WO2011083290A1 - Methods and compositions for altering temperature sensing in eukaryotic organisms - Google Patents

Methods and compositions for altering temperature sensing in eukaryotic organisms Download PDF

Info

Publication number
WO2011083290A1
WO2011083290A1 PCT/GB2010/050956 GB2010050956W WO2011083290A1 WO 2011083290 A1 WO2011083290 A1 WO 2011083290A1 GB 2010050956 W GB2010050956 W GB 2010050956W WO 2011083290 A1 WO2011083290 A1 WO 2011083290A1
Authority
WO
WIPO (PCT)
Prior art keywords
temperature
nucleosome
plant
altering
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2010/050956
Other languages
English (en)
French (fr)
Inventor
Philip Wigge
Vinod Kumar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Plant Bioscience Ltd
Original Assignee
Plant Bioscience Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Plant Bioscience Ltd filed Critical Plant Bioscience Ltd
Priority to MX2012007867A priority Critical patent/MX2012007867A/es
Priority to IN6570DEN2012 priority patent/IN2012DN06570A/en
Priority to CA2786341A priority patent/CA2786341A1/en
Priority to BR112012016796A priority patent/BR112012016796A2/pt
Priority to US13/520,967 priority patent/US20130239252A1/en
Priority to CN201080060911.3A priority patent/CN102781956B/zh
Priority to AU2010340802A priority patent/AU2010340802B2/en
Priority to EP10724120.0A priority patent/EP2521734B1/en
Publication of WO2011083290A1 publication Critical patent/WO2011083290A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8237Externally regulated expression systems
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/827Flower development or morphology, e.g. flowering promoting factor [FPF]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance

Definitions

  • H2A Z-containing nucleosomes mediate the thermosensory response in eukaryotes and modifications to H2A.Z alter this response .
  • Sessile organisms such as plants, continually sense environmental conditions to adapt their growth and development. Temperature varies both diurnally, which is important for entraining the clock (Michael et al . , 2008; Salome and McClung, 2005), as well as seasonally, providing information for the timing of reproduction (Heggie and Halliday, 2005; Samach and Wigge, 2005; Sung and Amasino, 2005). Extremes of temperature represent a significant stress for plants, and are a major factor limiting global plant distribution (Mittler, 2006).
  • Plants must constantly respond to changes in the environment whilst maintaining developmental and growth processes if they are to survive into the next generation.
  • a complex network of signals from temperature and light must correctly converge to achieve successful development, through vegetative to reproductive growth.
  • Temperature can be thought of as an environmental factor that provides both 'inductive' and 'maintenance' signals in development. It can stimulate developmental processes such as seed dormancy release, germination, vernalization and flowering. Thus, being able to control how a plant perceives temperature is desirable.
  • the responses of organisms to temperature, particularly in crop plants, are often detrimental, and the targeted alteration of these responses may improve the yield, quality and predictability of crops. For example grain-fill in wheat and rice is particularly sensitive to high temperatures.
  • Preventing a heat shock response in the developing grain would protect grain composition and quantity from being perturbed by a high temperature stress response.
  • High temperature stress responses have been selected for in evolution and breeding in order to maximise embryo survival, but these responses are detrimental to grain quality. This is already a major cause of reduced wheat and rice yields during hot summers, and these problems will be exacerbated by future climate change.
  • chromatin Genetic information within the eukaryotic cell nucleus is organized in a highly conserved structural polymer, the chromatin, which supports and controls crucial functions of the genome.
  • the basic unit of chromatin is the nucleosome, which contains DNA wrapped around a histone octamer.
  • Core histones H2A, H2B, H3, and H4 have a highly structured core domain involved in intranucleosomal histone-histone interactions and unstructured N- and C-terminal tails that extend outside of the nucleosomal core, and they interact with other nucleosomes and with nonhistone proteins.
  • tails are subject to a number of post-translational modifications, such as acetylation, methylation, phosphorylation, and ubiquitination .
  • the organization of DNA into chromatin is inhibitory to all the processes that need DNA as a template, such as replication, transcription, recombination, and repair.
  • Another mechanism of modulating chromatin structure is carried out by multisubunit ATP- dependent chromatin remodelling complexes.
  • H2A variants In addition to genes encoding the core histone H2A, the eukaryotic genome contains genes referred to as H2A variants, which have a different protein sequences from core H2A. Histone variants play critical roles in chromatin structure and function and are implicated in a variety of cellular activities, such as regulation of transcription, DNA repair, chromosome X inactivation, and heterochromatin formation. H2A.Z variants are highly conserved from Saccharomyces cerevisiae to human. H2A.Z variants have also been identified in plants.
  • the invention relates to methods for altering temperature sensing in a eukaryotic organism and to producing a eukaryotic organism with altered temperature sensing.
  • the invention also relates to methods for altering thermosensory responses in a eukaryotic organism and to producing a eukaryotic organism with altered thermosensory responses.
  • the invention relates to a method for altering temperature sensing in a eukaryotic organism comprising modifying the presence or state of H2A.Z in the nucleosome .
  • the invention in another aspect, relates to a method for altering thermosensory responses in a eukaryotic organism said method comprising decreasing the level of H2A.Z in said organism or altering post-translational modification of H2A.Z or a combination thereof.
  • the invention in a third aspect, relates to a method for inhibiting the response of a eukaryotic organism to an increase in ambient temperature comprising increasing the presence of H2A.Z in the nucleosome or preventing release of H2A.Z from the nucleosome, altering the state of H2A.Z, such as post-translational modification of H2A.Z, or inhibiting disassembly of the H2A.Z from the nucleosome.
  • the invention relates to a method for eliciting a warm temperature response in a eukaryotic organism comprising inhibiting or decreasing the presence H2A.Z in the nucleosome .
  • the invention in another aspect, relates to a method for eliciting a cold temperature response comprising inhibiting or decreasing the eviction of H2A.Z from the nucleosome.
  • the invention relates to a method for producing a eukaryotic organism that shows a constitutive warm temperature response comprising inhibiting or decreasing the presence H2A.Z in the nucleosome.
  • the invention also relates to a method for producing a eukaryotic organism that shows a constitutive cold temperature response comprising inhibiting or decreasing the eviction of H2A.Z from the nucleosome.
  • HSP70 expression is an output of the ambient temperature sensing pathway.
  • HSP70 black line, marked with an arrow
  • HSP70 family genes require a heat stress to be up-regulated.
  • HSP70 black line, marked with an arrow
  • HSP70 has a uniform linear expression pattern at various constant growth temperatures, in contrast to the rest of the HSP70 family (gray) .
  • HSP70 is therefore an excellent output of the thermosensory pathway over a wide temperature range.
  • HSP70::LUC in Arabidopsis mimics the endogenous HSP70 expression pattern in response to temperature.
  • LUC transcript analysis and live luciferase imaging of plants shifted to 17°C, 22°C and 27°C for two hours from 12°C show a temperature dependent LUC expression and luciferase activity.
  • LUC transcript levels were normalised to UBQ10.
  • arp6-10 flowers significantly earlier than wild-type under long-day (A, B) and short day conditions (C, D) at 22 °C. When grown in short days at 27 °C (E, F) , arp6-10 shows a very strong thermal induction of flowering. In comparison, wild-type flowering time is similar to arp6-10 at 22 °C. (x- axis shows the number of rosette leaves at the time of flowering, y-axis shows the corresponding number of plants) . (G, H) In addition to the flowering time phenotypes, arp6-10 displays all the architectural responses of wild-type plants grown at high temperature.
  • arp6-10 seedlings at 17°C show hypocotyl (G) and petiole elongation (H) that is equivalent to the wild-type phenotype at higher temperatures. (Petiole elongation was analysed on the first four true leaves of 20- day-old wild-type and arp6-10 seedlings) . See also Figure 8.
  • genes that are 2 fold up- (A) or down-regulated (B) in wild- type seedling within 2 hours of shifting to 27 °C are constitutively repressed or activated in the arp6-10 background.
  • genes that are 2 fold up- (C) or down- regulated (D) in arp6-10 compared to the wild-type at 12 °C (0 h) were down- or up-regulated in the wild-type upon shift to 27 °C.
  • Median and mean values are represented respectively by the solid and dotted horizontal lines. 5th and 95th percentiles represent outlier values (dots).
  • HTAll.-GFP expressed under the native promoter is functional and complements the hta9 htall double mutant.
  • the hta9 htall mutant has an extended hypocotyl compared to Col-0 at 21 °C. This phenotype was completely rescued in three independent lines expressing HTA11:GFP under the native promoter (left panel). HTA11:GFP also complements the elevated HSP70 expression in the hta9 htall double mutant (right panel ) .
  • x-axis the nucleotide positions across HSP70 gene with respect to TSS.
  • y- axis H2A.Z occupancy as a fraction of undigested input chromatin. Values are mean ⁇ SD from one representative experiment. Bar graph in the inset shows the -1 nucleosome in detail as represented by the amplicon centred on -246 bp.
  • a gypsy like transposon gene (At4g07700) acts as a control since it has positioned nucleosomes devoid of H2A.Z and it is transcriptionally inactive and unresponsive to temperature changes. ChIP analysis revealed no change in histone H3 occupancy at both 17 °C and 27 °C, indicating that H2A.Z confers temperature specific responsiveness to nucleosomes. As expected, H2A.Z occupancy was absent as measured by ChIP. See also Figure 9.
  • H2A.Z occupancy is primarily determined by temperature, independent of the specific transcriptional response. This result indicates that H2A.Z containing nucleosomes confer temperature information on chromatin, which could be interpreted according to the respective regulatory environment for appropriate gene expression.
  • Upper panels show the transcriptional response upon shift to 27 °C. 0 h represents sample from plants grown at 12 °C; 2h and 24 h are after shift to 27 °C. H2A.Z occupancy dynamics upon shift to 27°C for 2h is shown in the lower panel.
  • Chromatin architecture responds dynamically to changes in ambient temperature .
  • arp6 shows a constitutive temperature response in terms of chromatin architecture as measured by MNase accessibility. +1 nucleosome occupancy in arp6 is consistently lower, even at 17 °C.
  • RNA Pol II ChIP analysis for RNA Pol II at HSP70 in wild-type (closed circle) and arp6 (open circle) grown at 17 °C (D) or after 2h of incubation at 27 °C (E) .
  • x-axis represents nucleotide positions on HSP70 with respect to TSS;
  • y-axis represents fraction of input chromatin immunopurified using RNA Pol II antibody .
  • FIG. 1 Schematic representation of HSP70 +1 and -1 nucleosomes showing the Hph I sites. Grey ovals represent nucleosomes, oligo positions are indicated by arrows.
  • G-H Temperature- dependent nucleosomal DNA accessibility assay for Hph I enzyme in wild-type (G) and arp6-10 (H) . Nucleosomes containing H2A nucleosomes (-1 in wild-type and both -1 and +1 in arp6-10) show constitutive accessibility of restriction sites, whereas H2A.Z containing nucleosomes occlude access. Relative amounts of protected input nucleosomal DNA was calculated and was normalised against the +1 nucleosome of At4g07700 where Hph I does not cut. See also Figure 10.
  • H2A.Z containing nucleosomes can modulate transcription in a temperature dependent manner.
  • H2A.Z nucleosomes At lower temperature, H2A.Z nucleosomes have a high level of occupancy. H2A.Z nucleosomes may prevent transcription, either by acting as a physical block to the progression of RNA Pol II, or by occluding gene specific cis-elements from activating transcription factors. For genes that are specifically expressed at low temperature, H2A.Z occupancy may prevent the binding of repressors or antagonise DNA methylation. A chromatin-remodelling complex may relieve the nucleosomal repression when appropriate components and conditions exist. At higher temperature, H2A.Z nucleosome occupancy declines. This leads to increased expression of genes like HSP70, where transcription is limited by H2A.Z occupancy.
  • H2A.Z may facilitate repressor binding.
  • Conventional H2A nucleosomes are depicted in light gray ovals and the degree of H2A.Z occupancy is depicted in darker gray.
  • HTA11:GFP fusion protein is localized and functions as the endogenous protein
  • genes assigned to be up- and down-regulated in the htzlA background were compared with gene expression on shifting from 29 °C to 33 °C (x-axis) (Gasch et al . , 2000) .
  • genes constitutively down-regulated in the htzlA background tend to be those genes whose expression is inhibited on increasing temperature, while those genes whose expression goes up at 33 °C tend to be more highly expressed in the htzl mutant at 30 °C.
  • temperature sensing and eliciting temperature-dependent responses is known to be a complex biological process
  • the inventors have shown that a central single regulator in this mechanism is H2A.Z.
  • the inventors have shown that by modifying the presence or absence of H2A.Z in the nucleosome, it is possible to regulate the ways in which a plant perceives temperature and thus to alter developmental response that are dependent on temperature. It is therefore possible to alter a large variety of temperature dependent responses, including developmental responses in plants such as flowering, hypocotyl elongation and petiole growth, by targeting this single regulator.
  • the methods of the invention relate to altering temperature sensing in a eukaryotic organism, for example in a plant, and thus modifying thermosensory responses by altering the presence of H2A.Z in the nucleosome.
  • the presence of H2A.Z in the nucleosome is rate limiting for the expression of genes that are dependent on increasing temperature.
  • H2A.Z is present in the nucleosome at cold temperatures.
  • H2A.Z responds to an increase in the ambient temperature and is released from the nucleosome. This release induces the expression of temperature dependent genes that are expressed at higher temperatures, whilst cold temperature dependent genes are no longer expressed.
  • H2A.Z thus functions as a temperature sensor and the presence or absence of this regulator determines gene expression which in turn regulates developmental responses that are normally induced by changes in temperature.
  • H2A.Z deposition is prevented, plants display a constitutive warm temperature response even in cold temperature, i.e. a response that the plant would normally display in warm temperature.
  • genotypes deficient in incorporating H2A.Z into nucleosomes phenocopy warm grown plants even when grown at lower temperatures.
  • responses to changes in temperature vary between different plants, depending on the specific temperature threshold of the plant.
  • warm grown plants plants grown at a temperature of about 20 °C to about 24 °C, for example about 22 °C or above for Arabidopsis.
  • cold temperature plants gown at a temperature of about 15 °C to about 19 °C, for example about 17 °C or below for Arabidopsis.
  • Other plants have different temperature optima.
  • Genotypes deficient in incorporating H2A.Z into nucleosomes also show altered gene expression and the gene expression profile is that typically shown by plants grown in warm temperature conditions.
  • nucleosomes containing H2A.Z display distinct responses to temperature in vivo, independently of transcription.
  • H2A.Z confers distinct DNA unwrapping properties on nucleosomes, indicating a direct mechanism for the perception of temperature through DNA-nucleosome fluctuations.
