WO2011060040A1 - Applications diagnostiques et thérapeutiques de l'arnpn u6 - Google Patents

Applications diagnostiques et thérapeutiques de l'arnpn u6 Download PDF

Info

Publication number
WO2011060040A1
WO2011060040A1 PCT/US2010/056186 US2010056186W WO2011060040A1 WO 2011060040 A1 WO2011060040 A1 WO 2011060040A1 US 2010056186 W US2010056186 W US 2010056186W WO 2011060040 A1 WO2011060040 A1 WO 2011060040A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
snrna
level
animal
sample
Prior art date
Application number
PCT/US2010/056186
Other languages
English (en)
Inventor
Vuong Trieu
Larn Hwang
Neil Desai
Original Assignee
Abraxis Bioscience, Llc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Abraxis Bioscience, Llc filed Critical Abraxis Bioscience, Llc
Publication of WO2011060040A1 publication Critical patent/WO2011060040A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/318—Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
    • C12N2310/3181—Peptide nucleic acid, PNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/31—Combination therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • introns are removed from primary transcripts (or "pre-mRNAs") by RNA splicing. This RNA splicing is performed by a macromolecular enzyme complex known as the "spliceosome.” After the introns are removed, the resulting free ends of the RNA fragments (exons) are ligated together via two spliceosome-catalyzed phosphoryl-transfer reactions, providing mature mRNAs.
  • the spliceosome comprises five relatively small protein associated RNA molecules (small nuclear ribonucleoproteins, or "snRNPs") associated with snRNP proteins and a range of non-snRNP proteins.
  • the snRNPs are referred to as the Ul, U2, U4, U5 and U6 snRNP.
  • the U6 snRNP is required to permit the spliceosome to identify the 5' splice site at the beginning of each intron.
  • the consensus sequence for 5' splice sites of the major class of pre-mRNA introns spans an eight-nucleotide sequence (AG
  • the U6 snRNA functions by base pairing with this 5' consensus sequence.
  • the U6 snRNA is one of the most conformationally dynamic RNAs in the
  • the U6 snRNA takes on a relatively complex secondary structure, as shown in FIG. 1.
  • the U6 3' intramolecular stem-loop unwinds and the exposed sequences base pair with U4 snRNA, to form the U4/U6 snRNA complex.
  • spliceosome activation occurs, during which U4 snRNA is unwound from U6 snRNA.
  • the U6 snRNA then base pairs with the U2 snRNA to form the catalytically active form of the spliceosome.
  • the "U6-ISL” structure Upon activation of the spliceosome, the "U6-ISL” structure positions certain nucleotides of the U6 snRNA at the 5 'splice site to permit base pairing with the pre-mRNA at the 5' prime splice site (see FIG. 1). Mutations in the U6 snRNA can alter splice site specificity.
  • U6 snRNA There are two forms of the U6 snRNA: "RNU6-1 " is the 106 nucleotide full-length active form (SEQ ID NO: 1), and “RNU6-2” is the truncated 25 nucleotide inactive form (SEQ ID NO: 2) (FIG. 2).
  • the U6 snRNA because of its abundant and specific nuclear localization, has been used as an internal control for RT-PCR, and as a control for nuclear staining with in situ hybridization.
  • the invention provides antisense compositions which target the U6 snRNA
  • U6 antisense compositions comprising one or more of a DNA, RNA, locked nucleic acid (“LNA”) or peptide nucleic acid (“PNA”) molecule of from about 10 to 30 about bases which is complementary to a portion of SEQ ID NO: 1, wherein the in vitro
  • U6 antisense compositions reduces the level of RNA of SEQ ID NO: 1 in that cell by at least 50% or inhibits the activity of RNA SEQ ID NO: 1 in that cell by at least 50%.
  • Related embodiments of the invention include, e.g., wherein said one or more DNA, RNA, LNA or PNA molecule comprises one or more of SEQ ID NOS: 3-94 (with the chemical modification shown herein).
  • the invention also provides methods of increasing the level of mitochondrial function by inducing the expression of super oxide dismutase and/or TIMM17B in a cell as a result of administering to the cell one or more of the U6 antisense compositions provided by the present invention.
  • the invention provides methods of diagnosing cancer in a first animal comprising: isolating RNA from a first sample from an animal suspected of having cancer, measuring the level of U6 snRNA in said first sample, and comparing the level of U6 snRNA in the first sample with the level of U6 snRNA in a corresponding normal second sample from the same or a second animal, wherein the presence of a higher level of U6 snRNA in the first sample relative to the second sample indicates the presence of cancer in said first animal.
  • the second tissue sample used in such methods may be non-cancerous tissue from the same animal, or may be non-cancerous tissue from a control animal.
  • the invention further provides methods of treating a proliferative disease in an animal comprising: (a) isolating RNA from tissue containing a proliferative lesion, (b) measuring the level of U6 snRNA in the tissue containing a proliferative lesion, (c) comparing the level of U6 snRNA in the tissue containing the proliferative lesion with the level of U6 snRNA in corresponding normal tissue, and (d) administering a treatment to the animal when the comparison in step (c) indicates that there exists a higher level of U6 snRNA in the tissue containing the proliferative lesion relative to the level of U6 snRNA in the corresponding normal tissue.
  • FIG. 1 depicts the secondary structure of the U6-U2 complex acting on an as yet unspliced pre-mRNA and some of the structural domains of this complex.
  • FIG. 2 depicts the sequences of the U6 snRNA, specifically "RNU6-1,” a 106 nucleotide full-length active form (SEQ ID NO: 1) and "RNU6-2," a truncated 25 nucleotide inactive form (SEQ ID NO: 2) ( indicates sequence identity with RNU6-1 ; indicates no corresponding RNU6-2 sequence exists).
  • FIG. 3 depicts the sequences of selected inventive oligonucleotides (a capital letter indicates the nucleotide is a LNA).
  • FIG. 4 depicts nucleotide chemical modifications which are in accordance with the invention.
  • FIG. 5 depicts the correlation between the median fluorescence intensity by image analysis (y-axis) and visual scoring (x-axis) of U6 expression in normal and tumor tissues on microarrays.
  • FIG. 6 depicts the correlation between the mean fluorescence intensity minus background by image analysis (y-axis) and visual scoring (x-axis) of U6 expression in normal and tumor tissues on microarrays.
  • FIG. 7 depicts the correlation between the fluorescence signal to noise ratio (“SNR") (y-axis) and visual scoring (x-axis) of U6 expression in normal and tumor tissues on microarrays.
  • SNR fluorescence signal to noise ratio
  • FIG. 8 depicts the U6 level in normal control colon and colonic tumor tissue based on visual scoring.
  • FIG. 9 depicts the results of a study comparing the U6 level in normal control and colon cancer based on image analysis and a statistical analysis of the depicted data.
  • FIG. 10 depicts the U6 level in normal control skin and melanoma based on visual scoring.
  • FIG. 1 1 depicts the results of a study comparing the U6 level in normal control skin and melanoma based on image analysis and a statistical analysis of the depicted data.
  • FIG. 12 depicts the U6 level in normal control pancreas and pancreatic tumor tissue based on visual scoring.
  • FIG. 13 depicts the results of a study comparing the U6 level in normal control pancreas and pancreatic cancer based on image analysis and a statistical analysis of the depicted data.
  • FIG. 14 depicts the results of a study comparing the U6 level in normal control kidney and renal cancer based on image analysis.
  • FIG. 15 depicts the results of a study comparing the U6 level in normal control lung and lung cancer based on image analysis.
  • FIG. 16 depicts the correlation between U6 level and PCNA in breast cancer (circles, breast cancer; points, normal breast controls).
  • FIG. 17 depicts the correlation between U6 level and Her2 in breast cancer (circles, breast cancer; points, normal breast controls).
  • FIG. 18 depicts the correlation between U6 level and EGFR in breast cancer (circles, breast cancer; points, normal breast controls).
  • FIG. 19 depicts the position of PCR primers (SEQ ID NOS: 95 and 96) on the U6 sequence.
  • FIG. 20 depicts the U6 level in a series of tumors by quantitative RT-PCR.
  • FIG. 21 compares the U6 level, as determined by quantitative RT-PCR, in different tumor types.
  • FIG. 22 depicts the tumor cell killing dose-response curves for the U6 snRNA antisense compositions SEQ ID NO: 8 (LNA-U6-2) against SKOV-3 (ovarian), PC-3 (prostate), MDA-MB-231 (breast), HT29 (colon), 293 (kidney) and CHO (ovary) cells.
  • FIG. 23 depicts the tumor cell killing dose response curves for the U6 snRNA antisense compositions SEQ ID NO: 8 (LNA-U6-2) against PC-3 (prostate), MDA-MB-231 (breast), HT29 (colon), and MX-1 (breast) cell lines.
  • FIG. 24 depicts the position in the U6 sequence of a series of antisense
  • FIG. 25 presents the activity of a series of U6 antisense oligonucleotides in two cell lines, 293 (transformed monkey kidney cells) and HT29 (human colon cancer cells).
