CN103589737B - A kind of microalgae triacylglycerol synthesis regulation gene and application thereof - Google Patents
A kind of microalgae triacylglycerol synthesis regulation gene and application thereof Download PDFInfo
- Publication number
- CN103589737B CN103589737B CN201310342931.5A CN201310342931A CN103589737B CN 103589737 B CN103589737 B CN 103589737B CN 201310342931 A CN201310342931 A CN 201310342931A CN 103589737 B CN103589737 B CN 103589737B
- Authority
- CN
- China
- Prior art keywords
- gene
- sequence
- crbbox
- protein
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a kind of microalgae triacylglycerol synthesis regulation gene and encoding proteins thereof and application, this gene is derived from Chlamydomonas reinhardtii, is one of following nucleotide sequences: 1) SEQ ID NO:1DNA sequence in sequence table；2) polynucleotide of SEQ ID NO:2 protein sequence in polynucleotide；3) DNA sequence limited with SEQ ID NO:1 in sequence table has more than 90% homology and coding identical function protein DNA sequence.The encoding proteins of this gene is to have the protein of the amino acid residue sequence shown in SEQ ID NO:2 in sequence table, and protein I D is 159133, the protein being made up of 410 amino acid residues.This CrBbox gene can be applicable to change the neutral fat content of Chlamydomonas reinhardtii, can apply to the cultivation of novel high fat content algae strain.
Description
Technical field
The present invention relates to a kind of gene that can significantly change microalgae neutral fat content, Lay can be significantly changed particularly to one
The controlling gene of mattress chlamydomonas neutral fat content and application thereof.
Background technology
Entering 21 century, economy develops rapidly, and the consumption of the Fossil fuels such as oil is increased by the mankind day by day, and use
Stone fuel brings Heavy environmental pollution problem, and countries in the world are all in the regenerative resource finding safety.Bioenergy can between
Connect or directly utilize the photosynthesis of plant or microorganism, solar energy is fixed as chemical energy, be the first-selection of regenerative resource.
Biodiesel and alcohol fuel are the bioenergy that can come into the market as gasoline additive at present, the wherein one-tenth of biodiesel
Point closer to gasoline, and wide material sources, low cost, it it is most possible one of regenerative resource solving oil crisis.
The preparation of biodiesel is mainly made by ester exchange process with methanol (ethanol) by triacylglycerol (TAG).
The yield of biodiesel is being continuously increased in recent years, and within 2008, Global biodiesel total amount reaches 11,100,000 tons, it is contemplated that to 2016
Year biodiesel total output reaches 121,000,000 tons, but the price of biodiesel is still high so far.Cost of material occupies
The 60-70% of biodiesel total cost of production.At present the raw material of biodiesel has food and drink abandoned oil, animal and plant fat and micro-
Algae.Utilize microalgae to produce biodiesel and there is unrivaled advantage, it has also become the main path of preparation biodiesel.
Microalgae is utilized to have a lot of processing step, the selection-breeding of the most excellent algae kind to be crucial to produce biodiesel.The most preferable
Production of biodiesel algae strain require growth rapidly, oil content is high and fatty acid composition suitably prepares biodiesel.Current grinds
Study carefully work and be concentrated mainly on the separation of algae kind, the mensuration of algae kind oil content, the analysis of algae kind fatty acid composition and algae kind big
On scale evaluation.Compared with higher plant, the Study on Molecular Mechanism of the TAG biosynthesis and accumulation of microalgae is the weakest, about
In TAG metabolism network, related gene functional study report is the most rare.Chlamydomonas reinhardtii is pattern unicellular organism, gene order-checking
Being complete, under the conditions of nitrogen stress, oils and fats can accumulate and reach the 60% of kytoplasm, is the preferable algae strain of research TAG metabolic gene.
