WO2011049343A2

WO2011049343A2 - Methods and kits for the k-ras mutant detection using pna mediated real-tim pcr clamping

Info

Publication number: WO2011049343A2
Application number: PCT/KR2010/007149
Authority: WO
Inventors: Hee Kyung Park; Jae Jin Choi; Min Hye Cho
Original assignee: Panagene Inc.
Priority date: 2009-10-19
Filing date: 2010-10-19
Publication date: 2011-04-28
Also published as: KR20110042511A; KR101819937B1; WO2011049343A3

Abstract

Provided are a method for selectively detecting K-ras mutant by using a peptide nucleic acid (PNA) probe specifically binding to codon 12 or 13 of wild-type K-ras gene, thereby suppressin amplification of the wild-type, and a kit for use in the method.

Description

Title of Invention: METHODS AND KITS FOR THE K-RAS MUTANT DETECTION USING PNA MEDIATED REAL-TIME

PCR CLAMPING

Technical Field

[ 1] The present inventioiTrelates to detection of K-ras mutant using a peptide nucleic acid (PNA) probe, and more particularly, to a method for detecting mutation at codon 12 and/or 13 of K-ras gene with high sensitivity by suppressing the amplification of wild-type using a PNA probe specifically binding to the wild-type, and a kit for use in the method.

Background Art

[2] With the findings that mutations of oncogenes and tumor suppressor genes are

involved in carcinogenesis, studies have been actively performed for the detection thereof. As a result, a various kinds of mutations associated with carcinogenesis and prognosis of drugs are being revealed. The protein p21ras encoded by K-ras gene is known to have GTPase activity and be involved in intracellular signal transduction. Mutation of K-ras gene results in functional modification of p21ras protein, thereby transmitting growth signals to nucleus more than necessary to promote growth and division of cells. K-ras mutations are mainly found as point mutations at codons 12, 13 and 61 , and predominantly detected in lung cancer, particularly in non-small cell lung carcinoma. It is reported that K-ras mutations are related to smoking history and result in poor prognosis of cancer. Also, it is reported to be frequently found in squamous cell carcinoma and large cell carcinoma [Yoon et al., J. Lung Cancer 1( 1): 55-59, 2002; Beau-Faller et al., Br. J. of Cancer 100: 985-992, 2009]. The point mutations of K-ras are found at a frequency of 80 to 100% in pancreatic carcinoma. The mutations are mostly concentrated at codon 12. The point mutations of K-ras are widely studied as markers useful for the diagnosis of non-small cell lung carcinoma, pancreatic cancer, colon cancer, or the like [Minamoto et al., Cancer Detection & Prevention 24: 1 -12, 2000; Samowitz et al., Cancer Epidemiol. Biomarkers Prev. 9: 1 193-7, 2000; Andreyev et al., Br. J. Cancer 85: 692-6, 2001 ; Brink et al., Carcinogenesis 24(8): 703-10, 2003]. The detection of K-ras mutants is an important factor to predict effectiveness of therapies targeting epidermal growth factor receptor (EGFR) [Dacic, Adv. Anat. Pathol. 15(4): 241-247, 2008; Dahse et al.. Oral Oncology 45(9): 826-829, 2009; Krypuy et al., BMC Cancer 6: 295, 2006].

[3] Various methods for detection of K-ras mutants have been employed, including

polymerase chain reaction (PCR) followed by DNA sequencing, comparison of ampli- fication product sizes of wild-type cleaved and mutant type uncleaved with a wild-type specific restriction enzyme (BstNl or Mva\) [Dieterle et al., Clin. Cancer Res.AO: 641-650, 2004], polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP) comparing electrophoretic migration of wild-type and mutant type depending on their conformations [Oh et al., The Korean Journal of Pathology. 35: 291-298, 2001], or the like. However, these methods are time-consuming, cumbersome, and not cost-effective, because they require restriction enzyme digestion, electrophoresis or DNA sequencing, following PCR. Further, considering that clinical samples frequently contain a very small quantity of mutants as compared to wild-type, it is very important to detect even a small amount of mutants. However, the aforesaid methods cannot detect a small amount of mutants due to their low sensitivity.