  • FIG. 26 presents the activity of three U6 antisense oligonucleotides in two cell lines, 293 (transformed monkey kidney cells) and HT29 (human colon cancer cells).
  • FIG. 27 presents a series of U6 antisense oligonucleotides ("*" indicates the presence of a phosphorothioate internucleotide bond and a capital letter indicates the nucleotide is a LNA).
  • FIG. 28 presents the activity of a series of U6 antisense oligonucleotides in two cell lines, 293 (transformed monkey kidney cells) and HT29 (human colon cancer cells).
  • FIG. 29 presents a series of U6 antisense oligonucleotides in relation to their position in the U6 sequence.
  • FIG. 30 presents the activity of a series of U6 antisense oligonucleotides in two cell lines, 293 (transformed monkey kidney cells) and HT29 (human colon cancer cells).
  • FIG. 31 presents the sequences of oligonucleotides prepared by optimizing LNA-U6- 36 (SEQ ID NO: 57) via chemical modifications.
  • FIG. 32 presents the activity of a subset of the optimized oligonucleotides based on LNA-U6-36 (SEQ ID NO: 57) in two cell lines, 293 (transformed monkey kidney cells) and HT29 (human colon cancer cells).
  • FIG. 33 presents the activity (A) and toxicity (B) of the AZ-U6-36-2 U6 antisense oligonucleotide in a nude mouse xenograft tumor model system (p value is against saline).
  • the term "therapeutically effective” refers to a result which substantially decreases the level or functional activity of U6 snRNA from pretreatment levels, including for example, an about 20% reduction, preferably an about 25% reduction, more preferably an about 30% reduction, even more preferably an about 33% reduction, even more preferably an about 50% reduction, even more preferably an about 67% reduction, even more preferably an about 80% reduction, even more preferably an about 90% reduction, even more preferably an about 95% reduction, even more preferably an about 99% reduction, and most preferably complete silencing, such that the treated disease process or condition is
  • U6 snRNA levels are not available, "therapeutically effective” may refer to a substantial decrease in the level or functional activity of U6 snRNA as compared to a negative control, either in an unaffected tissue from the subject being treated, or in a suitable corresponding tissue of an unaffected control animal. It may be convenient to refer to the decrease in U6 snRNA in a test sample in terms of its proportion to the negative control.
  • the U6 snRNA level in the test sample can be decreased by an amount equal to the level of the negative control. More preferably, the test sample level can be decreased by an amount equal to about twice the level of the negative control (a two fold reduction).
  • the level can be decreased by about five fold, about six fold, about seven fold, about eight fold, about nine fold, about 10 fold, about 20 fold, about 50 fold, about 100 fold, about 1000 fold, or even about 10,000 fold as compared to the level of the negative control.
  • complete silencing of U6 snRNA is most preferred.
  • nucleic acid or “oligonucleotide” refers to multiple nucleotides (i.e. molecules comprising a sugar (e.g. ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g. cytosine (C), thymidine (T) or uracil (U)) or a substituted purine (e.g.
  • a substituted pyrimidine e.g. cytosine (C), thymidine (T) or uracil (U)
  • purine e.g.
  • adenine or guanine (G)
  • the term shall also include polynucleosides (i.e. a
  • nucleic acid also encompasses nucleic acids with substitutions or modifications, such as in the bases and/or sugars.
  • nucleic acid includes DNAs, RNAs and peptide nucleic acids (“PNAs").
  • isolated nucleic acid refers primarily to a RNA molecule encoded by an isolated DNA molecule as defined above. Alternatively, the term may refer to an RNA molecule that has been sufficiently separated from other nucleic acids with which it would be associated in its natural state (i.e., in cells or tissues).
  • An isolated nucleic acid (either DNA or RNA) may further represent a molecule produced directly by biological or synthetic means and separated from other components present during its production.
  • isolated RNA includes preparing RNA in a histologic section for detection by in situ hybridization.
  • polypeptide and “polypeptide” are used interchangeably herein and refer to a compound made up of a chain of amino acid residues linked by peptide bonds.
  • An "active portion" of a polypeptide means a peptide that is less than the full length polypeptide, but which retains measurable biological activity and retains biological detection.
  • Locked nucleic acids are a class of nucleic acid analogues in which the ribose ring is "locked” by, e.g., a methylene bridge connecting the 2'-0 atom and the 4'-C atom.
  • LNA nucleosides contain the common nucleobases (T, C, G, A, U and mC) and are able to form base pairs according to standard Watson-Crick base pairing rules. However, by "locking" the molecule with the methylene bridge the LNA is constrained in the ideal conformation for Watson-Crick binding. When incorporated into a DNA oligonucleotide, LNA therefore makes the pairing with a complementary nucleotide strand more rapid and increases the stability of the resulting duplex.
  • a "LNA/DNA mixmer” or “mixmer” is used to refer to a nucleic acid that contains at least one LNA unit and at least one RNA or DNA unit (e.g. , a naturally-occurring RNA or DNA unit).
  • a "headmer” is defined by a contiguous stretch of beta-D-oxy-LNA or LNA derivatives at the 5 '-end followed by a contiguous stretch of DNA or modified monomers recognizable and cleavable by the RNaseH towards the 3 '-end
  • a "tailmer” is defined by a contiguous stretch of DNA or modified monomers recognizable and cleavable by the RNaseH at the 5'-end followed by a contiguous stretch of beta-D-oxy-LNA or LNA derivatives towards the 3'-end.
  • subsequence comprises a stretch of 4 nucleotide analogues, such as LNA nucleotide analogues, as defined herein, followed by a stretch of 8 nucleotides, which is followed by a stretch of 4 nucleotide analogues, such as LNA nucleotide analogues as defined herein, optionally with a single nucleotide at the 3' end.
  • a "gapmer” is based on a central stretch of 4-12 base DNA (gap) typically flanked by 1 to 6 residues of 2'-0 modified nucleotides (beta-D-oxy-LNA in our case, flanks) which are able to act via an RNaseH mediated mechanism to reduce the target sequence's level.
  • said subsequence comprises a stretch of 3 nucleotide analogues, such as LNA nucleotide analogues, as defined herein, followed by a stretch of 9 nucleotides, which is followed by a stretch of 3 nucleotide analogues, such as LNA nucleotide analogues as defined herein, optionally with a single nucleotide at the 3' end.
  • 3 nucleotide analogues such as LNA nucleotide analogues, as defined herein
  • said subsequence comprises a stretch of 4 nucleotide analogues, such as LNA nucleotide analogues, as defined herein, followed by a stretch of 8 nucleotides, which is followed by a stretch of 3 nucleotide analogues, such as LNA nucleotide analogues as defined herein, optionally with a single nucleotide at the 3' end.
  • 4 nucleotide analogues such as LNA nucleotide analogues, as defined herein
  • 8 nucleotides which is followed by a stretch of 3 nucleotide analogues, such as LNA nucleotide analogues as defined herein, optionally with a single nucleotide at the 3' end.
  • conjugate refers to a chemical moiety, either a nucleotide, oligonucleotide, polynucleotide or an amino acid, peptide or protein or other chemical, that when added to another sequence, provides additional utility or confers useful properties, particularly in the delivery, trafficking, detection or isolation of that sequence.
  • the conjugate is cholesterol added to the 3' end of an LNA, which confers the ability of the LNA of the invention to be cell permeable.
  • histidine residues e.g., 4 to 8 consecutive histidine residues
  • amino acid sequences, peptides, proteins or fusion partners representing epitopes or binding determinants reactive with specific antibody molecules or other molecules (e.g. , flag epitope, c-myc epitope, transmembrane epitope of the influenza A virus hemaglutinin protein, protein A, cellulose binding domain, calmodulin binding protein, maltose binding protein, chitin binding domain, glutathione S-transferase, and the like) may be added to proteins to facilitate protein isolation by procedures such as affinity or immunoaffinity chromatography. Numerous other tag moieties are known to, and may be envisioned by, the skilled artisan, and are contemplated to be within the scope of this definition.
  • “pharmaceutical formulations” include formulations for human and veterinary use with no significant adverse toxicological effect.
  • “Pharmaceutically acceptable formulation” as used herein refers to a composition or formulation that allows for the effective distribution of the nucleic acid molecules of the instant invention in the physical location most suitable for their desired activity.
  • pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated.
  • co-administration and “combination therapy” refer to administering to a subject two or more therapeutically active agents.
  • the agents may be contained in a single pharmaceutical composition and be administered at the same time, or the agents can be contained in separate formulation and administered serially to a subject. So long as the two agents may be detected in the subject at the same time, the two agents are said to be coadministered.