B-Box-type zinc finger: the about length of 40 amino acid residues.Two classes, wherein type can be divided into
1 and 2 types B-Box are different and to combine residue at 7-8 zinc the most different in their consensus sequence.Some protein comprise two
The B-box of type 1 and 2, illustrates there be a certain degree of working in coordination with at the two type B-box.B-box domain is from various biologies
It is found in more than 1500 kinds of protein.B-box domain is mainly 2 types.Many 2 types B-box participate in proteins ubiquitin.Containing B-
The albumen of box Zinc finger domain includes transcription factor, ribose and proto-oncogene protein；Such as MID1, MID2, TRIM9, TNL,
TRIM36, TRIM63, TRIFIC, NCLl and CONSTANS-l ike proteins.
Summary of the invention
It is an object of the invention to provide a kind of gene that can change triacylglycerol content in microalgae and application thereof.
The Gene Name that can improve algae triacylglycerol content provided by the present invention is CrBbox (Chlamydomonas
Reinhardtii B-Box-type zinc finger), this gene is entitled JGI Chlamydomonas reinhardtii gene database
Acegs_kg.scaffold_38000029, is positioned at chromosome_13:4746249-4749429 region, containing 5 exons.
Protein I D159133, encodes B-box zinc finger protein, is to announce according on JGI Chlamydomonas reinhardtii gene database
CrBbox gene be stencil design specific primer, amplification cDNA obtain full length sequence, push away according to this base sequence analysis
Survey the sequence of coding CrBbox albumen.Its research is found that this gene overexpression can reduce Chlamydomonas reinhardtii neutral fat content,
And interfered by RNAi and this gene knockout is remarkably improved Chlamydomonas reinhardtii neutral fat content.CrBbox gene of the present invention,
Derive from Chlamydomonas reinhardtii, be one of following nucleotide sequences:
1) SEQ ID NO:1DNA sequence in sequence table；
2) polynucleotide of SEQ ID NO:2 protein sequence in polynucleotide；
3) DNA sequence limited with SEQ ID NO:1 in sequence table has more than 90% homology and coding identical function
Protein DNA sequence.
The encoding proteins B-box zinc finger protein of gene C rBbox of microalgae neutral fat content can be changed, be that there is sequence table
The protein of middle SEQ ID NO:2 amino acid residue sequence, or by the amino acid residue sequence of SEQ ID NO:2 through one
Individual or the replacement of several amino acid residue, lack or add and there is the identical work of amino acid residue sequence with SEQ ID NO:2
Property the protein derivative by SEQ ID NO:2.
The protein that in sequence table, sequence 2 amino acid residue is made up of 410 amino acid residues.
Expression vector containing gene of the present invention and at least 15 nucleotide with by nucleotides sequence shown in SEQ ID NO:1
The DNA complementary for DNA of row or its complementary strand composition all belongs to protection scope of the present invention.This CrBbox gene is applied to significantly change
The neutral fat content of Chlamydomonas reinhardtii and be applied to the cultivation of novel high fat content algae strain.
The carrier using plant to express, proceeds to Chlamydomonas reinhardtii by the CrBbox gene of the present invention and causes neutral fat content to subtract
Few；The method using RNAi to interfere, proceeds to CrBbox genetic fragment Chlamydomonas reinhardtii and causes neutral fat content to raise.
Accompanying drawing explanation
Fig. 1 is the RT-PCR amplification 1:DL2000DNA molecular weight standard of CrBbox；5:CrBbox amplification；
Fig. 2 is the situation of change of CrBbox overexpression transgenic algae strain Biomass；
Fig. 3 is the situation of change of CrBbox overexpression transgenic algae strain neutral fat content；
Nile red when Fig. 4 is pAMBIA1302 empty carrier transformant, pCAMBIA1302-CrBbox gene algae strain the 6th day
Fluirescence observation figure after dyeing；
Fig. 5 is pAMBIA1302 empty carrier transformant, CC425 and pCAMBIA1302-CrBbox gene algae strain rna expression
Analysis chart；
Fig. 6 is the Biomass changes of contents figure that CrBbox RNAi interferes transgenic algae strain；
Fig. 7 is the fat content variation diagram that CrBbox RNAi interferes transgenic algae strain；
Fig. 8 is fluorescence after Maa7/XIR empty carrier transformant and CrBbox RNAi interference transgenic algae strain Nile red dyeing
Observe figure；
Fig. 9 is that Maa7/XIR empty carrier transformant, CC425 and CrBbox RNAi interfere transgenic algae strain rna expression analysis
Figure
Detailed description of the invention
Below example facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiment
Method, if no special instructions, is conventional method.Test material used in following embodiment, if no special instructions, is certainly
Routine biochemistry reagent shop is commercially available.Marker is purchased from Dalian treasured biotech firm.% in following embodiment, as without special
Different explanation, is weight/mass percentage composition.Quantitative test in following example, is respectively provided with three times and repeats experiment, and result is averaged
Value.
