WO2001064909A1

WO2001064909A1 - Dna polymerase mu and uses thereof

Info

Publication number: WO2001064909A1
Application number: PCT/GB2001/000942
Authority: WO
Inventors: Luis Blanco Davila
Original assignee: Consejo Superior De Investigaciones Cientificas; Kiddle, Simon
Priority date: 2000-03-03
Filing date: 2001-03-05
Publication date: 2001-09-07
Also published as: AU3586101A

Abstract

A novel DNA polymerase (Pol ν) and nucleic acid encoding it is provided from both human and murine sources. Human Pol ν is 494 amino acids long and has about 40 % sequence identity with TdTs from different origins. This novel DNA polymerase has terminal transferase activity, but it is strongly stimulated by the presence of a template strand. In the presence of Mn?2+ or Mg2+¿ ions, Pol ν catalyses a random insertion of deoxynucleotides in front of various template bases. In the presence of Mg2+ ions, Pol ν has a very reduced base discrimination, mainly producing the insertion of A and T in front of a template G. This new enzyme is, therefore, the DNA-dependent DNA polymerase with the lowest value of insertion fidelity, a property that enables Pol ν to be an useful tool in processes oriented to modify the DNA and in the diagnosis of cancer and in particular B cell lymphomas.

Description

DNA Polymerase Mu and Uses Thereof

Field of the Invention

The present invention relates to the identification and isolation of a DNA polymerase and uses of this polymerase. In particular, the present invention describes the nucleotide sequence of the human gene for DNA polymerase mu (Pol μ) , the ammo acid sequence of Pol μ and methods for its production. The present invention further provides the use of Pol μ as a tool m genetic engineering and as a genetic marker of B-cells and lymphomas from different origins. The present invention therefore further relates to the use of Pol μ for the diagnosis and prognosis of pathologies such as cancer. The present invention further relates to applications of Pol μ based on the error-proneness of its DNA-dependent DNA polymerase activity which enables this enzyme to be responsible of the somatic hypermutation of Ig genes, a process that occurs in the germinal centres, developed at secondary lymphoid organs, and that is responsible for the maturation of the immune response.

Background of the Invention

In DNA organisms, the maintenance and stability of genetic information relies on the faithful DNA synthesis carried out by replicative DNA polymerases, most of them endowed with a proof reading capacity to edit insertion errors (Bebenek & Kunkel, (1995) Analysing fidelity of DNA polymerases. Methods Enzymol . , 262, 217-232). DNA stability also relies on different DNA repair machineries, able to detect and eliminate most DNA lesions that, if left unrepaired, could lead to cell death or transformation. However, m spite of all this enzymology for DNA maintenance, wnich is capable of excising bases and nucleotides, sealing DNA breaks and correcting DNA mismatches, a certain degree of mutability is required to trigger evolution. Such a mutator potential could be due to dysfunction of the replication and repair machineries, but also to the participation of a specific enzymology based on the action of mutator (error-prone) DNA polymerases, that would work in opposition to DNA repair.

A clear example on the existence of a particular enzymology oriented to generate diversity is terminal deoxynucleotidyl transferase (TdT), although its action is restricted to those genes coding for antigen receptors (Bentolila et al, (1995). The two isoforms of mouse terminal deoxynucleotidyl transferase differ both the ability to add N regions and subcellular localization. EMBO J. , 14, 4221-4229). TdT is a DNA-mdependent DNA polymerase activity, since it is able to catalyse the addition of nucleotides to a DNA strand without template information. This unusual capacity is exploited the recombination process that combines the different genomic segments of the inmunoglobulins (VDJ recombination) , allowing to increase diversity of the antigen receptors. The specificity of TdT action is not only dependent on its expression pattern, restricted to primary lymphoid organs, but also on its specific interaction with the Ku autoantigen, a component of the DNA-dependent protein k ase (DNA-PK), involved m DNA interaction. DNA-PK is involved in double-strand break repair and VDJ recombination (Mahajan et al, (1999) Association of terminal deoxynucleotidyl transferase with Ku . Proc . Na tl . Acad. Sci . USA, 96, 13926-13931). DNA polymerase beta (Pol β) is one of the few cellular enzymes shown to participate in a specific process of DNA repair (Wilson, (1998) Mammalian base excision repair and DNA polymerase beta. Muta t . Res . , 407, 203-215; Burgers, (1998) Eukaryotic DNA polymerases in DNA replication and DNA repair. Chromosoma , 107, 218-227; Dianov et al, (1999). Role of DNA polymerase beta in the excision step of long patch mammalian base excision repair. J. Biol . Chem . , 274, 13741-13743) . In spite of this function, it has been also proposed that dominant and altered forms of Pol β could constitute mutator DNA polymerases (error-prone) able to altere the normal levels of DNA repair (Bhattacharyya & Baner ee, (1997) A variant of DNA polymerase beta acts as a dominant negative mutant. Proc . Na tl . Acad. Sci . USA , 94, 10324-10329; Clairmont &

Sweasy, (1998) The Pol beta-14 dominant negative rat DNA polymerase beta mutator mutant commits errors during the gap-filling step of base excision repair in Sa ccharomyces cerevisiae . J Ba cteπol . , 180, 2292-2297; Clairmont et al, (1999) The Tyr-265-to-Cys mutator mutant of DNA polymerase beta induces a mutator phenotype in mouse LN12 cells. Proc . Na tl . Acad. Sci . USA, 96, 9580-9585), thus favouring the induction of a trans ormation phenotype (Bhattacharyya & Banerjee, (1997) A variant of DNA polymerase beta acts as a dominant negative mutant. Proc . Na tl . Acad. Sci . USA , 94, 10324-10329). Strikingly, TdT and Pol β are evolutionarily related, both belonging to the X family of DNA polymerases (Ito & Braithwaite, (1991) Compilation and alignment of DNA polymerase sequences. Nuclei c Acids Res . , 19, 4045-4057).

Recently, three novel cellular DNA polymerases have been described: zeta (ζ) (Lawrence & Hmkle, (1996) DNA polymerase zeta and the control of DNA damage induced mutagenesis eukaryotes. Cancer Surv. , 28, 21-31), eta (η) (Masutam et al, (1999) The XPV (xeroderma pigmentosum variant) gene encodes human DNA polymerase eta. Na ture, 399, 700-744), and theta (θ) (Sharief et al, (1999) Cloning and chromosomal mapping of the human DNA polymerase theta (POLQ), the eighth human DNA polymerase. Genomi cs , 59, 90-96) . These novel enzymes are able to alter the outcome of normal DNA repair, by efficiently using damaged DNA as a template (Friedberg & Gerlach, (1999) Novel DNA polymerases offer clues to the molecular basis of mutagenesis. Cell , 98, 413-416). In yeast and fungi, most of the spontaneous mutations and those induced by DNA damage are due to DNA polymerase ζ (Han et al, (1998) The uvsl gene of Aspergi ll us nidulans required for UV-mutagenesis encodes a homologue to REV3, a subunit of the DNA polymerase zeta of yeast involved m translesion DNA synthesis. FEMS Lett . 164, 13-19). Pol η is required for error-free replication across DNA lesions originated by ultraviolet (UV) light, and its absence causes Xeroderma pigmentosum variant, a recessive autosomic disease characterised by a high incidence of skin cancer (Han et al, 1998; Johnson et al, (1999) hRAD30 mutations m the variant form of Xeroderma pigmentosum. Science, 285, 263-265). More recently, a novel human DNA polymerase homologous to Pol β, named Pol lambda (λ) , has been identified, and shown to be associated to DNA synthesis reactions occurring during meiosis and during recombmational repair of double- strand breaks (see PCT/GB00/03784 and Garcia-Diaz et al, (2000) DNA polymerase lambda (Pol λ) , a novel DNA polymerase with a potential role in meiosis. J. Mol . Biol . 301, 851-867) .

Summary of the Invention The identification of novel human DNA polymerases will potentially enlarge our knowledge about the origin of cancer and immune diseases, providing us with new methods for detection and diagnosis of these pathologies, opening new avenues on therapy strategies, and offering new tools m molecular biology. Broadly, the present invention provides with a novel human DNA polymerase (Pol μ) gene, and the amino acid sequence of its encoded protein (494 amino acids), that has about 40% sequence identity with TdTs from different origins. The murine form of Pol μ is also disclosed. This novel DNA polymerase has terminal transferase activity, but it is strongly stimulated by the presence of a template strand. In the presence of Mn ions, Pol μ catalyses a random insertion of deoxynucleotides in front of various template bases. In the presence of either Mg or Mn^9" ions, Pol μ has a very reduced base discrimination, mainly producing the insertion of A and T front of a template G. This new enzyme is, therefore, the DNA-dependent DNA polymerase with the lowest value of insertion fidelity, a property that enables Pol μ to be an useful tool in processes oriented to modify the DNA. The predominant and normal expression of this enzyme m cell types undergoing somatic hypermutation of Ig genes supports the hypothesis that Pol μ is the mutator responsible for this process. Thus, Pol μ forms foci at the nuclei of centroblasts, a B-cell type that is differentiated at secondary lymphoid organs, and that is hypermutation competent. The same pattern of Pol μ lmmunostainmg is observed in cell lines derived from B- lymphomas undergoing constitutive somatic hypermutation, supporting its potential use as a tumoral marker for prognosis, and also provide with a new interference target that could contribute to the treatment of cancer and m particular these tumours.

Accordingly, in a first aspect, the present invention provides a DNA polymerase (Pol μ) having a specific terminal transferase activity, a DNA-dependent DNA polymerase activity and a reduced base discrimination m the presence of g^" or Mn^⁺ ions. In a further aspect, the present invention provides isolated DNA polymerase μ (Pol μ) polypeptide comprising the ammo acid sequence as set out in SEQ ID No: 2. This is the wild type ammo acid sequence of human Pol μ.

In a further aspect, the present invention provides isolated DNA polymerase μ (Pol μ) polypeptide comprising the ammo acid sequence as set out m SEQ ID No: 4. This is the wild type ammo acid sequence of murine Pol μ ana is 496 ammo acids m length.

In a further aspect, the present invention provides an isolated polypeptide having greater than 45% ammo acid sequence identity with any one of the above Pol μ ammo acid sequences. In a further aspect, the present invention provides an isolated polypeptide encoded by nucleic acid capable of hybridising to one of the nucleic acid sequences encoding human or murine Pol μ under stringent conditions.

In a further aspect, the present invention provides a substance which is a polypeptide which is a sequence variant or allele of any one of the above polypeptides.

In a further aspect, the present invention provides a substance which is a fragment or active portion of one of the above polypeptides.

In a further aspect, the present invention provides a polypeptide which comprises Pol μ, or an active portion, domain or fragment thereof, joined to a second polypeptide. An example of a preferred second polypeptide is terminal deoxynucleotidyltrans erase (TdT) a known DNA polymerase used for the diagnosis of acute lymphoblastic leukaemia and lymphoma. As Pol μ is very soluble, easy to produce and a tumour marker m its own right, a chimera of Pol μ and a second polypeptide such as TdT may have better solubility and be produced higher yield than the existing TdT marker which is difficult and expensive to produce in view of its poor solubility. Examples of Pol μ and TdT fusions and chimeras may include one or more of the following domains from Pol μ and TdT. The ammo acids present in the domains are as follows:

Pol μ: BRCT from 27 to 122

8 kDa from 141 to 231 fingers from 232 to 288 palm from 289 to 422 thumb from 423 to 495

TdT: BRCT from 32 to 124

8 kDa from 153 to 243 fingers from 244 to 301 palm from 302 to 437 thumb from 438 to 509

In a further aspect, the present invention provides isolated nucleic acid molecules encoding one of the above polypeptides. The cDNA sequence of full length human Pol μ is set out in SEQ ID No: 1, i.e. between nucleotides 46 and 1527 inclusive. The full length murine Pol μ cDNA sequence is provided as SEQ ID No: 3 (between nucleotides 10 and 1497 inclusive) .

The present invention also include nucleic molecules having greater than a 90% sequence identity with one of the above nucleic acid sequence. In other embodiments, the present invention relates to nucleic acid sequences which hybridise to the coding sequence set out m SEQ ID No: 1 or 3, e.g. under stringent conditions as disclosed herein.

In further aspects, the present invention provides an expression vector comprising one of the above nucleic acid operably linked to control sequences to direct its expression, and host cells transformed with the vectors. The present invention also includes a method of producing Pol μ polypeptide, or a fragment or active portion thereof, comprising cultunng the host cells and isolating the polypeptide thus produced.

In a further aspect, the present invention provides a composition comprising a Pol μ nucleic acid molecule as defined herein.

In a further aspect, the present invention provides a composition comprising one or more Pol μ polypeptides as defined above.

In a further aspect, the present invention provides the use of a Pol μ inhibitor for the preparation of a medicament for the treatment of cancer, and more especially lymphoma.

In a further aspect, the present invention provides the use of a Pol μ polypeptide or nucleic acid encoding a Pol μ polypeptide for screening for candidate compounds which (a) share a Pol μ biological activity or (b) bind to the Pol μ polypeptide or (c) inhibit a biological activity of a Pol μ polypeptide, e.g. to find peptidyl or non- peptidyl mimetics or inhibitors of the Pol μ polypeptides to develop as lead compounds in pharmaceutical research.

Thus, in one embodiment, the present invention provides a method of identifying a compound which is capable of modulating an activity of a Pol μ polymerase, the method comprising:

(a) contacting one or more candidate compounds with Pol μ under conditions m which the compounds of Pol μ are capable of interacting;

(b) determining m an assay for a Pol μ polymerase activity whether a candidate compound modulates the activity; and (c) selecting a candidate compound which modulates an activity of Pol μ polymerase.

Preferably, the method is for screening for modulators of Pol μ which are capable of inhibiting one or more of the Pol μ activities disclosed herein. Such inhibitors may be useful for the treatment of cancer.

In a further aspect, the present invention provides antibodies capable of specifically binding to the above Pol μ polypeptides, or an active portion, domain or fragment thereof, and the use of the Pol μ sequence or peptides based on the sequence for designing or preparing antibodies. These antibodies can be used m assays to detect and quantify the presence of Pol μ polypeptide, m methods of purifying Pol μ polypeptides, and as inhibitors of Pol μ biological activity. In the examples, the production of polyclonal antibodies able to recognize specifically Pol μ and truncated fragments thereof is disclosed, allowing their identification m biological samples. These experiments show that the antibodies have substantially no cross reactivity with other proteins such as TdT. Monoclonal antibodies could be easily obtained starting from the complete Pol μ polypeptide or from truncated peptides of this enzyme, using the procedures that are well known for those skilled in the art and that are discussed more detail below .

In a further aspect, the present invention method for determining the presence of Pol μ nucleic acid and/or mutations within a nucleic acid sequence a test sample comprising detecting the hybridization of test sample nucleic acid to a nucleic acid probe based on the Pol μ nucleic acid sequences provided herein.

In a further aspect, the present invention provides a method of amplifying a nucleic acid test sample comprising priming a nucleic acid polymerase reaction with nucleic acid encoding a Pol μ polypeptide as defined above. The present invention also provides the use of the above nucleic acid in the search for mutations in the Pol μ genes, e.g. using techniques such as single stranded conformation polymorphism (SSCP).

Moreover, the present invention describes several techniques as examples to identify Pol μ transcripts in tissue samples, as Northern-blotting and m si tu hybridization analysis. In addition, PCR can be employed to amplify and quantify Pol μ from its mRNA. Determination of the biological activity of Pol μ can be also considered as an alternative method to demonstrate its presence m biological samples, forming part of the present invention.

In a further aspect, the present invention provides a method for the diagnosis or prognosis of a tumour, the method comprising determining of the presence or amount of the Pol μ polymerase described above in a sample from a patient and comparing the presence or amount of the Pol μ polymerase to corresponding values obtained from controls to provide the diagnosis or prognosis of the tumour. Identifying Pol μ protein or the POLM transcript in biological samples corresponding to normal versus pathological (tumoral) human cells provides a useful tool for the diagnosis of different leukemias, for prognosis of these pathologies and monitoring the effect of treatments for them, and also to allow a more precise diagnostic than that available to date, based on the presence of TdT is several lymphomas.

These and other aspects of the present invention are described in more detail below. By way of example, embodiments of the present invention will now be described in more detail witn reference to the accompanying figures.

Brief Description of the Figures

Figure 1 : Pol μ , a novel eukaryotic DNA polymerase homologous to TdT. Multiple alignment of human Pol μ with TdTs from human (Hs; sp P04053), bovine (Bt; sp P06526) , murine (Mm; sp P09838), Monodelphis domestica (Md; sp Q02789), chicken (Gd; sp P36195), and Xenopus laevis (XI; sp P42118) . Numbers between slashes indicate the ammo acid position relative to the N-termmus of each DNA polymerase. A putative nuclear localization signal (NLS) at residues 3 to 9 of human Pol μ is ooxed. Ammo acid residues 22 to 118 of Pol μ (boxed) are predicted to form a BRCT domain (Bork et al . , 1997). Ammo acid residues 141 to 494 of Pol μ (boxed) for a conserved DNA polymerase beta (Pol β) core. Invariant residues among Pol μ and TdTs are indicated with white letters (over a black background) . Identical residues among TdTs are bold-typed and boxed (grey) . Other relevant similarity among Pol μ and TdTs is bold typed. Conservative substitutions were considered as follows: K, H and R; D, E, Q and D; W, F, Y, I, L, V, M, A; G, S, T, C and P. The 23 residues that are invariant among DNA polymerase X members (Oliveros et al . , 1997) are indicated with an asterisk. Dots at the bottom of the alignment indicate putative homologues to Pol β residues (Pelletier et a l . , 1994) shown to act either as DNA ligands (Gly^b\ Gly⁶\ Gly^lj , Gly Lys -, Arg²⁵\ Arg²⁸³, Tyr'"⁶; grey), or as dNTP and metal ligands (Phe^\ Gly⁷ \ Arg¹" ; Asρ^jQn, Asp ^" and Asp-^'M" black) . Squares at the bottom of the alignment indicate putative homologues to Pol β residues involved m interactions between the "palm" and "thumb" subdomams (Gly VPhe ; Arg /Glu¹ⁱ⁰) . Total length, in number of ammo acid residues, is indicated m parenthesis.

Figure 2: Expression of human Pol μ in Escher±ch±a. coll .

(A) Coomassie Blue staining after SDS-PAGE separation of control non-mduced (NI) and IPTG-mduced (I) extracts of E . coll BL21 (DE3) cells transformed with the recombinant plasmid pRSET-hPolμ, and further purification steps of the latter extracts. The mobility of the induced protein Pol μ was compatible with its deduced molecular mass (55 kDa/494 aa) . After PEI precipitation of the DNA, Pol μ was precipitated with 50% ammonium sulphate (AS), and further purified by phosphocellulose (PC) and heparin sepharose (HS) chromatography, as described in materials and methods. The electrophoretic migration of a collection of molecular mass markers (MW) is shown at the left. (B) Relative activation by Mg ^* versus Mn²⁺ of TdT and Klenow enzymes during DNA polymerization ( [a- ' P] dATP-labellmg) on activated DNA. TdT (5 units) and Klenow (1 unit) were assayed for 30 mm at 37°C, either in the presence of 10 mM MgCl or 1 mM MnCl,, as a source of activating metal ions. DNA polymerase activity, expressed as dAMP incorporation, was quantitated as described in materials and methods. (C) DNA polymerization activity associated to Pol μ expression. The 50% AS fraction corresponding to either non induced (N.I.) or induced (I) extracts were assayed and quantitated as described in part

Figure 3 : Cosedimentation of a DNA polymerase activity with the Pol μ polypeptide. The heparm sepharose fraction (HS) shown in Figure 2A was sedimented on a glycerol gradient (15-30%) and fractionated as described m materials and methods. The inset shows a SDS-PAGE analysis followed by Coomassie Blue staining of some selected fractions. Fractions are numbered from bottom (1) to top (22) . Arrows indicate the sedimentation position of several molecular mass markers centrifuged under identical conditions. Quantitation of the Pol μ band corresponding to each fraction is expressed as arbitrary units of optical density (a.u.; right ordinates) . DNA polymerase activity ( [a-³²P] dATP- labellmg of activated DNA) of each fraction, assayed for 15 mm at 37°C m the presence of ImM MnCl₂ (see materials and methods), is expressed as dAMP incorporation (left ordinates) .

Figure 4: Pol μ has terminal transferase activity, but requires a template/primer structure for optimal efficiency. (A) Terminal transferase activity associated to human Pol μ. The assay was carried out as described in materials and methods, using 3.2 nM of a 5 '-labelled single stranded 19-mer oligonucleotide (P19) as substrate, ImM MnCl as a source of activating metal ions, 80 μM of each individual deoxynucleotide, and either TdT (2.5 u/41 ng) or Pol μ (20 ng) . A control reaction in the absence of enzyme (c) was also carried out. After incubation for 30 mm at 30°C, extension of the 5' -labelled oligonucleotide was analysed m 8 M urea, 20% PAGE and autoradiography . (B) Template-dependent polymerization catalyzed by Pol μ. Polymerization efficiency was comparatively assayed on either Poly dA, or oligo dT, or a PolydA/oligo dT hybrid to provide a homopolymeric template (dA)n. The assay was carried out in the presence of 1 mM MnCl,, 13 nM [a-^zP]dTTP, Pol μ (20 ng) , and 0.5μM of each DNA substrate. After incubation for the indicated times at 37°C, dTMP incorporation was quantitated as described in materials and methods.

Figure 5: Inhibition of DNA-directed synthesis by non- complementary dNTPs . (A) Inhibition of [a- P]dATP- labellmg of activated (gapped) DNA by addition of different concentrations of a mixture of dC/dG/dTTP, in the presence of 1 mM MnCl? (a scheme is depicted) . Under the standard conditions described in materials and methods, only dATP (13 nM) is used as substrate for this assay. After incubation for 15 mm at 37°C m the presence of either TdT (2.5 units/41 ng) , Klenow (1 unit) or Pol μ (20 ng) , and the indicated concentration of dNTPs, dAMP incorporation on activated DNA was expressed as a percentage of that obtained under standard assay conditions. 100% represents either 73 (TdT), 13 (Klenow) or 8 (Pol μ) fmole of incorporated dAMP. (B) A similar analysis was carried out, but using a Poly dT/oligo dA hybrid to provide a homopolymeric template (dT)n. The assay was carried out m the presence of 1 mM MnCl , 13 nM [a-^3,P]dATP as the correct nucleotide, either Pol μ (20 ng) or Klenow (1 unit), and the indicated concentration (in abscisa) of individual non complementary dNTPs. After 5 mm at 37°C, dAMP incorporation on poly dT/oligo dA was expressed as a percentage of that obtained when non- complementary nucleotides were added. 100% represents either 23 (Pol μ) or 127 (Klenow) fmole of incorporated dAMP.

Figure 6 : Pol μ-catalysed misinsertion at the four template bases. The four template-primer structures used, that only differ in the first template base (outlined) are indicated at the left. The single-stranded oligonucleotide corresponding to the primer strand was assayed in parallel as a control of DNA-mdependent nucleotide insertion. Mg^~τ-actιvated nucleotide insertion on each 5' -labelled DNA substrate (3.2 nM) was analysed in the presence of either the complementary nucleotide (10 μM) or each of the three wrong dNTPs (100 μM) , as described under materials and methods. Mn²⁺-actιvated nucleotide insertion was assayed with each of the four dNTPs (0.1 μM) . After incubation for 15 mm at 30°C m the presence of 20 ng of human Pol μ, extension of the 5'- labelled (*) strand was analysed by electrophoresis in 8 M urea, 20% PAGE and autoradiography .

Figure 7 : Misinsertion at the four template bases catalysed by the catalytic domain of human Pol μ .

Figure 8: Pol μ mRNA is preferentially expressed in secondary lymphoid organs. Northern blotting analysis of TdT-2 mRNA was carried out as indicated in materials and methods, using commercial blots (MTN and MTN-II blots, Clontech) containing polyA⁺ RNA from the indicated human tissues. The membrane was hybridized with a specific ³²P- labelled DNA probe containing 1141 nucleotides of the Pol μ cDNA 3 ' -terminal sequence. The hybridized probe, revealing a major transcript (2.6 kb) , was detected by autoradiography. Figure 9 : Specificity of anti-Pol μ polyclonal antibodies

(A) Dot-blot analysis of the level of cross-reactivity of anti-Pol μ antibodies against commercial TdT. (B) Western blot analysis of: 1) Purified protein Pol μ (HS fraction), 2) Extract from Ramos cell line y 3) Nuclear extract from mouse spleen.

Detailed Description Pol u nucleic acid "Pol μ nucleic acid" includes a nucleic acid molecule which has a nucleotide sequence encoding a polypeptide which includes the ammo acid sequence shown SEQ ID No: 2 or . The Pol μ coding sequence may be the full length nucleic acid sequence shown in SEQ ID No: 1 or 3, a complementary nucleic acid sequence, or it may be a sequence variant differing from one of the above sequences by one or more of addition, insertion, deletion and substitution of one or more nucleotides of the sequence shown. Changes to a nucleotide sequence may result m an ammo acid change at the protein level, or not, as determined by the genetic code. Thus, nucleic acid according to the present invention may include a sequence different from the sequence shown m SEQ ID No: 1 or 3 yet encode a polypeptide with the same ammo acid sequence. On the other hand, the encoded polypeptide may comprise an ammo acid sequence which differs by one or more ammo acid residues from the ammo acid sequence shown in SEQ ID No: 2 or 4. Nucleic acid encoding a polypeptide which is an ammo acid sequence variant of the sequence shown in SEQ ID No: 2 or 4 is further provided by the present invention. Such polypeptides are discussed below. Nucleic acid encoding such a polypeptide preferably have at least 40% sequence identity with the coding sequence shown in SEQ ID No: 1 or 3, more preferably at least 80% sequence identity, more preferably at least 90% sequence identity, more preferably at least 95% sequence identity, and most preferably at least 98% sequence identity.

The present invention also includes fragments of the Pol μ nucleic acid sequences described herein, the fragments preferably being at least 60, 120, 180, 240, 480 or 960 nucleotides in length.

Generally, nucleic acid according to the present invention is provided as an isolate, in isolated and/or purified form, or free or substantially free of material with which it is naturally associated, such as free or substantially free of nucleic acid flanking the gene in the human genome, except possibly one or more regulatory sequence (s) for expression. Nucleic acid may be wholly or partially synthetic and may include genomic DNA, cDNA or RNA. Where nucleic acid according to the invention includes RNA, reference to the sequence shown should be construed as reference to the RNA equivalent, with U substituted for T.

Nucleic acid sequences encoding all or part of the POL M gene and/or its regulatory elements can be readily prepared by the skilled person using the information and references contained herein and techniques known m the art (for example, see Sambrook, Fritsch and Maniatis, "Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989, and Ausubel et al, Short Protocols in Molecular Biology, John Wiley and Sons, 1992) . These techniques include (l) the use of the polymerase chain reaction (PCR) to amplify samples of such nucleic acid, e.g. from genomic sources, (n) chemical synthesis, or (m) amplification in E . coll . Modifications to the Pol μ sequences can be made, e.g. using site directed mutagenesis, to provide expression of modified Pol μ polypeptide or to take account of codon preference in the host cells used to express the nucleic acid.

PCR techniques for the amplification of nucleic acid are described in US Patent No. 4,683,195. In general, sucn techniques require that sequence information from the ends of the target sequence is known to allow suitable forward and reverse oligonucleotide primers to be designed to be identical or similar to the polynucleotide sequence that is the target for the amplification. PCR comprises steps of denaturation of template nucleic acid (if double- stranded), annealing of primer to target, and polymerisation. The nucleic acid probed or used as template in the amplification reaction may be genomic DNA, cDNA or RNA. PCR can be used to amplify specific sequences from genomic DNA, specific RNA sequences and cDNA transcribed from mRNA, bacteπophage or plasmid sequences. The Pol μ nucleic acid sequences provided herein readily allow the skilled person to design PCR primers. References for the general use of PCR techniques include Mullis et al, Cold Spring Harbor Symp. Quant. Biol., 51:263, (1987), Ehrlich (ed) , PCR Technology, Stockton Press, NY, 1989, Ehrlich et al, Science, 252:1643-1650, (1991), "PCR protocols; A Guide to Methods and Applications", Eds. Innis et al, Academic Press, New York, (1990) .

In order to obtain expression of the Pol μ nucleic acid sequences, the sequences can be incorporated a vector having control sequences operably linked to the Pol μ nucleic acid to control its expression. The vectors may include other sequences such as promoters or enhancers to drive the expression of the inserted nucleic acid, nucleic acid sequences so that the Pol μ polypeptide is produced as a fusion and/or nucleic acid encoding secretion signals so that the polypeptide produced n the host cell is secreted from the cell. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. Vectors may be plasmids, viral e.g. 'phage, or phagemid, as appropriate. For further details see, for example, Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al . , 1989, Cold Spring Harbor Laboratory Press. Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described detail m Current Protocols m Molecular Biology, Ausubel et al. eds . , John Wiley & Sons, 1992.

Pol μ polypeptide can then be obtained by transforming the vectors into host cells m which the vector is functional, culturmg the host cells so that the Pol μ polypeptide is produced and recovering the Pol μ polypeptide from the host cells or the surrounding medium. Prokaryotic and eukaryotic cells are used for this purpose the art, including strains of E . coli , yeast, and eukaryotic cells such as COS or CHO cells. The choice of host cell can be used to control the properties of the Pol μ polypeptide expressed in those cells, e.g. controlling where the polypeptide is deposited m the host cells or affecting properties such as its glycosylation and phosphorylation.

Accordingly, the present invention also encompasses a method of producing a Pol μ polypeptide, the method comprising expressing nucleic acid encoding the Pol μ polypeptide. This may conveniently be achieved by growing a host cell in culture, containing such a vector, under appropriate conditions which cause or allow expression of the polypeptide. Polypeptides may also be expressed in in vi tro systems, such as reticulocyte lysate.

Thus, a further aspect of the present invention provides a host cell containing nucleic acid as disclosed herein. The nucleic acid of the invention may be integrated into the genome (e.g. chromosome) of the host cell. Integration may be promoted by inclusion of sequences which promote recombination with the genome, in accordance with standard techniques. The nucleic acid may be on an extra-chromosomal vector within the cell.

A still further aspect provides a method which includes introducing the nucleic acid into a host cell. The introduction, which may (particularly for in vi tro introduction) be generally referred to without limitation as "transformation", may employ any available technique. For eukaryotic cells, suitable techniques may include calcium phosphate transfection, DEAE-Dextran, electroporation, liposome-mediated transfection and transduction using retrovirus or other virus, e.g. vaccinia or, for insect cells, baculovirus. For bacterial cells, suitable techniques may include calcium chloride transformation, electroporation and transfection using bacteriophage . As an alternative, direct injection of the nucleic acid could be employed.

The introduction may be followed by causing or allowing expression from the nucleic acid, e.g. by culturmg host cells (which may include cells actually transformed although more likely the cells will be descendants of the transformed cells) under conditions for expression of the gene, so that the encoded polypeptide is produced. If the polypeptide is expressed coupled to an appropriate signal leader peptide it may be secreted from the cell into the culture medium. Following production by expression, a polypeptide may be isolated and/or purified from the host cell and/or culture medium, as the case may be, and subsequently used as desired, e.g. n the formulation of a composition which may include one or more additional components, such as a pharmaceutical composition which includes one or more pharmaceutically acceptable excipients, vehicles or carriers.

Host cells may be also useα as a nucleic acid factory to replicate the nucleic acid of interest m order to generate large amounts of it. Multiple copies of nucleic acid of interest may be made within a cell when coupled to an amplifiable gene such as DHFR. Host cells transformed with nucleic acid of interest, or which are descended from host cells into which nucleic acid was introduced, may be cultured under suitable conditions, e.g. m a fermenter, taken from the culture and subjected to processing to purify the nucleic acid. Following purification, the nucleic acid or one or more fragments thereof may be used as desired, for instance m a diagnostic or prognostic assay as discussed elsewhere herein.

The nucleic acid sequences provided herein are useful for identifying nucleic acid of interest (and which may be according to the present invention) m a test sample. The present invention provides a method of obtaining nucleic acid of interest, the method including hybridising a probe sharing all or part of the sequence provided herein, or a complementary sequence, to the target nucleic acid. Hybridization is generally followed by identification of successful hybridization and isolation of nucleic acid which has hybridized to the probe, which may involve one or more steps of PCR. These methods may be useful in the diagnosis or prognosis of cancer and in particular B cell lymphoma as described m more detail below.

Nucleic acid according to the present invention is obtainable using one or more oligonucleotide probes or primers designed to hybridize with one or more fragments of the nucleic acid sequence shown herein, particularly fragments of relatively rare sequence, based on codon usage or statistical analysis. A primer designed to hybridize with a fragment of the nucleic ac α sequence shown in the above figures may be used in conjunction with one or more oligonucleotides designed to hybridize to a sequence a cloning vector within which target nucleic acid has been cloned, or so-called "RACE" (rapid amplification of cDNA ends) m which cDNA's in a library are ligated to an oligonucleotide linker and PCR is performed using a primer which hybridizes witn the sequence shown herein and a primer which hybridizes to the oligonucleotide linker.

Such oligonucleotide probes or primers, as well as the full-length sequence and sequence variants are also useful m screening a test sample containing nucleic acid for the presence of Pol μ nucleic acid, the probes hybridizing with a target sequence from a sample obtained from the individual being tested. The conditions of tne hybridization can be controlled to minimise non-specific binding, and preferably stringent to moderately stringent hybridization conditions are preferred. The skilled person is readily able to design such probes, label them and devise suitable conditions for the hybridization reactions, assisted by textbooks such as Sambrook et al (1989) and Ausubel et al (1992), taking into account factors such as oligonucleotide length and base composition, temperature and so on. The binding of a probe to target nucleic acid (e.g. DNA) may be measured using any of a variety of techniques at the disposal of those skilled in the art. For instance, probes may be radioactively, fluorescently or enzymatically labelled. Other methods not employing labelling of probe include examination of restriction fragment length polymorphisms, amplification using PCR, RNAse cleavage and allele specific oligonucleotide probing .

On the basis of ammo acid sequence information, oligonucleotide probes or primers may be designed, taking into account the degeneracy of the genetic code, and where appropriate, codon usage of the organism from the candidate nucleic acid is derived. An oligonucleotide for use in nucleic acid amplification may have about 10 or fewer codons (e.g. 6, 7 or 8), i.e. be about 30 or fewer nucleotides m length (e.g. 18, 21 or 24). Generally specific primers are upwards of 14 nucleotides in length, but not more than 18-20. Those skilled in the art are well versed m the design of primers for use processes such as PCR.

Accordingly, a further aspect of the present invention provides an oligonucleotide or nucleotide fragment of the one of the nucleotide sequence disclosed herein, or a complementary sequence, m particular for use in a method of obtaining and/or screening nucleic acid. The sequences referred to above may be modified by addition, substitution, insertion or deletion of one or more nucleotides, but preferably without abolition of ability to hybridize selectively with nucleic acid with the sequence shown herein, that is wherein the degree of sequence identity of the oligonucleotide or polynucleotide with one of the sequences given is sufficiently high. In some preferred embodiments, oligonucleotides according to the present invention that are fragments of any of the nucleic acid sequences provided herein, or complementary sequences thereof, are at least about 10 nucleotides in length, more preferably at least about 15 nucleotides in length, more preferably at least about 20 nucleotides in length. Such fragments themselves individually represent aspects of the present invention. Fragments and other oligonucleotides may be used as primers or probes as discussed but may also be generated (e.g. by PCR) in methods concerned with determining the presence of Pol μ nucleic acid in a test sample.

Pol μ polpe tides The skilled person can use the techniques described herein and others well known the art to produce large amounts of the Pol μ polypeptides, or fragments or active portions thereof, for use as pharmaceuticals, m the developments of drugs, for further study into its properties and role m vivo, and to screen for Pol μ inhibitors.

Thus, a further aspect of the present invention provides a polypeptide which has the ammo acid sequence shown in SEQ ID No: 2 or 4, which may be isolated and/or purified form, free or substantially free of material with which it is naturally associated, such as polypeptides other than Pol μ.

Polypeptides which are ammo acid sequence variants are also provided by the present invention. A polypeptide which is a sequence variant differs from that provided herein by one or more of addition, substitution, deletion and insertion of one or more ammo acids. Preferred polypeptides have Pol μ polymerase function, as described herein, that is a specific terminal transferase activity, a DNA-dependent DNA polymerase activity and a reduced base discrimination in the presence of either Mg or Mn ions.

Preferably, a polypeptide which is an ammo acid sequence variant of the ammo acid sequence shown in SEQ ID Nos : 2 or 4 has at least 45% sequence identity to one of those sequences, more preferably at least 50% sequence identity, more preferably at least 60% sequence identity, more preferably at least 70% sequence identity, more preferably at least 80% sequence identity, more preferably at least 90% sequence identity, and most preferably at least 95% sequence identity to the sequences of SEQ ID Nos: 2 or 4.

The skilled person can readily make sequence comparisons and determine identity using techniques well known in the art, e.g. using the GCG program which is available from Genetics Computer Group, Oxford Molecular Group, Madison, Wisconsin, USA, Version 9.1. Particular ammo acid sequence variants may differ from those shown SEQ ID Nos: 2 or 4 by insertion, addition, substitution or deletion of 1 ammo acid, 2, 3, 4, 5-10, 10-20 20-30, 30- 50, 50-100, 100-150, or more than 150 ammo acids.

"Stringency" of hybridization reactions is readily determmable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al, Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).

"Stringent conditions" or "high stringency conditions", as defined herein, may be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chlorιde/0.0015 M sodium citrate/ 0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumm/0.1% Fιcoll/0.1% polyvmylpyrrolιdone/50mM sodium phosphate buffer at pH 6.5 with 760 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCI, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6 8), 0.1% sodium pyrophosphate, 5 x Denhardt ' s solution, sonicated salmon sperm DNA (50 lg/ml), 0.1% SDS, and 10% dextran sulfate at 42°C, with washes at 42°C 0.2 x SSC (sodium chloride/sodium citrate) and 50% formamide at 55°C, followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 55°C.

"Percent (%) amino acid sequence identity" with respect to the Pol μ polypeptide sequences identified herein is defined as the percentage of ammo acid residues in a candidate sequence that are identical with the amino acid residues in the Pol μ sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. The % identity values used herein are generated by WU-BLAST-2 which was obtained from [Altschul et al, Methods in Enzymology, 266:460-480 (1996); http: //blast. wustl/edu/blast/README. html] . WU-BLAST-2 uses several search parameters, most of which are set to the default values. The adjustable parameters are set with the following values: overlap span =1, overlap fractιon= 0.125, word threshold (T) = 11. The HSP S and HSPS2 parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched; however, the values may be adjusted to increase sensitivity. A % ammo acid sequence identity value is determined by the number of matching identical residues divided by the total number of residues of the "longer" sequence in the aligned region. The "longer" sequence is the one having the most actual residues n the aligned region (gaps introduced by WU-Blast-2 to maximize the alignment score are ignored) .

Similarly, "percent (%) nucleic acid sequence identity" with respect to the coding sequence of the Pol μ polypeptides identified herein is defined as the percentage of nucleotide residues a candidate sequence that are identical with the nucleotide residues m the Pol μ coding sequence as provided in SEQ ID Nos: 1 and 3. The identity values used herein were generated by the BLASTN module of WU BL AST-2 set to the default parameters, with overlap span and overlap fraction set to 1 and 0.125, respectively.

The present invention also includes active portions, domains and fragments (including domains) of the Pol μ polypeptides of the invention. An "active portion" of Pol μ polypeptide means a peptide which is less than said full length Pol μ polypeptide, but which retains at least some of its essential biological activity, e.g. as a DNA polymerase. Active portions may be great than 100 ammo acids, more preferably greater than 200 ammo acids, more preferably greater than 300 ammo acids and most preferably greater than 400 ammo acids in length.

A "fragment" of the Pol μ polypeptide means a stretch of ammo acid residues of at least 5 contiguous ammo acids from the sequences set out as SEQ ID Nos: 2 or 4, or more preferably at least 7 contiguous ammo acids, or more preferably at least 10 contiguous ammo acids or more preferably at least 20 contiguous ammo acids or more preferably at least 40 contiguous ammo acids. Fragments of the Pol μ polypeptide sequences may be useful as antigenic determinants or epitopes for raising antibodies to a portion of the Pol μ ammo acid sequence which also forms part of the present invention. For instance, fragments of Pol μ can act as sequestrators or competitive antagonists by interacting with other proteins, e.g. if they possess a protein interaction domain present m the full length Pol μ sequence.

A "sequence variant" of the Pol μ polypeptide or a fragment thereof means a polypeptide modified by varying the ammo acid sequence of the protein, e.g. by manipulation of the nucleic acid encoding the protein or by altering the protein itself. Such sequence variants of the natural ammo acid sequence may involve insertion, addition, deletion or substitution of one, two, three, five, ten, twenty or more am o acids.

A polypeptide according to the present invention may be isolated and/or purified (e.g. using an antibody) for instance after production by expression from encoding nucleic acid (for which see below) . Polypeptides according to the present invention may also be generated wholly or partly by chemical synthesis. The isolated and/or purified polypeptide may be used in formulation of a composition, which may include at least one additional component, for example a pharmaceutical composition including a pharmaceutically acceptable excipient, vehicle or carrier. A composition including a polypeptide according to the invention may be used m prophylactic and/or therapeutic treatment as discussed below.

The Pol μ polypeptides can also be linked to a coupling partner, e.g. an effector molecule, a label, a drug, a toxin and/or a carrier or transport molecule. Techniques for coupling the peptides of the invention to both peptidyl and non-peptidyl coupling partners are well known in the art.

Antibodies capable of binding Pol μ polypeptides A further important use of the Pol μ polypeptides is in raising antibodies that have the property of specifically binding to the Pol μ polypeptides or fragments thereof. The techniques for producing monoclonal antibodies to Pol μ protein are well established in the art. Monoclonal antibodies can be subjected to the techniques of recombinant DNA technology to produce other antibodies or chimeric molecules which retain the specificity of the original antibody. Such techniques may involve introducing DNA encoding the lmmunoglobulm variable region, or the complementarity determining regions (CDRs), of an antibody to the constant regions, or constant regions plus framework regions, of a different immunoglobulm. See, for instance, EP 0 184 187 A, GB 2 188 638 A or EP 0 239 400 A. A hybπdoma producing a monoclonal antibody may be subject to genetic mutation or other changes, which may or may not alter the binding specificity of antibodies produced.

The provision of the novel Pol μ polypeptides enables for the first time the production of antibodies able to bind it specifically. Accordingly, a further aspect of the present invention provides anti-Pol μ antibodies. Such an antibody may be specific in the sense of being able to distinguish between the polypeptide it is able to bind and other human polypeptides for which it has no or substantially no binding affinity (e.g. a binding affinity of about lOOOx worse) . Specific antibodies bind an epitope on the molecule which is either not present or is not accessible on other molecules. Antibodies according to the present invention may be specific for the wild-type polypeptide. Antibodies according to the invention may be useful m diagnostic and prognostic methods as discussed below. Antibodies are also useful purifying the polypeptide or polypeptides to which they bind, e.g. following production by recombinant expression from encoding nucleic acid.

Thus, in a further aspect the present invention provides a method of making antibodies, the method comprising employing a Pol μ polypeptide or a fragment thereof as an immunogen. The present invention also provides a method of screening for antibodies which are capable of specifically binding Pol μ polypeptide, the method comprising contacting a Pol μ polypeptide with one or more candidate antibodies and detecting whether binding occurs.

Preferred antibodies according to the invention are isolated, the sense of being free from contaminants such as antibodies able to bind other polypeptides and/or free of serum components. Monoclonal antibodies are preferred for some purposes, though polyclonal antibodies are within the scope of the present invention.

Antibodies may be obtained using techniques which are standard in the art. Methods of producing antibodies include immunising a mammal (e.g. mouse, rat, rabbit, horse, goat, sheep or monkey) with the protein or a fragment thereof. Antibodies may be obtained from immunised animals using any of a variety of techniques known in the art, and screened, preferably using binding of antibody to antigen of interest. For instance, Western blotting techniques or immunoprecipitation may be used (Armitage et al, Nature, 357:80-82, 1992). Isolation of antibodies and/or antibody-producing cells from an animal may be accompanied by a step of sacrificing the animal.

As an alternative or supplement to immunising a mammal with a peptide, an antibody specific for a protein may be obtained from a recombmantly produced library of expressed immunoglobulm variable domains, e.g. using lambda bacteriophage or filamentous bacteriophage which display functional immunoglobulm binding domains on their surfaces; for instance see WO92/01047. The library may be naive, that is constructed from sequences obtained from an organism which has not been immunised with any of the proteins (or fragments), or may be one constructed using sequences obtained from an organism which has been exposed to the antigen of interest.

Antibodies according to the present invention may be modified in a number of ways that are well known m the art. Indeed the term "antibody" should be construed as covering any binding substance having a binding domain with the required specificity. Thus the invention covers antibody fragments, derivatives, functional equivalents and homologues of antibodies, including synthetic molecules and molecules whose shape mimics that of an antibody enabling it to bind an antigen or epitope.

Humanised antibodies in which CDRs from a non-human source are grafted onto human framework regions, typically with the alteration of some of the framework amino acid residues, to provide antibodies which are less immunogenic than the parent non-human antibodies, are also included within the present invention.

A hybridoma producing a monoclonal antibody according to the present invention may be subject to genetic mutation or other changes. It will further be understood by those skilled in the art that a monoclonal antibody can be subjected to the techniques of recombinant DNA technology to produce other antibodies or chimeric molecules which retain the specificity of the original antibody. Such techniques may involve introducing DNA encoding the immunoglobulm variable region, or the complementarity determining regions (CDRs), of an antibody to the constant regions, or constant regions plus framework regions, of a different immunoglobulm. See, for instance, EP 0 184 187 A, GB 2 188 638 A or EP 0 239 400 A. Cloning and expression of chimeric antibodies are described in EP 0 120 694 A and EP 0 125 023 A.

Hybπdomas capable of producing antibody with desired binding characteristics are within the scope of the present invention, as are host cells, eukaryotic or prokaryotic, containing nucleic acid encoding antibodies (including antibody fragments) and capable of their expression. The invention also provides methods of production of the antibodies including growing a cell capable of producing the antibody under conditions in which the antibody is produced, and preferably secreted.

The reactivities of antibodies on a sample may be determined by any appropriate means. Tagging with individual reporter molecules is one possibility. The reporter molecules may directly or indirectly generate detectable, and preferably measurable, signals. The linkage of reporter molecules may be directly or indirectly, covalently, e.g. via a peptide bond or non- covalently. Linkage via a peptide bond may be as a result of recombinant expression of a gene fusion encoding antibody and reporter molecule.

One favoured mode is by covalent linkage of each antibody with an individual fluorochrome, phosphor or laser exciting dye with spectrally isolated absorption or emission characteristics. Suitable fluorochromes include fluorescem, rhodamme, phycoerythrm and Texas Red. Suitable chromogemc dyes include diammobenzidme .

Other reporters include macromolecular colloidal particles or particulate material such as latex beads that are coloured, magnetic or paramagnetic, and biologically or chemically active agents that can directly or indirectly cause detectable signals to be visually observed, electronically detected or otherwise recorded. These molecules may be enzymes which catalyse reactions that develop or change colours or cause changes electrical properties, for example. They may be molecularly excitable, such that electronic transitions between energy states result in characteristic spectral absorptions or emissions. They may include chemical entities used in conjunction with biosensors. Biotm/avidm or biotm/streptavidm and alkaline phosphatase detection systems may be employed.

The mode of determining binding is not a feature of the present invention and those skilled in the art are able to choose a suitable mode according to their preference and general knowledge.

Antibodies according to the present invention may be used m screening for the presence of a polypeptide, for example in a test sample containing cells or cell lysate as discussed, and may be used purifying and/or isolating a polypeptide according to the present invention, for instance following production of the polypeptide by expression from encoding nucleic acid therefor. Antibodies may modulate the activity of the polypeptide to which they bind and so, if that polypeptide has a deleterious effect in an individual, may be useful in a therapeutic context (which may include prophylaxis).

An antibody may be provided in a kit, which may include instructions for use of the antibody, e.g. in determining the presence of a particular substance a test sample. One or more other reagents may be included, such as labelling molecules, buffer solutions, elutants and so on. Reagents may be provided within containers which protect them from the external environment, such as a sealed vial.

Diagnostic Methods

Immunoglobulm genes are heavily mutated during an antigen-driven response and this somatic mutation is responsible for the maturation of the immune response. However, hypermutation occurs in cancer and more particularly different types of B cell lymphoma. This process leads to the mutation of tumour immunoglobulm genes, making these tumours resistant to anti-idiotypic immunotherapy . Thus, the present invention provides the use of Pol μ as a B cell tumour marker that can be used for the diagnosis or prognosis of cancer. The feasibility of this approach is demonstrated by the presence of both the Pol μ nucleic acid transcript and protein n cells corresponding to a Burkitt s lymphoma, showing that Pol μ is a valid marker for cancer and in particular for B-cell lymphomas .

In this context, there are a number of methods known in the art for analysing samples from individuals to determine the presence of Pol μ nucleic acid or polymerase. Examples of biological samples include blood, plasma, serum, tissue samples, tumour samples, saliva and urine. The purpose of such analysis may be used for diagnosis or prognosis, to assist a physician in determining the severity or likely course of the condition and/or to optimise treatment of it.

Exemplary approaches for detecting Pol μ nucleic acid or polypeptides include:

(a) determining the presence or amount of Pol μ polymerase m a sample from a patient, by measuring an activity of the Pol μ polymerase or its presence in a binding assay; or,

(b) determining the presence of Pol μ nucleic acid using a probe capable of hybridising to the Pol μ nucleic acid;

(c) using PCR involving one or more primers based on a Pol μ nucleic acid sequence to determine whether the Pol μ transcript is present a sample from a patient.

Recently, it has been described the use of microarrays to define diagnostic groups of leukemias from different origins [Alizabeth, AA et al. (2000) Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature, 403: 503-510]. In this work, a positive signal for TdT is observed m both germinal centre B-cells and in those lymphomas having the same origin. A possibility to explain these results, taking into account the expected absence of TdT in germinal centres, is that the signal obtained corresponds to a cross reaction with the Pol μ homologous enzyme described in the present invention.

The use of these techniques, or other similar, for determining the presence of Pol μ protein, or corresponding transcript, in human biological samples for diagnosis, prognosis and surveillance of different lymphoid pathologies from part of the present invention. Among these pathologies, but including other potential ones, are: acute lymphoblastic leukemia (ALL), chronic granulocytic leukemia (CGC, lymphoblastc lymphoma (LL) , B- cell leukemia, Diffuse B-cell lymphomase (DCBCL, and Burkitt 's lymphoma, among others.

The present invention provides a method for the diagnosis or prognosis of cancer, and in particular lymphoma, the method comprising determining the presence or amount of Pol μ protein or nucleic acid in a sample from a patient. The diagnosis or prognosis can then be made by correlating this level with known amounts of the Pol μ nucleic acid or protein from controls.

In one embodiment, the method comprises the steps of:

(a) contacting a sample obtained from the patient with a solid support having immobilised thereon binding agent having binding sites specific for Pol μ polymerase or Pol μ nucleic acid; (b) contacting the solid support with a labelled developing agent capable of binding to unoccupied binding sites, bound Pol μ polymerase or nucleic acid or occupied Dinding sites; and,

(c) detecting the label of the developing agent specifically binding in step (b) to obtain a value representative of the presence or amount of the Pol μ polymerase or nucleic acid in the sample.

The binding agent preferably is a specific binding agent and has one or more binding sites capable of specifically binding to Pol μ polymerase or nucleic aid in preference to other molecules. Conveniently, the binding agent is immobilised on solid support, e.g. at a defined location, to make it easy to manipulate during the assay.

The sample is generally contacted with a binding agent under appropriate conditions so that Pol μ present m the sample can bind to the binding agent. The fractional occupancy of the binding sites of the binding agent can then be determined using a developing agent or agents. Typically, the developing agents are labelled (e.g. with radioactive, fluorescent or enzyme labels) so that they can be detected using techniques well known in the art. Thus, radioactive labels can be detected using a scintillation counter or other radiation counting device, fluorescent labels using a laser and confocal microscope, and enzyme labels by the action of an enzyme label on a substrate, typically to produce a colour change. The developing agent can be used in a competitive method in which the developing agent competes with the analyte (P- type IPG) for occupied binding sites of the binding agent, or non-competitive method, in which the labelled developing agent binds analyte bound by the binding agent or to occupied binding sites. Both methods provide an indication of the number of the binding sites occupied by the analyte, and hence the concentration of the analyte m the sample, e.g. by comparison with standards obtained using samples containing known concentrations of the analyte .

Examples of specific binding pairs are antigens and antibodies, molecules and receptors and complementary nucleotide sequences. The skilled person will be able to think of many other examples and they do not need to be listed here. Further, the term "specific binding pair" is also applicable where either or both of the specific binding member and the binding partner comprise a part of a larger molecule. In embodiments in which the specific binding pair are nucleic acid sequences, they will be of a length to hybridise to each other under the conditions of the assay, preferably greater than 10 nucleotides long, more preferably greater than 15 or 20 nucleotides long.

There are various methods for determining the presence or absence in a test sample of a particular nucleic acid sequence, such as the sequence shown SEQ ID Nos: 1 or 3. Exemplary tests include nucleotide sequencing, hybridization using nucleic acid immobilized on chips, molecular phenotype tests, protein truncation tests (PTT), single-strand conformation polymorphism (SSCP) tests, mismatch cleavage detection and denaturing gradient gel electrophoresis (DGGE) . These techniques and their advantages and disadvantages are reviewed in Nature Biotechnology, 15:422-426, 1997.

Methods of Screening for Inhibitors

A further aspect of the invention provides a method of screening for inhibitors of Pol μ, that is substances which inhibit one or more of the Pol μ activities as described herein. The inhibitors may be particularly useful m blocking Pol μ activity in tumours, e.g. B cell lymphomas, m which Pol μ causes the tumour to be resistant to therapy.

It is well known that pharmaceutical research leading to the identification of a new drug may involve the screening of very large numioers of candidate substances, both before and even after a lead compound has been found. This is one factor which makes pharmaceutical research very expensive and time-consuming. Means for assisting the screening process can have considerable commercial importance and utility.

A method of screening for a substance which modulates activity of a polypeptide may include contacting one or more test substances with a Pol μ polymerase m a suitable reaction medium, testing the activity of the treated polypeptide and comparing that activity with the activity of the polypeptide m comparable reaction medium untreated with the test substance or substances. A difference in activity between the treated and untreated polypeptides is indicative of a modulating effect of the relevant test substance or substances.

Combinatorial library technology provides an efficient way of testing a potentially vast number of different substances for ability to modulate activity of a polypeptide. Such libraries and their use are known m the art. The use of peptide libraries is preferred.

Prior to or as well as being screened for modulation of activity, test substances may be screened for ability to interact with the polypeptide, e.g. in a yeast two-hybrid system (which requires that both the polypeptide and the test substance can be expressed in yeast from encoding nucleic acid) . This may be used as a coarse screen prior to testing a substance for actual ability to modulate activity of the polypeptide. Alternatively, the screen could be used to screen test substances for binding to a Pol μ specific binding partner, to find mimetics of the Pol μ polypeptide, e.g. for testing as therapeutics.

Following identification of a substance which modulates or affects polypeptide activity, the substance may be investigated further. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a composition such as a medicament, pharmaceutical composition or drug. These may be administered to individuals.

Thus, the present invention extends in various aspects not only to a substance identified using a nucleic acid molecule as a modulator of polypeptide activity, in accordance with what is disclosed herein, but also a pharmaceutical composition, medicament, drug or other composition comprising such a substance, a method comprising administration of such a composition to a patient, e.g. to reduce cancer resistance caused by Pol μ, use of such a substance in manufacture of a composition for administration, and a method of making a pharmaceutical composition comprising admixing such a substance with a pharmaceutically acceptable excipient, vehicle or carrier, and optionally other ingredients.

Pharmaceutical Compositions Pol μ proteins, inhibitors or nucleic acid of the invention can be formulated in pharmaceutical compositions .

These compositions may comprise, m addition to one of the above substances, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may depend on the route of administration, e.g. oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, mtrapeπtoneal routes .

Pharmaceutical compositions for oral administration may be in tablet, capsule, powder or liquid form. A tablet may include a solid carrier such as gelatin or an adjuvant. Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil.

Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.

For intravenous, cutaneous or subcutaneous injection, or injection at the site of affliction, the active ingredient will be m the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using, for example, lsotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, Lactated Ringer's Injection. Preservatives, stabilisers, buffers, antioxidants and/or other additives may be included, as required.

Whether it is a polypeptide, antibody, peptide, nucleic acid molecule, small molecule or other pharmaceutically useful compound according to the present invention that is to be given to an individual, administration is preferably m a "prophylactically effective amount" or a "therapeutically effective amount" (as the case may be, although prophylaxis may be considered therapy) , this being sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Prescription of treatment, e.g. decisions on dosage etc, is within the responsibility of general practitioners and other medical doctors, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington' s Pharmaceutical Sciences, 16th edition, Osol, A. (ed) , 1980.

A composition may be administered alone or m combination with other treatments, either simultaneously or sequentially, dependent upon the condition to be treated. In a preferred embodiment, inhibitors of Pol μ polymerase can be used as an adjunct to cancer therapy to treat resistance to therapy caused by Pol μ present in tumour cells, e.g. by using the inhibitors in conjunction with a cancer treatment and especially anti-idiotypic lmmunotherapy . Examples of lymphomas that can oe treated according to the present invention include acute lymphoblastic leukemia (ALL) , chronic granulocytic leukemia (CGC, lymphoblastc lymphoma (LL) , B-cell leukemia, diffuse B-cell lymphomase (DCBCL), and Burkitt s lymphoma.

Identification of DNA Polymerase Mu m Human Cells

The cDNA sequence (2580 nucleotides) of Pol μ (SEQ ID No: 1) codes for a 494 ammo acid protein (SEQ ID No: 2) with 42% identity to TdT (Bentolila et al, (1995) The two isoforms of mouse terminal deoxynucleotidyl transferase differ both the ability to add N regions and subcellular localization. EMBO J. , 14, 4221-4229). Fig. 1 shows an ammo acid sequence alignment between Pol μ and TdTs from different origins, allowing to define an average of 42% of identical ammo acids among these two enzymes. This value is significantly higher than that observed between Pol μ and Pol β (23%), or between Pol β and TdT (22%). The ammo acid sequence "PKRRRAR", located between residues 3 and 9 of the Pol μ sequence, is predicted to be a nuclear localization sequence (NLS) of the most common (SV40 large T antigen) . A similar sequence has been proposed for TdTs (Bentolila et al, (1995) The two isoforms of mouse terminal deoxynucleotidyl transferase differ m both the ability to add N regions and subcellular localization. EMBO . , 14, 4221-4229). Moreover, the region spanning ammo acid residues 22 and 118 of Pol μ contains a BRCT domain (Callebaut & Mornon, (1997) From BRCA1 to RAP1: a widespread BRCT module closely associated with DNA repair. FEBS Let t . , 400, 25- 30; Bork et al, (1997) A superfamily of conserved domains in DNA damage-responsive cell cycle checkpoint proteins. FASEB J. , 11, 68-76). This domain, whose name derives form its initial identification at the C-termmal domain of BRCA1 protein, is proposed to be involved in protein: protein interactions in a variety of proteins involved in DNA repair and response to DNA damage (Bork et al, (1997) A superfamily of conserved domains m DNA damage- responsive cell cycle checkpoint proteins. FASEB J. , 11, 68-76) . As shown in Fig. 1, residues 141 to 494 of Pol μ form a polymerase "core" homologous to Pol β (Pelletier et al, (1994) Structures of ternary complexes of rat DNA polymerase beta, a DNA template-primer, and ddCTP. Science, 264, 1891-1903). In this region, homologous to Pol β, Epol μ and TdT can be aligned with minimal discontinuities, restricted to connecting regions between certain structural elements. Neither Pol μ nor TdT contain the critical residues forming a dRPase (deoxyribose phosphate lyase) active site, as defined in Pol β (Matsumoto et al, (1998) Catalytic centre of DNA polymerase β for excision of deoxyribose phosphate groups. Biochemistry, 37, 6456-6464; Prasad et al, (1998) Human DNA polymerase β deosyribose phosphate lyase. Substrate specificity and catalytic mechanism. J. Biol . Chem . , 273, 15263-15270.). Pol μ shares 139 (66%) out of the 209 ammo acid residues that are invariant among TdTs from different origin, suggesting a common structure, not only evolutionaπly but also functionally conserved. Moreover, Pol μ conserves 21 out of the 23 ammo acid residues that are invariant among all members of the polymerase X superfamily, including those residues involved in metal, dNTP and DNA binding, and those involved m conformational changes induced by the formation of the ternary complex between the enzyme and its two substrates, DNA and dNTPs (see Fig. 1 of the paper by Oliveros et al, (1997) .

Characterization of an African Swine Fever Virus 20-kDa DNA polymerase involved in DNA repair. J. Biol . Chem . , 272, 30899-30910) . On the other hand, we have identified and cloned the cDNA sequence corresponding to the mouse orthologue of Pol μ (SEQ ID No: 3), which codes for a protein of 496 ammo acids (SEQ ID No: 4), and which also forms part of the present invention.

Enzymatic Activity of Pol u a) DNA polymerase activity associated to Pol μ

Human Pol μ, described m the present invention, was overproduced m E . col i and purified as described in the following examples. A recombinant protein of 55 kDa was obtained in soluble form and with a high yield (Fig. 2A) . Taking into account that DNA polymerases from family X are low processive enzymes without a 3 '-5' exonuclease, we selected assay conditions that would favour detection of a TdT-related enzyme as Pol μ, versus the endogenous E. coli DNA polymerases. Thus, labelling of activated neteropolymeπc DNA was assayed at low concentration of dATP, as the only nucleotide, and activating Mn^,+ ions. These conditions should favour both complementary and non- complementary incorporation by a terminal transferase (template-independent), but also by error-prone DNA- dependent DNA polymerases, lacking exonucleolytic proofreading. As shown in Fig. 2B, under these conditions, DNA labelling by commercial TdT was about 10- rold more efficient when using Mn versus Mg " ions. On tne other hand, an inverse behaviour was observed when using the Klenow fragment of E . col i Pol I. As shown m Fig. 2C, the labelling activity was detected in the 50% ammonium sulphate precipitates corresponding to the induced extracts, overproducing Pol μ, but was barely undetectable in the non-mduced fraction. Interestingly, the catalytic efficiency of the induced DNA polymerase was 20-fold higher in the presence of Mn²⁺ versus Mg²⁺ιons. This DNA polymerase activity was associated to a 55 kDa polypeptide throughout the purification procedure. As an additional demonstration that the DNA polymerase activity detected was intrinsic to Pol μ, the heparm-sepharose

(HS) fraction was subjected to sedimentation m a glycerol gradient. Fig. 3 shows a DNA polymerase activity, preferentially activated by Mn ' ions, perfectly cosedimented at a molecular weight corresponding to the monomeric form of Pol μ. Neither 3 '-5' exonuclease nor endonuclease activities were associated with the Pol μ peak. Fraction 9 and 10 of the glycerol gradient were used as an enzyme source for further activity assays.

b) Terminal transferase activity associated to human Pol P -

In agreement with the similarity between Pol μ and TdT, a terminal transferase activity intrinsic to Pol μ was demonstrated by using different oligonucleotides as single-stranded primers, and in the presence of the preferred metal activator (Mn²⁺) . As shown in Fig. 4A, Pol μ was able to catalyse the polymerization of any of the four dNTPs to a ssDNA primer in the absence of a template DNA. The catalytic efficiency of the terminal transferase activity associated to Pol μ varied as a function of the dNTP used, being TTP and dCTP (both pyrimidme nucleotides) the most efficiently inserted, and dATP the worst nucleotide as substrate. A different preference was observed when using commercial TdT, being dGTP and dCTP the preferred substrates under the same conditions. The terminal transferase activity associated to Pol μ was also detected, although at a lower efficiency, using double-stranded DNA with a blunt-ended primer-termmus, a behaviour previously described in the case of TdT.

Therefore, Pol μ is able to catalyze significant levels of terminal transferase activity, i.e. polymerizing deoxynucleotides m the absence of a DNA template. However, the level of incorporation of TMP on a ssDNA substrate as oligo dT or Poly dA, provided independently, were significantly increased (up to 370-fold) when both were pre-mcubated to form a primer template structure (Fig. 4B) . On the other hand, TdT catalyzed a similar nucleotide incorporation on both ssDNAs and Poly dA/oligo dT substrates, m agreement with its template- mdependency. Thus, in spite of its intrinsic terminal transferase activity, Pol μ must be considered as a DNA- dependent DNA polymerase since it requires a DNA template for optimal activity. c) Pol μ is an error-prone DNA-dependent DNA polymerase

Interestingly, when the polymerization assay on activated DNA (used to monitor Pol μ activity along the purification procedure), was carried out m the presence of the four dNTPs, a strong inhibition of the incorporation of the radiolabelled substrate (dATP) was enormously inhibited (Fig. 5A) . In fact, under the standard conditions used for most DNA polymerases (a 100-fold higher concentration of non-labelled versus labelled nucleotide precursors), Pol μ activity would not be detectable. A similar inhibition was observed for TdT, whereas dAMP incorporation by the Klenow enzyme was stimulated (11- fold) by addition of the tour deoxynucleotides.

Moreover, dAMP incorporation catalyzed by Pol μ on Pol dT/oligo dA was strongly inhibited by low concentrations of any of the three non-complementary nucleotides (Fig. 5B) . An identical behaviour was obtained with TdT in a parallel assay. On the contrary, addition of non- complementary nucleotides had no effect on the nucleotide incorporation carried out by the Klenow enzyme (see Fig. 5B) . These results suggest that dAMP incorporation by Pol μ is competed by the presence of the other nucleotides, as it would be expected for a TdT, which is template- independent, and for a DNA-dependent DNA polymerase with a very limited base discrimination upon template direction.

The ability of Pol μ to discriminate among the four deoxynucleotides (base discrimination) to catalyse template-directed DNA synthesis was evaluated with the four primer/template structures shown m Fig. 6. The four deoxynucleotides, provided at different concentrations, were individually assayed as substrates with each of these structures, thus covering the analysis of the possible 16 nucleotide pairs (4 matched and 12 mismatched) . The same primer molecule (ssDNA), in the absence of a template, was assayed in parallel to estimate the terminal transferase activity of Pol μ with the four dNTPs. As shown in Fig. 6, under these conditions, only TTP was incorporated to the ssDNA primer. On the contrary, when using the four template/primer structures, a preferential insertion of the complementary nucleotide was observed in the presence of Mg"^~, indicating that the catalytic efficiency (Kcat/Km) was improved by template selection of the incoming nucleotide (it is important to note that the complementary nucleotide in each case was always added at a 10-fold lower concentration than that used m the absence of template). However, template selection appears to be not strict, since the enzyme is able to add non- complementary nucleotides at a concentration of 100 μM

(Fig. 6) . The incorporation frequency corresponding to a G (template) :A mispair was estimated to be only 10 to 50- fold lower than that corresponding to a normal G (template) : C pair.

In the presence of activating n^ ions, the pattern and efficiency of nucleotide incorporation changed drastically (Fig. 6). In most cases, dNTP incorporation was stimulated by the presence of a DNA template (note that in this case, the nucleotide concentration used in all cases was 1000-fold lower than that used with activating Mg- 10ns), but with a poor or null base selectivity. As an example, when dC is the first template base, the four dNTPs appear to have similar probabilities to be inserted. Exceptionally, dGTP incorporation was restricted to occur mainly in front of its pair complement. Moreover, inserted errors are efficiently elongated, not only favoured by complementarity but also as reiterative mismsertions, particularly when using dTTP and dATP substrates. In the same assay, a Pol β-like enzyme of only 20 kDa (ASFV Pol X) was shown to extend the four template/primer structures only by adding the correct (complementary) deoxynucleotide, but not by adding an excess (400 μM) of each of the three wrong (non- complementary) deoxynucleotides (Oliveros et al, (1997). Characterization of an African Swine Fever Virus 20-kDa DNA polymerase involved in DNA repair. J. Biol . Cnem . , 272, 30899-30910) . Similar results were obtained when n' was used instead of Mg as metal activator. All these results demonstrate that Pol μ is an error-prone DNA-dependent DNA polymerase. Interestingly, m tne presence of its preferred activator (Mn ) , Pol μ behaves as a strong mutator, lacking base discrimination during nucleotide insertion on a DNA template-primer structure. Exceptionally, Pol μ preferentially inserts a dG in front of its complementary dC template base even in the presence

The results presented in this invention demonstrate that Pol μ shares enzymatic properties with different members of the Pol X family. As TdT, its closest homologue, Pol μ is endowed with an intrinsic terminal transferase activity, that preferentially inserts pyrimidme nucleotides. Thus, its relative nucleotide usage, different than that observed for TdT, is: dT»dC>dG>dA. As Pol β and other DNA-dependent DNA polymerases, but unlike TdT, the catalytic efficiency of nucleotide incorporation by Pol μ was largely enhanced by the presence of a template strand. Both terminal transferase and DNA-dependent DNA polymerization activities of Pol μ are strongly activated m vi tro by manganese ions. Interestingly, in the presence of its preferred activator (Mn ) , Pol μ behaves as a strong mutator, lacking any base discrimination during nucleotide insertion. TdT is a DNA polymerase with very special features that have been exploited to develop novel tools for DNA detection in both medical diagnosis and forensics analysis (US Patent No: 5,912,126), in addition to its convenience to induce mutagenesis among other uses m molecular biology techniques. On the same basis, the Pol μ enzyme described in the present invention could be used as an alternative terminal transferase with different specificity, and also as a mutator DNA-dependent DNA polymerase, particularly enhanced by the use of activating

d) Expression of a truncated form corresponding to the catalytic domain of human Pol μ . Based on ammo acid sequence alignments with TdT and Pol β, a truncated version of human Pol μ, lacking the BRCT domain and maintaining the Pol β-like domain, was independently expressed m E. coll . The truncated Pol μ (358 ammo acids) has an N-termmal sequence starting at ammo acid residue 138 of the full length Pol μ. After overproduction and purification, the truncated Pol μ displayed an specific activity several-fold higher than the enzyme containing the BRCT domain, suggesting that this domain could play a regulatory role m vivo . Since this truncated form was highly active, it was possible to determine the base discrimination parameters also m the presence of activating Mg ions. As occurred with the complete enzyme, the truncated form displayed intrinsic terminal transferase activity, and a highly error-prone DNA-dependent DNA polymerase activity. As shown in Fig. 7, the truncated enzyme incorporates mismatches at a different frequency, according to the nature of the template base. The three most frequent errors made by this polymerase are: G (template) : A mismatch, occurring at the same frequency than the normal G (template) : C pair; G (template) : T mismatch, occurring at a frequency of 1x10^" -; C (template) : A mismatch, occurring at a frequency of 1x10^" . The fact that the polymerization properties of Pol μ are maintained in the truncated version, lacking the BRCT domain, opens the possibility to construct chimaeras with TdT and Pol μ, that could display hybrid properties and improved solubility when overproduced E . col i .

Pol u mRNA is Predominantly Expressed m Perypheral Lymphoid Tissues

Quantitative analysis of Pol μ transcription levels in different human tissues were carried out by Northern blotting using commercial membranes containing normalized amounts of Poly A RNA from different human tissues. As shown in Fig. 8, a major transcript migrating at approximately 2.6 kb, in agreement with the size of the cDNA isolated (2589 nt), was accumulated at the highest level in lymph nodes, followed by spleen, thymus, pancreas and peripheral blood lymphocytes. Lower levels of this transcript were present m the other tissues examined, being undetectable only in lung. By searching the EST database using Pol μ cDNA, we identified a collection of 40 ESTs corresponding to human Pol μ; 37% of these ESTs derive from different tumours. It is worth noting that 36% of the non-tu oral ESTs of Pol μ derive from human tonsillar cells enriched for germinal center B cells (CD20~, IgD^") by flow sorting (library NCI-CGAP-GCB1 ) . The significance of this finding is stressed by the fact that only 7% of the available ESTs corresponding to Pol β, a housekeeping DNA repair polymerase, derive from germinal centre B cells. All these data suggested that Pol μ mRNA could be preferentially expressed in human B cells, particularly m populations associated with the germinal centre structures present in secondary lymphoid organs. It is important to stress also the high level of expression of the Pol μ mRNA in Ramos cell line (Sale & Neuberger, (1998) TdT-accessible breaks are scattered over the immunoglobulm V domain in a constitutively hypermutatmg B cell line. Immuni ty, 9, 859-869), that is a cell line derived from a Burkitt s lymphoma, a class of B-cell lymphomas.

To confirm this suggestion, we used m si tu hybridization to analyse localization, at the cellular level, of the Pol μ mRNA present in different human tissues. Using a specific antisense probe corresponding to the first 1200 nucleotides of Pol μ cDNA (see materials and methods), expression of Pol μ mRNA was observed in tissue sections corresponding to human secondary lymphoid organs. Thus, as shown in Fig. 9, and m agreement with the data obtained by Northern-blotting, the stronger signal was found m peripheral lymph node sections; a strong signal was also found in sections from spleen. Hybridization specificity was assessed by using a sense πboprobe under the same experimental conditions and in a close parallel tissue section, not producing a comparable signal (see Fig. 9) . In similar experiments, other human organs as muscle, lung or even bone marrow (the latter shown in Fig. 9) , a myelo-lymphoid tissue, were negative or faintly positive in comparison with the corresponding negative control. As shown in Fig. 9, the level of expression of the Pol μ mRNA in lymph nodes seems to be high, m comparison with other markers for centroblastic populations as A-myb. Besides, the m si tu hybridization pattern obtained is compatible with a preferential expression in the follicular lymphoid region, with a variable expression in different areas and not restricted to a particular cell subpopulation . The expression levels of Pol μ mRNA in spleen is lower in comparison with that observed in lymph nodes, and more restricted to particular structures as that shown in Fig. 9, that resembles the typical organization of a germinal center in a secondary follicular area. Also in this case, expression of Pol μ mRNA does not seem to be preferentially associated with a discrete cell subpopulation .

Pol u Forms Foci At the Nuclei of Human Centroblasts

To analyse the expression of Pol μ protein at the cellular level, we carried out mmunostainmg of purified populations of B-cells derived from secondary lymphoid organs, using purified IgGs obtained from the rabbit polyclonal antiserum against human Pol μ. As shown in Fig. 10, Pol μ was detected forming a specific pattern or foci at the nuclei of human centroblasts, that were flow- sorted from human tonsils. This pattern appears to be very specific of this B-cell developmental stage, since it was absent n other B-cell types, as circulating peripheral blood lymphocytes (PBLs). This result correlates with the proposed function of Pol μ as the enzyme responsible for somatic hypermutation, since this process is known to occur selectively at the developmental stage corresponding to centroblasts.

Pol , a Candidate Enzyme for Somatic Hypermutation of Ig Genes

During B-cell development, V(D)J recombination m pro/preB cells of the bone marrow creates the primary repertoire of antibody specificities. Following antigen encounter, the rearranged V genes of those cells that have been triggered by the antigen are subjected to a second mechanism for affinity maturation and further specificity diversification, known as somatic hypermutation since its first description in 1970 (Weigert et al, (1970) Variability in the lambda light chain sequence of mouse antibody. Na ture, 228, 1045-1047). There is a strong evidence in mouse, man and sheep that the germinal centres formed at secondary lymphoid organs are the site wherein antigen-stimulated B cells acquire somatic mutations (Berek et al, (1991) Maturation of the immune response in germinal centers. Cell, 67 1121-1129; Jacob et al, (1991) Intraclonal generation of antibody mutants in germinal centres. Na ture, 354, 389-392). Hypermutation introduces an estimated rate of 10^"' to 10^"" point mutations (per base pair per generation) specifically into the variable (V) regions of the gene segments encoding for Igs, being about 10^D-fold higher that the spontaneous mutation rate operating m the rest of the genome (Neuberger & Milstem, (1995) Somatic hypermutation. Curr. Opi . Immunol . 7, 248- 254). It has been reported that Ig hypermutation exhibits a distinctive pattern of nucleotide mismcorporations favouring transition mutations (Goldmg et al, (1987) Patterns of somatic mutation m immunoglobulm variable genes. Genetics, 115, 169-176) and targeting G:C base pairs preferentially (Betz et al, (1993) Discriminating intrinsic and antigen-selected utational hotspots m immunoglobulm V genes. Immunol Today, 14, 405-411; Bachl & and Wabl, (1996) An mmunoglobulm mutator that targets G:C base pairs. Proc. Na tl . Acad. Sci . USA, 93, 851-855). Several di- or trmucleotides have been defined as hot spots (Smith et al, (1996) Di- and trmucleotide target preferences of somatic mutagenesis in normal and autoreactive B cells. J. Immunol . , 156, 2642-2652) being the most important the G:C base pair embedded in the motifs CAGCT and AAGTT (Betz et al, (1993) Discriminating intrinsic and antigen-selected mutational hotspots m immunoglobulm V genes. Immunol Today, 14, 405-411; Betz et al, (1994) Elements regulating somatic hypermutation of an immunoglobulm kappa gene: critical role for the mtron enhancer/matrix attachment region. Cell , 11 , 239-248) and short palindromes or hairpin loops (Levy et al, (1988) Mutational hot spots in IgV region genes of human follicular lymphomas. J. Exp . Med. , 168, 475-489). Recently, analysis of the neighbour sequences proximal to the substituted nucleotides in the IgV_ genes suggests the existence of different GC and AT mutators (Spencer et al, (1999) Characteristics of sequences around individual nucleotide substitutions in IgV_H genes suggest different GC and AT mutators. J. Immunol . , 162, 6596-6601).

The original model proposed that somatic hypermutation is triggered by the generation of single- or double-strand breaks in the V region followed by an error-prone repair mechanism (Brenner & Milstem, (1966) Origin of antioody variation. Na ture, 211, 242-243). More recently, the study of lymphoid cell lines that undergo a constitutive (Sale and Neuberger, 1998) or inducible (Denepoux et al . , 1997; Zan et al . 1999) hypermutation demonstrated that such a DNA strand breaks are specifically scattered within the V mutation domain (Sale & Neuberger, 1998). Although dissection of the mechanism involved m somatic hypermutation have rendered important clues about cis- actmg factors, the enzymatic activities involved in the process are still a matter of speculation (reviewed by Winter & Gearhart, 1995). A reverse transcriptase activity was early proposed to be involved m the process because of its low level of fidelity (Steele & Pollard, 1987) although no further experimental support has been reported. Recently, it has been proposed that somatic hypermutation is taking place by an error-prone and short patch DNA synthesis process occurring outside of global semi conservative DNA replication (Bertocci et al, 1998). This proposal also agrees with recent reports describing that the postreplicative mismatch repair is not either primarily involved in the hypermutation process (Winter et al, 1998; Jacobs et al, 1998; Frey et al, 1998; Phung et al, 1998), or merely as a co-option mechanism (Cascalho et al, 1998) . Based on all this evidence, a candidate utagenic DNA polymerase, functionally analogous to Pol β and "copying" very short segments of DNA, has been invoked (Bertocci et al, 1998) .

TdT was the first proposed candidate to be a somatic mutagen in lymphocytes (Baltimore, 1974). 24 years later, it has been demonstrated that the DNA strand breaks specifically occurring at the V segments of Ig genes are accessible to TdT when this enzyme is transfected m Ramos cell line (Sale & Neuberger, (1998) TdT-accessible breaks are scattered over tne immunoglobulm V domain in a constitutively hypermutatmg B cell line. Immuni ty, 9, 859-869) . As shown here, a novel TdT-like DNA polymerase, Pol μ is preferentially expressed in secondary lymphoid tissues, and a large proportion of the ESTs corresponding to this polymerase derive from germinal center B cells. This circumstantial evidence, together with the catalytic properties of Pol μ as a strong mutator DNA polymerase, makes this enzyme a suitable candidate to participate in somatic hypermutation of Ig genes.

On the other hand, Pol μ is also expressed in non-lymphoid tissues, although at a lower level. Thus, it can not be discarded that Pol μ could be implicated m additional processes leading to mutagenesis, as it occurs in most tumours. In summary, Pol μ is a novel target, potentially implicated in the ethiopathogenesis of cellular processes leading to proliferation, that opens new perspectives in the search for new therapeutical compounds. In this sense, the different and specific assays for Pol μ activity described in this invention can be established to identify compounds able to regulate and/or inhibit Pol μ activity, that would be potentially useful for the treatment of pathologies directly involving Pol μ. A system to identify inhibitor and regulator compounds of Pol μ activity, together with their potential use as therapeutics, form part of the present invention.

DNA Polymerases As Specific Tumour Markers

TdT

It is well known that TdT is expressed at higher than normal levels in several disorders of the immune system, and it has been used for the diagnosis of human leukemias. Today, TdT is a valuable marker in lymphoblastic neoplasias like acute lymphoblastic leukemia (ALL) , cronic granulocytic leukemia (CGL) and lymphoblastic lymphoma (LL) . It has been developed several methods for quantification of TdT expression levels in clinical samples. One of them (US Patent No: 4,307,189) consists on measuring the biological activity of TdT by using radioactive or fluorescent deoxmucleotides . More recently, several monoclonal antibodies have been obtained that recognize TdTs from different species, including human, mouse, rat, rabbit and cow. These mAbs, as well as improvements of the immunoassays used, have allowed the precise quantification of TdT (US Patent Nos: 4,977,086, 4,839,289, and 8,818, 686) .

The levels of TdT expression have become an objective method for leukemia diagnosis, which is preferable to the previous, more ambiguous system of morphological classification. An specific diagnostic is crutial for choosing the better possible treatment, because in ALL and CGL the expression of TdT predicts an initial response to vmcrist and precdysone. Besides, TdT disappear from blood during the remission phase and reappears months before a recidive, which allows the establishment of appropiate therapeutic strategies. Pol u

Classification of human lymphomas has evolved relatively little from its original description (Hodgkin, 1832). The ma division remains between Hodgkin and non-Hodgkm lymphomas, but more precise diagnostic is still problematic. One of the more recent systems for lymphoma classification is the Revised European-American Lymphomas (REAL) , which defines different morphologic groups despite strong evidences that several of them included more than one clinical entity. An example of hard to diagnose lymphoma is the diffused large blood cell lymphoma (DLBCL). The many attempts to define different subtypes on a morphological basis have failed (Harris et al, 1994). DLBCL accounts for 40% of non-Hodgkm lymphomas and has an annual incidence of about 25,000 cases. Patients with

DLBCL show very different characteristics, and prognosis is made from a combination of parameters that is very uncertain due to the high variability of this type of lymphoma .

Because many properties of a malignant cell are derived from its normal progenitor, it has been tried to classify B-cell malignancies based on particular differentiation states. In DLBCL patients, as well as in most non-Hodgkm lymphomas, the Ig genes from tumoral cells show mutations similar to those generated during somatic hypermutation. Using DNA microarrays, it has been demonstrated that some DLBCLs are originated in germinal centres (GC) (GC B-like DLBCL) or correspond to peripheral B-cell activation states (activated B-like DLBCL) (Alizadeh et al, 2000) . In this study, patients with GC B-like DLBCL had showed higher survival rates than those with activated B-like DLBCL.

GC B-like DLBCL, as well as other GC derived B-cell lymphomas can be divided in two different groups, based on the activity of somatic hypermutation. It is very important to discriminate both types of lymphomas, because those with ongoing somatic hypermutation present a more greater variability, which diminishes the effectivity of anti-idiotypic therapies. Moreover, other cellular genes besides Igs, like the proto-oncogene bcl - 6, have recently been shown to undergo somatic hypermutation in GCs (Shen et al, 1998; Muschen et al, 2000) . This points to the intriguing possibility that misregulated somatic hypermutation itself could be the origin for some B-cell malignancies .

Preliminary experiments have shown a clear correlation between Pol μ expression and the previous characterization of ongoing bcl-6 SH in the samples. These data, together with all the evidences summarized previously, strongly support the hypothesis that Pol μ could be a specific marker for certain types of B-cell lymphomas.

Production of Polyclonal Antibodies Capable of Specifically Recognizing Human Pol μ

As described before, the ammo acid sequence of Pol μ shares a 41% of am o acid identity with TdTs from several origins. This suggests that previous methods to identify TdT as part of the differential diagnostic of leukemia, prognosis and therapeutic decisions, could be conditioned by the simultaneous or alternative presence of Pol μ and TdT. Since the TdT ammo acid sequences recognized by monoclonal antibodies anti-TdT have not been determined (US Patent Nos: 4,977,086 and 4,839,289), it can not be discarded that part of the signal detected can be due to the Pol μ described in the present invention. Therefore, it was important to develop specific antibodies that could recognize Pol μ selectively, allowing its unequivocal association to both normal and pathological cell types and tissues .

With this purpose, rabbit polyclonal antibodies specific for Pol μ were developed, via inoculation of the complete Pol μ enzyme overproduced in E. coli cells. Each rabbit was immunised with 300 μg of Pol μ, purified from E. col i extracts, as described in the present invention. Afterwards, the sensitivity of the rabbit antisera was tested by Dot-blotting, using different amounts of purified Pol μ as antigen. The specificity of the Pol μ- antibodies was tested by Western blotting of different protein extracts (Fig. 11) . As shown in this figure, the anti-Pol μ antibodies were able to recognize, in a specific form, the band corresponding to Pol μ m the purified extracts obtained from E . colr-pRSET-hPolμ. A band with the size corresponding to Pol μ was also observed m nuclear extracts derived from mouse spleen. Finally, Fig. 11B shows a clear signal m nuclear extracts derived from a human cell line (RAMOS) . This cell line derives from a Burkitt 's lymphoma (B-cell lymphoma), characterized by a constitutive somatic hypermutation process as the cells are maintained m culture. Therefore, the results obtained are compatible with the proposed function for Pol μ, and suggest that Pol μ could be used for diagnosis of germinal centre-derived B-cell lymphomas that are hypermutation competent.

Using dot-blotting, it was possible to discard the existence of a significant cross-reactivity with commercial TdT of the Pol μ polyclonal antisera developed m the present invention (Fig. 9A) .

Examples Example 1: Identi ication and gene cloning of human Pol μ An expressed sequence tag (EST) clone (genbank ace. no. AA298793) containing the partial sequence of a putative new DNA polymerase was identified by GAPPED-BLAST (Altschul et al, 1997) search of the NCBI EST Database using as probes different conserved ammo acid segments belonging to the catalytic core of DNA polymerases belonging to family X, derived from the alignment reported by Oliveros et al, (1997) . This new putative polymerase, named Pol μ fulfills the consensus pattern: G- [SG] - [LFY] - x-R-[6E] -x(3) -[SGCLj-x-D- [LIVM] -D- [LIVMFY] (3 ) -x (2 ) - [ SAP] , corresponding to the DNA polymerase X signature (PROSITE: PDOC00452). Human Pol μ cDNA sequence was obtained through a succession of overlapping cloning steps. First, the EST clone AA298793, identified by BLAST analysis, was obtained from the I.M.A.G.E. Consortium (Lennon et al, 1996; http: //www-bio . llnl . gov/bbrp/image/image . html ) , sequenced and shown to contain 1141 nt corresponding to the 3' end of the putative Pol μ. A segment of 5'- upstream sequence was gained by PCR on placenta cDNA from a specific antisense primer derived from the EST clone (ASH2: 5 -AAAAATGTCTTCTGCTCCGG) and a degenerate sense primer derived from the most conserved coding portions of the TdT gene family (S2G: 5 ' -ACAGGGGGGTTCCGGAGGGG) . PCR was performed with a standard profile of 95°C/15 sec, 62°C/15 sec, and 72°C with an extension time of 1 mm per kb to be amplified and a number of cycles defined by the template concentration. Reaction primers were used at 1 μM and either Taq, Pfu, or a blend of both (Marathon, Clontech) DNA polymerases, at 40 U/ml in elsewhere standard conditions. Further upstream sequence was cloned by 5' -RACE (Marathon, Clontech) on placenta cDNA, using the antisense gene specific primer h2asR (5 - CAGGCGGCACATCACTCT) . Placenta Pol μ cDNA was completed at the 3 -end by specific PCR between primers h2sR (5 - GAAGTTGCAGGGCCATGAC) and h2asZ (5 -CCTCGCCTAACAAAGTGGC) . The placenta cDNA so obtained contained an open reading frame highly homologous to the TdT sequence but interrupted by a frameshift at position 687. Pol μ sequence was confirmed on RAMOS cell line in which cDNA clones without frameshift were found. Pol μ cDNA has a length of 2589 bp, with 45 bp of 5' untranslated region, 1482 bp of coding sequence (494 aa), and 1062 bp of 3' untranslated region (SEQ ID NO 1) .

Example 2 : Chromosomal mapping

A preliminary mapping of human Pol μ was carried out by PCR screening of a panel of human-rodent somatic cell hybrids (BIOS Somatic Cell Hybrid PCRable DNAs, BIOS Laboratories. New Haven, Conn.). Following a 3 min- denaturation step at 94°C, 40 cycles of amplification were performed: 94°C for 1 mm, 55°C for 1 mm and 72°C for 1 mm. The PCR reactions were performed m a total volume of 10 μl, using 25 ng of template, 5μM primers h2MAPs (5^'- GCCACTGAATGTCTCCAAGC) and h2MAPas (5^'- TGCAGTGCAGGTATGCATGG) , 1.25 mM MgCl₂, 0.2 mM dNTPs and 0.025 units of Taq DNA polymerase (Gibco) m the buffer supplied by the manufacturer. No signal was detected from mouse and hamster genomic DNA using these amplification conditions. Using the same specific primers, h2MAPs and h2MAPas, a more precise chromosomal mapping of POLM gene, coding for Pol μ, was carried out by PCR screening of the High Resolution Stanford TNG3 Radiation Hybrid Panel RH03.02 (Research Genetics, Huntsville, AL) . The PCR reactions were performed as described above. Data were submitted to the Stanford Radiation Hybrid Server

(rhserver@shgc.stanford.edu), which returned the linked data. The human gene (POLM) coding for Pol μ was initially mapped to chromosome 7 by using a panel of human/rodent somatic cell hybrids. By radiation hybrid analysis, the SHGC marker which best linked with POLM gene was SHGC-6115, with a lod score of 8.2. Based on the correspondence of this marker with the GCK gene, POLM gene has been mapped within band 7pl3. This region constitutes one of the four known fragile sites in lymphocytes, with a high incidence of molecular alterations such as deletions, inversions and translocations .

Example 3: Overproduction of human Pol μ in E. coli cells

The complete coding sequence corresponding to Pol μ was cloned into the pRSET-A bacterial expression vector

(Invitrogen) , Pol μ complete ORF was RT- PCR-amplifled from RAMOS initially in two overlapping fragments (h2NdeATGs-h2asQ3 and h2sQ2-h2ERlTGAas ) that were subsequently merged into a single full length cDNA by PCR with the outer primers (h2NdeATGs-h2ERlTGAas ) . The amplified 1485 bp product, from initiation to stop codon, was cloned m pZERO (Invitrogen), verified by sequencing, and subcloned at the Ndel /EcoRI sites of the expression vector pRSET (Invitrogen), resulting in the construct named pRSET-hPolμ. Expression of Pol μ was carried out in the E. coli strain BL21(DE3) pLysS, that contains T7 RNA polymerase gene under the control of the lacUV5 promoter, mducible by isopropil β-D-thiogalactopyranoside (IPTG), and a plasmid constitutively expressing T7 lysozyme (Studier & Moffatt, (1986) Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol . Biol . , 189, 113-130; Studier, (1991) Use of bacteriophage T7 lysozyme to improve an mducible T7 expression system. J. Mol . Biol . , 219, 37- 44). These cells were transformed with plasmid Las pRSET- hPolμ and incubated overnight at 37°C in LB medium supplemented with the appropriate antibiotics. LB medium was re-mnoculated (1:10) with an overnight culture, and incubated at 37°C, up to a optical density of 0.6 units at 600 nm. Then, 0.5 mM IPTG (SIGMA) was added, and the incubation was continued fro two additional hours 37°C. Total extracts were obtained by freezing-thawing and further sonication of the cell pellet, resuspended in buffer containing 20 mM Tris-HCl pH 8 , 1 mM EDTA, 1 mM DTT, 1 mM PMSF and 5% glycerol, supplemented with 500 mM NaCI. The soluble fraction was obtained by centrifugation for 15 mm at 15000 x g, at 4°C. Overproduction and solubility was analyzed by SDS-polyacrylamide gel electrophoresis and subsequent Blue Coomassie staining.

Example 4 : Purification of human Pol μ

E. coli cells expressing human Pol μ were grounded with alumina for 20 mm at 4^&C, the resulting lysate was resuspended in buffer A (50 mM Tris-HCl, pH 7.5, 1 mM DTT, 1 mM EDTA, 4% glycerol, 0.1 mg/ml BSA) supplemented with 0.5 M NaCI (6 volumes per gram of cells), and centπfuged for 15 mm at 15000xg to separate alumina and insoluble proteins (debris) from the soluble extract. All the following purification steps were carried out at 4°C. The supernatant was diluted with buffer A + 0.5 M NaCI to reach 120 OD₂₆₀ units/ml, and the DNA present in the soluble extract was removed by polyethyleneimine (PEI) precipitation. By adding 0.3% PEI (10% stock solution, in water, at pH 7.5) and stirring for 10 mm, DNA forms a white precipitate that sediments by centrifugation at 15.000xg for 20 mm. The resulting supernatant was treated with ammonium sulphate at 50% saturation to obtain a PEI-free precipitate, containing most of the Pol μ. Afterwards, this precipitate was resuspended in buffer A + 50 mM NaCI (AS fraction in Fig. 2), and loaded m a phosphocellulose column, equilibrated m the same buffer. Pol μ eluted at an ionic strength corresponding to 0.3-0.5 M NaCI (PC fraction in Fig. 2) . This Pol μ enriched fraction was diluted in buffer A up to 0.3 M NaCI and loaded a HiTrap Heparin column (Pharmacia Biotech), elutmg at 0.4 M NaCI (HS fraction in Fig. 2). The final fraction contained highly purified Pol μ (>95%) in soluble form. To obtain a fraction free of contaminant nucleases, suitable to assay the activity of Pol μ, the final HS fraction was loaded onto a 5 ml-glycerol gradient (15%- 30%) containing 20 mM Tris-HCl, pH 8, 200 mM NaCI, ImM EDTA, and 1 mM DTT, and centrifuged at 62,000 rpm (Beckman SW.50 rotor) for 24 hours, at 4°C. After centrifugation, 20 fractions were collected from the bottom of the tube, examined in Coomassie-Blue stained gels, and tested for DNA polymerase activity on activated DNA. Example 5 : Enzymatic assays

Example 5. 1 : DNA polymerization on activated DNA The incubation mixture contained, in 25 μl, 50 mM Tris- HC1, pH 7.5, either 10 mM Mg Cl or 1 mM MnCl,, 1 mM DTT, 4% glycerol, 0.1 mg/ml BSA, 13 nM [a-^J P] dATP and 250 ng activated calf thymus DNA (Pharmacia) as a substrate. This assay was used to monitor Pol μ throughout the purification procedure. Alternatively, TdT (5 units) or Klenow (1 unit) were used as a control of DNA polymerization. When indicated, different amounts of additional deoxynucleotides were also added. After incubation for the indicated times at 37°C, the reaction was stopped by adding 10 mM EDTA and the samples were filtered through Sephadex G-50 spin columns. The excluded volume, corresponding to the labelled DNA, was counted (Cerenkov radiation) . Polymerisation activity was calculated as the amount of incorporated dAMP.

Example 5. 2 : DNA polymerization assays on defined DNA molecules

(a) Terminal transferase activity was evaluated by using 5 -labelled oligonucleotides ((P15: 5 ' -GATCACAGTGAGTAC; P19: 5'-GATCACAGTGAGTACAATA; oligo (dA) 15, oligo (dT) 10 ) ) as substrates. The incubation mixture contained, in 25 μl, 50 mM Tris-HCl, pH 7.5, 1 mM MnCl_:, 1 mM DTT, 4% glycerol, 0.1 mg/ml BSA, different concentrations of the indicated dNTPs, 3.2 nM of 5 ^'-labelled oligonucleotide, and 20 ng of purified Pol μ (glycerol gradient fraction) or 2.5 units of TdT (41 ng) . After incubation for the indicated times at either 30 or 37°C, the reactions were stopped by adding EDTA up to 10 mM. Samples were analyzed by 8 M urea-20% PAGE and autoradiography. When indicated, terminal transferase activity on a blunt-ended primer terminus, obtained by hybridization of oligonucleotides P19 and P19c, was assayed under identical conditions.

(b) DNA-dependent polymerization was assayed on defined primer/template structures, obtained by hybridization of either oligo (dA) to Poly dT, oligo (dT) to PolydA, or 5 -labelled P15 to the template oligonucleotide T15c+6 (5 ' -TCTATTGTACTCACTGTGATC, having a 5 ^'-terminal extension of 6 nucleotides addition to the sequence complementary to P15). The incubation mixture contained, in 25 μl, 50 mM Tris-HCl, pH 7.5, either 10 mM MgCl₂ or 1 mM MnCl,, 1 mM DTT, 4 % glycerol, 0.1 mg/ml BSA, 3.2 nM of the hybrid indicated m each case, and the indicated amount and concentration of either purified Pol μ or the indicated DNA polymerase.

(c) To analyse the base specificity (nucleotide insertion fidelity) of Pol μ, oligonucleotide P15 was hybridized to four variants of the T15c+6 template oligonucleotide: T15c+6(T), T15c+6 (G) , T15c+6 (C) , T15c+6 (A), differing in the first template base. Nucleotide insertion on each hybrid structure (3.2 nM) was comparatively studied in the presence of either MgCl₂ (10 mM) or MnCl₂ (1 mM) as metal activator, by providing 20 ng of Pol μ and various concentrations of either the correct dNTP (up to 10 μM) or each of the three wrong dNTPs (up to 100 μM) . After incubation at either 30°C in the presence of the indicated dNTPs, the reactions were stopped by adding EDTA, and the samples were either filtered through Sephadex G-50 spin columns and quantitated from the Cerenkov radiation, or analysed by 8 M urea-20% PAGE and autoradiography. Quantitation of autoradiographs was done by densitometπc analysis of the band(s) corresponding to primer extension products .

Example 6: Expression analysis Example 6.1: Northern blotting

RNA blots containing 2 μg of polyA" RNA per lane of different human tissues (MTN and MTN-II blots, Clontech) were hybridized with a probe (derived from EST AA298793) containing 1141 nucleotides corresponding to the 3' end of Pol μ cDNA. The probe was labelled by random priming (Redipπme II, Amersham) with [a-³²P] dATP (Amersham) . Blots were prehybridized for 4 hours and then hybridized overnight m Rapid-hyb buffer (Amersham) at 65°C. Blots were washed twice with 2x SSC-0.1% SDS at room temperature, twice with Ix SSC-0.1% SDS and twice with O.lx SSC-0.1% SDS at 65°C, prior to autoradiography. RAMOS cells were maintained m RPMI 1640 (Gibco-BRL) , supplemented with 10% fetal calf serum (Gibco-BRL) , 2 mM L-glutamme (Merck), streptomycin (0.1 mg/ml, Sigma) and penicillin (100 U/ml, Sigma), at 0.2-lxlO⁶ cells/ml. mRNA from the RAMOS cell line was obtained by standard procedures .

Example 6.2: In situ hybridization

Digoxygenm (DIG) -labeled riboprobes were prepared using the DIG RNA (SP6/T7) labeling kit (Boehrmger-Mannheim) . Antisense and sense probes were generated from a linearized pGEM-T Easy plasmid (Promega) containing 1200 nucleotides corresponding to the 5 -end of Pol μ cDNA, using SP6 or T7 RNA polymerases, respectively. When indicated, antisense and sense probes corresponding to the A-myb transcription factor were prepared and used as a positive control for centroblasts populations. Human tissue slides were purchased from Novagen (Human Tissue Set I and Human Hematal and Immune Tissue Set) .

The sections fixed in parafin were de-parafmated by washing twice with fresh xylene for 5 mm and by further washing with ethanol 100% for 5 mm. After fixation m paraformaldehyde-PBS 4%, the sections were incubated 2 times/15 mm m PBS containing actve DEPC 0.1% (Sigma), and further washed with 5x SSC. The preparations were pre-hybridized for 1-2 hours at 55°C, and hybridized overnight at 55°C in 50% formamide, 5x SSC, 0.3 mg/ml yeast tRNA, 100 μg/ml heparme, Ix Denhardt's, 0.1% Tween- 20, 0.1% CHAPS, and 5 mM EDTA, either with the sense or antisense RNA probes, previously denatured at 80°C for 10 mm. Hybridization was carried out in a wet chamber.

After incubation, sections were washed twice in 2x SSC for 20 mm, twice in 2x SSC for 30 mm at 55°C, two additional washes m 0.2x SSC at 55°C for 20 mm, and equilibrated with Tris-HCl 100 mM and NaCI 150 mM, pH 7.5, for 5 mm. Inmunological detection of RNA probes in tissue sections was carried out by incubation with anti-DIC—alkaline phosphatase (Boehrmger Mannheim) at 1 μg/ml in Tris-HCl 100 mM (pH 7.5), NaCI 150 mM, and 0.5% Blocking Reagent (Boehrmger Mannheim) , for 2 hours at room temperature, and further treatment with the NBT/BCIP reagent

(Boehrmger Mannheim) . The tissue sections were mounted with Aquatex (Merck) and visualized under the microscope. The dark blue stammg, observed in lymph nodes and spleen with the antisense riboprobe, outlined regions largely expressing Pol μ mRNA. No comparable signal was obtained by using a sense riboprobe under the same experimental conditions and in a close parallel tissue section.

Example 6.3: Immunostaining of human Pol u B-cells, obtained either from perypheral blood or flow- sorted from secondary lymphoid tissues, were fixed with methanol/acetone (1:1) for 5 mm at -20°C, washed PBS and pre-mcubated for 1 hour at room temperature, with gentle shaking, with goat serum 4%, Triton X-100 0.1% and sodium azide 0.02%. Afterwards, the fixed cells were incubated with purified IgGs obtained from rabbit polyclonal serum (1:1000) against human Pol μ, in a buffer containing goat serum 2%, Triton X-100 0.1%, and sodium azide 0.02%. Incubation was overnight at 4°C, with gentle shaking. After several washes with PBS, the cells were incubated for 2 hours at 4°C, with secondary anti-rabbit antibodies conjugated to fluorescem (Molecular Probes), diluted 1:5000, in a similar solution than that used for the incubation with the primary antibodies. Afterwards, the cells were washed with PBS and mounted for fluorescence microscopy. Discrete foci, localized at the nuclei of centroblasts purified from human tonsils, are evidenced by inmunofluorescence when using IgGs against human Pol μ. This foci pattern is not observed in circulating B lymphocytes (PBLs), but appears to be specific of centroblast, the B-cell developmental stage that is competent for somatic hypermutation.

Example 6.4: Specificity of the polyclonal antibodies against human Pol u

Equal protein amounts obtained from different sources were separated by SDS-PAGE and transferred to a PVDF membrane (1 hour/ 100 V) . The membrane was blocked by incubation with powdered milk (5% in PBS-T 0.1%), firstly incubated with the primary antibody (rabbit polyclonal serum anti- Pol μ, diluted 1/10.000), and further incubated with the secondary antibody (donkey serum anti-rabbit IgG) ligated to peroxidase. By detection of the peroxidase by a colorimetric assay (ECL, Amersham) , it was possible to evaluate the amount of Pol μ in the different extracts, and also the degree of cross-reactivity with related species as TdT (Fig. 9B) .

Claims

Claims :

1. A DNA polymerase (Pol μ) having a specific terminal transferase activity, a DNA-dependent DNA polymerase activity and a reduced base discrimination in the presence

2. The DNA polymerase of claim 1, wherein its terminal transferase activity has a preference for nucleotide usage which is dT>dC>dG>dA.

3. The DNA polymerase of claim 1 or claim 2, wherein the polymerase has a molecular weight of about 55 kDa as determined by SDS-PAGE.

4. An isolated DNA polymerase μ (Pol μ) comprising an ammo acid sequence as set out m SEQ ID No: 2 or SEQ ID No: 4.

5. An isolated polypeptide having at least 45% ammo acid sequence identity to the Pol μ polymerase of claim 4.

6. An isolated polypeptide which is encoded by nucleic acid capable of hybridising under stringent conditions to a nucleic acid sequence encoding the Pol μ polymerase of claim 4.

7. An isolated polypeptide which is a sequence variant of the Pol μ polymerase of claim 4.

8. An isolated fragment or active portion of a Pol μ polymerase of claim .

9. A polypeptide which comprises the Pol μ polymerase of any one of claims 1 to 8, or an active portion or fragment thereof, joined to a second polypeptide.

10. The polypeptide of claim 9, wherein the second polypeptide is terminal deoxynucleotidyltransferase (TdT) , or a fragment or active portion thereof.

11. An isolated nucleic acid molecule encoding a Pol μ polymerase of any one of claims 4 to 10.

12. An isolated nucleic acid molecule comprising the Pol μ coding sequence as set out m SEQ ID No: 1 or 3.

13. An isolated nucleic acid molecule which has at least 80% sequence identity to the Pol μ coding sequence as set

14. An isolated nucleic acid molecule which is capable of hybridising under stringent conditions to a nucleic acid sequences as set out in SEQ ID No: 1 or 3.

15. An expression vector comprising a nucleic acid molecule of any one of claims 11 to 14, operably linked to control sequences to direct its expression.

16. The vector of claim 15, wherein the vector is a plasmid, cosmid, bacteriophage or viral vector.

17. A host cell transformed with the expression vector of claim 15 or claim 16.

18. The host cell of claim 17, wherein the cell is a eukaryotic, prokaryotic or yeast cell.

19. A method of producing a Pol μ DNA polymerase, the method comprising culturmg the host cells of claim 17 or claim 18 and isolating the Pol μ polypeptide thus produced.

20. A composition comprising a Pol μ nucleic acid molecule of any one of claims 11 to 14.

21. A composition comprising a Pol μ polypeptide of any one of claims 1 to 10.

22. Use of an inhibitor of Pol μ DNA polymerase of any one of claims 1 to 10 for the preparation of a medicament for the treatment of cancer.

23. A method for the diagnosis or prognosis of cancer, the method comprising determining of the presence or amount of Pol μ polymerase of any one of claims 1 to 10 or Pol μ nucleic acid of any one of claims 11 to 14 in a sample from a patient and comparing the presence or amount to corresponding values obtained from controls.

24. The method of claims 23, wherein the cancer is B cell lymphoma .

25. The method of claims 23 or claim 24, wherein the B cell lymphoma is acute lymphoblastic leukemia (ALL) , chronic granulocytic leukemia (CGC, lymphoblastc lymphoma (LL) , B-cell leukemia, diffuse B-cell lymphomase (DCBCL, or Burkitt ' s lymphoma.

26. The method of any one of claims 23 to 25, wherein the method employs a binding agent capable of specifically binding Pol μ polymerase.

27. The method of any one of claims 23 to 26, wherein the binding agent is an antibody.

28. The method of any one of claims 23 to 25, wherein the method employs a nucleic acid probe capable of hybridising to Pol μ nucleic acid.

29. The method of any one of claims 23 to 25, wherein the method employs the polymerase chain reaction to amplify Pol μ nucleic acid.

30. The method of claim 29, wherein the Pol μ nucleic acid comprises a genomic DNA or a RNA sample.

31. Use of a Pol μ polypeptide or nucleic acid encoding a Pol μ polypeptide for screening for candidate compounds which (a) share a Pol μ biological activity or (b) bind to the Pol μ polypeptide or (c) inhibit a biological activity of a Pol μ polypeptide.

32. A method of identifying a compound which is capable of modulating an activity of a Pol μ polymerase, the method comprising:

33. The method of claim 32, wherein the method is for identifying candidate compounds which are capable of inhibiting an activity of Pol μ polymerase.

34. A method of amplifying a nucleic acid test sample comprising priming a nucleic acid polymerase reaction with nucleic acid encoding a Pol μ polypeptide of any one of claims 1 to 9.

35. An antibody which is capable of specifically binding to a Pol μ polypeptide of any one of claims 1 to 9.

36. Use of an antibody of claim 35 for (a) detecting or quantifying the presence or amount of a Pol μ polymerase in an assay or (b) purifying a Pol μ polymerase or (c) as an inhibitor of an activity of a Pol μ polymerase.

37. Use of a Pol μ DNA polymerase of any one of claims 1 to 9 which has DNA polymerase activity for repairing or reconstructing a DNA molecule.

38. Use of the nucleic acid molecule of any one of claims 11 to 14 for the design of primers for the amplification of a Pol μ nucleic acid sequence.