  • the invention provides U6 antisense compositions comprising one or more of a DNA, RNA, LNA or PNA molecule of 10 to 30 bases which is complementary to a portion of SEQ ID NO: 1 , wherein the in vitro administration of said U6 antisense composition to a cell reduces the level of RNA comprising SEQ ID NO: 1 in that cell by at least about 50%, preferably by at least about 80%, more preferably by at least about 90% and most preferably by at least about 95% or inhibits the activity comprising RNA SEQ ID NO: 1 in that cell by at least about 50%, preferably by at least about 80%, more preferably by at least about 90% and most preferably by at least about 95% as measured by any suitable assay known to those of ordinary skill in the art including, e.g., Nature Protocols 1 : 1022 - 1028 (2006); Methods 37(4): 306-313 (2005).
  • Preferred embodiments of said U6 antisense composition comprise one or more of SEQ ID NOS: 3-8, 9, 10, 12, 24, 25, 33, 39, 40, 57, 65, 66, and 75.
  • SEQ ID NO: 8 which is complementary to the helix I sequences in the U6 snRNA, has been found to be particularly effective in reducing the level of U6 snRNA, while SEQ ID NO: 7, which binds to the ISL, was found to be less active.
  • a 2'-MOE gapmer, SEQ ID NO: 45 (AZ-U6- 24), which binds to the U6 snRNA helix II, and SEQ ID NO: 66 also constitute preferred embodiments of the U6 antisense composition.
  • the inventive U6 antisense compositions include those in which one or more of the bases is modified, e.g. , to include a 2T, 2'ara-F, FANA (2'-fluoro-P-D-arabinonucleic acid), 4'-thioribose, 2'-OMe (i.e., 2 -O-methyl backbone), 2'-MOE ( 2'-0- dimethylaminoethyloxyethyl-modified), NMAC (N-methylacetamide), DMAEAc ([[2- (diniethylamino)ethyl]amino]-2-oxoethyl]), LNA, ENA (ethylene-bridged nucleic acid), 5- propynyl C, G-Clamp, 5-methyl-C, MMI or phosphorothioate chemical structure.
  • the bases is modified, e.g. , to include a 2T, 2'ara-F, FANA (2'-fluoro-P-
  • U6 antisense compositions in accordance with the invention include those wherein the composition comprises, e.g. , a gapmer, mixmer or headmer.
  • the U6 antisense compositions in accordance with the invention may further comprise a pharmaceutically-acceptable carrier.
  • the U6 antisense compositions provided by the invention include those where at least one of said one or more DNA, RNA , LNA or PNA oligonucleotides is modified by the addition of any one of cholesterol, bis-cholesterol, PEG, PEG-ylated carbon nanotube, poly- L- lysine, cyclodextran, polyethylenimine polymer or peptide moieties.
  • the U6 antisense compositions provided by the invention include those in which each of said one or more DNA, RNA , LNA or PNA oligonucleotides is modified by the addition of any one of cholesterol, bis-cholesterol, PEG, PEG-ylated carbon nanotube, poly-L- lysine, cyclodextran, polyethylenimine polymer or peptide moieties.
  • oligonucleotides in accordance with the invention may be modified by any polymeric species including synthetic or naturally occurring polymers or proteins.
  • the U6 antisense compositions provided by the invention include those which have been modified to facilitate cell-type selective targeting or to enhance the uptake of oligonucleotides. These include, e.g., modifications that target specific receptors (CTLs, cell targeting ligands) and agents that enhance transmembrane permeation (primarily cell penetrating peptides, CPPs). Suitable CTLs include lipoprotein receptors (particularly those in the liver), integrins and receptor tyrosine kinases.
  • CTLs target specific receptors
  • CPPs cell penetrating peptides
  • Suitable CPPs include polycationic peptides rich in argine and lysine and membrane-interactive hydrophobic sequences, e.g., KALA peptide (WEAKLAKALAKALAKHLAKALAKALKACEA (SEQ ID NO: 95), MPG peptide (GALFLGWLGAAGSTMGAPKKKRKV (SEQ ID NO: 96), R9 peptide
  • Suitable oligonucleotides useful in various embodiments of the present invention may be composed of naturally occurring nucleobases, sugars and internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly or with specific improved functions. Fully or partly modified or substituted oligonucleotides are often preferred over native forms because of several desirable properties of such oligonucleotides, for instance, the ability to penetrate a cell membrane, good resistance to extra- and intracellular nucleases, high affinity and specificity for the nucleic acid target.
  • the oligomeric compound such as an antisense oligonucleotide
  • the oligomeric compound comprises at least one Locked Nucleic Acid (LNA) unit, such as 3, 4, 5, 6, 7, 8, 9, or 10 Locked Nucleic Acid (LNA) units, preferably between 4 to 9 LNA units, such as 6-9 LNA units, and most preferably 6, 7 or 8 LNA units.
  • LNA Locked Nucleic Acid
  • the LNA units comprise at least one beta-D-oxy-LNA unit(s) such as 4, 5, 6, 7, 8, 9, or 10 beta-D-oxy-LNA units.
  • All the LNA units may be, e.g., beta-D-oxy-LNA units, although it is considered that the oligomeric compounds, such as the antisense oligonucleotide, may comprise more than one type of LNA unit.
  • the oligomeric compound may comprise both beta-D-oxy- LNA, and one or more of the following LNA units: thio-LNA, amino-LNA, oxy-LNA, ena- LNA and/or alpha-LNA in either the D-beta or L-alpha configurations or combinations thereof.
  • Embodiments of the invention may comprise nucleotide analogues, such as LNA nucleotide analogues, which typically comprise a stretch of 2-6 nucleotide analogues, such as LNA nucleotide analogues, as defined herein, followed by a stretch of 4-12 nucleotides, which is followed by a stretch of 2-6 nucleotide analogues, such as LNA nucleotide analogues, as defined herein.
  • the oligonucleotides of the present invention may comprise modified bases such that the oligonucleotides retain their ability to bind other nucleic acid sequences, but are unable to associate significantly with proteins such as the RNA degradation machinery.
  • the oligonucleotide agents featured in the invention also may include 2 -O-methyl, 3 -0- pixyl, 5'-0- pixyl, 2'-fluorine, 2'-0-methoxyethyl, 2'-0- aminopropyl, 2'-amino, and/or phosphorothioate linkages and the like.
  • ENAS ethylene nucleic acids
  • 2'-4'-ethylene-bridged nucleic acids e.g., 2-amino-A, 2-thio (e.g., 2-thio-U), G-clamp modifications, also may increase binding affinity to the target.
  • nucleobase modifications such as 2-amino-A, 2-thio (e.g., 2-thio-U), G-clamp modifications, also may increase binding affinity to the target.
  • the targeting portion is an analog of an oligonucleotide wherein at least one of the 2'-deoxy ribofuranosyl moieties of the nucleoside unit is modified.
  • a hydrogen or a hydroxyl, halo, azido, amino, methoxy or alkyl functional group may be added.
  • H OH, lower alkyl, substituted lower alkyl, F, CI, Br, CN, CF 3 , OCF 3 , OCN, 0-alkyl, S-alkyl, SOME, S0 2 Me, ON0 2 , N0 2 N 3 NH 2 NH-alkyl, OCH 2 CH 2 , OCH 2 CCH, -OCCH, aralkyl, heteroaralkyl, heterocycloalkyl, aminoalkylamino, heterocycloalkylamino, polyalkylamino, substituted silyl, a RNA cleaving moiety or a group for improving the pharmacodynamic properties of an oligonucleotide or a group for improving the pharmacokinetic properties of an
  • oligonucleotide where alkyl is a straight or branched chain of Ci to C 12 may be used, with unsaturation within the carbon chain, such as allyloxy, being particularly preferred.
  • U6 antisense oligonucleotides in accordance with the invention include those resulting in cyclobutyl moieties, e.g., cyclobutyl moieties that include a purine or pyrimidine heterocyclic base attached at a C-l cyclobutyl position and where cyclobutyl moieties are joined through a C-2, C-3 or C-4 position on a first of said cyclobutyl moieties and a C-2, C-3, or C-4 position on a second of said cyclobutyl moieties by a linkage that contains 4 or 5 consecutive, covalently-bound atoms selected from the group consisting of C, N, O, S, Si and P.
  • cyclobutyl moieties e.g., cyclobutyl moieties that include a purine or pyrimidine heterocyclic base attached at a C-l cyclobutyl position and where cyclobutyl moieties are joined through
  • U6 antisense oligonucleotides in accordance with the present invention include those resulting in compounds based on N-2 substituted purines, a 3-deazapurines ring system, and compounds with purines comprising a tether portion and at least one reactive or non-reactive
  • such embodiments include nucleosides, nucleoside analogs, nucleotides, nucleotide analogs, heterocyclic bases, and heterocyclic base analogs based on the purine ring system.
  • Natural nucleic acids have a deoxyribose- or ribose-phosphate backbone.
  • An artificial or synthetic polynucleotide is any polynucleotide that is polymerized in vitro or in a cell free system and contains the same or similar bases but may contain a backbone of a type other than the natural ribose-phosphate backbone. These backbones include: PNAs ("peptide nucleic acids”), phosphorothioates (“PS oligonucleotide”), phosphorodiamidates,
  • Bases include any of the known base analogs of DNA and RNA, as well as purines and pyrimidines, the latter further including the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs.