The clone of embodiment 1CrBbox
1) Chlamydomonas reinhardtii total serum IgE spoon extracts
Chlamydomonas reinhardtii (Chlamydomonas reinhardtii) algae strain CC425, is incubated at 24 DEG C of illumination boxs, and 100
μmolm-2sec-1White light, under the conditions of full exposure, to be grown to exponential phase, take algae solution 50mL, 10000r/min is centrifuged 1min
Collect frond, after liquid nitrogen flash freezer, be milled into powder, extract total serum IgE according to the method for Trizol；
2) design of primers
CrBbox gene according to announcing on DOE JGI Chlamydomonas database is template, and design is following special
Specific primer, carries out PCR amplification:
CrBbox total length amplimer primer sequence (5 ' → 3 ')
Forward primer ATGTCGAGTTGCGTCGTGTGCG
Reverse primer TTAGCACTCAGCGTCCAGGACCTCG
3) synthesis of cDNA
According to the test kit of the Takara that precious biological engineering (Dalian) company limited provides, RNA reverse transcription is made to become cDNA.
4) PCR Master mixture is prepared
5) PCR amplification is carried out:
94℃5min；35 circulations: 94 DEG C of lmin, 55 DEG C of lmin, 72 DEG C of lmin；72℃10min.
Take 8 μ L and carry out 1% agarose gel electrophoresis analysis result such as Fig. 1 ,-20 DEG C of preservations.
6) purification and the glue of PCR primer reclaims
Reclaiming test kit according to a small amount of glue of Shanghai Hua Shun biological engineering company limited and reclaim DNA segment, PCR primer connects
To pGEM-T Vector (promega company), convert bacillus coli DH 5 alpha, select positive colony order-checking.
The transformant of embodiment 2 overexpression CrBbox gene obtains
1) structure of plant expression vector
Design with Bgl II and Spe I restriction enzyme site primer (forward: 5 '-
AAAGATCTAATGTCGAGTTGCGTCGTGTG-3’；Reverse: 5 '-AAACTAGTTTAGCACTCAGCGTCCAGGA-3 '), PCR
Amplification CrBbox full length gene.CrBbox product after the modification of BglII and Spe I double digestion and the BGl II of pCAMBIA1302
It is attached with SpeI double digestion carrier large fragment.Connecting product and convert bacillus coli DH 5 alpha, PCR identifies positive colony, extracts
Plasmid carries out double digestion qualification.Extract correct recombinant expression plasmid pCAMBIA1302-CrBbox, be used for converting.
2) acquisition (electrotransformation) of overexpression CrBbox Chlamydomonas reinhardtii transformant
Chlamydomonas reinhardtii (algae strain CC425, purchased from Inst. of Hydrobiology, Chinese Academy of Sciences), is incubated at 24 DEG C of illumination cultivation
Case, 100 μm ol m-2sec-1White light, under the conditions of full exposure, to be grown to frustule number be 2 × 107Individual/mL；2000rpm is centrifuged
5min, collects frustule；Sterile deionized water washing precipitation is also repeated 3 times, with the TAP fluid medium containing 60mM sucrose
(2.42g/L Tris-base+lml/L glacial acetic acid+119mg/L K2HPO4+61mg/LKH2PO4+0.4g/L NH4Cl+0.1g/
LMgSO4·7H2O+50mg/LCaCl2·2H2O+lml/L Trace) resuspended precipitation；Ice bath 10min；Take algae solution and add restructuring matter
Grain, is transferred to after mixing shock by electricity in cup, and room temperature stands 5min；1.5kV, 10 μ F, 200 Ω, shock by electricity under the conditions of 6msec, room temperature is quiet
Put 10min, add 5mL TAP fluid medium, 22 DEG C, 100rpm, dim lights recovery 8h；2000rpm, centrifugal 5min, receive
Collection frustule, regulation frustule number is to 1 × 106Individual/mL；Transfer algae solution is to containing 1.5mML-tryptophan, 5 μ g/mL L-
On the TAP solid selection medium of paromomycin, slow Sloped rotating, make algae solution be evenly distributed；Close light source, dry up, 24
DEG C illumination box, 100 μm ol m-2sec-1White light, cultivates under the conditions of full exposure to forming single algae.