  • Our results show that H2A . Z-containing nucleosomes provide thermosensory information that is used to coordinate developmental responses and the ambient temperature transcriptome . We observe the same effect in budding yeast, indicating this is an evolutionarily conserved mechanism.
  • the invention relates to a method for altering temperature sensing in a eukaryotic organism comprising modifying the presence of H2A.Z in the nucleosome.
  • the invention in another aspect, relates to a method for altering thermosensory responses in a eukaryotic organism said method comprising decreasing the level of H2A.Z in said organism or altering post-translational modification of H2A.Z or a combination thereof.
  • the eukaryotic organism according to the different methods of the invention may be a plant, a yeast, a fungus, an invertebrate or a vertebrate.
  • the organism is a plant.
  • the organism may also be an isolated part of a plant, such as a plant cell, for example a plant cell culture or cell line.
  • the invention relates to a method for altering temperature sensing in a plant, a plant cell culture or cell line comprising modifying the presence of H2A.Z in the nucleosome and to a method for altering thermosensory responses in a plant said method comprising decreasing the level of H2A.Z in said organism or altering post-translational modification of H2A.Z or a combination thereof .
  • the organism is a plant, it may be a moncot or a dicot.
  • a dicot plant may be selected from the families including, but not limited to Asteraceae, Brassicaceae (eg Brassica napus) , Chenopodiaceae, Cucurbitaceae, Leguminosae (Caesalpiniaceae, Aesalpiniaceae Mimosaceae, Papilionaceae or Fabaceae) , Malvaceae, Rosaceae or Solanaceae .
  • the plant may be selected from lettuce, sunflower, Arabidopsis, broccoli, spinach, water melon, squash, cabbage, tomato, potato, yam, capsicum, tobacco, cotton, okra, apple, rose, strawberry, alfalfa, bean, soybean, field (fava) bean, pea, lentil, peanut, chickpea, apricots, pears, peach, grape vine or citrus species.
  • the plant is oilseed rape.
  • biofuel and bioenergy crops such as rape/canola, linseed, lupin and willow, poplar, poplar hybrids, Miscanthus or gymnosperms, such as loblolly pine.
  • crops for silage (maize) grazing or fodder (grasses, clover, sanfoin, alfalfa), fibres (e.g. cotton, flax), building materials (e.g. pine, oak), pulping (e.g. poplar), feeder stocks for the chemical industry (e.g. high erucic acid oil seed rape, linseed) and for amenity purposes (e.g.
  • turf grasses for golf courses include ornamentals for public and private gardens (e.g. snapdragon, petunia, roses, geranium, Nicotiana sp . ) and plants and cut flowers for the home (African violets, Begonias, chrysanthemums, geraniums, Coleus spider plants, Dracaena, rubber plant) .
  • a monocot plant may, for example, be selected from the families Arecaceae, Amaryllidaceae or Poaceae .
  • the plant may be a cereal crop, such as wheat, rice, barley, maize, oat sorghum, rye, onion, leek, millet, yam, buckwheat, turf grass, Italian rye grass, sugarcane or Festuca species.
  • the plant is a crop plant.
  • crop plant is meant any plant which is grown on a commercial scale for human or animal consumption or use.
  • Preferred plants are maize, wheat, rice, oilseed rape, sorghum, soybean, potato, tomato, grape, barley, pea, bean, field bean, lettuce, cotton, sugar cane, sugar beet, broccoli or other vegetable brassicas or poplar.
  • the invention also applies to other eukaryotic organisms. Therefore, in other embodiments, the organism is a yeast or fungus.
  • the organism is a yeast or fungus.
  • many of processes mediated in the brewing, baking and fermenting industries are very dependent on temperature responses of the cultured yeast strains. Since the H2A.Z nucleosome eviction pathway is extremely highly conserved across the eukaryotes, this provides a means to alter the responses of commercially important yeasts to temperature in a targeted fashion using the methods described herein.
  • the presence of H2A.Z in the nucleosome can be modified in a number of ways. These include altering, decreasing or inhibiting expression of genes that encode H2A.Z. Various methods known to a skilled person can be used to achieve this, for example using RNA interference (siRNA) technology.
  • the presence of H2A.Z in the nucleosome can be modified by altering the status of H2A.Z, for example the post-translational modification status of H2A.Z. This includes post-translational modifications such as acetylation, ubiquitination and methylation.
  • the presence of H2A.Z in the nucleosome can also be modified by altering assembly of H2A.Z into the nucleosome or eviction of H2A.Z from the nucleosome.
  • the invention relates to modifying the presence of H2A.Z in the nucleosome by decreasing the level of H2A.Z peptide or protein in said organism said method comprising decreasing or inhibiting the expression of one or more nucleic acids encoding for H2A.Z.
  • the level or amount of H2A.Z peptide or protein is reduced, for example so that substantially no H2A.Z peptide or protein is produced in said organism.
  • no or little H2A.Z can be incorporated into the nucleosome.
  • the reduced level or substantial lack of H2A.Z in the nucleosome influences temperature sensing and transcriptional control of genes that respond to changes in temperature and therefore temperature dependent developmental processes. This leads to the induction of a constitutive warm temperature response even in cold temperature conditions.
  • nucleic acids encoding for H2A.Z may be silenced using RNA interference.
  • RNA interference comprises for example expression of a simple antisense RNA, hairpin RNA, a natural or artificial microRNA or other RNA interference methods known in the art.
  • Plants with reduced or no expression of H2A.Z encoding nucleic acid(s) may also be selected from a mutagenised population through Targeting- induced Local Lesions IN Genomes (TILLING) (Till et al . , 2006).
  • TILLING Targeting- induced Local Lesions IN Genomes
  • H2A.Z is universally conserved in eukaryotic organisms and has been identified in mammals, birds, Drosophila, yeast, tetrahymenea and plants.
  • H2A.Z In plants, there are several nucleic acids that encode H2A.Z.
  • the four H2A.Z genes are HTA8 (At2g38810), HTA9 (Atlg52740), HTA4 (At4gl3570) and HTAll (At3g54560) .
  • H2A.Z has been identified in different plants and nucleic acid sequences encoding H2A.Z can be accessed on public databases. Plant H2A.Zs are very well conserved across different taxa, including algae, maize, mosses, rice and sorghum.
  • H2A.Z sequences from algae, mosses, rice, sorghum have conserved N- terminal acetylatable lysines (K) as in Arabidopsis.
  • K N- terminal acetylatable lysines
  • a comparison of the peptide sequences encoding H2A.Z in Arabidopsis, rice and maize shows that these sequences are highly conserved (see figure 11) .
  • a skilled person would be able to modify any plant H2A.Z according to the methods disclosed herein.
  • post- translational modification of H2A.Z is modified to alter the presence of H2A.Z in the nucleosome and/or alter thermosensory responses in the organism. This can for example be achieved as set out below.
  • H2A.Z is acetylated
  • Acetylation reversibly modifies histones and thus chromatin structure.
  • Acetylated chromatin is less tightly folded and therefore more accessible to interacting proteins.
  • Site specific acetylation leads to activation of transcription whereas deacetylation represses transcription.
  • Hyper- acetylated histone loosens contact with DNA, thus making nucleosome core particles less rigid.
  • Histone tails are normally positively charged due to amine groups present on their lysine (K) and arginine (R) amino acid residues. These positive charges help the histone tails to interact with and bind to the negatively charged phosphate groups on the DNA backbone.
  • Acetylation of lysine (K) which occurs normally in a cell, neutralizes the positive charges on the histone by changing amines into amides and decreases the ability of the histones to bind to DNA. This decreased binding allows chromatin expansion, permitting transcription to take place .
  • HAT histone acetyltransferase enzymes
  • HATs are enzymes that acetylate conserved lysine amino acids on histone proteins by transferring an acetyl group from acetyl CoA to form ⁇ - ⁇ - acetyl lysine.
  • Acetylation can be reversed by histone deacetylation (HDAC) enzymes.
  • HDACs remove acetyl groups, increasing the positive charge of histone tails and encouraging high-affinity binding between the histones and DNA backbone. The increased DNA binding condenses DNA structure, preventing transcription.
  • H2A.Z sequence is highly conserved amongst eukaryotic organisms and comprises a number of acetylation sites.
  • Arabidopsis H2A.Z proteins contain at least 4 to 5 potentially acetylatable K residues in its N-terminal tail, a feature that is conserved across different H2A.Z sequences across different plant species.
  • the conserved acetylatable K residues in the N-terminal tail of plant H2A.Z proteins can be targeted.
  • one or more acetylation sites of H2A.Z can be targeted to decrease or increase the degree of acetylation or to substantially prevent acetylation of H2A.Z thereby altering the presence of H2A.Z in the nucleosome and/or altering thermosensory responses in the organism.
  • site-directed mutagenesis of a gene sequence encoding for a H2A.Z peptide or protein can be used to change one or all of the K residues to a non-acetylatable residue (H2A.Z N ).
  • the non-acetylatable residue may be arginine (R) or another amino acid residue.
  • Mutagenesis of acetylatable K residues reduces or prevent acetylation. Reduced acetylation sites prevent the access of HATs, subsequent acetylation, transformation of chromatin into a less rigid structure and transcription of genes that are transcribed at elevated temperature conditions.
  • H2A.Z N that has a high affinity for DNA, and will not be evicted from the nucleosome at higher temperatures, preventing the transcription of genes that would normally be transcribed at higher temperatures and therefore developmental responses that would normally occur in response to higher temperatures.
  • a gene sequence encoding a H2A.Z peptide or protein can be modified to introduce further acetylation sites resulting in a hyper-acetylated H2A.Z protein. This facilitates release of H2A.Z from the nucleosome. H2A.Z absence from the nucleosome results in a constitutive warm temperature response even at colder temperature, as the transcription of genes that are responsive to higher temperature is induced whilst the transcription of genes that are responsive to cold temperature is repressed.
  • the altered gene sequences described above can be expressed in the organism using expression vectors commonly known in the art.
  • the mutated sequence may be part of an expression cassette comprising a promoter driving expression of said sequence.
  • Said promoter may be the endogenous promoter, a constitutive promoter, or a tissue specific promoter.
  • tissue specific promoter it is possible to drive expression of the transgene in a tissue specific way thus altering temperature sensing in a particular tissue.
  • the tissue specific promoter may for example be selected from the TaPR60 Promoter that has been demonstrated to be specifically active in endosperm transfer cells in wheat and barley and starchy endosperm in rice (Kovalchuk et al .
  • the OsPR602 and OsPR9a promoters from rice which are specific for endosperm transfer cells (Li et al . , 2008), the granule-bound starch synthase 1 (gbssl) promoter which is specific to the grain filling process in wheat (Kluth et al . , 2002), the napA promoter from rape for seed specific expression in crucifers, the E4, E8 or 2all promoter from tomato or the AGPLl promoter from water melon for fruit specific expression and the TA29 promoter from tobacco or the A9 promoter from Arabidopsis for anther/tapetum specific expression.
  • gbssl granule-bound starch synthase 1
  • Overexpression using a constitutive promoter in plants may be carried out using a strong promoter, such as the cauliflower mosaic virus promoter (CaMV35S), the rice actin promoter, the maize ubiquitin promoter, the rice ubiquitin rubi3 promoter or any promoter that gives enhanced expression.
  • a strong promoter such as the cauliflower mosaic virus promoter (CaMV35S), the rice actin promoter, the maize ubiquitin promoter, the rice ubiquitin rubi3 promoter or any promoter that gives enhanced expression.
  • enhanced or increased expression can be achieved by using transcription or translation enhancers or activators and may incorporate enhancers into the gene to further increase expression.
  • an inducible expression system may be used, such as a steroid or ethanol inducible expression system in plants.
  • enzymes that acetylate or de-acetylate H2A.Z are targeted to alter the presence of H2A.Z in the nucleosome and/or alter thermosensory responses in the organism according to the methods of the invention .
  • acetylation of the H2A.Z peptide or protein may be decreased or inhibited by decreasing or inhibiting HAT activity.
  • one or more nucleic acid sequence that encodes a HAT enzyme may be silenced using RNA interference.
  • a construct directed against a conserved region of the HAT family may be used to decrease the levels of HAT transcript.
  • HAT activity may be decreased or inhibited by altering a nucleic acid sequence that encodes a HAT enzyme by site directed mutagenesis to decrease activity of the enzyme.
  • Plants with reduced or little expression of HAT encoding nucleic acid(s) and/or mutated HAT protein (s) with decreased or no enzyme activity may be selected from a mutagenised population through TILLING (Till et al . , 2006) .
  • expression of nucleic acid sequence that encodes a HAT enzyme is increased, for example by introducing into said organism one or more nucleic acids encoding HAT or otherwise altering HAT activity, for example by mutagenesis of one or more nucleic acid sequence encoding HAT.
  • the expression of the nucleic acid sequence may be driven by the endogenous, constitutive or a tissue specific promoter. This will increase the amount of acetylation and thus increase release of H2A.Z from the nucleosome.
  • the acetylation status of the H2A.Z peptide or protein in the nucleosome may be increased by decreasing or inhibiting HDAC activity. Decreasing or inhibiting HDAC activity prevents or reduces the removal of the acetyl group from H2A.Z. This results in reduced binding between H2A.Z and DNA and thus release of H2A.Z from the nucleosome and thus expression of genes that respond to high temperatures .
  • histone deacetylase (HDAC) enzymes are expressed at enhanced levels or HDAC activity is otherwise altered, for example by mutagenesis of one or more nucleic acids encoding HAT. This prevents release of the H2A.Z from the nucleosome from the nucleosome as acetyl groups are removed.
  • HDAC histone deacetylase
  • one or more genes encoding for a HDAC enzyme may be constitutively expressed in the organism.
  • a tissue specific promoter may be used.
  • H2A.Z is assembled into the SWR1 nucleosome by the chromatin re-modelling machinery.
  • the components of this complex have been shown to be highly conserved amongst eukaryotes.
  • ARP6 in Arabidopsis has been shown to be responsible for inserting H2A.Z into the nucleosome in plants and is part of the SWR-1 complex. Depletion of ARP6 in mutants results in the failure to incorporate H2A.Z into chromatin and constitutive expression of the warm temperature transcriptome.
  • ARP6 homologues have been identified and are highly evolutionarily conserved across the plant kingdom. For example, analysis of the respective nucleic acid sequences for ARP6 homologue of rice, maize, capsella, and mosses reveals that these are highly similar to that of Arabidopsis indicating conservation across plants. Thus, a skilled person would be able to identify and modify an ARP6 homologue according to the methods of the invention.
  • the insertion or assembly of H2A.Z into the nucleosome can be prevented.
  • the presence of H2A.Z in the nucleosome can be altered by modifying the components of the chromatin re-modelling machinery.
  • expression of one or more genes that encode one or more proteins involved in the insertion of H2A.Z into the nucleosome can be inhibited, for example by RNA interference. This leads to a lack of H2A.Z in the nucleosome and thus a constitutive warm temperature response.
  • Factors that may be targeted include histone chaperones and members of the SWR-1 complex.
  • Histone chaperones and members of the SWR-1 complex For example, in plants ARP6 or a homologue or orthologue thereof may be targeted.
  • Other targets may include histone chaperones that promote assembly, such as NAP1, CHZ1 or a homologue or orthologue thereof.
  • components of the chromatin remodelling machinery for example a histone chaperone, may be targeted to prevent disassembly of H2A.Z from the nucleosome.
  • genes that encode such factors may be silenced.
  • the invention therefore relates to a method for altering thermosensory responses in a eukaryotic organism, for example a plant, said method comprising decreasing the level of H2A.Z in said organism or altering post-translational modification of H2A.Z or a combination thereof .
  • H2A.Z The ways of decreasing the level of H2A.Z in said organism or altering post-translational modification of H2A.Z are explained in detail above and apply to the different embodiments of this aspect of the invention.
  • expression of one or more nucleic acids encoding for H2A.Z may be decreased or inhibited as explained above.
  • said nucleic acid is silenced using RNA interference.
  • post-translational modification such as acetylation may be changed as explained above.
  • site-directed mutagenesis of a gene sequence encoding for a H2A.Z peptide or protein can be used to change one or all of the K residues to a non-acetylatable residue (H2A.Z N ) or to introduce further acetylation sites.
  • the expression of one or more nucleic acid sequence encoding HDACs or HATs may be decreased, inhibited or enhanced to alter thermosensory responses.
  • a mutant H2A.Z protein may be produced by expressing a nucleic acid sequence encoding a H2A.Z protein wherein said nucleic acid sequence has been altered to remove one or more acetylation sites, for example by altering a codon encoding an acetylatable K residue in said nucleic acid sequence by replacing or altering a nucleotide within said codon to produce a protein with non acetylatable residue.
  • a mutant H2A.Z protein may be produced by expressing a nucleic acid sequence encoding for a H2A.Z protein wherein said nucleic acid sequence has been altered to introduce one or more additional acetylation sites.
  • promoters according to the invention may be either the endogenous, a constitutive or a tissue specific promoter .
  • Altering post-translational modification according to the method may also comprise inhibiting or decreasing the expression of one or more nucleic acid sequence encoding for a HDAC enzyme to reduce or inhibit deacetylation of H2A.Z or expressing one or more nucleic acid sequences encoding a HDAC enzyme to increase removal of acetyl groups in H2A.Z.
  • altering post-translational modification according to the method may also comprise inhibiting or decreasing the expression of one or more genes encoding for a HAT enzyme to inhibit acetylation or expressing one or more nucleic acid sequences encoding a HAT enzyme to increase acetylation of H2A.Z.
  • Expression of said nucleic acid sequences according to the method may be driven by the endogenous, a constitutive, inducible or a tissue specific promoter.
  • Thermosensory responses are those responses that are observed in an organism in response to changes in temperature. These include changes in gene transcription.
  • genes such as HSP70 are up-regulated at higher temperatures.
  • HSP70 gene transcription follows a proportionate pattern with increasing temperature over a wider range (about 12°C to >37 °C) changes in gene transcription (of the temperature transcriptome ) and can therefore be used as a marker gene which indicates up or down-regulation of the temperature transcriptome.
  • Transcriptional changes also influence developmental processes and in plants an increase of temperature affects a number of developmental processes, such as flowering, hypocotyl elongation and petiole growth. It also leads to an increase in the rate of transition through different developmental phases. Juvenile to adult transition is therefore accelerated by higher ambient temperature. An increase in temperature leads to acceleration of flowering time, greater hypocotyl elongation, petiole growth, germination, and general acceleration of plant growth and development.
  • thermosensory responses in a plant that can be altered by the method described above and said responses include one or more of and preferably all of the following developmental responses: seed dormancy release, germination, hypocotyl elongation, petiole growth, vernalisation, juvenile to adult transition, flowering, senescence and temperature-protective responses.
  • thermosensory response in a plant is modified.
  • substantially all of the developmental and transcriptional responses that a plant shows in response to changes in temperature can be altered by increasing or decreasing the level of H2A.Z in said organism or altering post-translational modification of H2A.Z or a combination thereof.
  • Another aspect of the invention relates to a method for inducing a warm temperature response in a eukaryotic organism comprising inhibiting or decreasing the presence H2A.Z in the nucleosome.
  • the response may be constitutive and is induced even in temperatures which would normally be perceived as cold temperatures by said plant.
  • the method may include modifying the expression of one or more gene encoding for H2A.Z, increasing the acetylation status of H2A.Z or preventing assembly of H2A.Z into the nucleosome as described herein.
  • a warm temperature in plants response is a response that is shown at about 20 °C to about 24 °C, for example about ⁇ 22°C in Arabidopsis.
  • crops that require a certain threshold temperature for proper growth and yield can be manipulated using the methods of the invention to reduce that temperature threshold. This is of particular benefit for crops that are grown in the greenhouse.
  • Another aspect of the invention relates to a method for inducing a cold temperature response in a eukaryotic organism comprising inhibiting or decreasing the eviction of H2A.Z from the nucleosome.
  • the response may be constitutive.
  • the method may include preventing acetylation status of H2A.Z or preventing disassembly of H2A.Z from the nucleosome as described herein. For example in plants, the mutant plants phenocopy wild type plants growing at a lower temperature ( ⁇ 17 °C) .
  • a cold temperature response in plants is therefore a response that is shown at about 15 °C to about 19 °C, for example about ⁇ 17 °C in Arabidopsis.
  • Other plants have different temperature optima as a skilled person will appreciate.
  • the invention also relates to methods for producing a eukaryotic organism, for example a plant, that shows a constitutive warm temperature response, even in cold temperatures and under conditions in which such response would not normally be displayed.
  • the invention relates to a method for producing a plant that shows a constitutive warm temperature response said method comprising inhibiting or decreasing the presence H2A.Z in the nucleosome.
  • the method may include modifying the expression of one or more genes encoding for H2A.Z, increasing the acetylation status of H2A.Z or preventing assembly of H2A.Z into the nucleosome as described herein.
  • the invention in another aspect, relates to a method for producing a eukaryotic organism, for example in a plant, that shows a constitutive cold temperature response, even in high temperatures and under conditions in which such response would not normally be displayed.
  • the invention relates to a method for producing a plant that shows a constitutive cold temperature response said method comprising inhibiting or decreasing the eviction of H2A.Z from the nucleosome.
  • the method may include preventing acetylation status of H2A.Z or preventing disassembly of H2A.Z from the nucleosome as described herein.
  • the invention also provides a plant H2A.Z molecule in which some or all of the acetylatable lysines of the molecule have been replaced by non-acetylatable amino acid residues.
  • the invention further provides a plant comprising a novel H2A.Z molecule in which some or all of the lysines of the molecule have been replaced by non-acetylatable amino acid residues or a nucleic acid sequence encoding such a molecule.
  • the invention provides a plant comprising a non- acetylatable version of histone H2A.Z, an over-expressed histone deacetylase enzyme sufficient to remove histone acetylation marks in H2A.Z, or a down regulated histone acetyltransferase activity.
  • the plant may be selected from the plants recited elsewhere herein.
  • Another object of this invention is to provide a method to enhance yield in crop plants by altering temperature sensing as according to the embodiments described above.
  • this aspect relates to a method to enhance grain- fill, grain composition or grain quantity in grain crops or to prevent premature flowering or bolting.
  • the method relates to enhancing yield in crop plants by altering temperature sensing to allow said crop to reach its yield potential even at temperatures higher than those at which grain-fill is typically limited, or to avoid premature bolting/flowering following exposure to temperature conditions that typically cause such premature bolting.
  • the invention also relates to a method for inhibiting pathogenesis of a eukaryotic micro ⁇ organism comprising altering temperature sensing in a eukaryotic organism comprising modifying the presence of H2A.Z in the nucleosome. Ways of altering temperature sensing are described herein. Moreover, small molecule therapies can be used to target the system.
  • ChIP Chromatin Immuno-purification
  • ChIP was performed as described (Gendrel et al . , 2002) with minor modifications. Seven-day-old seedlings grown at 17°C were shifted to 27°C for 2 hours and ChIP experiments were performed in parallel on chromatin from both temperatures.
  • H2A.Z and H3 ChIP cross-linked chromatin was fragmented with 0.2 units of Micrococcal nuclease (Sigma) in 1 ml of MNase digestion buffer (10 mM Tris-HCl [pH 8.0], 50 mM NaCl, 1 mM ⁇ - mercaptoethanol , 0.1% NP40, 1 mM CaCl 2 and lx protease inhibitor cocktail [Roche] ) .
  • HTA11 one of the Arabidopsis H2A.Z homologues, was GFP tagged and ChIP was performed using GFP polyclonal antibody (Abeam, ab290) .
  • Histone H3 dynamics were assayed using H3 antibody (Abeam, abl791) .
  • chromatin was fragmented by sonication in lysis buffer (10 mM Tris-HCl [pH 8], 150 mM NaCl, 1 mM EDTA
  • ChIP was performed using monoclonal antibody to RNA polymerase II CTD repeat YSPTSPS (Abeam, ab817) . All ChIP experiments were performed in buffer containing 10 mM Tris-HCl
  • Micrococcal nuclease (MNase) digestion of enriched chromatin followed by qPCR using tiled oligonucleotides surrounding the transcription start site (TSS) was used for nucleosome positioning and analysis. Oligos were designed to have 95-110 bp amplicons every 35-45 bp in the HSP70 promoter.
  • TSS transcription start site
  • Oligos were designed to have 95-110 bp amplicons every 35-45 bp in the HSP70 promoter.
  • chromatin from seven-day-old seedlings of Col-0 and entrl grown at varying temperatures (17 °C, 22 °C, 27 °C) were digested with MNase and mononucleosome sized fragments were gel purified and used in qPCR. Relative nucleosome occupancy was represented as fraction of uncut chromatin DNA and was plotted against the HSP70 gene position with respect to the TSS for each primer pair where the position denotes the center of each amplicon.
  • nucleosomes devoid of linker histones and other associated proteins were purified according to (Brand et al . , 2008) . Purified nucleosomes were buffer exchanged to 10 mM Tris-HCl (pH 8.0), 1 mm EDTA (pH 8.0), 25 mM NaCl and lx protease inhibitor cocktail. Approximately 500 ng equivalent of nucleosomal DNA was assayed for restriction enzyme accessibility at 17 °C and 27 °C. The fraction of the input nucleosomal DNA protected was obtained using qPCR for HSP70 -1 and +1 nucleosomes. Data represented are normalized against the +1 nucleosome of At4g07700 that does not have a restriction site.
  • HSP70 is an output of the ambient temperature sensing pathway
  • HSP70 is expressed at a level proportionate to the ambient temperature within this temperature range ( Figure 1C) . While these experiments were performed on seedlings, HSP70 also shows these expression dynamics in the adult plant (Balasubramanian et al . , 2006) . We therefore used a fusion of the HSP70 promoter to Luciferase (HSP70::LUC) to monitor the activity of the endogenous gene non-destructively .
  • HSP70::LUC recapitulates the expression of HSP70 ( Figure ID) , providing us with a dynamic and sensitive assay for temperature perception status in planta, independent of high temperature stress (Larkindale and Vierling, 2008; Sung et al . , 2001).
  • ARP6 is in the ambient temperature sensing pathway that controls flowering
  • Transformation of entrl with a genomic fragment of ARP6 is able to rescue both the HSP70::LUC expression level as well as the altered development of entrl ( Figure 1G) , confirming that it is a new arp6 allele.
  • entrl and entr2 as arp6-10 and arp6-ll respectively.
  • Arabidopsis mutants in ARP6 have been identified in flowering time screens (Choi et al . , 2005; Deal et al . , 2005; Martin- Trillo et al . , 2006) . To determine if ARP6 acts in the ambient temperature pathway for flowering, we analysed flowering in arp6-10.
  • arp6-10 flowers earlier at 21 °C in long and 22 °C in short days ( Figure 2A- 2D) .
  • ARP6 therefore acts in the ambient temperature pathway that controls flowering.
  • ARP6 controls developmental responses to ambient temperature globally
  • the ambient temperature transcriptome is globally misregulated in arp6
  • the arp6-10 mutant at 12 °C resembles a plant at a higher temperature.
  • transcripts that are 2-fold more highly expressed at 12 °C in arp6-10 compared to wild-type are strongly induced by higher ambient temperature in wild-type, while those genes that are repressed in arp6-10 compared to wild-type at 12 °C (Figure 3D, blue bars), are transcriptionally repressed by higher temperature in wild-type ( Figure 3D, grey bars) .
  • ARP6 encodes a subunit of the SWR1 complex that is conserved among eukaryotes and is necessary for inserting the alternative histone H2A.Z into nucleosomes in place of H2A (Deal et al . , 2007; Kobor et al . , 2004; Krogan et al., 2003; Mizuguchi et al . , 2004) .
  • H2A.Z family members in Arabidopsis and we find the hta9 htall double mutant phenocopies arp6-10, showing the early flowering and architectural responses as well as increased HSP70 expression. This indicates that the temperature responses of arp6-10 result from a failure to incorporate H2A .
  • Z-containing nucleosomes into the genome.
  • Global analyses in yeast, Drosophila, C. elegans, Arabidopsis and mammalian cells have revealed that H2A .
  • Z-containing nucleosomes are especially enriched at the +1 position near the transcriptional start site (Creyghton et al . , 2008; Mavrich et al . , 2008; Raisner et al., 2005; Whittle et al . , 2008; Zhang et al . , 2005; Zilberman et al . , 2008) .
  • H2A.Z has been implicated in maintaining promoters of quiescent genes in a poised state ready for appropriate transcription (Li et al .
  • H2A Z-containing nucleosomes confer a temperature dependence on transcription.
  • ChIP chromatin immunopurification
  • HTA11:GFP expressed under the endogenous HTAll promoter for our ChIP experiments. This construct complements the hta9 htall double mutant ( Figure 4A) , showing that HTAll :GFP is functional. Microscopy of HTAll : GFP reveals incorporation into euchromatin as in other studies ( Figure 9A and 9B) (Zilberman et al . , 2008).
  • H3 levels at the +1 nucleosome drop, though not to the extent of H2A.Z ( Figure 4C) .
  • H3 levels at the -1 nucleosome did not drop significantly.
  • H2A . Z-containing nucleosomes exhibit specific dynamic responses to temperature. Since RNA Pol II must negotiate +1 nucleosomes for transcription to occur, this suggests a model where gene transcription may be controlled by the temperature responsive occupancy of +1 nucleosomes .
  • H2A.Z nucleosomes having a temperature specific response We therefore extended our analysis to the TSS of another locus, At4g07700, chosen since it does not contain H2A.Z (Zilberman et al . , 2008) and it is largely transcriptionally silent, avoiding complicating factors arising from RNA Pol II mediated displacement of nucleosomes, as well as being predicted to have a well ordered nucleosome structure using a recent model (Kaplan et al . , 2009) . ChIP analysis with H3 specific antibody showed the predicted nucleosome occupancy.
  • H2A.Z occupancy data (Zilberman et al . , 2008) revealed that H2A.Z is enriched in the FT promoter. We therefore assayed for H2A.Z changes at FT in response to temperature change. Consistently, we observe H2A.Z depletion from the FT promoter at higher temperatures ( Figure 9E) , suggesting an explanation for the acceleration of flowering in arp6.
  • H2A.Z occupancy decreases dynamically with increasing temperature at the +1 nucleosomes of temperature- induced genes. Since temperature-dependent histone eviction may be a consequence of greater transcriptional activity, and is not necessarily the cause, we sought to determine if H2A.Z eviction occurs independently of transcription. To test this, we analysed genes that are enriched for H2A.Z in their promoters and are either down regulated or show constant expression in response to increased temperature. We then performed ChIP to assay H2A.Z occupancy in response to ambient temperature change (Figure 5D-5I) . We observed a significant decrease in H2A.Z occupancy across all the genes examined, independent of their transcriptional response to temperature. This result suggests H2A .
  • Z-containing nucleosomes have a binding affinity or occupancy as measured by ChIP that varies with temperature. This is independent of transcription, which is analogous to the behaviour of nucleosomes at the Hsp70 locus of Drosophila (Petesch and Lis, 2008) . Since the presence of H2A . Z-containing nucleosomes is rate-limiting for the expression of the majority of the genes in the ambient temperature transcriptome, this suggests that H2A.Z responses to temperature play a key role in integrating temperature information .
  • the HSP70 +1 nucleosome shows a constitutive temperature response in arp6
  • nucleosomes at genes induced to undergo transcription dissociate or partially unwrap from their DNA, allowing passage of RNA Pol II, and the presence of nucleosomes, especially the +1 nucleosome near the transcriptional start site, can be rate limiting for controlling transcription (Boeger et al . , 2008; Boeger et al . , 2003) .
  • nucleosomes at the Drosophila Hsp70 locus are lost from the body of the gene in advance of the arrival of RNA Pol II, indicating that the nucleosomes are able to play a role in regulating transcription (Petesch and Lis, 2008).
  • RNA Pol II ChIP was used to study transcriptional dynamics at HSP70 in wild-type and arp6-10.
  • 17 °C in wild-type we observed a greater proportion of RNA Pol II present at the TSS compared to in the body of the gene.
  • arp6 a greater proportion of RNA Pol II is present in the body of the gene ( Figure 6D) .
  • 27 °C there is a strong shift of RNA Pol II occupancy, with the highest peak now occurring downstream of the TSS. Since this new RNA Pol II peak corresponds to the region occupied by the +1 nucleosome, it is likely that in wild-type at non-inductive conditions the +1 nucleosome plays a role in maintaining transcription in a poised state.
  • nucleosomes were purified from plant material, we do not exclude that post- translational modifications, for example acetylation, may be involved in modulating this response.
  • our assay is performed on highly purified material, indicating that the dynamic responses we observe are an inherent property resulting from the nucleosome-DNA interactions.
  • Our finding that the degree of local unwrapping of DNA on H2A.Z containing nucleosomes is reduced compared to H2A nucleosomes suggests a direct mechanism by which transcription can be adjusted according to the temperature of the cell.
  • H2A.Z Arabidopsis encodes three major H2A.Z genes (HTA8, HTA9 and HTA11) . Mutation of the two major genes HTA9 and HTAll (in hta9 htall double mutants) phenocopy arp6 mutant indicative of enhanced temperature reponse. We have been able to complement the hta9 htall double mutant phenotype by expressing HTAll from its native promoter.
  • a 2786 bp genomic region of HTAll (At3g54560) including 1589 bp promoter region and coding sequences (genomic cordinates Chromosome 3: 20194677 - 20197463) was amplified using oligos W1160 ( 5 ' CACCGAAATGTTTTTCTCTACG 3') and W1161
  • Lysine residues at positions 4,7, 13, 19 and 21 of HTAll N- teminus were selected for mutagenesis.
  • the wild type HTAll with all five lysine residues intact is hereafter mentioned HTAll-KKKKK.
  • HTA11-RRKKK CGCAGCTACGAGTCCTCTTCCACCTCTGCCTGCCATGTCTTGA 3'
  • Oligos W1445(5' GGACTCGTAGCTGCGAGGACGATGGCTGCTAAC 3') and W1446 (5' GTTAGCAGCCATCGTCCTCGCAGCTACGAGTCC 3') were used for targeted mutagenesis of lysine's residues 13 (K 13 ) to arginines (R) using HTA11-KKKKK as template.
  • the resulting plasmid was named HTA11-KKRKK .
  • W1448 (5' CTTCTTGTCCTTGTCTCTGTCCCTGTTAGCAGCCATCGTC 3') were used for targeted mutagenesis of lysine's residues 19 and
  • W1446 (5' GTTAGCAGCCATCGTCCTCGCAGCTACGAGTCC 3') were used for targeted mutagenesis of lysine's residues 13 (K13) to arginines
  • HTA11-RRRRR was named HTA11-RRRRR.
  • Wild type (HTA11-KKKKK) and mutagenized versions of HTA11 were transferred to a binary gateway vector pW1357 by recombination so as to have c-terminus fusions of the proteins with 3xFLAG tag.
  • FLAG tagged wild type and mutant versions of HTA11 are used to transform hta9 htall double mutant as well as Col-0 wild type.
  • the HAC family of Arabidopsis histone acetyl transferase family consists of five genes Atlg79000 HAC1, Atlg67220 (HAC2), Atlg55970 (HAC4) , At3gl2980 (HAC5) and Atlgl6710 (HAC12) .
  • HDAC histone deacetylase
  • Nucleosomes play an active role in controlling transcriptional processes through modulating the ability of transcription factors to access their cis elements or occluding the passage of RNA Pol II (Lam et al . , 2008; Segal and Widom, 2009) . Access of proteins to DNA wrapped around histones is mediated through local unwrapping events. This unwrapping is not affected by changes in ambient temperature in our study and others for H2A-containing nucleosomes (Polach and Widom, 1995). By contrast, H2A . Z-containing nucleosomes exhibit a much tighter wrapping of their DNA, consistent with studies of nucleosomal stability (Thambirajah et al . , 2006). This is supported by the observation that H2A .
  • Z-containing nucleosomes are more tightly positioned in the genome and are less fuzzy. Work on reconstituted nucleosomal arrays has also shown that the intranucleosomal interactions are stronger in H2A.Z- containing nucleosomes, while these have weaker internucleosomal interactions (Fan et al . , 2002). In addition to H2A . Z-containing nucleosomes having more tightly wrapped DNA, our results suggest that the degree of unwrapping may also be responsive to temperature.
  • Z-containing nucleosomes in these genes may prevent binding of a transcriptional repressor, or may antagonise DNA methylation which has been shown to be a role of H2A.Z in plants (Zilberman et al . , 2008). Consistently, H2A . Z-containing nucleosomes have been shown to play an important role in anti- silencing (Meneghini et al . , 2003).
  • Arabidopsis thaliana has a highly plastic life history, and a genetically informed photothermal model is able to explain most of the variation in flowering time for plants grown at different seasons (Wilczek et al . , 2009). Acceleration of flowering in response to higher temperature requires genes in the autonomous pathway (Blazquez et al . , 2003), and is dependent on increasing expression of FLOWERING LOCUS T (FT) (Balasubramanian et al . , 2006; Cerdan and Chory, 2003; Halliday et al . , 2003; Lee et al . , 2007).
  • FT FLOWERING LOCUS T
  • FVE flowering is one of the major developmental pathways regulated by ambient temperature. It has been shown that two autonomous flowering pathway genes, FVE and FCA, are necessary for mediating the ambient temperature response for flowering (Blazquez et al . , 2003). Interestingly, an arp6 allele, esdl- 2, is epistatic to fve and fca (Blazquez et al . , 2003; Martin- Trillo et al . , 2006) .
  • FVE is a homolog of the mammalian retinoblastoma-associated protein, a component of a histone deacetylase complex (Ausin et al . , 2004; Kim et al . , 2004) .
  • FVE As well as affecting the autonomous pathway, which regulates flowering time through the floral pathway integrator FLOWERING LOCUS C (FLC) , FVE is also involved in sensing cold temperatures (Kim et al . , 2004) . Taken together, these data suggest that FVE may exert its effects on temperature- dependent pathways through modulating H2A.Z, perhaps through acetylation, which affects nucleosome stability (Ishibashi et al., 2009; Thambirajah et al . , 2006).
  • thermosensory flowering pathway is mediated by FT expression levels, the major regulator of FT expression in response to long photoperiods , CONSTANS (CO), is not essential for perceiving temperature, since co-1 responds to thermal induction of flowering (Balasubramanian et al . , 2006).
  • CO the major regulator of FT expression in response to long photoperiods
  • co-1 responds to thermal induction of flowering
  • H2A.Z provides an explanation for how the thermal induction pathway may activate FT expression in response to higher temperature independently of CO.
  • another temperature dependent pathway that also affects flowering time in plants, vernalisation is also perturbed in the arp6 background (Choi et al . , 2005; Deal et al .
  • Barley plants are transformed with the vector pBRACT214 for constitutive overexpression of the altered H2A.Z non- acetylatable versions under the Ubiquitiin promoter.
  • Brassica are transformed with the vector pBRACT103 for expression of non-acetylatable H2A.Z versions of H2A.Z.
  • SUPPRESSOR OF FRIGIDA3 encodes a nuclear ACTIN-RELATED PROTEIN6 required for floral repression in Arabidopsis. Plant Cell 17, 2647-2660.
  • H2AZ is enriched at polycomb complex target genes in ES cells and is necessary for lineage commitment. Cell 135, 649-661.
  • the nuclear actin-related protein ARP6 is a pleiotropic developmental regulator required for the maintenance of FLOWERING LOCUS C expression and repression of flowering in Arabidopsis. Plant Cell 17, 2633-2646.
  • Histone variant H2A.Z marks the 5' ends of both active and inactive genes in euchromatin. Cell 123, 233-248.
  • PSEUDO-RESPONSE REGULATOR 7 and 9 are partially redundant genes essential for the temperature responsiveness of the Arabidopsis circadian clock. Plant Cell 17, 791-803.
  • Histone H2A.Z and DNA methylation are mutually antagonistic chromatin marks. Nature 456, 125-129.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physiology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Radiation Pyrometers (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
PCT/GB2010/050956 2010-01-07 2010-06-08 Methods and compositions for altering temperature sensing in eukaryotic organisms Ceased WO2011083290A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
MX2012007867A MX2012007867A (es) 2010-01-07 2010-06-08 Metodos y composiciones para alterar el sensado de temperatura en organismos eucarioticos.
IN6570DEN2012 IN2012DN06570A (https=) 2010-01-07 2010-06-08
CA2786341A CA2786341A1 (en) 2010-01-07 2010-06-08 Methods and compositions for altering temperature sensing in eukaryotic organisms
BR112012016796A BR112012016796A2 (pt) 2010-01-07 2010-06-08 "método e composição para alterar a detecção da temperatura em organismos eucarióticos."
US13/520,967 US20130239252A1 (en) 2010-01-07 2010-06-08 Methods and Compositions for Altering Temperature Sensing in Eukaryotic Organisms
CN201080060911.3A CN102781956B (zh) 2010-01-07 2010-06-08 在真核生物体中改变温度感知的方法和组合物
AU2010340802A AU2010340802B2 (en) 2010-01-07 2010-06-08 Methods and compositions for altering temperature sensing in eukaryotic organisms
EP10724120.0A EP2521734B1 (en) 2010-01-07 2010-06-08 Methods and compositions for altering temperature sensing in eukaryotic organisms

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1000184.0 2010-01-07
GBGB1000184.0A GB201000184D0 (en) 2010-01-07 2010-01-07 Methods and compositions for altering temperature sensing in eukaryotic organisms

Publications (1)

Publication Number Publication Date
WO2011083290A1 true WO2011083290A1 (en) 2011-07-14

Family

ID=41819024

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/GB2010/050956 Ceased WO2011083290A1 (en) 2010-01-07 2010-06-08 Methods and compositions for altering temperature sensing in eukaryotic organisms
PCT/GB2010/052144 Ceased WO2011083298A1 (en) 2010-01-07 2010-12-17 Temperature sensing in plants

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/GB2010/052144 Ceased WO2011083298A1 (en) 2010-01-07 2010-12-17 Temperature sensing in plants

Country Status (11)

Country Link
US (1) US20130239252A1 (https=)
EP (1) EP2521734B1 (https=)
CN (1) CN102781956B (https=)
AR (1) AR079319A1 (https=)
AU (1) AU2010340802B2 (https=)
BR (1) BR112012016796A2 (https=)
CA (1) CA2786341A1 (https=)
GB (1) GB201000184D0 (https=)
IN (1) IN2012DN06570A (https=)
MX (1) MX2012007867A (https=)
WO (2) WO2011083290A1 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110938605A (zh) * 2019-11-20 2020-03-31 中山大学附属第五医院 一种体外组装的HBV cccDNA核小体及其制备方法
EP3712271A1 (en) * 2019-03-18 2020-09-23 Commissariat à l'Energie Atomique et aux Energies Alternatives Altering thermoresponsive growth in plants via genome editing of phytochrome interacting factor 4 (pif4) regulatory elements
WO2025233441A1 (en) 2024-05-08 2025-11-13 Gmi - Gregor-Mendel-Institut Für Molekulare Pflanzenbiologie Gmbh Modified h2a.z l2 region

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105980395A (zh) 2013-11-04 2016-09-28 美国陶氏益农公司 最优大豆座位
UY35812A (es) 2013-11-04 2015-05-29 Dow Agrosciences Llc ?loci de maíz óptimos?.
NZ746567A (en) 2013-11-04 2019-09-27 Dow Agrosciences Llc Optimal soybean loci
NZ719494A (en) 2013-11-04 2017-09-29 Dow Agrosciences Llc Optimal maize loci
CN104894142A (zh) * 2015-06-11 2015-09-09 中国科学院西北高原生物研究所 调控花青素合成与代谢的小麦新基因TaMYB7D
CN111153980B (zh) * 2020-02-17 2022-03-15 南京农业大学 一种植物粒型相关蛋白OsSDSG及其编码基因与应用
CN117965579B (zh) * 2024-04-02 2024-06-07 中国科学院遗传与发育生物学研究所 麦属特异转座子h2a.1及其应用
CN120796341A (zh) * 2025-06-25 2025-10-17 浙江大学 番茄组蛋白变体h2a.z在提高番茄低温抗性中的应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1094112A2 (en) * 1999-08-27 2001-04-25 Her Majesty in Right of Canada, as represented by The Minister of Agriculture and Agri-Food Repressing gene expression in plants

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1313867A2 (en) * 2000-08-24 2003-05-28 The Scripps Research Institute Stress-regulated genes of plants, transgenic plants containing same, and methods of use

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1094112A2 (en) * 1999-08-27 2001-04-25 Her Majesty in Right of Canada, as represented by The Minister of Agriculture and Agri-Food Repressing gene expression in plants

Non-Patent Citations (65)

* Cited by examiner, † Cited by third party
Title
AUSIN, I.; ALONSO-BLANCO, C.; JARILLO, J.A.; RUIZ-GARCIA, L.; MARTINEZ-ZAPATER, J.M.: "Regulation of flowering time by FVE, a retinoblastoma-associated protein", NAT GENET, vol. 36, 2004, pages 162 - 166, XP008147392, DOI: doi:10.1038/ng1295
BALASUBRAMANIAN, S.; SURESHKUMAR, S.; LEMPE, J.; AND WEIGEL, D.: "Potent induction of Arabidopsis thaliana flowering by elevated growth temperature", PLOS GENET, vol. 2, 2006, pages E106
BLAZQUEZ, M.A.; AHN, J.H.; WEIGEL, D.: "A thermosensory pathway controlling flowering time in Arabidopsis thaliana", NAT GENET, vol. 33, 2003, pages 168 - 171
BOEGER, H.; GRIESENBECK, J.; KORNBERG, R.D.: "Nucleosome retention and the stochastic nature of promoter chromatin remodeling for transcription", CELL, vol. 133, 2008, pages 716 - 726
BOEGER, H.; GRIESENBECK, J.; STRATTAN, J.S.; KORNBERG, R.D.: "Nucleosomes unfold completely at a transcriptionally active promoter", MOL CELL, vol. 11, 2003, pages 1587 - 1598
BRAND, M.; RAMPALLI, S.; CHATURVEDI, C.P.; DILWORTH, F.J.: "Analysis of epigenetic modifications of chromatin at specific gene loci by native chromatin immunoprecipitation of nucleosomes isolated using hydroxyapatite chromatography", NAT PROTOC, vol. 3, 2008, pages 398 - 409
CERDAN, P.D.; CHORY, J.: "Regulation of flowering time by light quality", NATURE, vol. 423, 2003, pages 881 - 885, XP002988749, DOI: doi:10.1038/nature01636
CHOI, K.; KIM, S.; KIM, S.Y.; KIM, M.; HYUN, Y.; LEE, H.; CHOE, S.; KIM, S.G.; MICHAELS, S.; LEE, I.: "SUPPRESSOR OF FRIGIDA3 encodes a nuclear ACTIN-RELATED PROTEIN6 required for floral repression in Arabidopsis", PLANT CELL, vol. 17, 2005, pages 2647 - 2660, XP055230697, DOI: doi:10.1105/tpc.105.035485
CREYGHTON, M.P; MARKOULAKI, S.; LEVINE, S.S.; HANNA, J.; LODATO, M.A.; SHA, K.; YOUNG, R.A.; JAENISCH, R.; BOYER, L.A.: "H2AZ is enriched at polycomb complex target genes in ES cells and is necessary for lineage commitment", CELL, vol. 135, 2008, pages 649 - 661, XP002622570, DOI: doi:10.1016/J.CELL.2008.09.056
DEAL, R.B.; KANDASAMY, M.K.; MCKINNEY, E.C.; MEAGHER, R.B.: "The nuclear actin-related protein ARP6 is a pleiotropic developmental regulator required for the maintenance of FLOWERING LOCUS C expression and repression of flowering in Arabidopsis", PLANT CELL, vol. 17, 2005, pages 2633 - 2646
DEAL, R.B.; TOPP, C.N.; MCKINNEY, E.C.; MEAGHER, R.B.: "Repression of flowering in Arabidopsis requires activation of FLOWERING LOCUS C expression by the histone variant H2A.Z", PLANT CELL, vol. 19, 2007, pages 74 - 83
FAN, J.Y.; GORDON, F.; LUGER, K.; HANSEN, J.C; TREMETHICK, D.J.: "The essential histone variant H2A.Z regulates the equilibrium between different chromatin conformational states", NAT STRUCT BIOL, vol. 9, 2002, pages 172 - 176
FITTER, A.H.; FITTER, R.S: "Rapid changes in flowering time in British plants", SCIENCE, vol. 296, 2002, pages 1689 - 1691
GASCH, A.P; SPELLMAN, P.T; KAO, C.M; CARMEL-HAREL; 0., EISEN; M.B., STORZ, G; BOTSTEIN, D; BROWN, P.O: "Genomic expression programs in the response of yeast cells to environmental changes", MOL BIOL CELL, vol. 11, 2000, pages 4241 - 4257, XP002259051
GENDREL, A.V.; LIPPMAN, Z.; YORDAN, C.; COLOT, V.; MARTIENSSEN, R.A.: "Dependence of heterochromatic histone H3 methylation patterns on the Arabidopsis gene DDM1", SCIENCE, vol. 297, 2002, pages 1871 - 1873
GRAY, W.M.; OSTIN, A.; SANDBERG, G.; ROMANO, C.P.; ESTELLE, M.: "High temperature promotes auxin-mediated hypocotyl elongation in Arabidopsis", PROC NATL ACAD SCI U S A, vol. 95, 1998, pages 7197 - 7202
HALLIDAY, K.J.; SALTER, M.G.; THINGNAES, E.; WHITELAM, G.C.: "Phytochrome control of flowering is temperature sensitive and correlates with expression of the floral integrator FT", PLANT J, vol. 33, 2003, pages 875 - 885
HEGGIE, L.; HALLIDAY, K.J.: "The highs and lows of plant life: temperature and light interactions in development", INT J DEV BIOL, vol. 49, 2005, pages 675 - 687
HODGES, C.; BINTU, L.; LUBKOWSKA, L.; KASHLEV, M.; BUSTAMANTE, C.: "Nucleosomal fluctuations govern the transcription dynamics of RNA polymerase II", SCIENCE, vol. 325, 2009, pages 626 - 628
ISHIBASHI TOYOTAKA ET AL: "Acetylation of vertebrate H2A.Z and its effect on the structure of the nucleosome.", BIOCHEMISTRY 9 JUN 2009 LNKD- PUBMED:19385636, vol. 48, no. 22, 9 June 2009 (2009-06-09), pages 5007 - 5017, XP002592867, ISSN: 1520-4995 *
ISHIBASHI, T.; DRYHURST, D.; ROSE, K.L.; SHABANOWITZ, J.; HUNT, D.F.; AUSIO, J.: "Acetylation of vertebrate H2A.Z and its effect on the structure of the nucleosome", BIOCHEMISTRY, vol. 48, 2009, pages 5007 - 5017, XP002592867, DOI: doi:10.1021/BI900196C
KAPLAN, N.; MOORE, I.K.; FONDUFE-MITTENDORF, Y; GOSSETT, A.J.; TILLO, D.; FIELD, Y.; LEPROUST, E.M.; HUGHES, T.R.; LIEB, J.D.; WID: "The DNA-encoded nucleosome organization of a eukaryotic genome", NATURE, vol. 458, 2009, pages 362 - 366
KELLY, A.E.; GOULDEN, M.L.: "Rapid shifts in plant distribution with recent climate change", PROC NATL ACAD SCI U S A, vol. 105, 2008, pages 11823 - 11826
KIM, H.J.; HYUN, Y.; PARK, J.Y.; PARK, M.J.; PARK, M.K.; KIM, M.D.; LEE, M.H.; MOON, J.; LEE, I.; KIM, J.: "A genetic link between cold responses and flowering time through FVE in Arabidopsis thaliana", NAT GENET, vol. 36, 2004, pages 167 - 171, XP002522399, DOI: doi:10.1038/NG1298
KLUTH, A.; SPRUNCK, S.; BECKER, D.; LORZ, H.; LUTTICKE, S.: "5' deletion of a gbss1 promoter region from wheat leads to changes in tissue and developmental specificities", PLANT MOL BIOL, vol. 49, 2002, pages 669 - 682
KNEZETIC, J.A.; LUSE, D.S.: "The presence of nucleosomes on a DNA template prevents initiation by RNA polymerase II in vitro", CELL, vol. 45, 1986, pages 95 - 104, XP023883329, DOI: doi:10.1016/0092-8674(86)90541-6
KOBOR, M.S.; VENKATASUBRAHMANYAM, S.; MENEGHINI, M.D.; GIN, J.W.; JENNINGS, J.L.; LINK, A.J.; MADHANI, H.D.; RINE, J.: "A protein complex containing the conserved Swi2/Snf2- related ATPase Swrlp deposits histone variant H2A.Z into euchromatin", PLOS BIOL, vol. 2, 2004, pages E131
KOINI, M.A.; ALVEY, L.; ALLEN, T.; TILLEY, C.A.; HARBERD, N.P.; WHITELAM, G.C.; FRANKLIN, K.A.: "High temperature-mediated adaptations in plant architecture require the bHLH transcription factor PIF4", CURR BIOL, vol. 19, 2009, pages 408 - 413, XP028814216, DOI: doi:10.1016/j.cub.2009.01.046
KOVALCHUK, N.; SMITH, J.; PALLOTTA, M.; SINGH, R.; ISMAGUL, A.; ELIBY, S.; BAZANOVA, N.; MILLIGAN, A.S.; HRMOVA, M.; LANGRIDGE, P.: "Characterization of the wheat endosperm transfer cell-specific protein TaPR60", PLANT MOL BIOL, vol. 71, 2009, pages 81 - 98, XP019733023, DOI: doi:10.1007/s11103-009-9510-1
KROGAN, N.J.; KEOGH, M.C.; DATTA, N.; SAWA, C.; RYAN, O.W.; DING, H.; HAW, R.A.; POOTOOLAL, J.; TONG, A. ET AL.: "A Snf2 family ATPase complex required for recruitment of the histone H2A variant Htzl", MOL CELL, vol. 12, 2003, pages 1565 - 1576
KUMAR S V ET AL: "H2A.Z-Containing Nucleosomes Mediate the Thermosensory Response in Arabidopsis", CELL 20100108 CELL PRESS USA LNKD- DOI:10.1016/J.CELL.2009.11.006, vol. 140, no. 1, 8 January 2010 (2010-01-08), pages 136 - 147, XP002592866, ISSN: 0092-8674 *
LAM, F.H.; STEGER, D.J.; O'SHEA, E.K.: "Chromatin decouples promoter threshold from dynamic range", NATURE, vol. 453, 2008, pages 246 - 250
LARKINDALE, J.; VIERLING, E.: "Core genome responses involved in acclimation to high temperature", PLANT PHYSIOL, vol. 146, 2008, pages 748 - 761
LEE, J.H.; YOO, S.J.; PARK, S.H.; HWANG, I.; LEE, J.S.; AHN, J.H.: "Role of SVP in the control of flowering time by ambient temperature in Arabidopsis", GENES DEV, vol. 21, 2007, pages 397 - 402
LENOIR, J.; GEGOUT, J.C.; MARQUET, P.A.; DE RUFFRAY, P.; BRISSE, H.: "A significant upward shift in plant species optimum elevation during the 20th century", SCIENCE, vol. 320, 2008, pages 1768 - 1771
LI, B.; PATTENDEN, S.G.; LEE, D.; GUTIERREZ, J.; CHEN, J.; SEIDEL, C.; GERTON, J.; WORKMAN, J.L.: "Preferential occupancy of histone variant H2AZ at inactive promoters influences local histone modifications and chromatin remodeling", PROC NATL ACAD SCI U S A, vol. 102, 2005, pages 18385 - 18390
LI, M.; SINGH, R.; BAZANOVA, N.; MILLIGAN, A.S.; SHIRLEY, N.; LANGRIDGE, P.; LOPATO, S.: "Spatial and temporal expression of endosperm transfer cell-specific promoters in transgenic rice and barley", PLANT BIOTECHNOL J, vol. 6, 2008, pages 465 - 476, XP055062193, DOI: doi:10.1111/j.1467-7652.2008.00333.x
LORCH, Y.; LAPOINTE, J.W.; KORNBERG, R.D.: "Nucleosomes inhibit the initiation of transcription but allow chain elongation with the displacement of histones", CELL, vol. 49, 1987, pages 203 - 210, XP023884041, DOI: doi:10.1016/0092-8674(87)90561-7
MARCH-DIAZ R ET AL: "Histone H2A.Z and homologues of components of the SWR1 complex are required to control immunity in Arabidopsis", PLANT JOURNAL FEBRUARY 2008 BLACKWELL PUBLISHING LTD GB, vol. 53, no. 3, February 2008 (2008-02-01), pages 475 - 487, XP002592869, DOI: DOI:10.1111/J.1365-313X.2007.03361.X *
MARCH-DÍAZ ROSANA ET AL: "The beauty of being a variant: H2A.Z and the SWR1 complex in plants.", MOLECULAR PLANT JUL 2009 LNKD- PUBMED:19825639, vol. 2, no. 4, July 2009 (2009-07-01), pages 565 - 577, XP002592870, ISSN: 1674-2052 *
MARTIN-TRILLO, M.; LAZARO, A.; POETHIG, R.S.; GOMEZ-MENA, C.; PINEIRO, M.A.; MARTINEZ-ZAPATER, J.M.; JARILLO, J.A.: "EARLY IN SHORT DAYS 1 (ESD1) encodes ACTIN-RELATED PROTEIN 6 (AtARP6), a putative component of chromatin remodelling complexes that positively regulates FLC accumulation in Arabidopsis", DEVELOPMENT, vol. 133, 2006, pages 1241 - 1252
MAVRICH, T.N.; JIANG, C.; IOSHIKHES, I.P.; LI, X.; VENTERS, B.J.; ZANTON, S.J.; TOMSHO, L.P.; QI, J.; GLASER, R.L.; SCHUSTER, S.C.: "Nucleosome organization in the Drosophila genome", NATURE, vol. 453, 2008, pages 358 - 362
MENEGHINI, M.D.; WU, M.; MADHANI, H.D.: "Conserved histone variant H2A.Z protects euchromatin from the ectopic spread of silent heterochromatin", CELL, vol. 112, 2003, pages 725 - 736
MICHAEL, T.P.; MOCKLER, T.C.; BRETON, G.; MCENTEE, C.; BYER, A.; TROUT, J.D.; HAZEN, S.P.; SHEN, R.; PRIEST, H.D.; SULLIVAN, C.M.: "Network discovery pipeline elucidates conserved time-of-day-specific cis-regulatory modules", PLOS GENET, vol. 4, 2008, pages E14
MILLAR CATHERINE B ET AL: "Acetylation of H2AZ Lys 14 is associated with genome-wide gene activity in yeast", GENES & DEVELOPMENT, vol. 20, no. 6, March 2006 (2006-03-01), pages 711 - 722, XP002592868, ISSN: 0890-9369 *
MITTLER, R.: "Abiotic stress, the field environment and stress combination", TRENDS PLANT SCI, vol. 11, 2006, pages 15 - 19, XP028013182, DOI: doi:10.1016/j.tplants.2005.11.002
MIZUGUCHI, G.; SHEN, X.; LANDRY, J.; WU, W.H.; SEN, S.; WU, C.: "ATP-driven exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling complex", SCIENCE, vol. 303, 2004, pages 343 - 348
NGUYEN, V.Q.; SIL, A.: "Temperature-induced switch to the pathogenic yeast form of Histoplasma capsulatum requires Ryp1, a conserved transcriptional regulator", PROC NATL ACAD SCI U S A, vol. 105, 2008, pages 4880 - 4885
PETESCH, S.J.; LIS, J.T.: "Rapid, transcription- independent loss of nucleosomes over a large chromatin domain at Hsp70 loci", CELL, vol. 134, 2008, pages 74 - 84
POETHIG, R.S.: "Phase change and the regulation of developmental timing in plants", SCIENCE, vol. 301, 2003, pages 334 - 336
POLACH, K.J.; WIDOM, J.: "Mechanism of protein access to specific DNA sequences in chromatin: a dynamic equilibrium model for gene regulation", J MOL BIOL, vol. 254, 1995, pages 130 - 149
RAISNER, R.M.; HARTLEY, P.D.; MENEGHINI, M.D.; BAO, M.Z.; LIU, C.L.; SCHREIBER, S.L.; RANDO, O.J.; MADHANI, H.D.: "Histone variant H2A.Z marks the 5' ends of both active and inactive genes in euchromatin", CELL, vol. 123, 2005, pages 233 - 248
SALOME, P.A; MCCLUNG, C.R, PLANT CELL, vol. 17, 2005, pages 791 - 803
SAMACH, A.; WIGGE, P.A.: "Ambient temperature perception in plants", CURR OPIN PLANT BIOL, vol. 8, 2005, pages 483 - 486
SEGAL, E.; WIDOM, J.: "From DNA sequence to transcriptional behaviour: a quantitative approach", NAT REV GENET, vol. 10, 2009, pages 443 - 456
SUNG, D.Y.; VIERLING, E.; GUY, C.L.: "Comprehensive expression profile analysis of the Arabidopsis Hsp70 gene family", PLANT PHYSIOL, vol. 126, 2001, pages 789 - 800
SUNG, S.; AMASINO, R.M.: "Remembering winter: toward a molecular understanding of vernalization", ANNU REV PLANT BIOL, vol. 56, 2005, pages 491 - 508
THAMBIRAJAH, A.A.; DRYHURST, D.; ISHIBASHI, T.; LI, A.; MAFFEY, A.H.; AUSIO, J.: "H2A.Z stabilizes chromatin in a way that is dependent on core histone acetylation", J BIOL CHEM, vol. 281, 2006, pages 20036 - 20044
TILL, B.J.; ZERR, T.; COMAI, L.; HENIKOFF, S.: "A protocol for TILLING and Ecotilling in plants and animals", NAT PROTOC, vol. 1, 2006, pages 2465 - 2477
TSANKOV, A.M.; BROWN, C.R.; YU, M.C.; WIN, M.Z.; SILVER, P.A.; CASOLARI, J.M.: "Communication between levels of transcriptional control improves robustness and adaptivity", MOLECULAR SYSTEMS BIOLOGY, vol. 2, 2006, pages 65
WHITTLE, C.M.; MCCLINIC, K.N.; ERCAN, S.; ZHANG, X.; GREEN, R.D.; KELLY, W.G.; LIEB, J.D.: "The genomic distribution and function of histone variant HTZ-1 during C. elegans embryogenesis", PLOS GENET, vol. 4, 2008, pages E1000187
WILCZEK, A.M.; ROE, J.L.; KNAPP, M.C.; COOPER, M.D.; LOPEZ-GALLEGO, C.; MARTIN, L.J.; MUIR, C.D.; SIM, S.; WALKER, A.; ANDERSON, J: "Effects of Genetic Perturbation on Seasonal Life History Plasticity", SCIENCE, vol. 323, 2009, pages 930 - 934
WILLIS, C.G; RUHFEL, B; PRIMACK, R.B; MILLER-RUSHING, A.J; DAVIS, C.C: "Phylogenetic patterns of species loss", PROC NATL ACAD SCI, vol. 105, 2008, pages 17029 - 17033
ZHANG, H.; ROBERTS, D.N.; CAIRNS, B.R.: "Genome-wide dynamics of Htzl, a histone H2A variant that poises repressed/basal promoters for activation through histone loss", CELL, vol. 123, 2005, pages 219 - 231
ZILBERMAN, D.; COLEMAN-DERR, D.; BALLINGER, T.; HENIKOFF, S.: "Histone H2A.Z and DNA methylation are mutually antagonistic chromatin marks", NATURE, vol. 456, 2008, pages 125 - 129

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3712271A1 (en) * 2019-03-18 2020-09-23 Commissariat à l'Energie Atomique et aux Energies Alternatives Altering thermoresponsive growth in plants via genome editing of phytochrome interacting factor 4 (pif4) regulatory elements
US12077767B2 (en) 2019-03-18 2024-09-03 Commissariat A L'energie Atomique Et Aux Energies Alternatives Altering thermoresponsive growth in plants via genome editing of phytochrome interacting factor 4 (PIF4) regulatory elements
CN110938605A (zh) * 2019-11-20 2020-03-31 中山大学附属第五医院 一种体外组装的HBV cccDNA核小体及其制备方法
CN110938605B (zh) * 2019-11-20 2021-05-04 中山大学附属第五医院 一种体外组装的HBV cccDNA核小体及其制备方法
WO2025233441A1 (en) 2024-05-08 2025-11-13 Gmi - Gregor-Mendel-Institut Für Molekulare Pflanzenbiologie Gmbh Modified h2a.z l2 region

Also Published As

Publication number Publication date
AR079319A1 (es) 2012-01-18
EP2521734B1 (en) 2016-09-14
MX2012007867A (es) 2012-08-03
IN2012DN06570A (https=) 2015-10-23
GB201000184D0 (en) 2010-02-24
US20130239252A1 (en) 2013-09-12
EP2521734A1 (en) 2012-11-14
CA2786341A1 (en) 2011-07-14
AU2010340802B2 (en) 2014-03-13
AU2010340802A1 (en) 2012-06-21
CN102781956B (zh) 2015-09-16
WO2011083298A1 (en) 2011-07-14
CN102781956A (zh) 2012-11-14
BR112012016796A2 (pt) 2019-09-24

Similar Documents

Publication Publication Date Title
EP2521734B1 (en) Methods and compositions for altering temperature sensing in eukaryotic organisms
Ma et al. The miR156/SPL module regulates apple salt stress tolerance by activating MdWRKY100 expression
Wu et al. Characterization of maize phytochrome-interacting factors in light signaling and photomorphogenesis
Su et al. A novel MYBS3-dependent pathway confers cold tolerance in rice
Capella et al. Arabidopsis thaliana HomeoBox 1 (At HB 1), a Homedomain‐Leucine Zipper I (HD‐Zip I) transcription factor, is regulated by PHYTOCHROME‐INTERACTING FACTOR 1 to promote hypocotyl elongation
Lin et al. Role of Arabidopsis RAP2. 4 in regulating light-and ethylene-mediated developmental processes and drought stress tolerance
Li et al. Global identification of full‐length cassava lncRNAs unveils the role of cold‐responsive intergenic lncRNA 1 in cold stress response
Brugière et al. Overexpression of RING domain E3 ligase ZmXerico1 confers drought tolerance through regulation of ABA homeostasis
Li et al. A novel NAC transcription factor from Suaeda liaotungensis K. enhanced transgenic Arabidopsis drought, salt, and cold stress tolerance
Kalyna et al. Ectopic expression of atRSZ33 reveals its function in splicing and causes pleiotropic changes in development
Carvalho et al. On the physiological significance of alternative splicing events in higher plants
Marshall et al. The Arabidopsis sickle mutant exhibits altered circadian clock responses to cool temperatures and temperature-dependent alternative splicing
Huang et al. The DEAD-box RNA helicase AtRH7/PRH75 participates in pre-rRNA processing, plant development and cold tolerance in Arabidopsis
Li et al. The AP2/ERF transcription factor TOE4b regulates photoperiodic flowering and grain yield per plant in soybean
Wu et al. Characterization and fine mapping of the rice premature senescence mutant ospse1
Wei et al. The GATA transcription factor TaGATA1 recruits demethylase TaELF6‐A1 and enhances seed dormancy in wheat by directly regulating TaABI5
US20140137290A1 (en) Molecular clock mechanism of hybrid vigor
Zhao et al. Structure and character analysis of cotton response regulator genes family reveals that GhRR7 responses to draught stress
Zhao et al. Isolation and characterization of cold-regulated transcriptional activator LpCBF3 gene from perennial ryegrass (Lolium perenne L.)
Li et al. Overexpression of TCP transcription factor OsPCF7 improves agronomic trait in rice
WO2015095186A2 (en) Nitrogen use efficiency in plants
Li et al. ZmELP1, an Elongator complex subunit, is required for the maintenance of histone acetylation and RNA Pol II phosphorylation in maize kernels
Chen et al. A poplar DRE-binding protein gene, PeDREB2L, is involved in regulation of defense response against abiotic stress
Ribichich et al. Coping with drought and salinity stresses: role of transcription factors in crop improvement
WO2011138054A1 (en) Modulation of germination, elongation growth, flowering time, seed size and frost tolerance in plants

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080060911.3

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10724120

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2010340802

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2010340802

Country of ref document: AU

Date of ref document: 20100608

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2786341

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2012/007867

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 6570/DELNP/2012

Country of ref document: IN

REEP Request for entry into the european phase

Ref document number: 2010724120

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2010724120

Country of ref document: EP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112012016796

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 13520967

Country of ref document: US

ENP Entry into the national phase

Ref document number: 112012016796

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20120706