  • Synthetic derivatives of purines and pyrimidines include, but are not limited to, modifications which place new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates, and alkylhalides.
  • the term “specifically hybridizing” refers to the association between two single-stranded nucleotide molecules of sufficiently complementary sequence to permit such hybridization under predetermined conditions generally used in the art (sometimes termed "substantially
  • “Complementary” nucleic acids have the potential to base pair.
  • the term refers to hybridization of an oligonucleotide with a substantially complementary sequence contained within a RNA molecule, to the substantial exclusion of hybridization of the oligonucleotide with single-stranded nucleic acids of non-complementary sequence. Appropriate conditions enabling specific hybridization of single stranded nucleic acid molecules of varying complementarity are well known in the art.
  • Suitable oligonucleotides may be unmodified or chemically modified single-stranded DNA molecules. Suitable oligonucleotides are from about 10 to about 30 bases in length, preferably from about 13 to about 25 bases in length and hybridize under stringent conditions (e.g., high salt, high temperature) to provide a desired sequence, e.g., SEQ ID NO: 1.
  • stringent conditions e.g., high salt, high temperature
  • deoxyribonucleotide phosphodiester oligonucleotides are suitable for use in accordance with the invention, they are not perferred.
  • Methylphosphonate oligonucleotides are noncharged oligomers, in which a nonbridging oxygen atom is replaced by a methyl group at each phosphorus in the oligonucleotide chain.
  • the phosphorothioates in the phosphorothioate diastereomer have improved nuclease stability.
  • a preferred embodiment involves the replacement of the hydrogen at the 2'-position of ribose by an O-alkyl group, most frequently methyl.
  • Suitable oligonucleotides also include embodiments that do not possess the natural phosphate-ribose backbone.
  • PNAs Peptide Nucleic Acids
  • PNAs are nucleic acid analogues that contain an uncharged, flexible, polyamide backbone comprised of repeating N-(2- aminoethyl) glycine units to which the nucleobases are attached via methylene carbonyl linkers .
  • These oligomers will form very stable duplexes or triplexes with nucleic acids: single or double-strand DNA or RNA. The property of high-affinity nucleic acid binding may be explained by the lack of electrostatic repulsion because of the absence of negative charges on the PNA oligomers.
  • PNAs are not substrates for the RNase H or other RNases, the antisense mechanism of PNAs depends on steric hindrance. PNAs also may bind to DNA and inhibit RNA polymerase initiation and elongation, as well as the binding and action of transcription factors, such as nuclear factor ⁇ . PNAs also may bind mRNA and inhibit splicing or translation initiation and elongation .
  • Phosphorodiamidate morpholino oligomers in which the deoxyribose moiety is replaced by a morpholine ring and the charged phosphodiester intersubunit linkage is replaced by an uncharged phosphorodiamidate linkage, also are suitable for use in accordance with the invention. These oligonucleotides are very stable in biological systems and exhibit efficient antisense activity in cell-free translation systems and in a few cultured animal cell lines.
  • oligonucleotide is the N3' ⁇ P5' PN, which result from the replacement of the oxygen at the 3' position on ribose by an amine group.
  • These oligonucleotides can, relative to their isosequential phosphodiester counterparts, form very stable complexes with RNA and single- or double-stranded DNA. Specificity, as well as efficacy, may be increased by using a chimeric oligonucleotide, in which the RNase H- competent segment, usually a phosphorothioate moiety, is bounded on one or both termini by a higher-affinity region of modified RNA , e.g.
  • the invention provides methods of diagnosing and treating proliferative diseases in an animal, including, e.g., cancer, comprising (a) measuring the level of U6 snRNA in a first sample; (b) measuring the level of U6 snRNA in a second sample; and (c) comparing the level of U6 snRNA in the first samplewith the level of U6 snRNA in a second sample.
  • the level of U6 snRNA may be measured using any suitable means including, e.g., by in situ hybridization, blot hybridization, PCR, TMA, invader or microarray.
  • the first sample can be a test sample, i.e., taken from a tissue that is cancerous or is suspected of being cancerous.
  • the second sample is preferably a control sample, which can be a sample taken from a normal tissue of the animal or a non-cancerous tissue sample taken from a second animal. It will be understood that a control sample can also comprise a previously recorded and measured U6 level measured in a sample of normal tissue of an appropriate type taken from an appropriate animal.
  • the invention also provides for methods of diagnosing or treating proliferative diseases, wherein the animal is a human patient.
  • the invention also provides methods of diagnosing a lesion as cancerous including, e.g., wherein the lesion is from the colon, skin, lung, pancreas, kidney, breast, ovary or uterus.
  • the methods of the present invention can be used to determine whether cancer is present, i.e., diagnose cancer, in a tissue sample from an animal, wherein an increased level of U6 snRNA in the first sample as compared to the second sample indicates the presence of cancer.
  • the level of U6 snRNA in the first sample is at least about 150 % higher than that of the second sample, even more preferably at least about 160 % higher, even more preferably at least about 170 % higher, even more preferably at least about 175 % higher, even more preferably at least about 180 % higher, even more preferably at least about 185 % higher, even more preferably at least about 190 % higher, even more preferably at least about 195 % higher, even more preferably at least about 197 % higher, even more preferably at least about 199 % higher, even more preferably at least about 200 % (2.0 fold) higher, even more preferably at least about 2.2 fold higher, even more preferably at least about 2.3 fold higher, even more preferably at least about 2.4 fold higher even more preferably at least about 2.5 fold higher, even more preferably at least about 2.6 fold higher, even more preferably at least about 2.7 fold higher, even more preferably at least about 2.8 fold higher, even more preferably at least about 150 % higher than that
  • the first sample can be a sample from a colonic lesion, a skin lesion, a renal lesion, or a lung lesion.
  • the invention provides methods of treating a proliferative diseases in an animal comprising: (a) isolating RNA from a first sample of tissue containing a proliferative disease from the animal; (b) measuring the level of U6 snRNA present in the first sample; (c) isolating RNA from a second sample comprising normal tissue corresponding to that of the first sample from the same or another animal; (d) measuring the level of U6 snRNA present in the second sample; (e) comparing the level of U6 snRNA in the a first sample to the level of U6 snRNA in the second sample, and (f) administering a treatment to the animal when the comparison in step (e) indicates that there is a higher level of U6 snRNA in the tissue containing a proliferative disease or other suitable first sample relative to the level of U6 sn
  • the first sample from the animal with a proliferative disease may be from any suitable source including, e.g. , a sample of a tissue, body fluid, blood, urine, saliva, sputum, feces or bone marrow of the animal suspected of having cancer.
  • the invention provides methods of treating a proliferative disease comprising administering to the animal one or more of the U6 antisense compositions of the present invention.
  • Suitable U6 antisense compositions in accordance with the invention desirably also comprise one or more pharmaceutically-acceptable carriers.
  • Methods of treating proliferative diseases in accordance with the invention include those in which a therapeutically effective amount of one or more antisense U6 molecules are administered to the animal parenterally, subcutaneously, intramuscularly, intranasally, intraperitonealy, vaginally, anally, orally, intraocularly or intrathecally.
  • One embodiment of the present invention provides for administering treatment if the level of U6 snRNA in the first sample is at least about 150 % higher than that of the second sample, even more preferably at least about 160 % higher, even more preferably at least about 170 % higher, even more preferably at least about 175 % higher, even more preferably at least about 180 % higher, even more preferably at least about 185 % higher, even more preferably at least about 190 % higher, even more preferably at least about 195 % higher, even more preferably at least about 197 % higher, even more preferably at least about 199 % higher, even more preferably at least about 200 % (2.0 fold) higher, even more preferably at least about 2.2 fold higher, even more preferably at least about 2.3 fold higher, even more preferably at least about 2.4 fold higher even more preferably at least about 2.5 fold higher, even more preferably at least about 2.6 fold higher, even more preferably at least about 2.7 fold higher, even more preferably at least about 2.8
