WO2011039390A2

WO2011039390A2 - Mutants of dna polymerase mu

Info

Publication number: WO2011039390A2
Application number: PCT/ES2010/000402
Authority: WO
Inventors: Luis BLANCO DÁVILA; Raquel JUÁRES SANTOS
Original assignee: X-Pol Biotech, S.L
Priority date: 2009-10-02
Filing date: 2010-10-02
Publication date: 2011-04-07
Also published as: WO2011039390A8; WO2011039390A3; ES2364010B1; ES2364010A1

Abstract

The invention relates to mutants of DNA polymerase mu (Polμ) which have greater terminal deoxynucleotidyl transferase activity than the wild enzyme (wt) and which improve the potential thereof as a molecular tool. Said mutants can be used, inter alia, in polynucleotide labelling techniques and for joining overhangs and blunt ends.

Description

MUT BEFORE MU POLYMERASE DNA

FIELD OF THE INVENTION The present invention relates to the identification of mutants of the human mu DNA polymerase (Ροΐμ) and the uses thereof. These mutants have improved characteristics with respect to the wild version of said polymerase that improve its potential as a molecular tool. BACKGROUND OF THE INVENTION

The stability of genetic information depends not only on the reliability of replication systems but also on the existence of multiple repair systems, which correct most types of damage that occur in DNA. In addition to these repair systems, the existence of alternative enzymatic reactions that somehow counteract the effects of the former is evident, generating variability in the DNA. One of the enzymes involved in this type of processes is the terminal deoxynucleotidyl transferase (TdT) involved in the processes of generating diversity and selectively acting on those genes encoding antigen receptors {Komori et al. (1993). Science, 261, 1171-1175).

TdT is a 58 kDa enzyme that is normally only present in immature B and T lymphocytes. This enzyme catalyzes the addition of deoxynucleotides at the 3ΌΗ terminal end of the oligonucleotide chains without the need for a strand of template DNA (terminal deoxynucleotidyl transferase activity), thus generating diversity in the antigen receptors of the aforementioned immune system defense cells . This activity of TdT has allowed this polymerase to have been widely used as a molecular tool, especially in DNA mapping techniques. One of these marking techniques is the TUNEL assay, which is based on the principle that TdT incorporates labeled deoxyuridine (eg dUTP-biotin) at the 3ΌΗ ends of breaks in double and single strands of DNA. The incorporation of labeled dUTP acts as a signal that can be easily detected, for example, through fluorescence techniques. The more breaks the DNA has, the greater the resulting signal will be. This technique allows, among other applications, to identify samples that are undergoing apoptotic processes or measure the quality of a biological sample. Since the discovery of TdT, there have been few enzymes with terminal deoxynucleotidyl transferase activity found in nature and, currently, this is the only one that is marketed on a large scale (eg Roche Applied Science, Promega, Invitrogen).

In 2000, a new polymerase with terminal deoxynucleotidyl transferase activity and belonging to the X family of DNA polymerases, polymerase mu (Ροΐμ), was identified and sequenced for the first time (Domínguez et al, (2000) Embo J, 19, 1731-1742). However, although it can be said that there is a wide structural similarity between Ροΐμ and TdT, the terminal deoxynucleotidyl transferase activity of this new enzyme is comparatively much lower than that of TdT. This fact has made it impossible to enter the market as a viable alternative to TdT, with the discovery or development of new enzymes that have this activity improved or increased. To date, only the human tanteοΐμ simple mutant, R387, has a terminal deoxynucleotidyl transferase activity superior to 'wild polymerase and similar to that of TdT (María José Martín et al. Gordon Research Conference on Mutagenesis 07/20 / 2008 - 07/25/2008 at Magdalen College in Oxford. "Rate limited terminal transferase activity of human Pol μ: contribution to imprecise end-joining of non-complementary ends"). BRIEF DESCRIPTION OF THE INVENTION

The authors of the present invention have developed Ροΐμ mutants that exhibit a higher terminal deoxynucleotidyl transferase activity than the wild-type enzyme (Ροΐμ wt: UniProtKB / Swiss-Prot Q9NP87: SEQ ID NO: 17) and even that TdT itself. Specifically, the invention provides several Ροΐμ mutants with a high terminal deoxynucleotidyl transferase activity, superior to that of Ροΐμ wt, which can be used, among others, in polynucleotide or blunt end assembly techniques (End joining). Thus, in a first aspect of the present invention, Ροΐμ mutants (hereinafter, mutants of the invention) are provided which have at least about 10% more terminal deoxynucleotidyl transferase activity than Ροΐμ wt, preferably human Ροΐμ . Preferably, said activity is at least about 25%, 50%, 75%, 100%, 200%, 300%, 400%, 500% higher than that of the Ροΐμ wt. Similarly, the mutants of the invention also have a terminal deoxynucleotidyl transferase activity equal to or greater than that of the R387K mutant (hereinafter, also referred to as an R mutant), preferably said activity is at least about 10% higher and, more preferably, at least about 25%, 50%, 75%, 100%, 200%, 300% higher. These mutants in combination or individually are capable of being used as molecular tools, preferably, in any of the techniques in which TdT is used, either as substitutes for it or in combination with it.

In a second aspect of the invention there is provided a polynucleotide sequence (hereinafter, polynucleotide sequence or polynucleotide of the invention) encoding any of the mutants of the invention. Similarly, any part of the invention is also part of: i) vector comprising the polynucleotide of the invention or ii) host cell comprising the polynucleotide sequence of the invention or a vector according to the invention.

In a third aspect, the invention relates to a method for the production of the mutants of the invention that preferably comprises: i) the cultivation of a host cell according to the invention and ii) the isolation of the produced mutant.

A fourth aspect of the invention refers to the use of the mutants of the invention as a molecular tool, preferably, in all those techniques where TdT participates, either as substitutes for it or in combination with it. More specifically, the mutants of the invention in combination or individually are capable of being used in tests of: i) single-stranded (single-stranded or homopolymer) and double-stranded polynucleotide endpoints (ii) protruding or blunt ends, ii) gathering of protuberant and blunt ends, iii) mold-dependent or independent polymerization, iv) gaps or void filling (gap-filling), v) DNA breakage detection (mismatch detection; eg TUNEL), vi) mutagenesis or generation of variability, etc.

A fifth aspect of the invention provides kits comprising any of the mutants of the invention, preferably, for carrying out any of the tests referred to in the preceding paragraph. Additionally, in addition to the components necessary to launch the corresponding assay (eg buffers, primers, dNTPs, ddNTPs, markers, etc.), the kits may comprise TdT or mutants thereof. The use of such kits for the aforementioned applications, for example, in tests of: i) single-stranded (single-stranded or homopolymer) and double-stranded polynucleotide ends (protruding or blunt ends), ii) protruding ends and blunt, iii) mold-dependent or independent polymerization, iv) filling gaps or gaps (gap-filling), v) DNA break detection (mismatch detection; eg TUNEL), vi) mutagenesis or generation of variability, etc., constitutes an additional aspect of this invention

Definitions

The term "terminal deoxynucleotidyl transferase activity" or "terminal transferase activity" is defined as the ability to carry out template independent polymerization reactions, adding nucleotides to a 3ΌΗ end without being selected by any criteria of base complementarity. This activity can be measured by different tests on different types of substrates, preferably on homopolymeric single stranded DNA (see Examples 1 and 3). Throughout the description, when it is indicated that this activity is increased or improved, it implies that it is at least 10% higher than that of Ροΐμ wt, preferably that of human Ροΐμ. Preferably, said activity is at least about 25%, 50%, 75%, 100%, 200%, 300%, 400%, 500% higher than that of Ροΐμ wt, preferably that of human Ροΐμ.

The term "identity" or "percentage of identity (%)" refers to two or more sequences or sub-sequences that have in common a specific percentage of amino acids or nucleotides, when they are compared and aligned to find maximum correspondence between the two. . This parameter can be measured by sequence comparison techniques well known in the state of the art, preferably by BLAST or FASTA algorithms, using the parameters loaded by default.

The term "vector" refers to a linear or circular polynucleotide (e.g. plasmids, bacterial chromosome) comprising a polynucleotide sequence, wherein said vector is preferably adapted for amplification, replication and / or expression of said polynucleotide. In addition, these vectors may contain regions that allow the amplification, expression and / or replication of the polynucleotide to be controlled or enhanced, as well as others that facilitate or promote the excretion or capture of the polypeptides resulting from the expression of the polynucleotide.

The term "host cell" refers to a cell or group of cells (eukaryotic or prokaryotic) that contains a vector or polynucleotide according to the present invention. The term "polynucleotides" refers to both double and single stranded DNA and RNA polymers. Both polymers when in double chain form can have blunt or protruding ends. The term "nucleotides" refers to ribonucleotides, deoxyribonucleotides (dNTPs) or dideoxynucleotides (ddNTPs) that, preferably, are labeled or modified to allow their identification and / or monitoring. Preferably, nucleotide mapping is performed with fluorophores (eg Cy3, Cy5, fluorescein) or biotin. Throughout the description when nucleotides are labeled with fluorophores, they are referred to as fluorescent nucleotides.

The term "nucleotide analogs" refers to compounds or molecules that, for a specific application, behave in a similar or analogous way to a nucleotide and that do not have a particular or specific structure, although preferably their structure allows the detection of their incorporation into polynucleotides and / or stopping the polymerization reaction. Examples of these compounds can be found in other applications such as WO95 / 07920, WO2005 / 051530, WO2008 / 016909.

The term "ortholog" refers to proteins or genes encoding said proteins, with terminal transferase activity, which share at least about 40% identity with the Ροΐμ wt, preferably with the human Ροΐμ, and in successively more preferred embodiments. at least about 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%. The term "mutation" preferably refers to substitutions, insertions or deletions that occur at the level of polypeptides or polynucleotides that express said polypeptides. These mutations when they occur at the level of a single amino acid or triplet that encodes it are referred to as point. Within the point mutations can be differentiated between conservative and non-conservative, the former being understood as those that occur when an amino acid is replaced by another of similar characteristics, according to Table 1. Table 1

The expression "around", as used throughout the description, refers to the variation of between ± 5% that a given value (eg, identity or activity) may present, preferably between ± 3% and more preferably ± 1%.

The term "substantially", as used throughout the description, refers to the variation between ± 10% that a given value (eg activity) may present, preferably between ± 5% and more preferably ± one%.

The terms "fragments" or "subsequences" refer to portions of polypeptides or polynucleotides encoding said polypeptides, which maintain the increased or substantially increased terminal transferase activity.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows the terminal transferase activity of each of the mutants [μ-Κ387Κ- F389G, μ (} 275Μ, μΚ387Κ- (2275Μ, μΚ.387Κ-Οι1οορ1, μ-Ν457ϋ, μ-8458Ν and μ-Ν457ϋ-8458Ν (Example 1)], compared to that of the Ροΐμ wt and that of the commercial TdT.

Figure 2 shows the terminal transferase activity of the double mutants ^ -R387K / Q275M and μ-Ι1387ΚΛΐ: ΐύοορ1) at decreasing doses of polymerase (400 nM, 200 nM and 100 nM). Figure 3 shows the terminal transferase activity of the double mutants ^ -R387K / Q275M and μ-Ρν387Κ / Οη1οορ1) and of the simple mutants (μ-Ι1387Κ, μ-Chloopl and μ- (3275Μ and compared to that of Ροΐμ wt, with each of the 4 dNTPs separately Figure 4 shows the terminal transferase activity of the double mutants ^ -R387K / F389G, μ-ί087Κ / ς) 275Μ and μ-Κ387Κ / Οη1οορ1) and of the simple mutants ( μ-Ρν387Κ and μ-ς> 275Μ), compared to that of Ροΐμ wt, with each 4 dNTPS in the presence of Co ²⁺ as the activating metal. Figure 5 shows the results of the test performed to compare whether the double mutants

; M2 = μ-Ρ275Μ) have a mold-dependent polymerization capacity with respect to that of Ροΐμ wt. Figure 6 shows the mold dependence of the double mutants (M3 and M7) and the simple mutants (R, Ch and M2) in the context of a 1 nucleotide DNA gap with phosphate.

Figure 7 shows the results of the fluorescent derivative assay of DNA or ddNTPs, with the indicated mutants of Ροΐμ (M1-M7), together with Ροΐμ wt and TdT on single chain polynucleotides.

Figure 8 shows the results of the fluorescent derivative assay of DNA or ddNTPs, with the indicated mutants of Ροΐμ (R, Ch, M2, M3 and M7), on single chain polynucleotides.

Figure 9 shows the results of the fluorescent derivative assay of DNA or ddNTPs, with the indicated mutants of Ροΐμ (R, Ch, M2, M3 and M7), on single chain polynucleotides. Figure 10 shows the results of the fluorescent derivative assay of DNA or ddNTPs, with the indicated mutants of Ροΐμ (R, Ch, M2, M3 and M7), on single chain polynucleotides.

Figure 11 shows how the tidal reaction with M3 and M7 is highly effective with the 4 fluorescent ddNTPs, both in the presence of Mn ²⁺ and Co ²⁺ . Figure 12 shows the alignment of the ipeοΐμ wt polypeptide sequences of Mus musculus, Rattus norvegicus and Bos taurus with the M3 mutant. At the top, the arrow indicates amino acid 275 of human Ροΐμ wt. At the bottom, the arrow indicates amino acid 387 of human Ροΐμ wt.

Figure 13 shows the alignment of the human Ροΐμ wt polypeptide sequences and the TdT of human, murine and bovine origin. The arrows show the position of amino acids 275, 387, 457 and 458 in human Ροΐμ wt.

Figure 14 shows the three-dimensional structure of the human Ροΐμ wt. A) the arrow indicates the position of amino acid R387, B) the arrow indicates the position of amino acid Q275, C) the arrow indicates the position of amino acid N457 and D) the arrow indicates the position of amino acid S458.

DETAILED DESCRIPTION OF THE INVENTION

The TdT enzyme, also known as terminal deoxynucleotidyl transferase or terminal transferase, is a specialized DNA polymerase that is primarily expressed in immature B and T lymphocytes, in addition to certain types of tumors. Until the discovery of Ροΐμ in 2000 by the laboratory of Dr. Luis Blanco {Domínguez et al., (2000), cited above), TdT was the only known polymerase with the ability to add or bind nucleotides to an end 3ΌΗ of polynucleotides without requiring a template chain. However, as mentioned above, the low terminal deoxynucleotidyl transferase activity of Ροΐμ wt compared to TdT has made it impossible for this enzyme to date to become a viable alternative to TdT.

In the present invention, a series of Ροΐμ wt mutants are presented that increase the terminal deoxynucleotidyl transferase activity of wild Ροΐμ and even TdT. Preferably, said mutants are derived from or derived from human Ροΐμ wt, although they can also be obtained from the Ροΐμ of other vertebrates (orthologous rasο deμ polymerases), preferably mammals, such as Mus musculus, Rattus norvegicus, Bos taurus, among others .

Obtaining mutants, from orthologous polymerases to human Ροΐμ wt (or the gene that encodes them) and the teaching of the present invention, can be carried out simply by a person skilled in the art, as is explained in Example 12. Similarly, new mutants with increased terminal transferase activity, as with the mutants of the present invention, can also be easily obtained, as shown in Example 13. Ροΐμ mutants and polynucleotides of the invention

TdT and Ροΐμ wt are two enzymes that belong to the X family of DNA polymerase that are characterized by being small (between 39 and 66 KDa), both being generally quite inaccurate during DNA synthesis. They are distributive enzymes with little capacity to synthesize more than a few bases before dissociating from DNA. In addition to belonging to the same family and having terminal deoxynucleotidyl transferase activity, these polymerases have a BRCT domain (C-terminal domain of BRCA1), involved in the protein-protein interaction, which is not present in other members of family X like beta polymerase (Ροΐβ). When this domain is eliminated together with the rest of the amino terminus (NH2-BRCT-) and even with part of the 8 KDa domain (NH2-BRCT-KDa-) the TdT activity of these enzymes is not affected (see table 2).

The 8 KDa domain is also characteristic of the enzymes of this family, being present in both Ροΐμ wt and TdT. This domain gives these polymerases the ability to anchor the gaps that occur in the DNA, allowing them to effectively perform their biological activity. Even, the distribution of amino acids between the different domains of these two enzymes is quite similar, as can be seen in Table 2.

Despite the clear structural similarities between the two proteins, the degree of identity they share is around 40% and, therefore, they have a large number of different or non-conserved amino acids (approximately 300). By aligning and comparing sequences between TdT and Ροΐμ wt, the authors of the present invention identified and selected a group of amino acids conserved in Ροΐμ wt and TdT, but different between both enzymes. These amino acids were reversed in Ροΐμ wt towards the amino acid of TdT in order to obtain a series of single and double mutants with a potential better terminal deoxynucleotidyl transferase activity. In addition to these point mutants, another mutant was generated that included a point mutation and the substitution of the loop-1 subdomain with the same TdT subdomain (see Table 2). The assay of these mutants has offered surprising results in terms of their terminal deoxynucleotidyl transferase activity, such that the present invention provides a series of ΐοΐμ mutants that exhibit a greater terminal transferase activity than Ροΐμ wt and even that TdT itself.

Thus, in a first aspect of the present invention, the mutants of the invention have at least about 10% more terminal deoxynucleotidyl transferase activity than Ροΐμ wt, preferably human Ροΐμ wt. Preferably, said activity is at least about 25%, 50%, 75%, 100%, 200%, 300%, 400%, 500% higher than that of the Ροΐμ wt. Similarly, the mutants of the invention also have a terminal deoxynucleotidyl transferase activity equal to or greater than that of the R mutant, preferably said activity is at least about 10% higher and, more preferably, at least about 25% , 50%, 75%, 100%, 200%, 300% higher. These mutants, in combination or individually, are likely to be used as molecular tools, preferably, in any of the techniques in which TdT is used, as substitutes for it or in combination with it. In a preferred embodiment of this aspect of the invention the mutants comprise at least two mutations.

In a preferred embodiment, the Ροΐμ mutants comprise a polypeptide sequence with at least 60% identity with the sequence SEQ ID NO: 17 (Ροΐμ wt: UniProtKB / Swiss-Prot Q9NP87), or with any of its SEQ ID NO sub-sequences : 1 and SEQ Π) NO: 2, or with fragments thereof, wherein said mutants comprise at least two mutations and maintain an increased terminal transferase activity. Preferably, said mutations are (i) a first point mutation at position 387 and (ii) a second mutation consisting of:

a) a point mutation in a conserved amino acid of Ροΐμ, where preferably said point mutation consists of a reversal towards the homologous amino acid present in TdT, or

b) a mutation in the subdomain loop-1. In more preferred embodiments the degree of identity of the Ροΐμ mutants with the sequence Q9NP87, any of its sub-sequences SEQ ID NO: l and SEQ ID NO: 2, or fragments thereof is about at least 65, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

Also, preferably, the first point mutation (i) of the Ροΐμ mutants consists in replacing the amino acid found at position 387 with any of the amino acids selected from the group comprising: Glutamine, Asparagine, Cistern, Threonine, Serine, Methionine, Lysine, Arginine, Histidine or the like thereof, although even more preferably said point mutation consists of R387K substitution or reversal (non-conservative mutation).

Preferably, the second mutation (ii) corresponding to the point mutation (a) is located at position 275. Preferably, this mutation consists in replacing the amino acid found in said position (275) with any of the amino acids selected from the group comprising: Glutamine, Asparagine, Cysteine, Threonine, Serine, Methionine or the like thereof, although even more preferably said point mutation consists of the Q275M substitution (conservative mutation). In another also preferred embodiment, the second mutation (ii) consists of (b) a mutation in the loop-1 subdomain, such as the replacement or modification of the loop-1 subdomain or fragments thereof by: i) a sequence with at least about 10% identity with SEQ ID NO: 3 (loop-1 of Ροΐμ), preferably, with at least about 15%, 20%, 25%, 30%, 50%, 60%, 70% , 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or ii) by a sequence with at least about 10% identity with SEQ ID NO: 4 (loop -1 of TdT), preferably, with at least about 15%, 20%, 25%, 30%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%. In a particular embodiment, said sequence is SEQ ID NO: 4, which shares about 20% identity with SEQ ID NO: 3. More specifically, the mutants of the invention have the sequences SEQ ID NO: 5, which comprises the point mutations R387K and Q275M (hereinafter, mutant M3), or SEQ ID NO: 6, which comprises the point mutation R387K and the insertion of the loop-1 of TdT in the place of loop-1 of Ροΐμ (hereinafter, mutant M7). Similarly, the invention also comprises fragments or sub-sequences of the sequences SEQ ED NO: 5 or SEQ ID NO: 6 comprising said mutations and, preferably, substantially maintaining their increased terminal deoxynucleotidyl transferase activity. Preferably said fragments have the sequences SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10.

According to the invention, it also provides an imitant comprising a polypeptide sequence with at least 60% identity with the sequence Q9NP87 (human wοΐμ wt: SEQ ID NO: 17) and at least one point mutation at position 275, wherein said mutant has an enhanced or increased terminal deoxynucleotidyl transferase activity. This activity is at least about 10%, 25%, 50%, 75%, 100%, 200%, 300% higher than that of the Ροΐμ wt. Preferably, said mutation at position 275 consists in the substitution of the amino acid found in said position by Glutamine, Asparagine, Cysteine, Threonine, Serine, Glycine, Alanine, Valine, Leucine, Isoleucine, Methionine, Proline, Phenylalanine and Tryptophan, although even more preferably said point mutation consists in the Q275M substitution. More specifically, this mutant has the sequence SEQ ID NO: 11 (hereinafter, mutant M2) or fragments thereof that comprise the mutation at position 275 and, preferably, substantially maintain its increased terminal transferase activity. Examples of these fragments or subsequences are the sequences SEQ ID NO: 12 and SEQ ID NO: 13.

A second aspect of the invention provides a polynucleotide sequence encoding any of the walls of the invention. Likewise, they also form part of the invention: (i) a vector, comprising any of the polynucleotide sequences according to the invention, and (ii) a host cell comprising any of the polynucleotide sequences or vectors of the invention. More specifically, the polynucleotide sequence of the invention comprises any of the sequences SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16, which encode respectively for the mimics M3, M7 and M2. Also part of the invention are the sub-sequences or fragments of the polynucleotide sequence of the invention that codes for any of the sub-sequences or fragments of the mimics of the invention. All these sequences and sub-sequences can be modified by silent mutations (eg point mutations, deletions, insertions or substitutions) that have no effect on the activity of the mutant in question or do not modify its activity substantially or that, simply, due to the degeneracy of the code Genetic, do not modify its sequence and consequently its activity. Thus, any sequence with at least about 40% identity with any of SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16 that preferably does not modify are also part of the present invention. its activity or do not modify it substantially. Preferably, said identity is at least about 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%.

Production methods of Ροΐμ mutants

In order to produce the mutants of the invention, the polynucleotide sequences of the invention are preferably incorporated into a vector comprising a promoter or regulatory sequence operatively related to the sequence encoding the mutant of the invention. Thus, a third aspect of the invention also relates to a method for the production of the mutants of the invention comprising: i) the cultivation of a host cell comprising any of the polynucleotides or vectors of the invention and ii) the isolation of the mutant produced. Preferably, the cell flow is performed under conditions that promote the growth of the host cell and / or the expression of the polynucleolide of the invention. Practically any host cell that allows the expression of the polynucleolide of the invention can be used (e.g., bacteria, yeasts, etc.). Similarly, the invention also comprises the expression or production of the mutants of the invention by chemical synthesis or other cell-free expression systems ("Cell-Free Expression Systems") well known in the state of the art. Uses of the mutants Ροΐμ

A fourth aspect of the invention relates to the use of the mutants of the invention as a molecular tool, preferably, in all those techniques where TdT is used. Mutants can be used in these types of techniques, as substitutes for TdT or in combination with it. More specifically, the mutants of the invention, in combination or individually, are likely to be used preferably in: i) single-stranded polynucleotide (heteropolymer or homopolymer) and double-stranded (double-ended (bulging or blunt), ii) assembly tests protuberant and blunt ends, iii) mold-dependent or independent polymerization, iv) gaps filling (gap-filling), v) DNA break detection mismatch detection; e.g. TUNEL), vi) mutagenesis, etc.

Thus, this aspect provides a method for elongation of a target polynucleotide comprising: i) contacting a target polynucleotide with the mutant of the invention and nucleotides or nucleotide analogs (reaction mixture) and ii) subjecting the reaction mixture at conditions that favor the insertion of at least one nucleotide or nucleotide analogs at the 3ΌΗ end of the target polynucleotide. In a preferred embodiment the number of nucleotides or nucleotide analogs inserted is at least 1, 2, 3, 4 or 5 nucleotides and in successively more preferred embodiments between 1 and 20, 3 and 20, 5 and 20, 1 and 10, 3 and 10, 5 and 10. The invention also provides methods for polynucleotide mapping comprising i) contacting a target polynucleotide with the mutant of the invention and labeled nucleotides or nucleotide analogs (reaction mixture), ii) subjecting the reaction mixture at conditions that favor the insertion of at least one nucleotide or analogue thereof at the 3ΌΗ end of the target polynucleotide, and iii) detect the presence or not of insertion. In a preferred embodiment the number of nucleotides or labeled nucleotide analogs inserted is at least 1, 2, 3, 4 or 5 nucleotides and in successively more preferred embodiments between 1 and 20, 3 and 20, 5 and 20, 1 and 10 , 3 and 10, 5 and 10.

The mutants of the invention are also capable of being employed in gap filing methods or techniques comprising: i) contacting a target polynucleotide, comprising at least one gap or gap of at least one nucleotide, with the mutant of the invention and nucleotides or nucleotide analogs (reaction mixture), and ii) subjecting the reaction mixture to conditions that favor the insertion of at least one nucleotide or nucleotide analog at the 3ΌΗ end of the gap. Additionally, this method comprises iii) detecting whether or not the gap has been filled in and / or iv) the addition of enzymes (eg nucleases, ligases), which bind to nucleotides or nucleotide analogs introduced into the target polynucleotide, or Hydrolyze the target polynucleotide. In a more preferred embodiment the gap size is at least 1, 2, 3, 4 or 5 nucleotides and, more preferably, between 1 and 10 nucleotides. These reactions can be further enhanced by the presence of a phosphate group in the 5'P regions of the target polynucleotide.

Because the mutants of the invention have the ability to incorporate nucleotides independently of template, they are excellent candidates for use in end-gathering techniques, whether they are bulging or blunt. Thus, the invention also provides a method for gathering double-stranded polynucleotide ends comprising: i) contacting a double-stranded target polynucleotide with the mutant of the invention and at least two complementary nucleotides or nucleotide analogs ( reaction mixture), and ii) placing the reaction mixture under conditions that favor the introduction of a sufficient number of nucleotides or nucleotide analogs at each end of the target polynucleotide for the meeting to occur. Additionally, this method comprises iii) the addition of enzymes (eg ligases) that bind the ends once they are together. In a preferred embodiment the number of nucleotides or nucleotide analogs inserted is at least 1, 2, 3, 4 or 5 nucleotides and in successively more preferred embodiments between 1 and 20, 3 and 20, 5 and 20, 1 and 10, 3 and 10, 5 and 10. Another important application of the TdT activity is its use in the TUNEL assays (TdT-mediated dUTP-biotin nick end labeling) that allow the detection of biological samples that are undergoing apoptosis (Gavrieli, Y . et al. (1992) Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell. Biol. 119, 493.501). When apoptosis signals are triggered in the cell, a process of DNA breakage or fragmentation occurs. A polymerase with terminal deoxynucleotidyl transferase activity has the ability to introduce nucleotides or nucleotide analogs into such breaks thus making the apoptotic process visible. Thus, the present invention provides a method for the detection of apoptotic samples, preferably in their early stages. Said method comprises i) contacting a sample, containing genetic material of potentially apoptotic cells, with the mutant of the invention and at least one nucleotide or nucleotide analogue (reaction mixture), ii) subjecting the reaction mixture to conditions that favor the insertion of nucleotides or analogs thereof, and iii) detect the presence or not of insertion, preferably by fluorescence, where the detection of insertion is indicative of the presence of fragmented genetic material and, consequently, of the beginning of the apoptotic process In the sample. This same method can also be used in techniques aimed at checking the viability of a biological sample, such as sperm analysis in assisted reproduction techniques, where in the sperm with normal DNA only background fluorescence is detected, while the Sperm with fragmented DNA (multiple 3ΌΗ terminals) are stained with intense fluorescence. The fluorescence can be detected, preferably, both by flow cytometry and by fluorescent microscopy.

In any of the mentioned methods in which it is necessary to detect the presence or absence of insertion of nucleotides or analogs thereof, this detection can be done by multiple methodologies well known in the state of the art, such as fluorescence. Preferably, the samples to be labeled or detected are compared with control samples, so that the test sample is considered positive when it has at least about 5% more insertion than the control sample and in successively more preferred embodiments at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%. As mentioned above, in any of the methods described the mutants of the invention can be found in combination with TdT or mutants thereof, as a way to improve the efficiency of the techniques. Even several mutants of the invention can be combined with TdT for the same purpose. Another way to increase the efficiency of the mentioned methods comprises the addition of ions, preferably Mn ²⁺ or Co ²⁺ 'to the reaction mixtures, since these are capable of increasing the catalytic efficiency of the mutants of the invention.

Kits

A fifth aspect of the invention relates to kits that incorporate any of the mutants of the invention, preferably, to carry out any of the methods mentioned above. Additionally, in addition to the components necessary to launch the corresponding assay (eg buffers, primers, dNTPs, ddNTPs, hNTPs, nucleotide analogs, ions, etc.), the kits may also comprise TdT or mutants thereof as a way to improve the efficiency of such tests.

The use of such kits for the aforementioned applications, for example, in tests of: i) single-stranded (single-stranded or homopolymer) and double-stranded polynucleotide ends (protruding or blunt ends), ii) protruding ends and blunt, iii) mold-dependent or independent polymerization, iv) filling gaps or gaps (gap-fdling), v) DNA breakage detection {mismatch detection; e.g. TUNEL), vi) mutagenesis or generation of variability, etc., constitutes an additional aspect of this invention

EXAMPLE 1

Terminal Transferase Reaction

This assay shows the terminal transferase activity of each of the mutants, compared to the human Ροΐμ wt [SEQ ED NO: 17] and the commercial TdT of Promega (Fig. 1). The maximum extent is analyzed with each of the 4 dNTPS separately, on a 3ΌΗ end of single-chain homopolymeric DNA (PoliT). Initially, those mutants that produced a striking stimulation of the terminal transferase activity with respect to Ροΐμ wt were selected for the conduct of DNA 3-end labeling assays. Materials and methods

The fluorescent oligonucleotide used to evaluate terminal transferase activity was PoliT-Cy5 (PoliT15-CY5), which was purchased from Sigma. The dNTPs (dATP, dCTP, dGTP and dTTP) were purchased from GE Healthcare. The polymerization reactions were carried out in a volume of 10 μΐ, in the presence of 1 mM MnC ^, 50 mM TrisHCl (pH 7.5), 1 mM dithiothreitol (DTT), 4% glycerol, 0.1 mg / ml bovine serum albumin (BSA), 20 nM of the fluorescent oligonucleotide indicated in each case, 100 μΜ of the dNTP indicated in each case, and 600 nM of the protein indicated in each case, except for the commercial TdT of Promega (1 unit). After a 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 μΐ of loading buffer (95% formamide, 10 mM EDTA (ethylenediaminetetraacetic acid)). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent fluorescent signal reading using Typhoon 9410 (GE Healthcare) equipment. Results (see Figure 1)

The combined mutant R387 -F389G (MI) has greatly reduced the intrinsic terminal transferase activity of Ροΐμ wt.

The Q275M (M2) mutation alone seems to slightly stimulate the terminal transferase with respect to Ροΐμ wt.

- The changes R387K-Q275M (M3) and R387K-Chloopl (M7) are the truly spectacular ones, since they consume the entire starting substrate (which is very applicable to 3 ΌΗ end marking as it can be a near tidal efficiency 100%) and extend to large sizes (which can be applied in "tailing" reactions).

The changes N457D (M4), S458N (M5) and their combination also stimulate terminal transferase activity.

The point mutations Q275M, N457D, S458N and R387K correspond to reversals (substitutions) towards the amino acid that is conserved in TdT as can be seen in Figure 13. The first three mutations are conservative mutations, since the amino acid to which reversed belongs to the same group (see Table 1), and instead the R387K mutation is non-conservative. EXAMPLE 2

Comparative terminal transferase test between the two double mutants of the series: u-

R387K Q275M and u-R387K / Chloopl

A reaction similar to that of Example 1 was carried out, but at decreasing doses of polymerase (400 nM, 200 nM and 100 nM). At 400 nM protein, the extension of about 100% of the original starting substrate was maintained. At lower doses of protein, although terminal transferase activity remained strongly stimulated, the extent of the original starting substrate was not as effective (Figure 2).

Materials and methods

The fluorescent oligonucleotide used to evaluate terminal transferase activity was PoliT-Cy5 (PoliT15-CY5), which was purchased from Sigma. The dNTPs were purchased from GE Healthcare. The polymerization reactions were carried out in a volume of 10 μΐ, in the presence of 1 mM MnCl ₂ , 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol, 0.1 mg / ml BSA, 20 nM of the fluorescent oligonucleotide indicated in each case, 100 μΜ of the dNTP indicated in each case, and the protein dose indicated in each case. After a 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 μΐ of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent fluorescent signal reading using Typhoon 9410 (GE Healthcare).

EXAMPLE 3

Test of terminal transferase activity of double mutants (u-R387K / Q275M and u-R387K / Chloopl) compared to the simple mutants of each of them

The maximum extent is analyzed with each of the 4 dNTPS separately on a 3 extremo end of single-stranded homopolymeric DNA (Poly T). It is determined whether simple mutations alone are sufficient to stimulate terminal transferase activity to the extent that it has been proven, or the combination of several mutations is necessary to achieve the potent activity achieved in the previous tests.

Materials and methods The fluorescent oligonucleotide used to evaluate terminal transferase activity was PoliT-Cy5 (PoliT15-CY5), which was purchased from Sigma. The dNTPs were purchased from GE Healthcare. The polymerization reactions were carried out in a volume of 10 μΐ, in the presence of 1 mM MnCl ₂ , 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol, 0.1 mg / ml BSA, 20 nM of the fluorescent oligonucleotide indicated in each case, 100 μΜ of the dNTP indicated in each case, and 600 nM of the protein indicated in each case, except for the commercial TdT of Promega (1 unit). After a 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 μΐ of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent fluorescent signal reading using Typhoon 9410 (GE Healthcare) equipment.

Results (see Figure 3)

The simple mutant R387K (R) achieves an effective increase in the intrinsic terminal transferase activity of Ροΐμ wt, especially with dT and dC. However, it is far from reaching the levels reached by any of the combined mutants (M3 and M7).

The simple mutant μ-Chloopl (Ch) achieves a change in the pattern of insertion of dNTPs with respect to Ροΐμ wí, but does not imply a special call for its terminal transferase activity.

The Q275M mutant (M2) achieves a certain stimulus of terminal transferase activity compared to Ροΐμ wt.

The combination of the two mutations that make up each selected mutant (μ- R387K / Q275M and μ ^ 387Κ / 01ι1οορ1) results in spectacular levels of terminal transferase activity. Each of the simple mutations separately assumes a certain improvement over respectoοΐμ wt in this regard.

EXAMPLE 4

Test of terminal transferase activity of the double mutants (u-R387K / 0275M and n-R387K / Chloopl) in comparison with the simple mutants of each of them and in the presence of Co ²⁺ as activating metal

In this case, although the insertion pattern of dNTPs is somewhat different from that of Mn ²⁺ , and in general it is less advanced, it is evident that the double mutants ^ -R387K / Q275M and μ- R387K / Chloopl) clearly stand out with respect to simple mutants in terms of terminal transferase activity.

Materials and methods

The fluorescent oligonucleotide used to evaluate terminal transferase activity was PoliT-Cy5 (PoliT15-CY5), which was purchased from Sigma. The dNTPs were purchased from GE Healthcare. The polymerization reactions were carried out in a volume of 10 μΐ, in the presence of 100 mM of cacodylate buffer (pH 6.8), 1 mM CoCl ₂ , 0.1 mM DTT, 20 nM of the fluorescent oligonucleotide indicated in each case, 100 μΜ of the dNTP indicated in each case, and 600 nM of the protein indicated in each case, with the exception of the commercial TdT of Promega (1 unit). After a 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 μΐ of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent fluorescent signal reading using Typhoon 9410 (GE Healthcare).

Results (see Figure 4)

The combination of the two mutations that make up each selected mutant (μ- R387K / Q275M and μ-¾387Κ / Οι1οορ1) achieves spectacular levels of terminal transferase activity. Each of the simple mutations separately assumes a certain improvement over respectoοΐμ wt in this regard.

EXAMPLE 5

Mold Dependency Test

With this test it is checked if the double mutants have been affected by their ability to mold dependent polymerization with respect to Ροΐμ wt. It is convenient that this activity be maintained within certain levels, since this would allow its application in dizzying reactions with double-stranded DNA templates or with template.

Materials and methods

The fluorescent oligonucleotide SP1C-FLO (GATCACAGTGAGTAC-FLO) was hybridized with oligonucleotide TI 3 (G) (AGAAGTGTATCTGGTACTCACTGTGATC) to generate the DNA substrate indicated in the upper part of Figure 5. Both oligonucleotides were bought from Sigma. The dNTPs were purchased from GE Healthcare. The polymerization reactions were carried out in a volume of 10 μΐ, in the presence of 2.5 mM MgCl ₂ , 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol, 0.1 mg / ml BSA , 10 nM of the fluorescent DNA hybrid, the dose of dNTP / dNTPs indicated in each case, and 100 nM of the protein indicated in each case. After a 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 μΐ of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent fluorescent signal reading using Typhoon 9410 (GE Healthcare) equipment. Results

As can be seen in the left part of Figure 5, the 4 dNTPs are supplied, in order to try to verify the maximum extent that the protein can carry out on the DNA substrate indicated in the upper part. Only the simple Chloopl mutation seems to produce a small decrease in elongation, without the polymerization capacity disappearing. The M7 mutant, which contains the Chloopl mutation is also affected to the same degree. The M2 and M3 mutants even seem to improve the elongation capacity of Ροΐμ wt itself, which is very positive. A similar reaction is carried out on the right side of Figure 5, but supplying only the complementary nucleotide to the first position in the mold. The step to +1 is done very efficiently with all cases.

EXAMPLE 6

Mold Dependency Test

In this assay, mold dependence was verified with double mutants (M3 and M7) (see Figure 6) and simple mutants in the context of a 1 nucleotide DNA gap with phosphate.

Materials and methods

The fluorescent oligonucleotide SP1C-FLO (GATCACAGTGAGTAC-FLO) was hybridized with oligonucleotide TI 3 (G) (AGAAGTGTATCTGGTACTCACTGTGATC) and Dgl-P (AGATACACTTCT-P) to generate the DNA substrate indicated in the upper part of Figure 6. The oligonucleotides were purchased from Sigma. The dNTP was purchased from GE Healthcare The polymerization reactions were carried out in a volume of 10 μΐ, in the presence of 2.5 mM MgCl ₂ , 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol, 0.1 mg / ml BSA , 10 nM of the fluorescent DNA hybrid, the dose of dNTP / dNTPs indicated in each case, and 100 nM of the protein indicated in each case. After a 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 μΐ of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent fluorescent signal reading using Typhoon 9410 (GE Healthcare) equipment. Results

As can be seen in Figure 6, in this type of DNA context all mutants show similar insertion efficiency. EXAMPLE 7

3 ΌΗ End Tide Test

The complete series of mutants of Ροΐμ was tested, together with Ροΐμ wt and TdT in a 3 ma end reaction reaction of a single stranded oligonucleotide. A single chain oligonucleotide labeled with Cy5 at its 5 'end was used as a substrate for monitoring. Fluorescein-labeled ddATP (FLO) capable of being incorporated by polymerase at the 30H 'end of the DNA was supplied. The DNA channel allows to track the original DNA, and check the proportion of oligo that has been marked (position +1) against the unmarked remainder (position 0). The ddNTP channel allows you to check the entry at position +1 of the ddNTP marked with FLO.

Materials and methods

The fluorescent oligonucleotide used was: SPlC-Cy5 (GATCACAGTGAGTAC-Cy5), which was purchased from Sigma. The ddATP -Cy5 was purchased from Perkin-Elmer. The reactions were carried out in a volume of 10 μΐ, in the presence of 1 mM (η (¾ 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol and 0.1 mg / ml BSA (except the channel of TdT, which carried 100 mM of cacodylate buffer, 1 mM CoCl ₂ and 0.1 mM DTT), 10 nM of the fluorescent DNA oligo, 1 μΜ ddATP-FLO, and 600 nM of the indicated protein in each case. 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 μΐ of loading buffer (95% formamide, 10 mM EDTA) These samples were analyzed by electrophoresis in polyacrylamide gels at 20% and 8 M urea and subsequent fluorescent signal reading using a Typhoon 9410 (GE Healthcare).

Results

As can be seen in Figure 7, Ροΐμ wt is capable of marking around 50% of the oligo supplied. The mutants M4, M5 and M6 (μ-Ν457ϋ-8458Ν) have a similar behavior. The mutant MI sees its ability to mareaje very low compared to Ροΐμ wt. The mutant M2 represents an improvement over Ροΐμ wt although it does not reach 100% of the starting substrate. The M3 and M7 are capable of marking 100% of the original starting substrate, even exceeding the levels achieved with the commercial TdT of Promega.

EXAMPLE 8

3 ma end tide test

Test similar to that performed in Example 7, in which the efficacy of the M3 and M7 mutants in mareaje reactions is compared, with respect to the simple mutations that make up each of the mutants. Materials and methods

The fluorescent oligonucleotide used was: SPlC-Cy5 (GATCACAGTGAGTAC-Cy5), which was purchased from Sigma. The ddATP-Cy5 was purchased from Perkin-Elmer. The reactions were carried out in a volume of 10 μΐ, in the presence of 1 mM MnC ^, 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol and 0.1 mg / ml BSA (except the channel of TdT, which carried 100 mM of cacodylate buffer, 1 mM C0CI ₂ and 0.1 mM DTT), 10 nM of the fluorescent DNA oligo, Ι μΜ ddATP-FLO, and 600 nM of the indicated protein in each case. After a 30 minute incubation at 37 ° C, the reactions were stopped by adding 5.6 µΐ of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent fluorescent signal reading using Typhoon 9410 (GE Healthcare) equipment.

Results (see Figure 8)

The simple mutations R387 (R) and Ch-loop-1 (Ch) do not achieve any improvement over Ροΐμ wt in such reactions. The mutant M2, as already seen in Figure 7, does mean an improvement since it is capable of destroying almost the entire starting substrate, although not 100%.

M3 and M7 do not achieve 100% marking of the starting substrate.

EXAMPLE 9

3 ma end tide test

Test similar to that performed in Example 8, in which the efficacy of the M3 and M7 mutants in mareaje reactions is compared, with respect to the simple mutations that make up each of the mutants. In this case, a different single stranded DNA (PoliT) substrate is used to rule out that the result is sequence dependent.

Materials and methods The fluorescent oligonucleotide used was: PoliT-Cy5 (PoliT15-Cy5), which was purchased from Sigma. The ddATP-Cy5 was purchased from Perkin-Elmer. The reactions were carried out in a volume of 10 μΐ, in the presence of 1 mM MnCl ₂ , 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol and 0.1 mg / ml BSA (except the channel of TdT, which carried 100 mM of cacodylate buffer, 1 mM CoCl ₂ and 0.1 mM DTT), 10 nM of the fluorescent DNA oligo, 1 μΜ ddATP-FLO, and 600 nM of the indicated protein in each case. After a 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 μΐ of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent fluorescent signal reading using Typhoon 9410 (GE Healthcare) equipment. Results (see Figure 9)

The simple mutant Ch does not achieve any improvement over Ροΐμ wt in such reactions.

The mutant R in this particular case improves slightly with respect to Ροΐμ wt, which may be due to a sequence effect.

The mutant M2, as already seen in Figure 8, does mean an improvement, but it does not achieve 100% marking of the starting substrate, as it does in the cases of M3 and

M7

EXAMPLE 10

End OH 3 tide test In this test, similar to that shown in Example 9, the efficacy of the M3 and M7 mutants in mareaje reactions is compared with respect to the simple mutations that make up each of the mutants. In this case, a different single-stranded DNA (PolyA) substrate is used to contrast with the previous ones.

Materials and methods

The fluorescent oligonucleotide used was: PoliA-Cy5 (PoliA15-Cy5), which was purchased from Sigma. The ddATP-Cy5 was purchased from Perkin-Elmer. The reactions were carried out in a volume of 10 μΐ, in the presence of 1 mM MnCl ₂ , 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol and 0.1 mg / ml BSA (except the channel of TdT, which carried 100 mM of cacodylate buffer, 1 mM CoCl ₂ and 0.1 mM DTT), 10 nM of the fluorescent DNA oligo, 1 μΜ ddATP-FLO, and 600 nM of the indicated protein in each case. After a 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 μΐ of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent fluorescent signal reading using Typhoon 9410 (GE Healthcare) equipment.

Results (see Figure 10)

The simple mutants R and Ch do not achieve any improvement over Ροΐμ wt in such reactions. It seems to be confirmed that the effect of improvement with R seen in the previous figure was sequence dependent.

The mutant M2, as already seen in previous examples, does mean an improvement, but it does not achieve 100% marking of the starting substrate, as it does in cases of

M3 and M7.

EXAMPLE 11

3 ^' end mareaje test with the 4 fluorescent ddNTPs

This test shows that the reaction of M3 and M7 is highly effective with the 4 fluorescent ddNTPs, both in the presence of Mn and Co ²⁺ (Fig. 11).

Materials and methods

The fluorescent oligonucleotide used was: SPlC-Cy5 (GATCACAGTGAGTAC-Cy5), which It was bought from Sigma. Fluorescent dideoxynucleotides (ddATP-FLO, ddUTP-FLO, ddCTP-FLO, ddGTP-FLO) were purchased from Perkin-Elmer. The reactions were carried out in a volume of 10 μΐ, in the presence of 1 mM MnC, 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol and 0.1 mg / ml BSA (in the case of reactions with ImM Mn ²⁺ ) and 100 mM of cacodylate buffer, 1 mM C0CI ₂ and 0.1 mM DTT (in the case of reactions with ImM Co ²⁺ ), 10 nM of the fluorescent DNA oligo, 1 μΜ ddATP-FLO , and 600 nM of the protein indicated in each case. After a 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 μΐ of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent fluorescent signal reading using Typhoon 9410 (GE Healthcare) equipment.

EXAMPLE 12

Obtaining new homologous mutants As shown in Figure 12, the alignment by FASTA, using the parameters established by default, of the sequences corresponding to the Ροΐμ wt of different mammals, more specifically, Mus musculus, Rattus norvegicu and Bos taurus with the M3 mutant, it provides those amino acids homologous to 275 and 387 of M3 (or human Ροΐμ wt). The mutation of the homologous amino acids of the Ροΐμ wt of Mus musculus, Rattus norvegicu and Bos taurus corresponding to positions 275 and 387 of M3, would result in obtaining new mutants, which would potentially have enhanced deoxynucleotidyl transferase activity due to high degree of identity existing between the different polymerases (Table 3). As can be seen from Figure 12, homologous amino acids are not necessarily in the same position in relation to their sequence.

Table 3

EXAMPLE 13

Obtaining new mutants with increased terminal transferase activity The structural data of Ροΐμ wt used conveniently can be used to obtain new mutants with increased terminal transferase activity, by identifying and mutating amino acids that are at or near the catalytic site of the enzyme, preferably on the surface, this It is, in direct interaction with DNA. Thus, for example, the three-dimensional analysis of the polymerase structure can lead to the identification of residues that allow the creation of a salt bridge, the introduction of a hydrophobic group or the creation of any other type of interaction that allows a better interaction. with the DNA in order to obtain mutants with increased terminal transferase activity.

Certain laboratory techniques are well known for the identification of candidate amino acids, such as X-ray crystallography and nuclear magnetic resonance imaging (NMR), which make it possible to know the three-dimensional structure of proteins. In addition to this type of techniques, there are many computer programs that make it possible, based on the primary structure of the enzyme, to predict its spatial configuration (e.g. Swiss PDB Viewer). Thus, it is easy by visual inspection of the structures to determine which amino acids may be candidates for mutation. The use of these types of techniques in combination with the comparison of the primary structures of homologous enzymes and / or similar activities allows even further refinement in the selection of those mutants that are potentially going to have increased activity. As an example, the collection of all known sequences of Ροΐμ and TdT of different species, their alignment and comparison of the primary structure allows the identification of those amino acids that are conserved in both families of polymerases and that are different from each other. When this process is performed, some of the candidate amino acids of Ροΐμ that could be selected are Q275, R387, N457 and S458, which after a visual analysis of the three-dimensional structure of the enzyme is found to be on the surface and close to the center catalytic (Figure 14). The mutation of these amino acids to the homologous amino acid of TdT (Q275M, R387K, N457D and S458N) and, optionally, the combination of these mutations results in obtaining Ροΐμ mutants with an increased terminal transferase activity, as can be Check throughout the description.

Claims

1. Mutated mu (Ροΐμ) DNA polymerase exhibiting terminal deoxynucleotidyl transferase activity at least about 10% higher than the terminal deoxynucleotidyl transferase activity of mutated R387 mutated DNA polymerase.

2. Mutated DNA polymerase according to claim 1, comprising at least two mutations.

3. Mutated DNA polymerase according to any one of claims 1 or 2, comprising a sequence with at least 60% identity with SEQ ID NO: 17, or with any of its sub-sequences SEQ ID NO: l and SEQ ID NO: 2, or with a fragment of any of said sequences.

4. Mutated DNA polymerase according to claim 3, comprising at least two mutations consisting of (i) a first point mutation at position 387 and (ii) a second mutation consisting of:

(a) a point mutation in a conserved amino acid of Ροΐμ wt and other than the homologous amino acid present in the TdT enzyme, or

(b) a mutation in the loop-1 subdomain of Ροΐμ.

5. Mutated DNA polymerase according to claim 4, wherein the first point mutation (i) at position 387 consists of the substitution of the amino acid found in that position by any of the amino acids selected from the following group: Glutamine, Asparagine, Cysteine, Threonine, Serine, Methionine, Lysine, Arginine, Histidine or the like thereof.

6. Mutated DNA polymerase according to claim 5, wherein the second point mutation (a) is a point mutation in the amino acid that is in position 275 and consists of the substitution of the amino acid that is in that position by any of the amino acids selected from the following group: Glutamine, Asparagine, Cysteine, Threonine, Serine, Methionine or the like thereof.

7. Mutated DNA polymerase according to any of the preceding claims, wherein. The second mutation (b) consists of the deletion and replacement of loop-1 of Ροΐμ or a fragment thereof by: i) a sequence with at least about 10% identity with SEQ ID NO: 3 (loop-1 of Po ^), or

ii) by a sequence with at least about 10% identity with SEQ ID NO: 4 (loop-1 of TdT).

8. Mutated DNA polymerase according to any of the preceding claims, whose sequence is selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, fragments or sub-sequences thereof that substantially maintain their terminal transferase activity.

9. Polynucleotide encoding a mutated mutated DNA polymerase, or a fragment or sub-sequence thereof, according to any one of claims 1 to 8.

10. Polynucleotide according to claim 9, wherein its sequence is selected from the group comprising the sequences SEQ ID NO: 14 and SEQ ID NO: 15.

1 1. Vector comprising a polynucleotide according to any of claims 9 or 10.

12. Host cell comprising a polynucleotide according to any one of claims 9 or 10, or a vector according to claim 1 1.

13. A method for the production of a mutated mu DNA polymerase according to any one of claims 1 to 8, comprising: i) culturing a host cell according to claim 12 under conditions that promote the expression of the polynucleotide according to any of claims 9 or 10, and ii) isolation of the mutant produced.

14. Method for elongation of a target polynucleotide comprising: i) contacting the target polynucleotide with the mutated mu DNA polymerase according to any one of claims 1 to 8 and nucleotides or nucleotide analogs (reaction mixture), and ii) subject the reaction mixture to conditions that favor the insertion of at least one nucleotide or an analogue thereof at the 3 extremo end of the target polynucleotide.

15. Method for filling voids comprising: i) contacting a target polynucleotide, comprising at least one gap or gap of at least one nucleotide, with the mutated DNA polymerase according to any one of claims 1 to 8 and nucleotides or nucleotide analogs (reaction mixture), and ii) subjecting the reaction mixture to conditions that favor the insertion of at least one nucleotide or nucleotide analogue at the 3ΌΗ end of the gap.

16. Method for the detection of apoptotic samples comprising: i) contacting a sample, containing genetic material of potentially apoptotic cells, with the mutated mutated DNA polymerase according to any of claims 1 to 8 and at least one nucleotide or analogue nucleotide (reaction mixture), ii) subject the reaction mixture to conditions that favor the insertion of nucleotides or analogs thereof, and iii) detect the presence or not of insertion, where the detection of insertion is indicative that the Sample is apoptotic.