Real-time fluorescence quantitative PCR determines that the overexpression of CrBbox gene: RNA extracts with reference to example one, and real-time fluorescence is fixed
Amount PCR is with reference to TaKaRa companyPremix Ex TaqTMReagent operation explanation is carried out.Result is shown in Fig. 5.
3) acquisition of Chlamydomonas reinhardtii is compareed
Replacing pCMBIA1302-CrBbox with pCMBIA1302, (algae strain CC425, purchases to convert Chlamydomonas reinhardtii with electrotransformation
From the aquatic institute of the Chinese Academy of Sciences), method, with step 2, obtains turning the algae strain of empty carrier.
The physiological phenotype of embodiment 3CrBbox overexpression algae strain is observed
Turn pCMBIA1302 empty carrier group, CrBbox overexpression group, original algae strain CC425, respectively select 100 algae strains, training
Support in 24 DEG C of illumination boxs, 100 μm ol m-2sec-1White light, under the conditions of full exposure, to be grown to exponential phase,
2000rpm, centrifugal 5min, distilled water is resuspended, is inoculated into the HSM-N fluid medium (2g/ without antibiotic by 10% inoculum concentration
LNaAc·3H2O+1.44g/L K2HPO4+0.72g/L KH2PO4+0.5467g/L NaCl+20mg/LMgSO4·7H2O+
10mg/LCaCl2·2H2O+lml/L Trace-N), concussion is cultivated 6 days continuously.Every 24h measures following biological value.
1) biomass statistics
The method described in 1989 according to Harris uses blood counting chamber counting, and calculates Biomass.Result shows
Show the algae strain of overexpression CrBbox gene and non-transgenic algae strain CrCC425 and turn empty carrier algae strain Biomass without the poorest
Different.(Fig. 2).
2) neutral fat assay
Use acid-hydrolysis method mensuration neutral fat content: algae solution frozen drying algae powder, respectively takes 0.1g algae powder, adds nothing
Bacterium distilled water, adds 10ml hydrochloric acid, 80 DEG C of water-bath 25min after mixing, add 10ml95% ethanol, mixing.Add after cooling
10ml ether, adds a cover shaking 1min, releasing gas of uncapping afterwards.4000rpm is centrifuged 3min, takes supernatant and moves to the taper of constant weight
In Ping, the residue in repeated washing centrifuge tube, then supernatant is transferred in original conical flask.Conical flask is placed in water-bath
On be evaporated, transfer in 100 DEG C of baking ovens be dried 2h, take out cooling after weigh.Separately take algae solution, through final concentration of 10 μ g/mL Buddhist nuns
After sieve red colouring 10min, using fluorescence microscope is 480nm at exciting light, diverging light be carry out under 560nm-600nm observing and
Take pictures, it is possible to see that overexpression CrBbox gene neutral fat content is decreased obviously (Fig. 3).
Embodiment 4CrBbox gene RNAi interferes expression vector establishment and the acquisition of transgenic algae strain
1) RNAi interferes the structure of expression vector
Design specific primer (forward: 5 '-AGCTGCTACGCACGAGACCG-3 '；Reverse: 5 ,-
GCCCATGTCGAGCCAGTTGT-3 ') amplification CrBbox gene 410bp fragment be used for interfering research.Sense fragment is used respectively
The PCR primer of HindIII and BamHII double digestion amplification and RNAi intermediate carrier T282, connect, and converts, and identifies, order-checking determines
Correct positive colony.Antisense fragments respectively with XbaI and SalI double digestion PCR primer and connected sense fragment T282 carry
Body connects, and converts, and identifies and obtains the intermediate carrier T282-CrBbox that CrBbox inverted repeat inserts.EcoRI enzyme action
Maa7/XIR carrier dephosphorylation with as connect through the T282-CrBbox carrier of EcoRI enzyme action, convert, identify and used
Final carrier Maa7/XIR-CrBbox in RNA interference.