  • the first sample can be a sample from a colonic lesion, a skin lesion, a renal lesion, or a lung lesion.
  • Suitable doses of such antisense U6 molecules include, e.g., from about 0.3 mg/m 2 to
  • Suitable doses of antisense U6 molecules include, e.g., those which result in stable blood level of the U6 antisense molecule of from about 0.1 uM to about 1,000 uM, preferably about 0.5 uM to about 500 uM, more preferably about 5 uM to about 100 uM and most preferably about 1 OuM to about 100 uM, from about 1 hour to about 8 hours after administration 1 hour to about 4 hours after administration 0.5 hour to about 4 hours after administration of said antisense U6 molecule of composition which includes said molecule.
  • methods of treating the proliferative diseases in accordance with the invention may desirably further include administering to the animal having such disease a therapy selected from the group consisting of tyrosine kinase inhibitors, phophatase inhibitors, chemotherapy, radiation therapy, biological therapy and surgical therapy.
  • a therapy selected from the group consisting of tyrosine kinase inhibitors, phophatase inhibitors, chemotherapy, radiation therapy, biological therapy and surgical therapy.
  • Methods of treating a proliferative disease in an animal in accordance with the invention include, e.g., methods comprising: (a) isolating RNA or protein from lesional tissue in the animal, (b) isolating RNA or protein from corresponding normal tissue, (c) measuring the level of U6 RNA or protein from said lesional tissue, (d) measuring the level of U6 RNA or protein in said corresponding normal tissue, (e) comparing the level of U6 RNA or protein in said lesional tissue with the level of U6 RNA in said corresponding normal tissue, and (f) administering a therapeutically effective amount of the U6 antisense composition of the invention to the animal when the comparison in step (e) indicates that there exists a higher level of U6 RNA or protein in the lesional tissue relative to the level of U6 RNA in the corresponding normal tissue.
  • the level of U6 RNA may be determined by any suitable technique, including, e.g, in situ hybridization, blot hybridization, PCR, TMA, invade
  • methods of treating a proliferative disease in an animal in accordance with the invention include methods which do not determine or compare the level of U6 RNA in the lesion, e.g. , histopathology, immunohistology, cytology, and the like, preceed the administration of U6 antisense compositions
  • Proliferative diseases which may be treated or prevented in accordance with various embodiments of the present invention include, without limitation, cancer, restenosis or other proliferative diseases, fibrosis, osteoporosis or exaggerated wound healing. More
  • these diseases include, without limitation: (a) cancer which may be selected from the group consisting of carcinoma in situ, atypical hyperplasia, carcinoma, sarcoma, carcinosarcoma, lung cancer, pancreatic cancer, skin cancer, melanoma, hematological neoplasms, breast cancer, brain cancer, colon cancer, bladder cancer, cervical cancer, endometrial cancer, esophageal cancer, gastric cancer, head and neck cancer, multiple myeloma, liver cancer, leukemia, lymphoma, oral cancer, osteosarcomas, ovarian cancer, prostate cancer, testicular cancer, and thyroid cancer, (b) restenosis which may be selected from the group consisting of coronary artery restenosis, cerebral artery restenosis, carotid artery restenosis, renal artery restenosis, femoral artery restenosis, peripheral artery restenosis or combinations thereof, (c) other proliferative disease which may be selected from the group consisting of hyperplasias,
  • Methods in accordance with the invention include, without limitation, those in which the U6 antisense composition is administered directly to the diseased tissue in the organism intravenously, subcutaneously, intramuscularly, nasally, intraperitonealy, vagainally , anally, orally, intraocularly or intrathecally.
  • the formulations administered in accordance with the invention may include one or more penetration enhancers, such as, e.g., fatty acids, bile salts, chelating agents, surfactants or non-chelating non-surfactants.
  • Methods in accordance with the invention include, e.g., combination therapies wherein the animal also may undergo one or more cancer therapies selected from the group consisting of surgery, chemotherapy, radiotherapy, thermotherapy, immunotherapy, hormone therapy and laser therapy.
  • combination therapy may include one or more of chemotherapeutics, targeting agents like antibodies; kinase inhibitors; hormonal agents and the like.
  • Combination therapies by any known conventional therapy, including, but not limited to, antibody administration, vaccine administration, administration of cytotoxic agents, natural amino acid polypeptides, nucleic acids, nucleotide analogues, and biologic response modifiers. Two or more combined compounds may be used together or sequentially.
  • anti-cancer agents that are well known in the art and can be used as a treatment in combination with the compositions described herein include, but are not limited to as used herein, a first line "chemotherapeutic agent" or first line chemotherapy is a medicament that may be used to treat cancer, and generally has the ability to kill cancerous cells directly.
  • chemotherapeutic agents include alkylating agents, antimetabolites, natural products, hormones and antagonists, and miscellaneous agents.
  • alkylating agents include nitrogen mustards such as mechlorethamine, cyclophosphamide, ifosfamide, melphalan (L-sarcolysin) and chlorambucil; ethylenimines and methylmelamines such as hexamethylmelamine and thiotepa; alkyl sulfonates such as busulfan; nitrosoureas such as carmustine (BCNU), semustine (methyl-CCNU), lomustine (CCNU) and streptozocin (streptozotocin); DNA synthesis antagonists such as estramustine phosphate; and triazines such as dacarbazine (DTIC, dimethyl- triazenoimidazolecarboxamide) and temozolomide.
  • antimetabolites include folic acid analogs such as methotrexate (amethopterin); pyrimidine analogs such as fluorouracin (5-fluorouracil, 5-FU, 5
  • fluorodeoxyuridine, FUdR fluorodeoxyuridine
  • cytarabine cytosine arabinoside
  • gemcitabine purine analogs such as mercaptopurine (6-niercaptopurine, 6-MP), thioguanine (6-thioguanine, TG) and pentostatin (2'-deoxycoformycin, deoxycoformycin), cladribine and fludarabine
  • topoisomerase inhibitors such as amsacrine.
  • VLB vinblastine
  • VLB vinblastine
  • Taxanes such as paclitaxel (Abraxane) and docetaxel (Taxotere)
  • epipodophyllotoxins such as etoposide and teniposide
  • camptothecins such as topotecan and irinotecan
  • antibiotics such as dactinomycin
  • actinomycin D daunorubicin (daunomycin, rubidomycin), doxorubicin, bleomycin, mitomycin (mitomycin C), idarubicin, epirubicin; enzymes such as L-asparaginase; and biological response modifiers such as interferon alpha and interlelukin 2.
  • hormones and antagonists include luteinising releasing hormone agonists such as buserelin; adrenocorticosteroids such as prednisone and related preparations; progestins such as hydroxyprogesterone caproate, medroxyprogesterone acetate and megestrol acetate; estrogens such as diethylstilbestrol and ethinyl estradiol and related preparations; estrogen antagonists such as tamoxifen and anastrozole; androgens such as testosterone propionate and
  • miscellaneous agents include thalidomide; platinum coordination complexes such as cisplatin (czs-DDP), oxaliplatin and carboplatin; anthracenediones such as mitoxantrone; substituted ureas such as hydroxyurea; methylhydrazine derivatives such as procarbazine (N- methylhydrazine, MIH); adrenocortical suppressants such as mitotane ( ⁇ , ⁇ '-DDD) and aminoglutethimide; RXR agonists such as bexarotene; and tyrosine kinase inhibitors such as imatinib.
  • miscellaneous agents include thalidomide; platinum coordination complexes such as cisplatin (czs-DDP), oxaliplatin and carboplatin; anthracenediones such as mitoxantrone; substituted ureas such as hydroxyurea; methylhydrazine derivatives
  • the chemotherapeutic agent comprises particles of albumin-bound paclitaxel, e.g., Abraxane®.
  • albumin-bound paclitaxel formulations may be used in accordance with various aspects of the present invention, wherein the paclitaxel dose
  • the administered is from about 30 mg/m to about 1000 mg/m with a dosing cycle of about 3 weeks (i.e., administration of the paclitaxel dose once every about three weeks). Further, it is desirable that the paclitaxel dose administered is from about 50 mg/rrf to about 800 mg/m , preferably from about 80 mg/m 2 to about 700 mg/m 2 , and most preferably from about 250 mg/m 2 to about 300 mg/m 2 , with a dosing cycle of about 3 weeks.
  • radiotherapeutic regimen refers to the administration of radiation of a type and in an intensity sufficient to kill cancerous cells. Radiation interacts with various molecules within the cell but the primary target, which results in cell death, is the deoxyribonucleic acid (DNA). However, radiotherapy often also results in damage to the cellular and nuclear membranes and other organelles. DNA damage usually involves single and double strand breaks in the sugar-phosphate backbone.
  • DNA damage may vary as does the relative biologic effectiveness.
  • heavy particles i.e. protons, neutrons
  • electromagnetic radiation results in indirect ionization acting through short-lived, hydroxyl free radicals produced primarily by the ionization of cellular water.
  • Clinical applications of radiation consist of external beam radiation (from an outside source) and brachytherapy (using a source of radiation implanted or inserted into the patient).
  • External beam radiation consists of X- rays and/or gamma rays
  • brachytherapy employs radioactive nuclei that decay and emit alpha particles, or beta particles along with a gamma ray.
  • alternative therapeutic regimen or “alternative therapy” (not a first line chemotherapeutic regimen as described above) may include, for example, receptor tyrosine kinase inhibitors (for example IressaTM (gefitinib), TarcevaTM (erlotinib), ErbituxTM (cetuximab), imatinib mesilate (GleevecTM), proteosome inhibitors (for example bortezomib, VelcadeTM); VEGFR2 inhibitors such as PTK787 (ZK222584), aurora kinase inhibitors (for example ZM447439); mammalian target of rapamycin (mTOR) inhibitors, cyclooxygenase-2 (COX-2) inhibitors, rapamycin inhibitors (for example sirolimus, RapamuneTM);
  • receptor tyrosine kinase inhibitors for example IressaTM (gefitinib), TarcevaTM (erlotinib), ErbituxTM (cet
  • farnesyltransferase inhibitors for example tipifarnib, Zarnestra
  • matrix metal loproteinase inhibitors for example BAY 12-9566; sulfated polysaccharide tecogalan
  • angiogenesis inhibitors for example AvastinTM (bevacizumab); analogues of fumagillin such as TNP-4; carboxyaminotriazole; BB-94 and BB-2516; thalidomide; interleukin-12; linomide; peptide fragments; and antibodies to vascular growth factors and vascular growth factor receptors
  • platelet derived growth factor receptor inhibitors protein kinase C inhibitors, mitogen- activated kinase inhibitors, mitogen-activated protein kinase inhibitors, Rouse sarcoma virus transforming oncogene (SRC) inhibitors, histonedeacetylase inhibitors, small hypoxia- inducible factor inhibitors, hedgehog inhibitors, and TGF- ⁇ signaling inhibitors.
  • alternative therapies may include other biological- based chemical entities such as polynucleotides, including antisense molecules, polypeptides, antibodies, gene therapy vectors and the like. Such alternative therapeutics may be administered alone or in combination, or in combination with other therapeutic regimens described herein. Methods of use of chemotherapeutic agents and other agents used in alternative therapeutic regimens in combination therapies, including dosing and
  • oligonucleotide internalization with the relative proportions of internalized material depending on oligonucleotide concentration. At relatively low oligonucleotide
  • Suitable vectors include liposomes, which are vesicular colloid vesicles generally composed of bilayers of phospholipids and cholesterol. Liposomes can be neutral or cationic, depending on the nature of the
  • the oligonucleotide can be easily encapsulated in the liposome interior, which contains an aqueous compartment, or be bound to the liposome surface by electrostatic interactions.
  • These vectors because of their positive charge, have high affinity for cell membranes, which are negatively charged under physiological conditions.
  • certain "helper" molecules have been added into the liposomes to allow the oligonucleotides to escape from the endosomes; these include species such as chloroquine and l ,2-dioleoyl-sn-glycero-3- phosphatidylethanolamine.
  • helper molecules ultimately induce endosomal membrane destabilization, allowing leakage of the oligonucleotide, which then appears to be actively transported in high concentration to the nucleus.
  • Many commercial vectors such as Lipofectin and compounds known collectively as Eufectins, Cytofectin, Lipofectamine, etc., are commonly used in laboratory research studies. With some of these delivery vehicles, and under defined conditions, oligonucleotide concentrations of ⁇ 50 nm may be successfully used.
  • Other cationic polymers including, e.g., poly-L-lysine, PAMAM
  • dendrimers polyalkylcyanoacrylate nanoparticles , and polyethyleneimine, are also suitable for use in accordance with the invention.
  • An additional suitable approach to oligonucleotide internalization is to generate transient permeabilization of the plasma membrane and allow naked oligonucleotides to penetrate into the cells by diffusion. This approach involves the formation of transitory pores in the membrane, induced either chemically by streptolysin permeabilization, mechanically by microinjection or scrape loading, or produced by electroporation.
  • compositions in accordance with the invention can be formulated in combination with another agent, e.g., another therapeutic agent or an agent that stabilizes an
  • oligonucleotide agent e.g., a protein which complexes with the oligonucleotide agent.
  • agents include, without limitation, chelators, salts, and R Ase inhibitors (e.g.,
  • Formulations for direct injection and parenteral administration are well known in the art. Such formulations may include sterile aqueous solutions which also may contain buffers, diluents and other suitable additives. For intravenous use, the total concentration of solutes should be controlled to render the preparation isotonic.
  • the oligonucleotide agents featured in the invention can include a delivery vehicle, such as liposomes, for administration to a subject, carriers and diluents and their salts, and/or can be present in pharmaceutically acceptable formulations.
  • a delivery vehicle such as liposomes
  • Methods for the delivery of nucleic acid molecules are well known in the art.
  • compositions featured in the invention can also include conventional pharmaceutical excipients and/or additives.
  • suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents.
  • Suitable additives include physiologically biocompatible buffers, additions of chelants or calcium chelate complexes, or, optionally, additions of calcium or sodium salts.
  • compositions may be packaged for use in liquid form, or can be lyophilized.
  • Preferred physiologically acceptable carrier media are water, buffered water, normal saline, 0.4% saline, 0.3% glycine, hyaluronic acid and the like.
  • compositions prepared for storage [0109]
  • oligonucleotides in a pharmaceutically acceptable carrier or diluent.
  • Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art.
  • Sustained release compositions such as those described in, for example, U.S. Patents 5,672,659 and 5,595,760.
  • immediate or sustained release compositions depends on the nature of the condition being treated. If the condition consists of an acute or over-acute disorder, treatment with an immediate release form will be preferred over a prolonged release composition. Alternatively, for certain preventative or long-term treatments, a sustained release composition may be appropriate.
  • compositions in accordance with the invention may be administered in a single dose or in multiple doses.
  • the infusion may be a single sustained dose or may be delivered by multiple infusions.
  • Injection of the agent may be directly into the tissue at or near the site of aberrant target gene expression. Multiple injections of the agent may be made into the tissue at or near the site.
  • an antisense composition may be administered at a unit dose less than about 75 mg per kg of bodyweight, or less than about 70, 60, 50, 40, 30, 20, 10, 5, 2, 1 , 0.5, 0.1 , 0.05, 0.01 , 0.005, 0.001 , or 0.0005 mg per kg of bodyweight, and less than 200 nmol of antisense composition per kg of bodyweight, or less than 1500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075, 0.00015 nmol of antisense composition per kg of bodyweight.
  • the unit dose may be administered by injection (e.g., intravenous or intramuscular, intrathecally, or directly into an organ), inhalation, or via topical application.
  • injection e.g., intravenous or intramuscular, intrathecally, or directly into an organ
  • topical application e.g., intravenous or intramuscular, intrathecally, or directly into an organ
  • One skilled in the art also may readily determine an appropriate dosage regimen for administering the antisense composition of the invention to a given subject.
  • the U6 antisense composition may be administered to the subject once, as a single injection or deposition at or near the site on unwanted target nucleic acid expression.
  • the U6 antisense composition may be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more preferably from about seven to about ten days.
  • a dosage regimen comprises multiple administrations
  • the effective amount of U6 antisense composition administered to the subject may include the total amount of antisense composition administered over the entire dosage regimen.
  • the individual dosages may be adjusted depending on a variety of factors, including the specific U6 antisense composition being administered, the time of administration, the route of administration, the nature of the formulation, the rate of excretion, the particular disorder being treated, the severity of the disorder, the
  • oligonucleotide agent pharmacodynamics of the oligonucleotide agent, and the age, sex, weight, and general health of the patient. Variations in the necessary dosage level are to be expected in view of the differing efficiencies of the various routes of administration.
  • the unit dose may be administered less frequently than once each day, e.g., less than every 2, 4, 8 or 30 days.
  • the unit dose is not administered with a frequency ⁇ e.g., not a regular frequency).
  • the unit dose may be administered a single time. Because oligonucleotide agent-mediated up-regulation may persist for several days after administering the antisense composition, in many instances, it is possible to administer the composition with a frequency of less than once per day, or, for some instances, only once for the entire therapeutic regimen.
  • the effective dose may be administered in a single dose or in two or more doses, as desired or considered appropriate under the specific circumstances. If desired to facilitate repeated or frequent infusions, implantation of a delivery device, e.g. , a pump, semipermanent stent ⁇ e.g. , intravenous, intraperitoneal, intracisternal or intracapsular), or reservoir may be advisable. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state.
  • the concentration of the antisense composition is an amount sufficient to be effective in treating or preventing a disorder or to regulate a physiological condition in humans. The concentration or amount of antisense composition administered will depend on the parameters determined for the agent and the method of administration.
  • U6 snRNA antisense composition used for treatment may increase or decrease over the course of a particular treatment. Changes in dosage may result and become apparent from the results of diagnostic assays.
  • the subject may be monitored after administering a U6 snRNA antisense composition. Based on information from the monitoring, an additional amount of the U6 snRNA antisense composition may be administered.
  • Persons of ordinary skill may readily determine optimum dosages, dosing methodologies and repetition rates.
  • ISH in situ hybridization
  • the in situ hybridization protocol used tissue microarray slides with normal and cancer samples (from BioMax, Rockville, MD). The microarray slides were baked at 60°C for 30 minutes, soaked in Citrisolv for three times, and 10 minutes each time at room temperature as de-paraffanization process. The microarray slides were then rehydrated with ethanol/water, Proteinase K treated and fixed with 4% paraformaldeyhde. The tissue microarray slides were then pre-hybridized at probe's Tm of 21 °C for 3.5 hours and followed by hybridization with 5 ' -DIG-labeled U6 LNA probe (sequence 5 ' -
  • the "secondary” antibody was anti-DIG alkaline phosphate conjugated for 1 hour at room temperature.
  • the tissue microarrays were counterstained with Vector Red solution for 20-45 min. in dark and counter stained by Hematoxylin for 30 sec or DAPI solution for nuclear staining.
  • In situ hybridization scanning was performed by a GenePix 6.0 (Molecular Devices, Sunnyvale, CA). Each tissue microarray was scanned for the fluorescent intensity at 532 nm. Each sample on the microarray was also visually scored for intensity at from 0 to 4. The median intensity minus background at 532nm (Median F532-B532), mean intensity minus background at 532nm (Mean F532-B532), and signal/noise ratio (SNR 532) were compared with visual scoring and analyzed in JMP software for correlation (JMP, Cary, NC).
  • the rapid U6 snRNA ISH was adapted to screen tissue samples on microarray slides allowing the U6 snRNA ISH results to be compared with the expression of various proteins as determined using Alkaline Phosphatase method.
  • Example 1 The same hybridization method and analysis described in Example 1 were again employed. Baseline studies using tumor microarrays and visual scoring suggested that U6 snRNA levels were increased in tumors relative to normal tissues (FIGS. 8 (colon cancer), 10 (melanoma) and 12 (pancreatic cancer)). This was confirmed using the rapid U6 snRNA ISH/image analysis system with colon cancer, melanoma, renal cancer and lung cancer (FIGS. 9, 1 1, 14, and 15, respectively). Analysis of the results by t-Test demonstrated that there was a statistically significant difference between normal tissue of origin and these tumors. There was also a suggestion that pancreatic cancer also shows increased U6 (see FIG. 13).
  • This example also assesses the relationship between U6 snRNA expression and the level of expression of the established tumor markers Her2, the epidermal growth factor receptor ("EGFR"), and the proliferating nuclear antigen ("PCNA").
  • U6 snRNA levels were determined by the rapid U6 snRNA ISH assay described above.
  • Her2, EGFR, and PCNA levels were determined by immunohistochemistry and quantitated similarly to that of U6.
  • Immunohistochemistry Tissue microarray with normal and cancer tissues (BioMax) from colon were baked at 60 °C for 30 minutes, soaked in Citrisolv three times, and 10 minutes each time at room temperature as de-paraffanization process. The tissue microarray was then rehydrated with ethanol/water, and blocked with 10% FBS in HBSS for one hour. The tissue microarray was treated with primary antibody against EGFR, PCNA, and Her2 for one hour followed by the secondary antibody for another hour. Incubated the tissue microarray with Vector Red solution for 20-45 min. in dark and counter stained by Hematoxylin for 30 seconds.
  • IHC scanning GenePix 6.0 (Molecular Devices) was used to detect the staining intensity from each tissue sample.
  • the tissue microarray was scanned at 532 nm.
  • Each sample on the tissue microarray was also visual scored for staining intensity from 0 to 4.
  • the median intensity minus background at 532nm Median F532-B532
  • mean intensity minus background at 532nm mean intensity minus background at 532nm
  • SNR 532 signal/noise ratio
  • This example demonstrates the utility of a quantitative real-time PCR assay in the analysis of U6 snRNA levels in breast and other cancers.
  • U6_79RL/25FUb CGCAAGAACGCTTCACGAATTTGCG (SEQ ID NO: 101)
  • U6 snRNA CGCAAGAACGCTTCACGAATTTGCG (SEQ ID NO: 101)
  • the qPCR instrument was programmed to perform a brief UDG incubation immediately followed by PCR amplification.
  • the cycling program for UDG incubation were: 50 °C for 2 minutes hold, 95 °C for 2 minutes and 45 cycles of 95 °C, 10 seconds and 50 °C, 30 seconds. Data was collected for Melting Curve Analysis.
  • the cycling program for PCR amplification was: 72.0 °C for 30 seconds, 95.0 °C for minute, 55.0 °C for 1 minute and 81 cycles of 55.0 °C-95.0 °C for 10 seconds but increase set point temperature after cycle 2 by 0.5 °C. Melting curve data collection and analysis enabled. Analysis was performed using the change of Ct method to calculate relative expression. Further statistical analysis was performed in JMP.
  • U6 snRNA levels were found to be increased, relative to the corresponding normal tissue, in carcinoma of the breast, colon, kidney, liver, lung, and ovary (FIGS. 20 and 21). No increase over the corresponding normal tissue was found in prostate and thyroid carcinomas (FIG. 21).
  • This example discloses U6 snRNA antisense molecules having in vitro activity against tumor cells.
  • U6 antisense oligonucleotides were tested for cytotoxic activity against SkOV3, CHO, 293, MDA-MB-231 , PC3, MXl , and HT29 cells.
  • Lipofectamine 2000 CD was incubated for 5 minutes at room temperature (0.3ul/well) and was then added 25ul/well to the diluted oligonuceotides at 25ul/well. This lipofectamine/oligo complex was incubated for 20 minutes at room temperature. Then, lOOul of cells in the appropriate growth medium were added to the plate at a concentration of 20,000/well.
  • U6 snRNA antisense compositions based on SEQ ID NO: 10 was shown to be cytotoxic against all tumor cells tested: SKOV-3 (ovarian), PC-3 (prostate), MDA-MB- 231 (breast), HT29 (colon), MX-1 (breast) including the rapidly growing embryonic cell lines which can also grow as solid tumor in nude mice - 293 (kidney) and CHO (ovary). (FIGs. 22 and 23). SEQ ID NO: 6 and 7 did not have any significant cytoxic effect when similarly assayed. SEQ ID NO: 10 (LNA-U6-2) was not cytotoxic using an in vitro hepatocyte model system.
  • the LNA-U6-2 was more effective, having greater cytotoxic potency than U6 LNA from Exiqon (SEQ ID NO: 6). There was no significant difference observed for LNA-U6-2 (desalt) and LNA-U6-2 (HPLC) in all cell lines tested.
  • This example discloses the use of a U6 snRNA antisense composition in a tumor xenograft model system.
  • HCT-1 16 cells were implanted subcutaneously were treated once the tumor reached 100 mm .
  • the U6-36-2 U6 (SEQ ID NO: 66) antisense composition was administered at 10 mg/kg twice a week for four weeks.
  • Inactive U6 antisense and saline where used as controls There were 5-7 animals per group.
  • the equivalent mixmer was ineffective in vivo confirming the reported superiority of gapmer versus mixmer in vivo.
  • U6 snRNA antisense compositions may have in vivo antitumor activity.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne de nouvelles compositions et des méthodes exploitant la fonction biologique de l'ARNpn U6.
PCT/US2010/056186 2009-11-10 2010-11-10 Applications diagnostiques et thérapeutiques de l'arnpn u6 WO2011060040A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US25996109P 2009-11-10 2009-11-10
US61/259,961 2009-11-10

Publications (1)

Publication Number Publication Date
WO2011060040A1 true WO2011060040A1 (fr) 2011-05-19

Family

ID=43991998

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/056186 WO2011060040A1 (fr) 2009-11-10 2010-11-10 Applications diagnostiques et thérapeutiques de l'arnpn u6

Country Status (1)

Country Link
WO (1) WO2011060040A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050074788A1 (en) * 2002-12-18 2005-04-07 Dahlberg James E. Detection of small nucleic acids
US20050186212A1 (en) * 2003-08-07 2005-08-25 Janatpour Mary J. Trefoil factor 3 (TFF3) as a target for anti-cancer therapy

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050074788A1 (en) * 2002-12-18 2005-04-07 Dahlberg James E. Detection of small nucleic acids
US20050186212A1 (en) * 2003-08-07 2005-08-25 Janatpour Mary J. Trefoil factor 3 (TFF3) as a target for anti-cancer therapy

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
HANSEN ET AL.: "Expression of CPEB, GAPDH and U6snRNA in Cervical and Ovarian Tissue during Cancer Development.", APMIS., vol. 117, no. 1, January 2009 (2009-01-01), pages 53 - 59 *

Similar Documents

Publication Publication Date Title
JP7423015B2 (ja) キメラ２重鎖核酸
CA3020487C (fr) Traitement de la fibrose pulmonaire idiopathique a l'aide de complexes d'arn qui ciblent le facteur de croissance du tissu conjonctif
JP2019055995A (ja) オリゴヌクレオチドコンジュゲート
US20080199960A1 (en) Methods for the Delivery of Oligomeric Compounds
CA2917320C (fr) Arnsi specifique du gene associe a une maladie respiratoire, structure oligo-arn double helice contenant l'arnsi, composition contenant cette structure pour prevenir ou traiter un e maladie respiratoire
AU2016244027A1 (en) Oligonucleotide compounds for targeting Huntingtin mRNA
US9701962B2 (en) Hydrophobically modified antisense oligonucleotides comprising a ketal group
US20120183538A1 (en) Sparc antisense compositions and uses thereof
JP2014506789A (ja) ｍｉＲ−１２４の合成模倣体
EP3810776A1 (fr) Oligonucléotides pour moduler l'expression de scn9a
JP7154403B2 (ja) アンフィレグリン遺伝子特異的二重鎖オリゴヌクレオチド及びこれを含む線維症関連疾患及び呼吸器関連疾患の予防及び治療用組成物
KR20180104692A (ko) Angpt2 및 pdgfb를 표적화하는 rna 복합체를 사용하는 혈관신생 관련 질환의 치료
WO2022031237A1 (fr) Modulation de l'expression du transducteur de signal et activateur de transcription 3 (stat3)
JP2023053352A (ja) アンチセンスオリゴマー化合物
CN112996568A (zh) 用于调节mir-10b活性的微小rna化合物和方法
US11459563B2 (en) Treatment for NEAT1 associated disease
WO2011060040A1 (fr) Applications diagnostiques et thérapeutiques de l'arnpn u6
KR20220110723A (ko) 암 치료를 위한 TGF-β SIRNA 및 PDL1 SIRNA의 공동 전달
US11479769B2 (en) Technique for treating cancer using structurally-reinforced S-TuD
WO2016077566A1 (fr) Modulation de l'épissage de mdm2 alternatif
WO2011068865A1 (fr) Le micro-arn-101 stimule la croissance indépendante des œstrogènes et confère une résistance au tamoxifène dans des cellules cancéreuses er-positives

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10830637

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10830637

Country of ref document: EP

Kind code of ref document: A1