[4] To improve detection sensitivity, allele-specific PCR selectively amplifying mutants with mutant type-specific primers [Rhodes et al., Diagn. Mol. Pathol. 6( 1 ): 49-57, 1997], co-amplification at low denaturation temperature (COLD)-PCR selectively detecting mutants based on the critical denaturation temperature (T_c) [Zuo et al., Modern Pathol. 22: 1023-1031 , 2009], or the like have been developed. Further, Scorpion real-time allele-specific PCR (DxS^* Scorpions® and ARMS® selectively detecting mutants using Scorpion probes is employed [Cross, Pharmacogenomics 9(4): 463-467, 2008]. These techniques can be readily and rapidly applied for various diagnoses and provide a good tool for the analysis of mutations of cancer-associated genes [Bernard et al., Clinical Chemistry 48(8): 1 178- 1 185, 2002]. However, they require multiple reactions for detecting a single mutant because they use individual probe and/or individual primer set for each mutable site [Rhodes et al., Diagn. Mol. Pathol. 6(1 ): 49-57, 1997; Zuo et al., Modern Pathol. 22: 1023-1031, 2009],

[5] Recently, peptide nucleic acid (PNA) clamping technique has been developed to selectively detect mutants by suppressing the amplification of wild-type present in majority, using a PNA probe specifically binding to the wild-type. Peptide nucleic acid (PNA) is a DNA analogue whose nucleobases are linked by peptide bonds, ndt by phosphate bonds, and was first reported in 1991 [Nielsen et al., Science 254:

1497-1500, 1991]. PNA is not naturally occurring but synthesized artificially through a chemical process. PNA can hybridize with a natural nucleic acid having a complementary base sequence to form a double strand. Given the same length, a PNA/ DNA double strand is more stable than a DNA/DNA double strand, and a PNA/RNA double strand is more stable than a DNA/R A double strand. Further, PNA has a higher detectability for point mutation or SNP, because its double strand is unstablized at a larger extent from a single nucleotide mismatch, than natural nucleic acids. The peptide backbone is often composed of repeating N-(2-aminoethyl)glycine units linked by amide bonds. Such PNA has the electrically neutral backbone, differently from negatively charged natural nucleic acids. The four nucleobases of PNA occupy similar space as those of DNA, and the distance between the nucleobases is almost identical to that in natural nucleic acids. PNAs are more chemically stable than natural nucleic acids. In addition, they are more biologically stable because they are not degraded by nucleases or proteases. Since PNA is electrically neutral, the stability of the PNA/DNA and PNA/RNA double strands is not affected by the salt concentration. From such properties, PNA can recognize complementary nucleic acid sequences better than natural nucleic acids, and is applied for diagnostic or other biological or medical purposes.

[6] A typical example of the PNA clamping technique is for the detection of -ras

mutant by analyzing melting curve using a 17mer PNA probe (SEQ ID NO 41 :

CCTACGCCACCAGCTCC) specifically binding to the wild-type [US 2008/0176226 Al , Jul. 24, 2008; Chen et al., Clinical Chemistry 50(3): 481-489, 2004; Behn et al., J. Pathol. 190: 69-75, 2000; Rhodes et al., Diagn. Mol. Pathol. 6( 1): 49-57, 1997;

Dabritz et al., Br. J. Cancer 92: 405-412, 2005; Beau-Faller et al., Br. J. Cancer 100: 985-992, 2009]. However, this technique distinguishes mutants from wild type by melting curve, not by cycle number of amplification reaction, to ensure its sensitivity, so requires a donor fluorophore and an acceptor-labeled probe for detection of fluorescence to analyze melting curve. Thus, it requires a large amount of fluorophore- labeled probe for detection, so has a low cost-effectiveness.

Disclosure of Invention

Technical Problem

[7] By using a peptide nucleic acid (PNA) clamping probe ( 18-25mer) that is longer than the known 17mer probe, the present inventors have developed a method for detection of K-ras mutants using PNA-mediated real-time polymerase chain reaction (PCR) clamping, involving the detection of mutants based on the cycle number of amplification reaction, which is simpler than the prior method involving the detection of mutant based on the melting curve, and enables rapid and accurate detection of even an extremely small amount of mutants in admixture with a large amount of wild-type in high sensitivity, by completely suppressing the amplification of the wild-type.

[8] An object of the present invention is to provide a method for detection of K-ras mutants using PNA-mediated real-time PCR clamping.

[9] Another object of the present invention is to provide a kit for detection of K-ras mutants using PNA-mediated real-time PCR clamping.

Solution to Problem

[ 10] One aspect of the present invention provides a method for detection of K-ras

mutants, comprising: [1 1 ] performing real-time polymerase chain reaction (PCR) for K-ras gene in the presence of a K-ras clamping primer set and a peptide nucleic acid (PNA) clamping probe consisting of the sequence as set forth in any one of SEQ ID NOS: 1 to 36; and

[ 2] analyzing gene amplification by the real-time PCR to determine presence or absence, or concentration of the K-ras mutants.

[13] In an embodiment of the present invention, the presence or absence, or concentration of the K-ras mutants may be determined by measuring cycle threshold (C,) of the realtime PCR.

[14] As used herein, the term, 'cycle threshold' or 'C,' refers to the cycle number at which the exponential increase of the fluorophore begins to be detected during real-time PCR.

[ 15] For example, presence or absence, or concentration of mutants can be determined from AC, value, which is calculated by the following mathematical formula ( 1 ).

[ 16] Mathematical formula ( 1 )

[17] AC, = C, value of a positive control sample - C, value of an unknown sample

[18] , wherein the positive control sample is a gene perfectly matched with a PNA

clamping probe, i.e., a wild-type gene, and the unknown sample is a gene for which presence or absence, or concentration of mutants is to be detected.

[ 19] The K-ras clamping primer set may include a forward primer specifically binding to upstream region of K-ras codon 12 or 13 of wild-type. For example, the forward primer may consist of the sequence of SEQ ID NO: 37 or 38.

[20] In an embodiment of the present invention, the gene amplification may be analyzed using a DNA intercalating fluorophore. For example, the DNA intercalating fluorophore may be one or more selected from the group consisting of SYBR Green I, EvaGreen, ethidium bromide (EtBr), BEBO, YO-PRO- 1 , TO-PRO-3, LC Green, SYTO-9, SYTO- 13, SYTO-16, SYTO-60, SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO-3 and SYTOX Orange. Any fluorophore capable of intercalating with DNA may be used without particular limitation.

[21] The method according to the present invention may be applied for the diagnosis of colon cancer, pancreatic cancer, non-small cell lung carcinoma, adenocarcinoma or squamous cell carcinoma.

[22] Another aspect of the present invention provides a kit for use in the method for

detection of K-ras mutants according to the present invention, comprising one or more of PNA clamping probes of SEQ ID NOS: 1 to 36.

Advantageous Effects of Invention

[23] In accordance with the present invention, even an extremely small amount of K-ras mutants associated with carcinogenesis and prognosis of cancer can be detected within a short time with high sensitivity and specificity. Since the peptide nucleic acid (PNA) used as a probe is very stable against biological enzymes and physical factors, and the detection method is very simple and rapid, the present invention will be very useful for large-scale analysis and clinical application.

Brief Description of Drawings

[24] The above and other objects, features and advantages of the present disclosure will become apparent from the following description of certain exemplary embodiments given in conjunction with the accompanying drawings, in which:

[25] Fig. 1 schematically illustrates the principle of peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping;

[26] Fig. 2 shows real-time PCR curves showing detection sensitivity depending on the concentration of K-ras codon 12 mutant;

[27] Fig. 3 shows real-time PCR curves showing detection sensitivity depending on the concentration of K-ras codon 13 mutant;

[28] Fig. 4 shows graphs comparing detection sensitivity (AC,) of real-time PCR using

PNA probes of SEQ ID NOS: 1 to 6 according to the present invention and the prior

PNA probe depending on the concentration of mutant;

[29] Fig. 5 shows graphs comparing detection sensitivity (cycle number) of real-time PCR using a PNA probe of SEQ ID NO: 1 or 4 according to the present invention and the prior PNA probe depending on the concentration of mutant; and

[30] Fig. 6 shows graphs comparing detection sensitivity (AC,) of real-time PCR using a

PNA probe of SEQ ID NO: 1 or 4 according to the present invention and the prior

PNA probe for cell lines with K-fas mutant depending on the concentration of K-ras mutant.

Best Mode for Carrying out the Invention

[31] Hereinafter, the embodiments of the present invention will be described in detail with reference to accompanying drawings.

[32]

[33] 1. Design and manufacture of PNA clamping probe

[34] As shown in Table 1 , a peptide nucleic acid (PNA) probe according to the present invention consists of 18 or more, specifically, 18 to 25, more specifically, 19 to 23, nucleotides of the sequence perfectly matched with the sequence of the wild-type at codon 12 or 13 of K-ras gene. The PNA probe of the present invention may be designed such that the region matching with wild-type codon 12 or 1 3 of K-ras gene is located at the middle of the probe. For example, the PNA probe of the present invention may consist of the sequence as set forth in any one of SEQ ID NOS: 1 to 36. It is to be understood that any PNA probe of the sequence that could be easily derived by one skilled in the art from the above sequences are included in the scope of the present invention. Any PNA probes which have a length of 18mer or longer and are capable of effectively detecting mutation of codon 12 or 13 of K-ras gene based on the variation in amplification cycles using the PNA-mediated real-time PCR clamping according to the present invention are included in the scope of the present invention.

[35] Specifically, the PNA probes of SEQ ID NOS: 1 to 3 and 7 to 21 , perfectly matching with wild-type K-ras codon 12, thereby suppressing its amplification and detecting mutant, are designed to be specifically hybridized with nucleotides 125- 150 including codon 12 of K-ras gene. SEQ ID NOS: 4 to 6 and 22 to 36, perfectly matching with wild-type K-ras codon 13, thereby suppressing its amplification and detecting mutant, are designed to be specifically hybridized with nucleotides 127- 151 including codon 13 of K-ras gene.

[36] Table 1

[Table 1] [Table ]

25 KC13was-7 TGCCTACGCCACCAGCTCC 19

26 KC 13was-8 TTGCCTACGCCACCAGCTCC 20

27 KC 13was-9 CTTGCCTACGCCACCAGCTC 20

28 C 13 was- 10 TTGCCTACGCCACCAGCTCCA 21 ^"

29 KC 13 was- 1 1 CTTGCCTACGCCACCAGCTCC 21

30 KC 13was- 12 CTTGCCTACGCCACCAGCTCCA 22

31 KC 13was-13 TTGCCTACGCCACCAGCTCCAA 22

32 C 13was-14 CTTGCCTACGCCACCAGCTCCAA 23

33 KC13was- 15 TCTTGCCTACGCCACCAGCTCCA 24

A

34 C13was-16 CTCTTGCCTACGCCACCAGCTCC 24

A

35 C13was-17 CTCTTGCCTACGCCACCAGCTCC 25

AA^{" ·}

36 C 13was- 18 TCTTGCCTACGCCACCAGCTCCA 25 ^"

AC

[37] The result of suppressing the amplification of wild-type and detecting mutant using the probes of SEQ ID NOS: 1 to 6 shows that all the probes of SEQ ID NOS: 1 to 6 provide excellent effects. The probes of SEQ ID NO: 1 and SEQ ID NO: 4 provide particularly excellent effects (see Fig. 6).

[38] The PNA probe of the present invention may have a hydrophilic functional group(s), for example, one or more hydrophilic linkers, amino acids or amine groups, at the N- and/or C-terminal(s), to improve reaction efficiency and solubility. [Shakeel et al., J Chem Technol Biotechnol., 81 : 892-899, 2006; Gildea et al., Tetrahedron Lett., 39: 7255-7258, 1998; Demidov et al., PNAS., 99: 5953 5958, 2002; Wang et al., Anal Chem., 69: 5200-5202, 1997]. In a specific embodiment, a PNA probe having one lysine attached at the N-terminal or a PNA probe having one lysine attached at the N- terminal and one lysine attached at the C-terminal is used.

[39] The PNA oligomer used in the present invention may be synthesized from a PNA monomer protected with a benzothiazolesulfonyl (Bts) according to the method of International Publication No. WO 03/091231 A l , or from a PNA monomer protected with a 9-flourenylmethloxycarbonyl (Fmoc) or r-butoxycarbonyl (t-Boc) group

[Dueholm et al., J. Org. Chem. 59( 19): 5767-5773, 1994; Christensen J. Peptide Sci. 1(3): 175- 183, 1995; Thomson et al., Tetrahedron 51(22): 6179-6194, 1995].

[40] [41] 2. Design and manufacture of K-ras gene clamping primer set

[42] As used herein, the term, 'K-ras gene clamping primer set,' refers to a PCR primer set that suppresses the amplification of wild-type perfectly matched with the PNA probe and allows the amplification of mutant not perfectly matched, i.e., mismatched, with the PNA probe. Without being intended to be limitative, the clamping primer set of the present invention may be designed to include a region partly overlapping with the PNA clamping probe in one direction and a region to be detected in the other direction, with considering the size of PCR product, for the detection of mutant with high sensitivity and specificity. Further, each primer of the clamping primer set may be designed to have a length between 17mer and 30mer and to have a melting temperature, T_m, lower than that of the PNA probe. In order to maximize the detection sensitivity and specificity, it may be designed to include a region immediately upstream from the mutation site. For example, clamping primers of 22mer to 27mer are designed to include 9 or 10 nucleotides at the 3' region of the PNA probes of SEQ ID NO: 1 and SEQ ID NO: 4. The forward primer of SEQ ID NO: 37 as exemplified is designed to specifically recognize nucleotides 107-133 of K-ras gene as set forth in SEQ ID NO: 1 , the recognized region being located in exon 2 and upstream from codon 12 of K-ras gene. The forward primer of SEQ ID NO: 38 as exemplified is designed to specifically recognize nucleotides 1 15-136 of K-ras gene as set forth in SEQ ID NO: 4, the recognized region being located in exon 2 and upstream from codon 13 of K-ras gene. The reverse primer of SEQ ID NO: 40 which is combined with the forward primer of SEQ ID NO: 37 or 38 is designed to specifically recognize nucleotides - 17802 to - 17780 of intron 2 of K-ras gene. The primer is designed such that it has a length between 17mer and 30mer and the amplification product by the combination with the forward primer of SEQ ID NO: 37 or 38 has a size of 80 bp to 400 bp.

[43] The forward primer of SEQ ID NO: 39, which is provided to identify K-ras gene by DNA sequencing, is designed to specifically recognize nucleotides -89 to -66 of intron 1 of K-ras gene. The primer is designed such that it has a length between 17mer and 30mer and the amplification product by the combination with the reverse primer of SEQ ID NO: 40 has a size of 200 bp to 500 bp. The characteristics of each primer are summarized in Table 2.

[44] Table 2 [Table 2]

[Table ]

[46] 3. Detection of K-ras mutant using PNA-mediated real-time PCR clamping

[47] A method for detection of K-ras mutant according to the present invention

comprises:

[48] (a) performing real-time PCR for K-ras gene in the presence of a K-ras gene

clamping primer set and a PNA clamping probe; and

[49] (b) analyzing gene amplification by the real-time PCR to determine presence or absence, or concentration of the K-ras mutant.