2) CrBbox RNAi interferes the acquisition of express transgenic algae strain
Electrotransformation is used to convert Chlamydomonas reinhardtii (algae strain CC425, purchased from the aquatic institute of the Chinese Academy of Sciences), concrete steps
See step 2 in example 2.
3) acquisition of Chlamydomonas reinhardtii is compareed
(algae strain CC425, in being purchased to replace Maa7/XIR-CrBbox electrotransformation to convert Chlamydomonas reinhardtii with Maa7/XIR
The aquatic institute of academy of science of state), method, with step 2, obtains turning the algae strain of empty carrier.
Embodiment 5CrBbox RNAi interferes the physiological phenotype of express transgenic algae strain to be observed
CrBbox RNAi interferes expression group, waits that growing single algae falls behind, and is inoculated into containing 1.5mM L-Trp, 5 μMs of 5-FI
TAP solid selection medium on, turn Maa7/XIR empty carrier group direct inoculation to containing 1.5mM L-Trp, 5 μ g/mL
On the TAP solid selection medium of paromomycin, it is incubated at 24 DEG C of illumination boxs, 100 μm ol m-2sec-1White light, entirely
Under illumination condition, treat that third time grows single algae and falls, picking positive transformant, it is inoculated into HSM fluid medium (2g/LNaAc
3H2O+1.44g/L K2HPO4+0.72g/L KH2PO4+0.5g/LNH4Cl+20mg/LMgSO4·7H2O+10mg/LCaCl2·
2H2O+1ml/L Trace) in, concussion is cultivated 9 days continuously.Every 24h measures following biological value.
The mensuration of Biomass and neutral fat content is with reference to example 3.Result CrBbox RNAi interferes the algae strain Biomass expressed
Change is not clearly (Fig. 6)；Neutral fat content, in the trend of rising, raised when the 10th day at most, (Fig. 7), CrBboxRNAi
The neutral fat content interfering expression group rises can also take a picture clearly visible (Fig. 8) by Nile red after being dyeed.Its mrna expression
Level is with reference to example two, and the rna expression of CrBbox gene is substantially suppressed (Fig. 9).
Claims (3)
1. the application in the neutral fat synthesis of regulation and control Chlamydomonas reinhardtii of the microalgae triacylglycerol synthesis regulation gene, its feature
It is that this gene is selected from one of following nucleotide sequences:
1) SEQ ID NO:1DNA sequence or its complementary series in sequence table；
2) nucleotide sequence of SEQ ID NO:2 protein sequence in polynucleotide.
2. the carrier application in the neutral fat synthesis of regulation and control Chlamydomonas reinhardtii, it is characterised in that described carrier is containing having the right
Profit requires the microalgae triacylglycerol synthesis regulation gene in 1.
