WO2011048210A1 - Pdgfr-α en tant que marqueur de réponse pour le traitement avec pm00104 - Google Patents

Pdgfr-α en tant que marqueur de réponse pour le traitement avec pm00104 Download PDF

Info

Publication number
WO2011048210A1
WO2011048210A1 PCT/EP2010/065964 EP2010065964W WO2011048210A1 WO 2011048210 A1 WO2011048210 A1 WO 2011048210A1 EP 2010065964 W EP2010065964 W EP 2010065964W WO 2011048210 A1 WO2011048210 A1 WO 2011048210A1
Authority
WO
WIPO (PCT)
Prior art keywords
pdgfr
patient
levels
expression
reference value
Prior art date
Application number
PCT/EP2010/065964
Other languages
English (en)
Inventor
Amancio Carnero Moya
Victoria MONEO OCAÑA
Original Assignee
Pharma Mar, S.A.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pharma Mar, S.A. filed Critical Pharma Mar, S.A.
Publication of WO2011048210A1 publication Critical patent/WO2011048210A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4995—Pyrazines or piperazines forming part of bridged ring systems
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to the treatment of cancer by PM00104 and more specifically to the treatment of cancer in patients having tumors with certain molecular markers profile, in particular, having low PDGFR-a expression levels.
  • the invention also relates to methods for providing personalized PM00104 chemotherapy to cancer patients based on said tumor molecular markers.
  • Cancer develops when cells in a part of the body begin to grow out of control. Although there are many kinds of cancer, they all arise from out- of-control growth of abnormal cells. Cancer cells can invade nearby tissues and can spread through the bloodstream and lymphatic system to other parts of the body. In addition, cancer is invasive and tends to infiltrate the surrounding tissues and give rise to metastases. It can spread directly into surrounding tissues and also may be spread through the lymphatic and circulatory systems to other parts of the body.
  • PM00104 Zalypsis ® is a synthetic alkaloid related to jorumycin and renieramycins, and also to safracin and saframycin compounds.
  • Jorumycin is a natural compound isolated from the skin and from the mucus of the Pacific nudib ranch Jorunna funebris (Fontana A., et al. Tetrahedron (2000), 56, 7305-8).
  • the family of renieramycins is disclosed as being isolated from sponges and tunicates (James M.F. et al. J. Am. Chem. Soc. (1982), 104, 265-269; Oku N., et al.
  • PM00104 is currently in Phase II clinical development for the treatment of solid tumors and haematological malignancies. It previously demonstrated significant in vitro activity against solid and non-solid tumor cell lines as well as significant in vivo activity in several xenografted human cell lines in mice, such as breast and prostate. The reader is referred to WO 01 /87894, WO 2009/ 140675, and WO 2009/ 138509, which are incorporated herein by specific reference, for further details on PM00104 biological activity both as single agent and in combination with other agents. Preliminary insights into the mechanism of action of PM00104 suggested that the agent has DNA binding properties, induces cell cycle arrest and transcriptional inhibition (Leal et al. Biochemical pharmacology (2009), 78, 162-170).
  • an object of the present invention is to provide anticancer therapies that are useful in the treatment of cancer and to provide methods useful to predict and asses tumor drug response in individual subjects and/or allowing to choose the correct treatment regime for each patient.
  • the invention relates to a method for predicting the clinical response of a cancer patient to PM00104 chemotherapy or for designing an individual chemotherapy for a human patient suffering from cancer comprising
  • the invention relates to a screening method for selecting a human patient suffering from cancer for a treatment with PMOO 104, comprising the steps of
  • the invention relates to PM00104 for use in the treatment of cancer in a patient wherein a biological sample of said patient has a PDGFR-a expression level lower than a reference value.
  • Figure 1 Panel of low passaged human sarcoma cell lines. Tumor origin, phenotypic characteristics and doubling time.
  • FIG. 1 mRNA expression levels of pl6 INK4a , p 1 5 INK4b , pl4 ARF , p2 ici p i, p27KiPi , MSH-2, MLH-1 , Apaf-1 , p73, E-cadherin, ⁇ -catenin, APC, PTEN and P85 genes in the panel of sarcoma cell lines determined by RT- PCR. ⁇ -actin was used as a control.
  • FIG. 1 Protein levels of cyclin D l , CDK4, MDM2, p53 and ⁇ 27 ⁇ in the panel of sarcoma cell lines determined by Western-Blot, a-tubulin was used as a control.
  • Figure 4. Protein levels of pp60 src , PDGFR-a, p-C-kit and PTEN in the panel of sarcoma cell lines determined by Western-Blot, a-tubulin was used as a control.
  • Figure 5 Characterisation of the constitutive activation of the PI3K route. Cells were cultured in two different serum concentrations 10% (+) and 0.5% (-). Figure 6. A. mRNA and protein expression levels of the panel of sarcoma cell lines are shown as discrete values. B. pl4 ARF gene mRNA expression levels are shown together with the score (0 or 1) given to the different expression levels. C. PTEN protein expression levels are shown together with their respective score (0, 0.5, 1 , 2 or 3).
  • FIG. 7 Correlation between the cytotoxicity (IC50) values obtained for the assayed drugs and the biomarkers' expression in the panel of cell lines. A positive coefficient indicates that an increase in marker expression is associated with a decrease in IC50 values (i.e. increased sensitivity to the cytotoxic drug), whilst a negative coefficient indicates that an increase in the marker value is associated with an increase in IC50 values (i.e. resistance to the drug). Only statistically significant results are shown.
  • Figure 9 A. Kaplan-Meier like graph showing the proportion of cell lines having an IC50 above the X-axis value according to the cell lines marker profile: -/- (low levels or absence of PDGFR-a and low levels or absence of phosphorylated C-kit), PDGFR/- (high levels of PDGFR-a and low levels or absence of phosphorylated C-kit) and PDGFR/p-C-kit (high levels of PDGFR-a and high levels of phosphorylated C-kit).
  • -/- low levels or absence of PDGFR-a and low levels or absence of phosphorylated C-kit
  • PDGFR/- high levels of PDGFR-a and low levels or absence of phosphorylated C-kit
  • PDGFR/p-C-kit high levels of PDGFR-a and high levels of phosphorylated C-kit.
  • FIG. 10 PDGFR-a protein levels relative to a-tubulin expression. Expression of PDGFR-a was analyzed by Western Blot, quantified by densitometry and normalised with those of a- tubulin. Tumor volume (mm 3 ) after drug treatment is shown above each bar.
  • FIG. 11 Characterization by Western Blot analysis of the PDGFR- a, EGFR and p-EGFR expression levels in the cell lines used for the in vivo assay.
  • the human epithelial tumor cell lines were grown in the presence of low (0.5%) or standard (10%) percentage of serum.
  • Figure 12 In vivo response of a panel of xenografted human epithelial tumor cell lines to PM00104.
  • C control (placebo) treatment
  • Z Zalypsis® (PM00104) treatment.
  • Multivariate Cox models analysis confirmed that PM00104 resistance correlated with high levels of PDGFR-a and that the combined presence of constitutively phosphorylated C-kit increased the statistical significance of the correlation.
  • PDGFR-a was also a suitable marker of in vivo response to PM00104.
  • PDGFR-a protein expression levels were found to correlate with the in vivo sensitivity of human epithelial tumor cells to PM00104, namely, cells with low levels of PDGFR-a were more sensitive to the drug than those with high levels.
  • the invention relates to a method for predicting the clinical response of a cancer patient to PMOO 104 chemotherapy comprising
  • an expression level of PDGFR-a equal to or lower than the reference value indicates an increased likelihood of showing a positive response to the treatment with PMOO 104.
  • treating means reversing, alleviating, inhibiting the progress of, attenuating the symptoms or pathological basis of the disease, or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition.
  • treatment refers to the act of treating as “treating” is defined immediately above.
  • PMOO 104 chemotherapy refers to the treatment of a patient with PMOO 104 thereof either as a single agent or in combination with any other treatment for cancer such as radiation for localised disease and drugs that destroy cancer cells (chemotherapy) .
  • Chemotherapy plays a significant part in cancer treatment, as it is required for the treatment of advanced cancers with distant metastasis and often helpful for tumor reduction before surgery (neoadjuvant therapy). It is also used following surgery or radiation (adjuvant therapy) to destroy any remaining cancer cells or prevent recurrence of the cancer.
  • This method of the invention is suitable for the prediction of the clinical outcome of a patient.
  • the expression "clinical outcome” or “clinical response”, as used herein, relates to the determination of any parameter that can be useful in determining the evolution of a patient.
  • the prediction of the clinical response to PM00104 chemotherapy although preferred to be, need not be correct for 100% of the subjects to be diagnosed or evaluated. The term, however, requires that a statistically significant portion of subjects can be identified as having an increased probability of having a positive response.
  • Whether a subject is statistically significant can be determined without further ado by the person skilled in the art using various well known statistic evaluation tools, e.g., determination of confidence intervals, p- value determination, Student's t-test, Mann-Whitney test, etc. Details are found in Dowdy and Wearden, Statistics for Research, John Wiley & Sons, New York 1983.
  • Preferred confidence intervals are at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%.
  • the p- values are, preferably, 0.2, 0.1 or 0.05.
  • the determination of the clinical outcome can be done by using any endpoint measurements used in oncology and known to the skilled practitioner.
  • Useful endpoint parameters to describe the evolution of a disease include objective response, tumor control, progression free survival, progression free survival for longer than 6 months and median survival.
  • Objective response describes the proportion of treated people in whom a complete or partial response is observed.
  • PDGFR-a PDGF-a and PDGF- ⁇ protein tyrosine kinase receptors.
  • determination of the expression level of PDGFR-a can be carried out by determination of the PDGFR-a mRNA levels or of the PDGFR-a protein levels.
  • any suitable technique can be used including, without limitation, RT-PCR, SAGE or DNA microarrays.
  • expression levels of a given mRNA are determined by reverse transcription polymerase chain reaction (RT-PCR).
  • RT-PCR reverse transcription polymerase chain reaction
  • the determination is carried out by quantitative (q-) RT-PCR, using a 5'-nuclease assay such as TaqMan®.
  • the detection can be carried out in individual samples or in tissue microarrays.
  • an "endogenous control RNA” as used herein relates to a mRNA whose expression levels do not change or change only in limited amounts in tumor cells with respect to non-tumorigenic cells.
  • the "endogenous control RNA” is mRNA derived from housekeeping genes and which code for proteins which are constitutively expressed and carry out essential cellular functions. More than one endogenous control RNA may be used.
  • Preferred housekeeping genes for use in the present invention include ⁇ -2-microglobulin, ubiquitin, 18-S ribosomal protein, cyclophilin, GAPDH, ⁇ -tubulin and ⁇ -actin.
  • the control RNA is ⁇ -actin mRNA.
  • biological sample generally refers to a sample obtained from a biological subject, including a sample of a biological tissue or fluid origin, obtained, reached, or collected in vivo or in situ.
  • exemplary biological samples include but are not limited to cell lysate, a cell culture, a cell line, a tissue, an oral tissue, a gastrointestinal tissue, an organ, an organelle, a biological fluid, a blood sample, a serum sample, a urine sample, and a skin sample.
  • tumor cells are preferably isolated from the patient. Tumors or portions thereof are surgically resected from the patient or obtained by routine biopsy. RNA isolated from frozen or fresh samples is extracted from the cells by any of the methods typical in the art, for example, Sambrook, Fischer and Maniatis, Molecular Cloning, a laboratory manual, (2nd ed.), Cold Spring Harbor Laboratory Press, New York, (1989). Preferably, care is taken to avoid degradation of the RNA during the extraction process.
  • the expression level is determined using mRNA obtained from a formalin-fixed, paraffin-embedded tissue sample.
  • tissue samples are envisaged, such as fresh tissue from a biopsy or blood samples depending on their availability.
  • Fixed and paraffin-embedded tissue samples are preferred because they are broadly used storable or archival tissue samples in the field of oncology.
  • mRNA may be isolated from an archival pathological sample or biopsy sample which is first deparaffinized.
  • An exemplary deparaffinization method involves washing the paraffinized sample with an organic solvent, such as xylene. Deparaffmized samples can be rehydrated with an aqueous solution of a lower alcohol.
  • Western blot is based on the detection of proteins previously resolved by gel electrophoreses under denaturing conditions and immobilized on a membrane, generally nitrocellulose by the incubation with an antibody specific and a developing system (e.g. chemoluminiscent) .
  • the analysis by immunofluorescence requires the use of an antibody specific for the target protein for the analysis of the expression and subcellular localization by microscopy.
  • the cells under study are previously fixed with paraformaldehyde and permeabilised with a non-ionic detergent.
  • ELISA is based on the use of antigens or antibodies labelled with enzymes so that the conjugates formed between the target antigen and the labelled antibody results in the formation of enzymatically-active complexes.
  • the antibody-antigen complexes are immobilised on the support and thus, it can be detected by the addition of a substrate which is converted by the enzyme to a product which is detectable by, e.g. spectrophotometry or fluorometry.
  • This technique does not allow the exact localisation of the target protein or the determination of its molecular weight but allows a very specific and highly sensitive detection of the target protein in a variety of biological samples (serum, plasma, tissue homogenates, nuclear supernatants, ascites and the like).
  • the determination of PDGFR-a protein levels is carried out by Western Blot, as described in Example 1.
  • the determination of PDGFR-a protein is carried out by immunohistochemistry (IHC) analysis using thin sections of the biological sample immobilised on coated slides.
  • the sections when derived from a paraffinised tissue sample, are deparaffinised and treated so as to retrieve the antigen.
  • the detection can be carried out in individual samples or in tissue microarrays.
  • step (b) of the method of the invention comprises comparing the amount of expression of PDGFR-a in the biological sample with a reference value.
  • reference value is used to denote a laboratory value used as a reference for values/ data obtained by laboratory examinations of patients or samples collected from patients.
  • the term “reference value” can be an absolute value; a relative value; a value that has an upper and/or lower limit; a range of values; an average value; a median value; a mean value; or a value as compared to a particular control or baseline value.
  • Suitable reference values for use in the present invention include the expression levels of PDGFR-a in a tumoral or non- tumoral tissue (protein or mRNA) which may be obtained from a different subject or from the same subject.
  • the tumoral tissue will preferably be from patients suffering the same type of cancer.
  • the reference value is the median value of the expression of PDGFR-a (mRNA or protein) measured in a collection of biological samples.
  • the collection of samples from which the reference level is derived will preferably be constituted from patients suffering from the same type of cancer.
  • the collection may comprise samples from three, four, five, ten, 15, 20, 30, 40, 50 or more individuals, preferably, a statistically representative number of samples. In any case it can contain a different number of samples.
  • the expression levels of PDGFR-a are determined by measuring the levels of PDGFR-a mRNA, this is more conveniently carried out by the comparative Ct method using a housekeeping gene as an endogenous control and commercial RNA controls as calibrators or comparator.
  • the determination is carried out using one or more reference proteins.
  • Reference proteins are generally derived from housekeeping genes, are constitutively expressed and carry out essential cellular functions.
  • Preferred housekeeping proteins for use in the present invention include ⁇ -2-microglobulin, ubiquitin, 18-S ribosomal protein, cyclophilin, GAPDH, a-tubulin an d ⁇ -actin.
  • the reference protein is a-tubulin.
  • the samples can be classified in two or more groups according to its PDGFR-a protein expression level.
  • two groups "low level” and "high level” can be defined.
  • said reference protein is a housekeeping protein.
  • said reference protein is alpha-tubulin (a-tubulin) and the patient is classified in the "low level” group when PDGFR-a levels are equal or lower than 50% of those of ⁇ -tubulin and the patient is classified in the "high level” group when his PDGFR-a levels are higher than 50% of those of the ⁇ -tubulin protein.
  • a patient classified in the "low level” group will have an increased likelihood of showing a positive response after treatment with PM00104.
  • one or more "intermediate levels” can be defined.
  • the method of the invention allows the identification of patients likely to show a positive response to the treatment with PM00104 based as those showing expression levels of PDGFR-a which are equal or lower than the reference value.
  • the PDGFR-a expression level is considered to be low when the levels in a sample from the subject under study are decreased with respect to the reference value by at least 5% , by at least 10% , by at least 15% , by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, by at least 100%, by at least 1 10%, by at least 120%, by at least 130%, by at least 140% by at least 150%, or more.
  • the authors of the present invention have also observed that an increased accuracy of the prediction of the clinical outcome can be achieved by also measuring the phosphorylation status of C-kit and, in particular, the presence of constitutively phosphorylated C-kit results in a correlation with increased statistitical significance. Moreover, the authors of the present invention have also observed that cell lines showing resistance to the treatment with PM00104 and which do not show increased levels of PDGFR-a show increased levels of Epidermal Growth Factor Receptor (EGFR), suggesting that there is certain degree of cooperation between PDGFR-a and EGFR in the resistance to PM00104.
  • EGFR Epidermal Growth Factor Receptor
  • an expression level of PDGFR-a equal to or lower than the reference value and (ii) an activity level of the receptor tyrosine kinase lower than the reference value indicates an increased likelihood of showing a positive response to the treatment with PM00104.
  • receptor tyrosine kinase refers to any member of said family of receptors that regulates major cellular events, such as cell proliferation, differentiation, cell migration, adhesion and apoptosis. They are transmembrane proteins with enzymatic activity in the cytoplasmic part, catalyzing the transfer of the ⁇ -phosphate of ATP to tyrosine residues in protein substrates.
  • the RTK family includes a plethora of growth factor receptors, such as platelet-derived growth factor receptor (PDGF-R), epidermal growth factor receptor (EGF-R), the insulin growth factor receptor (IGF-R) and the receptor of stem cell factor C-kit.
  • Aberrant tyrosine kinase activity and/or tyrosine kinase overactivity is associated with the development and progress of various human cancers and hyperproliferative diseases.
  • several strategies for inhibition of aberrant tyrosine kinase activity such as antisense oligonucleotides, antigenic stimulation and small molecular inhibitors have been developed (Roussidis et al., In vivo (2002), 16(6), 459-469; Roussidis et al., Current Medicinal Chemistry (2007), 14, 735-743; and Pytel et al., Anticancer Agents Med. Chem. (2009), 9(l),66-76).
  • the receptor tyrosine kinase which activity is determined is C-kit.
  • the C-kit proto-oncogene encodes C-kit receptor, a transmembrane glycoprotein with a tyrosine kinase activity in the intracellular domain. It belongs to the same subclass as the receptors for PDGF and colony stimulating factor- 1. Its natural ligand, SCF, is a hematopoetic growth factor, which activates the receptor promoting dimerization and autophosphorylation at specific tyrosine residues.
  • SCF is a hematopoetic growth factor, which activates the receptor promoting dimerization and autophosphorylation at specific tyrosine residues.
  • C-kit signals major cellular functions, such as cell survival, proliferation, differentiation, adhesion, and chemotaxis.
  • the determination of the activity of C-kit can be carried out by any method known to the skilled person and includes an enzymatic assay for determination of C-kit tyrosine kinase activity such as the assay described in Majumder et al. (Mol. Cell Biol. (1988), 8, 4896-4903) or by determining the degree of C-kit phosphorylation wherein absence or low level of phosphorylation of C-kit is indicative of decreased receptor tyrosine kinase activity, i.e. the phosphorylation status of C-kit acts as a surrogate of C-kit activity.
  • an enzymatic assay for determination of C-kit tyrosine kinase activity such as the assay described in Majumder et al. (Mol. Cell Biol. (1988), 8, 4896-4903) or by determining the degree of C-kit phosphorylation wherein absence or low level of phosphorylation of C-kit is indicative of decreased receptor tyrosine kin
  • phosphorylation refers to the post- translational covalent addition of a phosphate group to the side chain in an amino acid within a peptide chain.
  • protein phosphorylation is mediated by a protein kinase. Regulation of proteins by phosphorylation is one of the most common modes of regulation of protein function, and is often termed "phosphoregulation". In almost all cases of phosphoregulation, the protein switches between a phosphorylated and an unphosphorylated form, and one of these two forms is the active form, while the other one is inactive.
  • Phosphorylated C-kit is the active form of the C-kit receptor.
  • tyrosine phosphorylation can be determined by using any method known to the skilled person including ELISA, Western Blot using anti-phosphotyrosine specific antibodies, mass spectrometry or immunohistochemistry.
  • phosphorylation can be determined by Western blot using phosphoamino acid-specific antibody and, more specifically, anti- phosphotyrosine antibodies on samples previously immunoprecipitated with anti-C-kit-specific antibodies.
  • the methods of the invention are suitable for predicting the clinical outcome of patients suffering from a wide variety of cancer types.
  • the invention allows to predict the clinical response to chemotherapy with PM00104 of patients suffering from varied types of cancer, including, without limitation, lung cancer, sarcoma, malignant melanoma, pleural mesothelioma, bladder carcinoma, prostate cancer, pancreas carcinoma, gastric carcinoma, ovarian cancer, hepatoma, breast cancer, colorectal cancer, kidney cancer, esophageal cancer, suprarenal cancer, parotid gland cancer, head & neck carcinoma, cervix cancer, endometrial cancer, liver cancer, mesothelioma, multiple myeloma, leukaemia, and lymphoma.
  • PDGFR-a protein or mRNA
  • the invention provides a method for designing an individual chemotherapy for a human patient suffering from cancer comprising
  • an expression level of PDGFR-a equal to or lower than the reference value indicates that the patient is to be treated with a PMOO 104- based chemotherapy.
  • the method for designing an individual chemotherapy for a patient suffering from cancer according to the invention results in the selection of a given therapy for a patient which has been analysed for the expression levels of PDGFR-a. Accordingly, for those patients having an expression level of PDGFR-a equal to or lower than the reference value, the therapy of choice will be a therapy based on the treatment with a PM00104-based chemotherapy.
  • the particulars of the different types of PM00104-based chemotherapy have been described in detail in the context of the method for predicting the clinical outcome according to the invention.
  • the method for designing an individual chemotherapy for a patient suffering from cancer involves the determination of the PDGFR-a (mRNA or protein).
  • the reference value used for determination of whether the expression levels are high or low corresponds to the expression levels of a control sample (or from a pool of samples obtained from a series of individuals essentially as described above).
  • the method for designing an individual chemotherapy for a patient suffering from cancer involves the determination of the activity of a receptor tyrosine kinase in the biological sample wherein an activity level of the receptor tyrosine kinase (RTK) lower than the reference value indicates that the patient is to be treated with a PM00104-based chemotherapy.
  • the RTK is C-kit.
  • the activity of C- kit is measured by determining the degree of phosphorylation of C-kit, being said phosphorylation determined in the tyrosine residues in C-kit. Since phosphorylation in tyrosine residues in C-kit is associated with increased activity, an increased phosphorylation is indicative of increased activity and thus, the method involves the selection of PM00104 chemotherapy in patients having an expression level of PDGFR-a equal to or lower than the reference value and an phosphorylation level in C-kit lower than the reference value.
  • the patient is classified in one of two or more groups according to his PDGFR-a protein expression level.
  • two groups "low level” and "high level” can be defined.
  • said reference protein is a housekeeping protein.
  • said reference protein is alpha-tubulin (a-tubulin) and the patient is classified in the "low level” group when PDGFR-a levels are equal or lower than 50% of those of a-tubulin and the patient is classified in the "high level” group when his PDGFR-a levels are higher than 50% of those of the a-tubulin protein.
  • a chemotherapy treatment based on PM00104 will be selected when the patient classified in the "low level” group.
  • the authors of the present invention have also observed that the personalized chemotherapy based on PM00104 can also be decided on the basis of the determination of PDGFR-a protein expression levels in combination with the phosphorylation status of C-kit.
  • the in vitro method for designing an individual chemotherapy for a human patient suffering from cancer based on the levels of PDGFR-a protein further comprises the determination of the phosphorylation status of C-kit, wherein (i) a level of PDGFR-a protein equal or lower than those of the reference protein and (ii) low levels or absence of phosphorylated C-kit will determine the selection of a chemotherapy treatment based on PM00104.
  • the determination of the expression levels of PDGFR-a protein is followed by recording the results of the determination as negative expression (0), low expression (0.5), moderate expression (1), or high expression (2). Accordingly, (i) a PDGFR-a protein expression level of (0) or (0.5) and (ii) low levels or absence of phosphorylated C-kit will determine the selection of a chemotherapy treatment based on PM00104.
  • the invention relates to a screening method for selecting a human patient suffering from cancer for a treatment with PM00104, comprising the steps of (a) determining the expression level of PDGFR-a in a biological sample of the patient before PMOO 104 chemotherapy,
  • the method for selecting a patient suffering from cancer for PM00104-based chemotherapy involves the determination of the PDGFR-a mRNA or protein levels.
  • the reference value used for determination of whether the expression levels are high or low corresponds to the expression levels of a control sample or from a pool of samples obtained from a series of individuals essentially as described above.
  • the method for selecting a patient suffering from cancer for PM00104-based chemotherapy involves the determination of the activity of a receptor tyrosine kinase in the biological sample wherein an activity level of the receptor tyrosine kinase (RTK) lower than the reference value indicates that the patient is to be treated with a PM00104-based chemotherapy.
  • RTK receptor tyrosine kinase
  • the RTK is C-kit.
  • the activity of C- kit is measured by determining the degree of phosphorylation of C-kit, being said phosphorylation determined in the tyrosine residues in C-kit. Since phosphorylation in tyrosine residues in C-kit is associated with increased activity, an increased phosphorylation is indicative of increased activity and thus, the method involves the selection of PM00104 chemotherapy in patients having an expression level of PDGFR-a equal to or lower than the reference value and an phosphorylation level in C-kit lower than the reference value.
  • the patient is classified in one of two or more groups according to his PDGFR-a protein expression level.
  • two groups "low level” and "high level” can be defined.
  • said reference protein is a housekeeping protein.
  • said reference protein is alpha-tubulin (a-tubulin) and the patient is classified in the "low level” group when PDGFR-a levels are equal or lower than 50% of those of a-tubulin and the patient is classified in the "high level” group when his PDGFR-a levels are higher than 50% of those of the ⁇ -tubulin protein.
  • a patient classified in the "low level” group will be selected for a treatment with PM00104.
  • the invention relates to a screening method for selecting a human patient suffering from cancer for a treatment with
  • step (a) determining at least the expression level of PDGFR-a protein in a biological sample of the patient before the PMOO 104 chemotherapy, b) recording the results of the determination in step (a) as negative expression (0), low expression (0.5), moderate expression (1), or high expression (2), and c) selecting said patient classified in the (0) and (0.5) groups for a chemotherapy treatment based on PM00104.
  • the screening method for selecting a human patient suffering from cancer for a treatment with PM00104 can also be decided on the basis of the determination of PDGFR-a protein expression levels in combination with the phosphorylation status of C-kit.
  • the screening method for selecting a human patient suffering from cancer for a treatment with PM00104 based on the levels of PDGFR-a protein further comprises the determination of the phosphorylation status of C-kit, wherein (i) a level of PDGFR-a protein equal or lower than those of the reference protein and (ii) low levels or absence of phosphorylated C-kit will determine the selection of said patient for a chemotherapy treatment based on PM00104.
  • the determination of the expression levels of PDGFR-a protein is followed by recording the results of the determination as negative expression (0), low expression (0.5), moderate expression (1), or high expression (2). Accordingly, (i) a PDGFR-a protein expression level of (0) or (0.5) and (ii) low levels or absence of phosphorylated C-kit will determine the selection of said patient for a chemotherapy treatment based on PM00104.
  • the methods of the invention for selecting a patient for chemotherapy based on PM00104 or for designing an individual chemotherapy based on PM00104 for a patient can be applied to patients suffering from varied types of cancer, including, without limitation, lung cancer, sarcoma, malignant melanoma, pleural mesothelioma, bladder carcinoma, prostate cancer, pancreas carcinoma, gastric carcinoma, ovarian cancer, hepatoma, breast cancer, colorectal cancer, kidney cancer, esophageal cancer, suprarenal cancer, parotid gland cancer, head & neck carcinoma, cervix cancer, endometrial cancer, liver cancer, mesothelioma, multiple myeloma, leukaemia, and lymphoma.
  • cancer including, without limitation, lung cancer, sarcoma, malignant melanoma, pleural mesothelioma, bladder carcinoma, prostate cancer, pancreas carcinoma, gastric carcinoma, ovarian cancer, hepatoma, breast
  • the methods of the invention for selecting a patient for chemotherapy based on PM00104 or for designing an individual chemotherapy based on PM00104 for a patient can also be carried out in any type of sample from the patient, such as a biopsy sample, tissue, cell or fluid (serum, saliva, semen, sputum, cerebral spinal fluid (CSF), tears, mucus, sweat, milk, brain extracts and the like).
  • sample from the patient is a tumor tissue sample.
  • a portion of normal tissue from the patient from which the tumor is obtained it is also examined.
  • the invention is directed to PM00104 for the treatment of cancer in human patients having low levels of PDGFR-a expression.
  • the invention relates to the use of PM00104 for the manufacture of a medicament for the treatment of cancer in a patient having low levels of PDGFR-a expression.
  • the invention relates to a method for the treatment of cancer in human patients having low levels of PDGFR-a expression comprising the administration of PM00104.
  • low levels of PDGFR-a expression refers to the levels of expression in a biological sample isolated from a patient when compared with a reference sample. Suitable biological samples for the determination of the PDGFR-a expression and suitable reference values have been described in detail with respect of the methods for selecting an individualised chemotherapy of the invention.
  • the determination of PDGFR-a expression can be carried by determination of the PDGFR-a mRNA levels or of the PDGFR-a protein levels.
  • the values for "low” or “high” levels of PDGFR-a expression are determined by comparison with the expression levels of at least a reference protein in the sample.
  • said reference protein is a housekeeping protein.
  • said reference protein is alpha-tubulin (a-tubulin), and accordingly, "low" levels of PDGFR-a expression correspond to those when PDGFR-a expression levels are equal or lower than 50% of those of the a-tubulin protein and "high" levels of PDGFR-a expression correspond to those when PDGFR-a expression levels are higher than 50% of those of the ⁇ -tubulin protein. If desired, one or more “intermediate levels" can be defined.
  • PDGRF-a protein expression levels can be determined as discrete values. Accordingly, in a further aspect, the invention relates to a use of PMOO 104 in the treatment of a cancer patient comprising
  • step b) recording the results of the determination in step a) as negative expression (0), low expression (0.5), moderate expression (1), or high expression (2), and
  • the patients to be treated with PM00104 are those having low levels of PDGFR-a mRNA or PDGFR-a protein and presenting C-kit in a non-phosphorylated status.
  • the invention also provides methods of treatment based on the levels of PDGFR-a, as PDGFR-a protein or as PDGFR-a mRNA.
  • the invention is directed to a method for treating a human cancer patient with PM00104, wherein said patient has low levels of PDGFR-a expression, in terms of mRNA expression or in terms of protein expression.
  • the patients also present C-kit in a non-phosphorylated status.
  • mRNA and protein expression levels are determined as described above for other methods of the invention.
  • PM00104 is a synthetic alkaloid related to the marine compounds jorumycin and renieramycins, and also to safracin and saframycin compounds, having the following structure:
  • PM00104 is intended here to cover any pharmaceutically acceptable salt, solvate, hydrate, prodrug, or any other compound which, upon administration to the patient is capable of providing (directly or indirectly) the compound as described herein.
  • the preparation of salts, solvates, hydrates, and prodrugs can be carried out by methods known in the art.
  • salts can be synthesized from the parent compound, which contains a basic or acidic moiety, by conventional chemical methods.
  • such salts are, for example, prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent or in a mixture of the two.
  • nonaqueous media like ether, ethyl acetate, ethanol, isopropanol or acetonitrile are preferred.
  • acid addition salts include mineral acid addition salts such as, for example, hydrochloride, hydrobromide, hydroiodide, sulphate, nitrate, phosphate, and organic acid addition salts such as, for example, acetate, trifluoroacetate, maleate, fumarate, citrate, oxalate, succinate, tartrate, malate, mandelate, methanesulphonate and p-toluenesulphonate.
  • mineral acid addition salts such as, for example, hydrochloride, hydrobromide, hydroiodide, sulphate, nitrate, phosphate
  • organic acid addition salts such as, for example, acetate, trifluoroacetate, maleate, fumarate, citrate, oxalate, succinate, tartrate, malate, mandelate, methanesulphonate and p-toluenesulphonate.
  • alkali addition salts include inorganic salts such as, for example, sodium, potassium, calcium and ammonium salts, and organic alkali salts such as, for example, ethylenediamine, ethanolamine, N,N- dialkylenethanolamine, triethanolamine and basic aminoacids salts.
  • prodrug is used in its broadest sense and encompasses those derivatives that are converted in vivo to PM00104.
  • the prodrug can hydrolyze, oxidize, or otherwise react under biological conditions to provide PM00104.
  • prodrugs include, but are not limited to, derivatives and metabolites of PM00104 that include biohydrolyzable moieties such as biohydrolyzable amides, biohydrolyzable esters, biohydrolyzable carbamates, biohydrolyzable carbonates, biohydrolyzable ureides, and biohydrolyzable phosphate analogues.
  • Prodrugs can typically be prepared using well-known methods, such as those described by Burger “Medicinal Chemistry and Drug Discovery 6th ed. (Donald J. Abraham ed., 2001 , Wiley) and “Design and Applications of Prodrugs” (H. Bundgaard ed., 1985, Harwood Academic Publishers).
  • any drug referred to herein may be in crystalline form either as free compound or as solvates (e.g. hydrates) and it is intended that both forms are within the scope of the present invention. Methods of solvation are generally known within the art.
  • PM00104 for use in accordance of the present invention may be prepared following the synthetic process disclosed in WO 01 /87894, which is incorporated herein by reference.
  • compositions of PM00104 that can be used include solutions, suspensions, emulsions, lyophilised compositions, etc., with suitable excipients for intravenous administration.
  • PM00104 may be supplied and stored as a sterile lyophilized product, comprising PM00104 and excipients in a formulation adequate for therapeutic use.
  • a formulation comprising sucrose and a phosphate salt buffered to an adequate pH is preferred.
  • PM00104 formulations is given in WO 2007/052076 which is incorporated herein by reference in its entirety.
  • Administration of PM00104 or of pharmaceutical compositions comprising the compound is preferably by intravenous infusion.
  • Infusion times of up to 72 hours can be used, more preferably between 1 and 24 hours, with either about 1 , about 3 or about 24 hours most preferred. Short infusion times which allow treatment to be carried out without an overnight stay in hospital are especially desirable. However, infusion may be around 24 hours or even longer if required.
  • the administration PM00104 is performed in cycles.
  • an intravenous infusion of PM00104 is given to the patients typically the first day of each cycle and then the patients are allowed to recover for the remainder of the cycle.
  • the preferred duration of each cycle is typically of 3 or 4 weeks; multiple cycles can be given as needed.
  • the drug is administered in a weekly basis, with a recovery period wherein the drug is not administered to the patient. Dose delays and/ or dose reductions and schedule adjustments are performed as needed depending on individual patient condition and tolerance to treatments.
  • representative schedules and dosages are for example: a) about 3.0 mg/m 2 body surface area, administered as 1-hour intravenous infusion every three weeks;
  • the correct dosage of the compound may change according to the particular formulation, the mode of application, and the particular situs, patient and tumor being treated. Other factors like age, body weight, sex, diet, time of administration, rate of excretion, condition of the patient, drug combinations, reaction sensitivities and severity of the disease shall be taken into account. Dose delays and/ or dose reductions and schedule adjustments are performed as needed depending on individual patient condition and tolerance of treatments.
  • anticancer effects of the methods of treatment of the present invention include, but are not limited to, inhibition of tumor growth, tumor growth delay, regression of tumor, shrinkage of tumor, increased time to regrowth of tumor on cessation of treatment, slowing of disease progression, and prevention of metastasis. It is expected that when a method of treatment of the present invention is administered to a patient in need of such treatment, said method of treatment will produce an effect, as measured by, for example, the extent of the anticancer effect, the response rate, the time to disease progression, or the survival rate.
  • the methods of treatment of the invention are suited for human patients, especially those who are relapsing or refractory to previous chemotherapy. First line therapy is also envisaged.
  • a panel of low-passaged tumor cell lines is of high value to gain knowledge on the molecular basis of sensitivity/ resistance to a given antitumoral compound. In particular, keeping the cell lines low passaged avoid undesired alterations occurring as a consequence of genomic instability of the tumor.
  • a panel of low passaged tumor cell lines was generated from chemonaive sarcoma patients as described in Moneo et al. (Journal of Cellular Biochemistry (2007), 100, 399-348) and in Moneo et al. (Mol. Cancer Ther. (2007), 6(4), 1310-1316).
  • Molecular characterisation of the cell lines in the panel ( Figure 1) was performed by determining the expression levels (mRNA or protein) of several biomarkers which often are found altered in cancer disease.
  • mRNA analysis RT-PCR
  • the expression levels of 14 genes which mRNA levels are often altered in human tumors were determined by Reverse Transcription- Polymerase Chain Reaction (RT-PCR).
  • the genes under study were p l 6 INK4a , p l 5 INK4b , p l 4ARF, p 21CIPI, p 27KIPI, MSH-2, MLH-1 , Apaf-1 , p73, E-cadherin, ⁇ -catenin, APC, PTEN and P85.
  • ⁇ -actin was used as a control.
  • Ooligo - ACAATAGCTTATCAATATTACCTT Tm 60
  • Protein expression levels of the following molecular markers were determined by Western blot analysis: cyclin D l , Cyclin-dependent kinase 4 (CDK4), MDM2, p53, ⁇ 27 ⁇ , pp60src, Platelet-derived growth factor receptor (PDGFR-a), PTEN, AKT and phosphorylated AKT (p-AKT).
  • the determination of phosphorylated C-kit (p-C-kit) levels was carried out by Western Blot after immunoprecipitation.
  • Samples were diluted in a sample buffer (Tris-HCl 62.5 mN pH 6.8 (Sigma), glycerol 10% (Sigma), SDS 1% (Merck), 2-mercaptoethanol 5% (Sigma), bromophenol blue 0.0025% (Sigma)) and were denatured for 5 minutes at 95°C. Proteins were separated on 7.5% SDS-PAGE gels in a electrophoresis buffer (5x: TrisHCl 0.13M (Sigma), glycine 0.95M (Sigma), SDS 0.5%). Then, proteins were transferred onto Immobilon-P membrane (Millipore) using Mini trans-Blot Electrophoretic transfer Cell (Biorad). Transfer was carried out according to the manufacturer's protocol.
  • the membranes were blocked by being maintained 4 hours under agitation with a blocking buffer containing Tris-buffered saline (TBS) buffer, 0.1% Tween 20 (Sigma) and 1% Bovine serum albumin (BSA) (Sigma) and immunostained by using the antibodies shown in Table 2 below:
  • TBS Tris-buffered saline
  • BSA Bovine serum albumin
  • Anti-C-kit c- 19 (polyclonal; Anti-rabbit Ig ;G
  • the protein containing membranes were incubated overnight at 4°C in agitation with the appropriate dilution of primary antibody in blocking buffer. Membranes were washed (three times, 5 minutes) with TBS containing 0.1% Tween 20, and then incubated for 30 minutes at room temperature with the peroxidase conjugated secondary antibody in blocking buffer. Proteins were visualized using the Enhanced Chemiluminiscence (ECL) detection system (Amersham Pharmacia Biotech) and Kodak-X.Omat LS autoradiography film (Kodak).
  • ECL Enhanced Chemiluminiscence
  • the immunoprecipitated was washed 4 times with a washing buffer (20 mM Hepes pH 7.5 (Sigma), 150 mM NaCl (Panreac), 0.1% Triton X-100 (Sigma), 10% glycerine (Sigma), 10 mM Na 4 P207 (Sigma)) .
  • a washing buffer (20 mM Hepes pH 7.5 (Sigma), 150 mM NaCl (Panreac), 0.1% Triton X-100 (Sigma), 10% glycerine (Sigma), 10 mM Na 4 P207 (Sigma)
  • quantification of the phosphorilation status of C-kit was determined by carrying out an electrophoresis in a 7.5% SDS- PAGE gel followed by immunodetection using an anti-p-tyrosine (Santa Cruz) as the primary antibody, as described in the above section.
  • Protein expression levels of cyclin D l, CDK4, MDM2, p53 and P27 Ki p ! are shown in Figure 3 and those of pp60 src , PDGFR-a, p-C-kit and PTEN are shown in Figure 4.
  • the sensitivity and resistance profiles of the low passaged tumor cell lines of Table 1 to twelve well-known antitumor drugs were studied.
  • the drugs assayed in the sarcoma cell lines of the panel were: gemcitabine (Lilly), cisplatin (Sigma), oxaliplatin (Sigma), camptothecin (Sigma), doxorubicin (Sigma), paclitaxel (Sigma), vinblastine (Sigma), flavopiridol (Sigma), UCN-01 (Sigma), imatinib (LC Laboratories), rapamycin (Bio Mol) and LY-294002 (Sigma). Cytotoxicity assay
  • cytotoxicity of the compounds against each of the cell lines was determined by the tetrazolium colorimetric assay (MTT assay) described by Denizot and Lang (J. Immunol. Methods (1986), 89, 271-277) and Mosmann (J. Immunol. Methods (1983), 65, 55-63).
  • MTT assay tetrazolium colorimetric assay
  • the compounds were tested on 96-well trays. Cells growing in a flask were harvested just before they became confluent, counted using a haemocytometer (Coulter) and diluted down with media adjusting the concentration to the required number of cells per 0.2 ml (volume for each well). Details on the culture media used for each of the cell lines of the panel are provided in Moneo et al.
  • DMSO dimethyl sulfoxide
  • the drug concentrations assayed were as follows: imatinib and LY-294002 from 0.002 to 100 ⁇ ; UCN-01 from 0.00016 to 10 ⁇ ; rapamycin, flavopiridol, vinblastine, paclitaxel and campthotecin from 0.002 to 100 nM; gemcitabine and doxorubicin from 0.005 to 300 nM; cisplatin from 0.005 to 300 ⁇ ; and oxaliplatin from 0.00084 to 50 ⁇ .
  • Each concentration was assayed in triplicate. Two sets of control wells were left on each plate, containing either medium or medium with the same concentration of DMSO as the sample being assayed.
  • a third control was used to determine the number of cells starting the culture. Cells were exposed to the drugs for 96 hours. Then, 50 ⁇ of a freshly prepared solution of MTT (Sigma) in culture medium were added to each well at a final concentration of l mg/ml. Plaques with MTT were incubated for 5 hours at 37°C. Afterwards, medium was discarded and 50 ⁇ of DMSO were added to each well and surviving cells were quantified by measuring absorbance using a Victor 3 multilabel reader. Finally, IC50 values (the concentration of drug at which absorbance was reduced 50% with regards to the DMSO control sample) were determined. The IC50 values were calculated by adjusting the results to a sigmoid curve using the GraphPad Prism 3.0 software (GraphPad Software, Inc.).
  • the cytotoxicity data obtained with these well-known antitumor drugs together with the molecular characterisation of the sarcoma cell lines of the panel was analysed.
  • a bioinformatics algorithm was used to determine genes which correlate with the pharmacologic activity of the compound.
  • a univariable Cox method was used to analyse the relationship between IC50 values and biomarkers. It is to note that the data of the p21 CIp i , p2 7KiPi , MSH2, MLH 1 , PTEN, P85, ⁇ -Catenin, Apaf-1 and APC genes were not considered because it was found that they had constant values.
  • response to cisplatin was similar in all cell lines except one and thus, it was decided not to consider the data of this compound. Accordingly, 16 gene markers and 1 1 compounds were ultimately used for the calculations.
  • Discrete values are needed to perform the analysis by correlation analysis software. Accordingly, the presence or absence of mRNA expression for the different markers was scored as 1 or 0, meaning presence and absence, respectively.
  • the assignation of the score values to the mRNA expression levels was performed after visual analysis of the intensity of RT-PCR products in the agarose gels. Similarly, scoring values of 0, 0.5, 1 , 2 or 3 were assigned after visual determination of the protein expression levels after Western Blot analysis, according to the observed intensity. Score data of mRNA and protein expression levels is shown in Figure 6. Fifteen Cox models were obtained for each compound, one for each marker with the exception of p l 6 INK4a and p l4 ARF which had shown identical patterns. In addition, the t-test P value was also used to evaluate the statistical significance of the correlation. The results of the statistical analysis giving the correlation between the cytotoxicity values obtained for the assayed drugs and the biomarkers' expression in the panel of cell lines are shown in Figure 7.
  • flavopiridol showed a correlation with CDK4 levels, namely, those cell lines with high levels of CDK4 were more sensitive to the treatment with flavopiridol. This relationship was prior described by Lu et al., (Lu et al. Cancer Chemother. Pharmacol. (2000) 46, 293-304). In connection with paclitaxel, results are coincident with those published by other authors proposing that cells with non-functional p53 are more sensitive to paclitaxel (Kielb et al. J. Urol. (2001), 166, 482-487; and Kurschat and Mauch, Clin. Exp. Dermatol. (2000), 25, 482-489).
  • cytotoxicity IC50 values
  • the cytotoxicity assay was performed as described in Example 2. Drug concentrations from 0.002 to 100 nM and from 0.002 to 100 raM were assayed. After 96-hour exposure, cells were washed twice with phosphate buffered saline (PBS) (Sigma) before being fixed with 10% glutaraldehyde (Panreac). Cells were washed twice and fixed with crystal violet (Merck) 0.5% during 30 minutes.
  • PBS phosphate buffered saline
  • Panreac 10% glutaraldehyde
  • Example 4 Identification of biomarkers of sensitivity/ resistance to PM00104.
  • PDGFR-a protein levels and c-Kit phosphorylation status were previously determined by Western Blot as described in Example 1. These protein expression results were correlated with the IC50 values obtained after exposure to PM00104 as described in Example 3, showing that high basal expression levels of PDGFR-a protein were associated with increased resistance to the drug ( Figure 8). Furthermore, relative expression levels of PDGFR-a protein expressed as percentage of the reference protein levels (i.e. a-tubulin) for the assayed low passaged human tumor cell lines was determined. It was observed that those cells which were found to be sensitive to PM00104 had expression levels of PDGFR-a equal or lower than 50% of those of the a-tubulin protein. The only exceptions were the cell lines CNIO-BF and CNIO-BI which despite expressing low levels of the marker were quite resistant to the drug. However, as shown in Figure 8 these cell lines constitutively expressed phosphorylated c-Kit receptor.
  • the previously validated bioinformatics algorithm was used to correlate the gene markers profile of the tumor cell lines in the panel with their sensitivity/ resistance to PM00104. Accordingly, we carried out a univariate Cox model analysis to determine the relationship between IC50 cytotoxicity values and the tumor cell lines biomarkers profile. Based on the outcome of the Cox model analysis, it was evaluated how relevant each of the markers was for IC50 by using, for instance, the p-value for the likelihood-ratio test of the Cox model. Multivariate Cox models were also used to evaluate whether a better signature was obtained by the combination of several markers.
  • Example 5 Evaluation of In vivo response to PM00104 in human xenograft models
  • Example 4 we found that high levels of PDGFR-a expression determined resistance to the treatment with PM00104.
  • PDGFR-a expression was generated in order to validate PDGFR-a expression as a marker predictive of the sensitivity to the treatment with PMOO 104 in the in vivo setting. It was found that the low passaged sarcoma cells of the predictive panel did not grow exponentially when xenografted in immunosuppressed mice.
  • the following commercial cell lines were used for the in vivo assay: - UMUC-3 (ATCC CRL-1749), bladder carcinoma;
  • mice Four- to six-week-old athymic nu/nu mice (Harlan Sprague Dawley, Madison, WI, USA) were subcutaneously xenografted into their right flank with (0.5-1 ) x l O 7 cells in 0.2 ml of a mixture (50:50; v:v) of Matrigel basement membrane matrix (Beckton Dickinson) and serum-free medium. When tumors reached approximately 150 mm 3 , mice were randomly assigned into treatment or control groups.
  • EGFR Epidermal Growth Factor Receptor
  • p-EGFR phosphorylated EGFR
  • SKOV-3 was the only cell line expressing high levels of constitutively active EGF receptor ( Figure 1 1). This data indicates that there is certain degree of cooperation between PDGFR-a and EGFR in the resistance to PM00104 in the in vivo setting.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Pathology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Oncology (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Hospice & Palliative Care (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne l'utilisation de PM00104 dans le traitement du cancer chez des patients ayant des tumeurs ayant un certain profil de marqueurs moléculaires, en particulier, ayant de faibles taux d'expression de PDGFR-α. L'invention concerne en outre des procédés pour produire une chimiothérapie personnalisée avec PM00104 de patients cancéreux basée sur lesdits marqueurs moléculaires de tumeur.
PCT/EP2010/065964 2009-10-22 2010-10-22 Pdgfr-α en tant que marqueur de réponse pour le traitement avec pm00104 WO2011048210A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP09382223 2009-10-22
EP09382223.7 2009-10-22

Publications (1)

Publication Number Publication Date
WO2011048210A1 true WO2011048210A1 (fr) 2011-04-28

Family

ID=43242619

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2010/065964 WO2011048210A1 (fr) 2009-10-22 2010-10-22 Pdgfr-α en tant que marqueur de réponse pour le traitement avec pm00104

Country Status (1)

Country Link
WO (1) WO2011048210A1 (fr)

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000018233A1 (fr) 1998-09-30 2000-04-06 President And Fellows Of Harvard College Analogues synthetiques d'ecteinascidine 743
WO2001087894A1 (fr) 1999-05-14 2001-11-22 Pharma Mar, S.A. Analogues antitumoraux de et-743
WO2007052076A2 (fr) 2005-10-31 2007-05-10 Pharma Mar, S.A. Preparations
WO2008006517A2 (fr) * 2006-07-13 2008-01-17 Siemens Healthcare Diagnostics Gmbh Prédiction de réponse du cancer du sein à une chimiothérapie utilisant du taxane
WO2008109423A1 (fr) * 2007-03-02 2008-09-12 Board Of Regents, The University Of Texas System Dosage multigène pour prédire les résultats de traitement concernant un individu atteint de glioblastome
WO2008135792A1 (fr) 2007-05-04 2008-11-13 Pharma Mar S.A. Composés pm00104 utilisés en thérapie anticancéreuse
WO2009114836A1 (fr) * 2008-03-14 2009-09-17 Genomic Health, Inc. Marqueurs d’expression génique pour la prédiction de la réponse d’un patient à une chimiothérapie
WO2009138509A1 (fr) 2008-05-16 2009-11-19 Pharma Mar, S.A. Traitements du myélome multiple
WO2009140675A2 (fr) 2008-05-16 2009-11-19 Pharma Mar, S.A. Thérapie combinée comportant un alcaloïde antitumoral

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000018233A1 (fr) 1998-09-30 2000-04-06 President And Fellows Of Harvard College Analogues synthetiques d'ecteinascidine 743
WO2001087894A1 (fr) 1999-05-14 2001-11-22 Pharma Mar, S.A. Analogues antitumoraux de et-743
WO2007052076A2 (fr) 2005-10-31 2007-05-10 Pharma Mar, S.A. Preparations
WO2008006517A2 (fr) * 2006-07-13 2008-01-17 Siemens Healthcare Diagnostics Gmbh Prédiction de réponse du cancer du sein à une chimiothérapie utilisant du taxane
WO2008109423A1 (fr) * 2007-03-02 2008-09-12 Board Of Regents, The University Of Texas System Dosage multigène pour prédire les résultats de traitement concernant un individu atteint de glioblastome
WO2008135792A1 (fr) 2007-05-04 2008-11-13 Pharma Mar S.A. Composés pm00104 utilisés en thérapie anticancéreuse
WO2009114836A1 (fr) * 2008-03-14 2009-09-17 Genomic Health, Inc. Marqueurs d’expression génique pour la prédiction de la réponse d’un patient à une chimiothérapie
WO2009138509A1 (fr) 2008-05-16 2009-11-19 Pharma Mar, S.A. Traitements du myélome multiple
WO2009140675A2 (fr) 2008-05-16 2009-11-19 Pharma Mar, S.A. Thérapie combinée comportant un alcaloïde antitumoral

Non-Patent Citations (31)

* Cited by examiner, † Cited by third party
Title
"Design and Applications of Prodrugs", 1985, HARWOOD ACADEMIC PUBLISHERS
BOARD, R.; JAYSON G.C., DRUG RESISTANCE UPDATES, 2005, pages 75 - 83
BURGER: "Medicinal Chemistry and Drug Discovery", 2001, WILEY
CHARUPANT KORNVIKA ET AL: "Microarray-based transcriptional profiling of renieramycin M and jorunnamycin C, isolated from Thai marine organisms.", MARINE DRUGS 2009 LNKD- PUBMED:20098592, vol. 7, no. 4, 2009, pages 483 - 494, XP002613943, ISSN: 1660-3397 *
DENIZOT; LANG, J. IMMUNOL. METHODS, vol. 89, 1986, pages 271 - 277
DOWDY; WEARDEN: "Statistics for Research", 1983, JOHN WILEY & SONS
DUAN ZHENFENG ET AL: "Diverse cross-resistance phenotype to ET-743 and PM00104 in multi-drug resistant cell lines.", CANCER CHEMOTHERAPY AND PHARMACOLOGY MAY 2009 LNKD- PUBMED:18828019, vol. 63, no. 6, May 2009 (2009-05-01), pages 1121 - 1129, XP002613945, ISSN: 1432-0843 *
DUAN ZHENFENG ET AL: "ZNF93 increases resistance to ET-743 (Trabectedin; Yondelis) and PM00104 (Zalypsis) in human cancer cell lines.", PLOS ONE 2009 LNKD- PUBMED:19742314, vol. 4, no. 9, 2009, pages E6967, XP002613944, ISSN: 1932-6203 *
FAZEKAS DE ST GROTH ET AL., BIOCHIM BIOPHYS ACTA, vol. 14, no. 71, 1963, pages 377 - 91
FONTANA A. ET AL., TETRAHEDRON, vol. 56, 2000, pages 7305 - 8
GRIFFITHS ET AL., J. BIOL. CHEM., vol. 279, 2004, pages 46113 - 46121
HERRERO ET AL., AMERICAN ASSOCIATION FOR CANCER RESEARCH ANNUAL MEETING, no. 5733, April 2007 (2007-04-01), pages 14 - 18
ISONISHI ET AL., ONCOL. REP., vol. 18, 2007, pages 195 - 201
JAMES M.F. ET AL., J. AM. CHEM. SOC., vol. 104, 1982, pages 265 - 269
JOURNAL OF CELLULAR BIOCHEMISTRY, vol. 100, 2007, pages 399 - 348
KAUFFMANN-ZEH ET AL., NATURE, vol. 385, 1997, pages 544 - 548
KIELB ET AL., J. UROL., vol. 166, 2001, pages 482 - 487
KIM ET AL., SCIENCE, vol. 266, 2004, pages 2011 - 2015
KURSCHAT; MAUCH, CLIN. EXP. DERMATOL., vol. 25, 2000, pages 482 - 489
LEAL ET AL., BIOCHEMICAL PHARMACOLOGY, vol. 78, 2009, pages 162 - 170
LU ET AL., CANCER CHEMOTHER. PHARMACOL., vol. 46, 2000, pages 293 - 304
MAJUMDER ET AL., MOL. CELL BIOL., vol. 8, 1988, pages 4896 - 4903
MANZANARES I. ET AL., CURR. MED. CHEM. ANTI-CANCER AGENTS, vol. 1, 2001, pages 257 - 276
MONEO ET AL., JOURNAL OF CELLULAR BIOCHEMISTRY, vol. 100, 2007, pages 399 - 348
MONEO ET AL., MOL. CANCER THER., vol. 6, no. 4, 2007, pages 1310 - 1316
MOSMANN, J. IMMUNOL. METHODS, vol. 65, 1983, pages 55 - 63
OKU N. ET AL., JOURNAL NATURAL PRODUCTS, vol. 66, 2003, pages 1136 - 9
PYTEL ET AL., ANTICANCER AGENTS MED. CHEM., vol. 9, no. 1, 2009, pages 66 - 76
ROUSSIDIS ET AL., CURRENT MEDICINAL CHEMISTRY, vol. 14, 2007, pages 735 - 743
ROUSSIDIS ET AL., IN VIVO, vol. 16, no. 6, 2002, pages 459 - 469
SAMBROOK; FISCHER; MANIATIS: "Molecular Cloning, a laboratory manual", 1989, COLD SPRING HARBOR LABORATORY PRESS

Similar Documents

Publication Publication Date Title
Murugan mTOR: Role in cancer, metastasis and drug resistance
ES2734673T3 (es) Predicción de la sensibilidad farmacológica de tumores de pulmón basándose en identificaciones moleculares y genéticas
JP2020198883A (ja) 癌の分類および使用法
JP2016105096A (ja) バイオマーカー及び治療の方法
US9523691B2 (en) Use of the olfactomedin-4 protein (OLFM4) in colorectal cancer diagnosis
JP2018508183A (ja) 化学療法耐性癌を治療及び診断する組成物及び方法
JP2014503821A (ja) 抗体ベースのアレイを用いる悪性がんの療法のための薬剤選択
CA2846630A1 (fr) Polytherapies comportant des antagonistes de c-met et de b-raf
EP2510121A1 (fr) Biomarqueurs de la voie de la phosphatidylinotisol-3-kinase
US20130252950A1 (en) Targeting mtor substrates in treating proliferative diseases
US20200216906A1 (en) Methods and compositions relating to the diagnosis and treatment of cancer
TWI595879B (zh) Prediction of therapeutic effect in patients with colorectal cancer with TK1 protein hyperactivity
KR20090015947A (ko) 암의 치료를 위한 혈관 내피 성장 인자 수용체 억제제의 용도
Rivera et al. Resistance to therapy
Osei et al. A review of predictive, prognostic and diagnostic biomarkers for non-small-cell lung cancer: towards personalised and targeted cancer therapy
WO2011048210A1 (fr) Pdgfr-α en tant que marqueur de réponse pour le traitement avec pm00104
Carnero et al. PDGFR-α as response marker for PM00104 treatment
EP2409156A2 (fr) Biomarqueur de phosphorylation de la tyrosine 176 d'akt pour le cancer
Galazi ErbB activation and heterodimerisation is responsible for resistance upon PI3K-mTOR inhibition in metastatic prostate cancer
Shrestha Combination of ALK and MEK inhibitors for the treatment of ALK-positive non-small cell lung cancer
Hajdúch Identification and Characterization of Molecular Basis of Cancer Cell Drug Resistance Mechanisms towards Aurora Kinase Inhibitors CYC116 and ZM447439
KIDANI et al. activity of mtTFA through direct interaction
Lon THE ROLE OF SRC FAMILY KINASES IN THE DEVELOPMENT AND PROGRESSION OF PROSTATE CANCER
Jeffrey An evaluation of molecular changes in non-small cell lung cancer (NSCLC) cell lines with acquired resistance to NVP-BEZ235, a novel PI3K/mTOR dual inhibitor

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10768243

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10768243

Country of ref document: EP

Kind code of ref document: A1