[50] The K-ras gene used in the step (a) is extracted from a subject. The extraction

method is not particularly limited and any conventional method may be used. It may be prepared by extracting DNA from a blood or tumor sample of a patient using, for example, a commercially available DNA extraction kit.

[51] In the step (a), real-time PCR is performed to detect K-ras mutant. The real-time

PCR allows a more accurate quantitative assay and analyzes the reaction in real time since the exponential amplification of DNA can be monitored based on the cycle number at which the exponential increase of the fluorophore begins to be detected (cycle threshold, C,). This method allows rapid and simple detection by avoiding the step of performing electrophoresis and determining intensity using an image analyzer, and by providing the amplification result in an automated and quantitated manner. For example, double-stranded DNA amplified through the real-time PCR may be detected using a DNA intercalating fluorophore. By measuring the fluorescence intensity, the quantity of the amplification product may be determined. [52] In the present invention, a DNA-binding fluorophore commonly used in real-time detection of gene amplification products may be used without particular limitation. For example, SYBR Green I, EvaGreen, ethidium bromide (EtBr), BEBO, YO-PRO-1 , TO-PRO-3, LC Green, SYTO-9, SYTO- 13, SYTO-16, SYTO-60, SYTO-62, SYTO- 64, SYTO-82, POPO-3, TOTO-3, BOBO-3, SYTOX Orange, or the like may be used [Gudnason et al., Nucleic Acids Res. 35(19): e l 27, 2007; Bengtsson et al., Nucleic Acids Res. 31(8): e45, 2003; Wittwer et al., Clinical Chemistry 49(6): 853-860, 2003].

[53] In the step (b), presence or absence, or concentration of K-ras mutant is determined by analyzing gene amplification by the real-time PCR. The presence or absence of K- ras mutant may be confirmed by comparing the C, values. When a PNA probe designed to hybridize with the wild-type gene hybridizes with the wild-type gene, its amplification is suppressed and an increased C, value is obtained. In contrast, if the K- ras gene has a mutation, the PNA probe fails to hybridize with the K-ras gene, so a small C, value is obtained as a result of its amplification. By subtracting the C_t value of an unknown sample from the C, value of a positive control sample (i.e. wild-type sample), the presence or absence of mutation of each codon can be determined from the AC, value. Since the C, value becomes smaller as the quantity of the mutant gene becomes larger, a greater AC, value indicates the presence of a larger amount of mutants.

[54] The method for detection of K-ras mutant using a PNA clamping probe according to the present invention may be used to detect tumors, including colon cancer, pancreatic cancer, non-small cell lung carcinoma, adenocarcinoma, squamous cell carcinoma, or the like. In addition to tumor research, it may be very useful in studying the mechanism of the K-ras signal transduction pathway. In addition, it may be effectively utilized in the studies requiring analysis of a large quantity of samples such as population-based studies.

Mode for the Invention

[55] Hereinafter, the examples and experiments will be described. The following

examples and experiments are for illustrative purposes only and not intended to limit the scope of the present invention.

[56]

[57] Example 1 : Synthesis of PNA probes for suppressing amplification of wild-type K- ras codons 12 and 13

[58] 36 PNA probes perfectly matched with wild-type codons 12 and 13 of K-ras gene were manufactured as shown in Table 1. The probes perfectly matched with the wild- type codons of K-ras gene were designed such that a mutable site is located at the middle of each probe for effective detection. The PNA probes were synthesized according to the method disclosed in International Publication No. WO 03/091231 A l [Lee et al., Org. Lett., 9: 3291 -3293, 2007],

[59]

[60] Example 2: Extraction of DNA from wild-type and mutant cell lines for K-ras codons 12 and 13

[61] Hela (genomic DNA) human cervical cancer cells (KCLB 10002) were acquired from the Korean Cell Line Bank (KCLB, Seoul, Korea) as wild-type cell line for K-ras codons 12 and 13. The cell lines listed in Table 3 were acquired from the KCLB as mutant cell line for K-ras codons 12 and 13. The cells were cultured in a 37 °C incubator maintained at 5% carbon dioxide (C0₂) using an RPMI1640 medium (HyClone, Thermo Scientific, USA) including 10% heat-inactivated fetal bovine serum (FBS, HyClone, Thermo Scientific, USA) and lx penicillin-streptomycin (Welgene, Korea). Target DNA was extracted from the cultured cells using a LaboPass™ Tissue Mini kit (Cosmo Genetech, Korea) according to the manufacturer's instructions. The acquired DNA was quantitated using a nanodrop spectrophotometer (ND 2000C, Thermo Scientific, USA) and stored at -20 °C for later use. Total DNAs including codons 12 and 13 where K-ras mutation is concentrated isolated from the wild-type and mutant human cells were amplified using a primer set of SEQ ID NOS: 39 and 40. The amplified PCR products were purified using a LaboPass™ PCR purification kit (Cosmo Genetech, Korea) and their genotype was identified by DNA sequencing. The wild-type and mutant cells with the genotype identified were used as samples for realtime PCR using the PNA probe of the present invention.

[62] Table 3

[Table 3]

[Table ]

KCLB Exon Mutation Cell Line Origin

No.

00601 2 Gly l2Asp (G 12D) SNU-601 Gastric ulcerating tumor

10233 2 Gly.l2Ala (G 12A) SW- 1 1 16 Colon cancer

10228 2 Glyl2Val (G12V) SW-480 Colon cancer

10185 2 Gly l 2Ser (G 12S) A549 Lung cancer

21420 2 Glyl2Cys (G12C) MIA PaCa2 Pancreatic cancer

10229 2 Gly l3Asp (G 13D) LoVo Colon cancer

10002 2 Gly l2 Hela Uterine cancer

10222 2 Gly l2 Colo205 Colon cancer [63]

[64] Example 3: Synthesis of primer set for amplifying target PNA of K-ras codons 12 and 13

[65] Primers were manufactured for amplification and PCR clamping of target DNA of K- ras codons 12 and 13 by analyzing exon 2 of the K-ras gene. A primer set consisting of SEQ ID NOS: 39 and 40 for detection of the wild-type and mutant genes, a K-ras codon 12 clamping primer of SEQ ID NO: 37, and a K-ras codon 13 clamping primer of SEQ ID NO: 38 were synthesized. For the reverse primer for codons 12 and 13 clamping, the reverse primer of SEQ ID NO: 40 which was designed to identify the K- ras gene was used. The sequences of the primers are shown in Table 2. The primers were manufactured by Bioneer (Korea).

[66]

[67] Example 4: Establishment of method of real-time PCR clamping using PNA probe for wild-type K-ras codon 12 or 13

[68] Real-time PCR clamping was performed as follows using the DNA extracted in

Example 2 in order to find the optimum PNA probe by comparing various PNA probes for detecting K-ras mutant. Real-time PCR was carried out using a template DNA solution (50 ng/μί, 1 βί), one clamping sense primer ( 10 pmoles/ ^, 1 μί) and one antisense primer ( 10 pmoles/ , 1 μί) given in Table 2, one of the clamping probes (100 nM, 1 id) given in Table 1 , 2x IQ Sybr Green Supermix ( 10 μί,, Bio-Rad, USA) and distilled water (6 fd) in a real-time PCR machine (CFX96TM Real-Time PCR System, Bio-RAD, USA). The reaction was performed in 40 cycles of 3 minutes at 95 °C, 30 seconds at 95 °C, 20 seconds at 70 °C for PNA hybridization, 30 seconds at 63 °C and 30 seconds at 72 °C. Ruorescence was measured during the polymerization step at 72 °C.

[69]

[70] Example 5: Detection of K-ras mutant by real-time PCR clamping using PNA probe for wild-type K-ras codon 12 or 13

[71 ] Real-time PCR was carried out using samples containing 10 pg, 100 pg, 500 pg, 1 ng and 5 ng of K-ras mutant gene, using the real-time PCR established in Example 4.

From the relationship between the C, value and the concentration of mutant gene, the mutant detection limit was determined.

[72] The result is shown in Figs. 2 and 3. As shown in Figs. 2 and 3, the C, value is

decreased as the relative concentration of mutant gene in the solution is increased.

[73]

[74] Comparative Example 1 : Comparison with the PNA probe according to the prior art for wild-type K-ras codon 12 or 13

[75] For comparison of the PNA probe of the present invention with that disclosed in US 2008/0176226 A 1 , the PNA probe for K-ras codons 12 and 13 of wild-type according to the US patent publication was prepared as shown in Table 4.

[76] Table 4

[Table 4]

[Table ]

[77] Then, real-time PCR was performed using the probes of the US patent publication and the present invention, respectively.

[78] The result is shown in Figs. 4 to 6. As shown in Figs. 4 to 6, it was difficult to detect mutant with the probe of the US patent publication because the C, value did not show a significant variation, i.e., AC, was small, depending on the presence or concentration of the mutant. By comparison, the PNA probe according to the present invention allowed effective detection of mutant because the C, value showed a significant variation, i.e., AC, was large, in the presence of the mutant, and furthermore, the C, value was decreased in proportion to the increase of the concentration of mutant. In addition, as shown in Fig. 5, the PNA probe according to the present invention was confirmed to enable the detection of mutant in admixture with wild-type at 1 : 1000.

Sequence Listing Free Text

[79] SEQ ID Nos. 1 to 36 show the sequences of the PNA claiming probes according to the present invention;

[80] SEQ ID Nos. 37 to 40 show the sequences of the forward or reverse primer(s)

according to the present invention; and

[81 ] SEQ ID No. 41 shows the sequence of the PNA sensor probe according to the prior art.

[82] The present application contains subject matter related to Korean Patent Application No. 10-2009-0099207, filed in the Korean Intellectual Property Office on October 19, 2009, the entire contents of which is incorporated herein by reference.

[83] Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present disclosure. Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the disclosure as set forth in the appended claims.

Claims

[Claim 1 ] A method for detection of K-ras mutant, comprising:

performing real-time polymerase chain reaction (PCR) for K-ras gene in the presence of a K-ras gene clamping primer set and a peptide nucleic acid (PNA) clamping probe consisting of the sequence as set forth in any one of SEQ ID NOS: 1 to 36; and, analyzing gene amplification by the real-time PCR to determine presence or absence, or concentration of the K-ras mutant.

[Claim 2] The method of claim 1 , wherein the presence or absence, or concentration of K-ras mutant is determined by measuring cycle threshold (C) value of the real-time PCR.

[Claim 3] The method of claim 1 , wherein the K-ras gene clamping primer set comprises a forward primer specifically binding to a region upstream from wild-type K-ras codon 12 or 13.

[Claim 4] The method of claim 3, wherein the forward primer consists of the sequence of SEQ ID NO: 37 or 38.

[Claim 5] The method of claim 1 , wherein the gene amplification is analyzed using a DNA intercalating fluorophore.

[Claim 6] The method of claim 5, wherein the DNA intercalating fluorophore is one or more selected from the group consisting of SYBR Green I, EvaGreen, ethidium bromide (EtBr), BEBO, YO-PRO-l, TO-PRO-3, LC Green, SYTO-9, SYTO-13, SYTO- 16, SYTO-60, SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO-3 and SYTOX Orange.

[Claim 7] The method of claim 1 , which is applied for the diagnosis of colon cancer, pancreatic cancer, non-small cell lung carcinoma, adenocarcinoma or squamous cell carcinoma.

[Claim 8] A kit for use in the method for detection of K-ras mutant according to any one of claims 1 to 7, comprising one or more of peptide nucleic acid (PNA) clamping probes of SEQ ID NOS: 1 to 36.