3. the purposes in the neutral fat content changing Chlamydomonas reinhardtii of the gene in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310342931.5A CN103589737B (en) | 2013-08-05 | 2013-08-05 | A kind of microalgae triacylglycerol synthesis regulation gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310342931.5A CN103589737B (en) | 2013-08-05 | 2013-08-05 | A kind of microalgae triacylglycerol synthesis regulation gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103589737A CN103589737A (en) | 2014-02-19 |
| CN103589737B true CN103589737B (en) | 2016-12-28 |
Family
ID=50080051
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310342931.5A Expired - Fee Related CN103589737B (en) | 2013-08-05 | 2013-08-05 | A kind of microalgae triacylglycerol synthesis regulation gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103589737B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106709273B (en) * | 2016-12-15 | 2019-06-18 | 国家海洋局第一海洋研究所 | The matched rapid detection method of microalgae protein characteristic sequence label and system |
| CN113122518B (en) * | 2019-12-31 | 2023-02-24 | 福建农林大学 | Gene for improving oil content of microalgae cells and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102321642A (en) * | 2011-09-16 | 2012-01-18 | 中国热带农业科学院热带生物技术研究所 | Chlamydomonas reinhardtii lipid metabolism gene CrDGAT2-5, encoding protein thereof, and application thereof |
| CN102660566A (en) * | 2012-05-10 | 2012-09-12 | 中国热带农业科学院热带生物技术研究所 | Chlamydomonas reinhardtii triacylglycerol synthesis restriction gene chlamydomonas reinhardtii phosphoenolpyruvate carboxylase isoform 1 (CrPEPC1) and coded protein and application thereof |
-
2013
- 2013-08-05 CN CN201310342931.5A patent/CN103589737B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN103589737A (en) | 2014-02-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ye et al. | Simultaneous wastewater treatment and lipid production by Scenedesmus sp. HXY2 | |
| Liu et al. | Production potential of Chlorella zofingienesis as a feedstock for biodiesel | |
| Mondal et al. | Mixotrophic cultivation of Chlorella sp. BTA 9031 and Chlamydomonas sp. BTA 9032 isolated from coal field using various carbon sources for biodiesel production | |
| Jiang et al. | The feasibility of using complex wastewater from a monosodium glutamate factory to cultivate Spirulina subsalsa and accumulate biochemical composition | |
| Deng et al. | The mRNA abundance of pepc2 gene is negatively correlated with oil content in Chlamydomonas reinhardtii | |
| Wang et al. | A comparative analysis of biomass and lipid content in five Tribonema sp. strains at autotrophic, heterotrophic and mixotrophic cultivation | |
| Economou et al. | Lipid production by the filamentous cyanobacterium Limnothrix sp. growing in synthetic wastewater in suspended-and attached-growth photobioreactor systems | |
| Řezanka et al. | Pilot cultivation of the green alga Monoraphidium sp. producing a high content of polyunsaturated fatty acids in a low-temperature environment | |
| EP2668259A2 (en) | Process for production of microalgae, cyanobacteria and metabolites thereof | |
| CN103014053B (en) | Synechocystis efficient double homologous recombinant vector as well as construction method and application thereof | |
| JP6446774B2 (en) | Lipid accumulation mutant of green algae and use thereof | |
| WO2011011568A2 (en) | Methods and compositions for the production of fatty acids in photosynthetic prokaryotic microorganisms | |
| CN104651236A (en) | Transgenic Chlamydomonas for improving fatty acid content of Chlamydomonas reinhardtii as well as construction method and application thereof | |
| CN103589737B (en) | A kind of microalgae triacylglycerol synthesis regulation gene and application thereof | |
| Lin et al. | Isolation of a high-ammonium-tolerant Monoraphidium sp. and evaluation of its potential for biodiesel production | |
| Huo et al. | Outdoor growth characterization of an unknown microalga screened from contaminated Chlorella culture | |
| Gao et al. | Bilateral and simultaneous accumulation of lipid and biomass in the novel oleaginous green microalga Tetradesmus bernardii under mixotrophic growth | |
| KR101525319B1 (en) | Novel Micractinium inermum NLP-F014 and use thereof | |
| CN102911872B (en) | Scenedesmus sp. strain and application thereof | |
| CN102321642A (en) | Chlamydomonas reinhardtii lipid metabolism gene CrDGAT2-5, encoding protein thereof, and application thereof | |
| Deng et al. | Effects of selective medium on lipid accumulation of chlorellas and screening of high lipid mutants through ultraviolet mutagenesis | |
| Gomaa et al. | Identification of green alga Chlorella vulgaris isolated from freshwater and improvement biodiesel productivity via UV irradiation | |
| CN114958636B (en) | Recombinant yarrowia lipolytica capable of producing punica granatum at high yield as well as construction method and application thereof | |
| CN103849633A (en) | Regulatory gene for changing lipid content of chlamydomonas reinhardtii and encoded proteins and applications thereof | |
| CN108330114B (en) | EPA-utilizing diacylglycerol acyltransferase and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20161228 Termination date: 20170805 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |