distilled water is used to be settled to 1000 mL.
6. according to the cultural method of the scenedesmus obliquus described in claim 3,4 or 5, it is characterized in that: make algae strain temperature 15～40 DEG C, light intensity 500～2500 lux, grow under conditions of pH7-9, cultivate to the logarithmic growth later stage, frustule is complete natural subsidence in 6～12h, pours out the culture medium on upper strata, i.e. obtains the algae solution of high concentration.
The cultural method of scenedesmus obliquus the most according to claim 6, it is characterised in that: cultivation temperature is 30 DEG C, and light intensity is 2000lux.
8. the scenedesmus obliquus algae strain SoHNCJ2 described in, it is mass propgation in 1/4N BG11 culture medium, grows unaffected, and fat content is the highest, it is thus achieved that oil-containing frustule in the application turned in esterified production biodiesel.
9. the scenedesmus obliquus algae strain SoHNCJ2 described in, the content of polyunsaturated fatty acid of the scenedesmus obliquus SoHNCJ2 that its mass propgation obtains is higher, for the interpolation of animal feed.
10. the scenedesmus obliquus algae strain SoHNCJ2 described in, it grows unaffected in 3N and 3P culture medium, the application in organic contamination sewage disposal of its cultural method.
CN201610502815.9A 2016-06-28 2016-06-28 A kind of strain of scenedesmus obliquus algae and its cultural method and application Active CN105969667B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610502815.9A CN105969667B (en) 2016-06-28 2016-06-28 A kind of strain of scenedesmus obliquus algae and its cultural method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610502815.9A CN105969667B (en) 2016-06-28 2016-06-28 A kind of strain of scenedesmus obliquus algae and its cultural method and application

Publications (2)

Publication Number Publication Date
CN105969667A true CN105969667A (en) 2016-09-28
CN105969667B CN105969667B (en) 2019-06-14

Family

ID=56953462

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610502815.9A Active CN105969667B (en) 2016-06-28 2016-06-28 A kind of strain of scenedesmus obliquus algae and its cultural method and application

Country Status (1)

Country Link
CN (1) CN105969667B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106623406A (en) * 2016-12-23 2017-05-10 浙江大学 Waste water and acid soil combined remediation method
CN111172039A (en) * 2020-03-10 2020-05-19 宁波大学 Two-stage low-nitrogen low-phosphorus stress microalgae culture method

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104611227A (en) * 2013-11-05 2015-05-13 中国石油化工股份有限公司 Scenedesmus obliquus with tolerance to high pH and breeding method thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104611227A (en) * 2013-11-05 2015-05-13 中国石油化工股份有限公司 Scenedesmus obliquus with tolerance to high pH and breeding method thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
杨宋琪等: "斜生栅藻在不同磷条件下氮生态幅的研究", 《水生生物学报》 *
许海等: "铜绿微囊藻、斜生栅藻对氮磷饥饿的耐受能力研究", 《生态科学》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106623406A (en) * 2016-12-23 2017-05-10 浙江大学 Waste water and acid soil combined remediation method
CN106623406B (en) * 2016-12-23 2019-10-29 浙江大学 A method of joint repairs waste water and acid soil
CN111172039A (en) * 2020-03-10 2020-05-19 宁波大学 Two-stage low-nitrogen low-phosphorus stress microalgae culture method

Also Published As

Publication number Publication date
CN105969667B (en) 2019-06-14

Similar Documents

Publication Publication Date Title
CN102093955B (en) Chlorella strain and application thereof
CN104611228B (en) Highly oil-containing monoraphidium and culture and application thereof
Tale et al. Isolation and characterization of microalgae for biodiesel production from Nisargruna biogas plant effluent
Zhang et al. Domestic wastewater treatment and biofuel production by using microalga Scenedesmus sp. ZTY1
CN102492626B (en) Intend Nannochloropsis oceanica and application thereof
Narayanan et al. Isolation, identification and outdoor cultivation of thermophilic freshwater microalgae Coelastrella sp. FI69 in bubble column reactor for the application of biofuel production
CN106467897B (en) A kind of grease-contained scenedesmus of richness and its culture application
CN107177505B (en) Scenedesmus as well as culture method and application thereof
CN103184156B (en) Scenedesmus algal strain and its use
CN106916747A (en) The strain of Sorokin chlorella algae and its cultural method and purposes
CN103555584B (en) Acquisition and application of grease-producing monoraphidium LB50
CN104004658B (en) One strain utilizes high concentration CO2show the limnetic chlorella of heterotrophic growth characteristic
CN105331552A (en) Efficient denitrification novel Acinetobacter and application thereof
CN103146581B (en) Marine Nannochloropsis oceanica strain containing rich hexadecadienoic acid and culture method thereof capable of enhancing biomass and oil content
CN105969667A (en) Scenedesmus obliquus strain and separation purifying method, cultivation method and application thereof
CN103160440B (en) The one algae strain of strain grid algae and application thereof
Cheng et al. Identification of a newly isolated microalga from a local pond and evaluation of its growth and nutrients removal potential in swine breeding effluent
Lan et al. Resource utilization of microalgae from biological soil crusts: Biodiesel production associated with desertification control
WO2011085642A1 (en) Chlamydomonas strain and uses thereof
CN103540533B (en) Obtaining and application of oil-producing monoraphidium LB59
CN102943044B (en) Scenedesmus sp. and use thereof
Chik et al. Isolation, purification and identification of microalgae from coal-fired power plant environment
CN102978118A (en) Scenedesmus sp., CHX1 and use thereof
CN116064239A (en) Grease-rich micro-mango algae and culture application thereof
CN106467894B (en) One plant height produces single needle algae and its culture application of starch and grease

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant