ES2364010A1 - Mutants of dna polymerase mu - Google Patents

Mutants of dna polymerase mu Download PDF

Info

Publication number
ES2364010A1
ES2364010A1 ES200901943A ES200901943A ES2364010A1 ES 2364010 A1 ES2364010 A1 ES 2364010A1 ES 200901943 A ES200901943 A ES 200901943A ES 200901943 A ES200901943 A ES 200901943A ES 2364010 A1 ES2364010 A1 ES 2364010A1
Authority
ES
Spain
Prior art keywords
pol
baselineskip
seq
mutants
dna polymerase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
ES200901943A
Other languages
Spanish (es)
Other versions
ES2364010B1 (en
Inventor
Luis Blanco Davila
Raquel Juarez Santos
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
X-POL BIOTECH SL
X Pol Biotech SL
Original Assignee
X-POL BIOTECH SL
X Pol Biotech SL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by X-POL BIOTECH SL, X Pol Biotech SL filed Critical X-POL BIOTECH SL
Priority to ES200901943A priority Critical patent/ES2364010B1/en
Priority to PCT/ES2010/000402 priority patent/WO2011039390A2/en
Publication of ES2364010A1 publication Critical patent/ES2364010A1/en
Application granted granted Critical
Publication of ES2364010B1 publication Critical patent/ES2364010B1/en
Withdrawn - After Issue legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention relates to mutants of DNA polymerase mu (Pol[mu]) which have greater terminal deoxynucleotidyl transferase activity than the wild enzyme (wt) and which improve the potential thereof as a molecular tool. Said mutants can be used, inter alia, in polynucleotide labelling techniques and for joining overhangs and blunt ends.

Description

Mutantes de la ADN polimerasa mu.Mutants of DNA polymerase mu.

Campo de la invenciónField of the Invention

La presente invención se refiere a la identificación de mutantes de la ADN polimerasa mu humana (Pol\mu) y a los usos de los mismos. Estos mutantes presentan características mejoradas respecto a la versión silvestre de dicha polimerasa que mejoran su potencialidad como herramienta molecular.The present invention relates to the identification of mutants of the human mu DNA polymerase (Pol) and their uses. These mutants have characteristics improved compared to the wild version of said polymerase that They improve their potential as a molecular tool.

Antecedentes de la invenciónBackground of the invention

La estabilidad de la información genética no sólo depende de la fiabilidad de los sistemas de replicación sino también de la existencia de múltiples sistemas de reparación, que corrigen la mayoría de los tipos de daños que se producen en el ADN. Además de estos sistemas de reparación, es evidente la existencia de reacciones enzimáticas alternativas que de algún modo contrarrestan los efectos de los primeros, generando variabilidad en el ADN. Una de las enzimas implicadas en este tipo de procesos es la desoxinucleotidil-transferasa terminal (TdT) involucrada en los procesos de generación de diversidad y que selectivamente actúa sobre aquellos genes codificantes de receptores de antígenos (Komori et al. (1993). Science, 261, 1171-1175).The stability of genetic information depends not only on the reliability of replication systems but also on the existence of multiple repair systems, which correct most types of damage that occur in DNA. In addition to these repair systems, the existence of alternative enzymatic reactions that somehow counteract the effects of the former is evident, generating variability in the DNA. One of the enzymes involved in this type of process is terminal deoxynucleotidyl transferase (TdT) involved in the processes of generating diversity and selectively acting on those genes encoding antigen receptors ( Komori et al . (1993). Science, 261, 1171-1175 ).

La TdT es una enzima de 58 kDa que normalmente sólo se encuentra presente en linfocitos B y T inmaduros. Esta enzima cataliza la adición de desoxinucleótidos en el extremo 3'OH terminal de las cadenas de oligonucleótidos sin necesidad de una hebra de ADN molde (actividad deoxinucleotidil-transferasa terminal), generando así diversidad en los receptores de antígenos de las referidas células de defensa del sistema inmune. Esta actividad de TdT ha permitido que esta polimerasa haya sido ampliamente utilizada como herramienta molecular, especialmente, en técnicas de mareaje de ADN.TdT is a 58 kDa enzyme that normally It is only present in immature B and T lymphocytes. This enzyme catalyzes the addition of deoxynucleotides at the 3'OH end terminal of oligonucleotide chains without the need for a DNA strand template (activity terminal deoxynucleotidyl transferase), generating thus diversity in the antigen receptors of those referred immune system defense cells. This activity of TdT has allowed this polymerase to have been widely used as Molecular tool, especially in mareaje techniques of DNA

Una de estas técnicas de mareaje es el ensayo TUNEL que se basa en el principio de que la TdT incorpora desoxiuridina marcada (e.g. dUTP-biotina) en los extremos 3'OH de roturas de cadenas dobles y simples del ADN. La incorporación de dUTP marcada actúa como una señal que puede ser detectada fácilmente, por ejemplo, a través de técnicas de fluorescencia. Cuantas más roturas tenga el ADN mayor será la señal resultante. Esta técnica permite, entre otras aplicaciones, identificar muestras que están sufriendo procesos apoptóticos o medir la calidad de una muestra biológica.One of these marking techniques is the test TUNNEL that is based on the principle that TdT incorporates labeled deoxyuridine (e.g. dUTP-biotin) in 3'OH ends of breaks of double and single strands of DNA. The incorporation of marked dUTP acts as a signal that can be easily detected, for example, through techniques of fluorescence. The more breaks the DNA has, the greater the signal resulting. This technique allows, among other applications, identify samples that are undergoing apoptotic processes or Measure the quality of a biological sample.

Desde el descubrimiento de la TdT, han sido pocas las enzimas con actividad deoxinucleotidil-transferasa terminal encontradas en la naturaleza y, actualmente, ésta es la única que se comercializa a gran escala (e.g. Roche Applied Science, Promega, Invitrogen).Since the discovery of TdT, there have been few enzymes with terminal deoxynucleotidyl transferase activity found in nature and, currently, this is the only one that is marketed on a large scale (eg Roche Applied Science, Promega, Invitrogen ).

En el año 2000, una nueva polimerasa con actividad deoxinucleotidil-transferasa terminal y perteneciente a la familia X de las ADN polimerasas, la polimerasa mu (Pol\mu), fue identificada y secuenciada por primera vez (Domínguez et al, (2000) Embo J, 19, 1731-1742). Sin embargo, aunque se puede decir que existe una amplia similitud estructural entre Pol\mu y TdT, la actividad desoxinucleotidil-transferasa terminal de esta nueva enzima es comparativamente muy inferior a la de la TdT. Este hecho ha imposibilitado su incorporación al mercado como una alternativa viable a la TdT, siendo todavía necesario el descubrimiento o desarrollo de nuevas enzimas que presenten esta actividad mejorada o incrementada. Hasta la fecha, únicamente el mutante simple de Pol\mu humana, R387K, presenta una actividad deoxinucleotidil-transferasa terminal superior a la polimerasa silvestre y similar a la de la TdT (María José Martín et al. Gordon Research Conference on Mutagenesis 07/20/2008 - 07/25/2008 at Magdalen College in Oxford. "Rate limited terminal transferase activity of human Pol \mu: contribution to imprecise end-joining of non-complementary ends").In 2000, a new polymerase with terminal deoxynucleotidyl transferase activity and belonging to the X family of DNA polymerases, polymerase mu (Pol), was identified and sequenced for the first time ( Dominguez et al , (2000) Embo J, 19, 1731-1742 ). However, although it can be said that there is a broad structural similarity between Pol and TdT, the terminal deoxynucleotidyl transferase activity of this new enzyme is comparatively much lower than that of TdT. This fact has made it impossible to enter the market as a viable alternative to TdT, with the discovery or development of new enzymes that have this activity improved or increased. To date, only the human Pol µ simple mutant, R387K, has a terminal deoxynucleotidyl transferase activity superior to wild polymerase and similar to that of TdT ( María José Martín et al . Gordon Research Conference on Mutagenesis 07/20 / 2008 - 07/25/2008 at Magdalen College in Oxford . " Rate limited terminal transferase activity of human Pol: contribution to imprecise end-joining of non-complementary ends ").

Breve descripción de la invenciónBrief Description of the Invention

Los autores de la presente invención han desarrollado mutantes de Pol\mu que presentan una mayor actividad deoxinucleotidil-transferasa terminal que la enzima silvestre o wildtype (Pol\mu wt: UniProtKB/Swiss-Prot Q9NP87: SEQ ID NO: 17) e incluso que la propia TdT. Concretamente, la invención proporciona varios mutantes de Pol\mu con una elevada actividad deoxinucleotidil-transferasa terminal, superior a la de la Pol\mu wt, que pueden ser empleados, entre otras, en técnicas de mareaje de polinucleótidos o de reunión de extremos protuberantes y romos (End joining).The authors of the present invention have developed mutants Pol \ mu having a higher terminal deoxynucleotidyl transferase activity than the wild type enzyme or wildtype (Pol \ mu wt: UniProtKB / Swiss-Prot Q9NP87: SEQ ID NO: 17) and even TdT itself. Specifically, the invention provides several Pol [mu] mutants with a high terminal deoxynucleotidyl transferase activity, which is superior to that of Pol [mu] wt, which can be used, among others, in polynucleotide or protruding end assembly techniques. and blunt ( End joining ).

Así, en un primer aspecto de la presente invención, se proporcionan mutantes de Pol\mu (en adelante, mutantes de la invención) que tienen al menos alrededor de un 10% más de actividad desoxinucleotidil-transferasa terminal que la Pol\mu wt, preferentemente la Pol\mu humana. Preferentemente, dicha actividad es al menos alrededor de un 25%, 50%, 75%, 100%, 200%, 300%, 400%, 500% superior a la de la Pol\mu wt. Del mismo modo, los mutantes de la invención también tienen una actividad desoxinucleotidil-transferasa terminal igual o superior a la del mutante R387K (en adelante, también referido como mutante R), preferentemente dicha actividad es al menos alrededor de un 10% superior y, más preferentemente, al menos alrededor de un 25%, 50%, 75%, 100%, 200%, 300% superior. Estos mutantes en combinación o individualmente son susceptibles de ser empleados como herramientas moleculares, preferentemente, en cualquiera de las técnicas en que se utiliza la TdT, bien como sustitutivos de ésta o en combinación con la
misma.Thus, in a first aspect of the present invention, Pol µ mutants (hereinafter, mutants of the invention) are provided that have at least about 10% more terminal deoxynucleotidyl transferase activity than Pol µ wt, preferably the human Pol. Preferably, said activity is at least about 25%, 50%, 75%, 100%, 200%, 300%, 400%, 500% higher than that of the Pol. Similarly, the mutants of the invention also have a terminal deoxynucleotidyl transferase activity equal to or greater than that of the R387K mutant (hereinafter, also referred to as an R mutant), preferably said activity is at least about 10% higher and, more preferably, at least about 25%, 50%, 75%, 100%, 200%, 300% higher. These mutants in combination or individually are likely to be used as molecular tools, preferably, in any of the techniques in which TdT is used, either as substitutes for it or in combination with the
same.

En un segundo aspecto de la invención se proporciona una secuencia polinucleotídica (en adelante, secuencia polinucleotídica o polinucleótido de la invención) que codifica- cualquiera de los mutantes de la invención. Del mismo modo, también forman de parte de la invención cualquier: i) vector que comprenda al polinucleótido de la invención o ii) célula huésped que comprenda la secuencia polinucleotídica de la invención o un vector de acuerdo con la invención.In a second aspect of the invention, provides a polynucleotide sequence (hereinafter, sequence polynucleotide or polynucleotide of the invention) which encodes any of the mutants of the invention. Similarly also any part of the invention is: i) vector comprising to the polynucleotide of the invention or ii) host cell comprising the polynucleotide sequence of the invention or an agreement vector with the invention

En un tercer aspecto, la invención se refiere a un método para la producción de los mutantes de la invención que preferentemente comprende: i) el cultivo de una célula huésped de acuerdo con la invención y ii) el aislamiento del mutante producido.In a third aspect, the invention relates to a method for the production of the mutants of the invention that preferably it comprises: i) the culture of a host cell of according to the invention and ii) mutant isolation produced.

Un cuarto aspecto de la invención se refiere al empleo de los mutantes de la invención como herramienta molecular, preferentemente, en todas aquellas técnicas donde participa la TdT, bien como sustitutivos de ésta o en combinación con la misma. Más concretamente, los mutantes de la invención en combinación o individualmente son susceptibles de ser empleados en ensayos de: i) mareaje de extremos de polinucleótidos de cadena simple (heteropolímeros u homopolímeros) y cadena doble (extremos protuberantes o romos), ii) reunión de extremos protuberantes y romos, iii) polimerización dependiente o independiente de molde, iv) rellenado de gaps o huecos (gap-filling), v) detección de roturas de ADN (mismatch detection; e.g. TUNEL), vi) mutagénesis o generación de variabilidad, etc.A fourth aspect of the invention refers to the use of the mutants of the invention as a molecular tool, preferably, in all those techniques where TdT participates, either as substitutes for it or in combination with it. More specifically, the mutants of the invention in combination or individually are capable of being used in tests of: i) single-stranded (single-stranded or homopolymer) and double-stranded polynucleotide endpoints (ii) protruding or blunt ends, ii) gathering of protuberant and blunt ends, iii) mold-dependent or independent polymerization, iv) gaps or void filling ( gap-filling ), v) DNA breakage detection ( mismatch detection; eg TUNEL ), vi) mutagenesis or generation of variability, etc.

Un quinto aspecto de la invención proporciona kits que comprenden cualquiera de los mutantes de la invención, preferentemente, para llevar a cabo cualquiera de los ensayos referidos en el párrafo anterior. Adicionalmente, además de los componentes necesarios para poner en marcha el correspondiente ensayo (e.g. tampones, cebadores, dNTPs, ddNTPs, marcadores, etc.), los kits pueden comprender TdT o mutantes de la misma. El empleo de dichos kits para las aplicaciones previamente mencionadas, por ejemplo, en ensayos de: i) mareaje de extremos de polinucleótidos de cadena simple (heteropolímeros u homopolímeros) y cadena doble (extremos protuberantes o romos), ii) reunión de extremos protuberantes y romos, iii) polimerización dependiente o independiente de molde, iv) rellenado de gaps o huecos (gap-filling), v) detección de roturas de ADN (mismatch detection; e.g. TUNEL), vi) mutagénesis o generación de variabilidad, etc., constituye un aspecto adicional de esta invención.A fifth aspect of the invention provides kits comprising any of the mutants of the invention, preferably, for carrying out any of the tests referred to in the preceding paragraph. Additionally, in addition to the components necessary to launch the corresponding assay (eg buffers, primers, dNTPs, ddNTPs, markers, etc.), the kits may comprise TdT or mutants thereof. The use of such kits for the aforementioned applications, for example, in tests of: i) single-stranded polynucleotide (heteropolymer or homopolymer) and double-stranded (protruding or blunt ends), ii) gathering of protruding ends and blunt, iii) mold-dependent or independent polymerization, iv) filling gaps or gaps ( gap-filling ), v) DNA breakage detection ( mismatch detection; eg TUNEL ), vi) mutagenesis or generation of variability, etc., It constitutes an additional aspect of this invention.

Definiciones Definitions

El término "actividad deoxinucleotidil-transferasa terminal" o "actividad transferasa terminal" se define como la capacidad de llevar a cabo reacciones de polimerización independiente de molde, añadiendo nucleótidos a un extremo 3'OH sin ser éstos seleccionados por ningún criterio de complementariedad de bases. Esta actividad puede ser medida mediante diferentes ensayos sobre diferentes tipos de sustratos, preferentemente, sobre ADN de cadena simple homopoliméricas (ver Ejemplos 1 y 3). A lo largo de la descripción, cuando se indica que esta actividad se encuentra incrementada o mejorada implica que ésta es al menos un 10% más elevada que la de la Pol\mu wt, preferentemente que la de la Pol\mu humana. Preferentemente, dicha actividad es al menos alrededor de un 25%, 50%, 75%, 100%, 200%, 300%, 400%, 500% superior a la de Pol\mu wt, preferentemente que la de la Pol\mu humana.The term "activity terminal deoxynucleotidyl transferase "or "terminal transferase activity" is defined as the ability to carry out mold independent polymerization reactions, adding nucleotides to a 3'OH end without being selected by no criteria of complementarity of bases. This activity It can be measured by different tests on different types of substrates, preferably, on single stranded DNA homopolymerics (see Examples 1 and 3). Throughout the description, when it is indicated that this activity is increased or improved implies that this is at least 10% higher than that of Pol [mu] wt, preferably that of human Pol [mu]. Preferably, said activity is at least about 25%, 50%, 75%, 100%, 200%, 300%, 400%, 500% higher than Pol µwt, preferably that of human Pol.

El término "identidad" o "tanto por ciento (%) de identidad" hace referencia a dos o más secuencias o subsecuencias que tienen en común un porcentaje específico de aminoácidos o nucleótidos, cuando éstas son comparadas y alineadas para encontrar la máxima correspondencia entre ambas. Este parámetro puede ser medido mediante técnicas de comparación de secuencia sobradamente conocidas en el estado de la técnica, preferentemente mediante los algoritmos BLAST o FASTA, empleando los parámetros cargados por defecto.The term "identity" or "both by percent (%) identity "refers to two or more sequences or sub-sequences that have in common a specific percentage of amino acids or nucleotides, when they are compared and aligned to find maximum correspondence between the two. This parameter can be measured by sequence comparison techniques well known in the state of the art, preferably using the BLAST or FASTA algorithms, using the parameters loaded by default.

El término "vector" hace referencia a un polinucleótido lineal o circular (e.g. plásmidos, cromosoma bacteriano) que comprende una secuencia polinucleotídica, donde preferentemente dicho vector está adaptado para la amplificación, replicación y/o expresión de dicho polinucleótido. Además, estos vectores pueden contener regiones que permitan controlar o potencien la amplificación, expresión y/o replicación del polinucleótido, así como otras que faciliten o promuevan la excreción o captura de los polipéptidos resultantes de la expresión del polinucleótido.The term "vector" refers to a linear or circular polynucleotide (e.g. plasmids, chromosome bacterial) comprising a polynucleotide sequence, where preferably said vector is adapted for amplification, replication and / or expression of said polynucleotide. In addition, these vectors may contain regions that allow control or potentiation amplification, expression and / or replication of the polynucleotide, as well as others that facilitate or promote the excretion or capture of polypeptides resulting from polynucleotide expression.

El término "célula huésped" hace referencia a una célula o grupo de células (eucariota o procariota) que contiene un vector o polinucleótido según la presente invención.The term "host cell" refers to to a cell or group of cells (eukaryotic or prokaryotic) that It contains a vector or polynucleotide according to the present invention.

El término "polinucleótidos" hace referencia tanto a polímeros de ADN como de ARN de cadena doble o simple. Ambos polímeros cuando están en forma de cadena doble pueden tener extremos romos o protuberantes.The term "polynucleotides" makes reference to both DNA and double stranded RNA polymers or simple. Both polymers when in double chain form can have blunt or protruding ends.

El término "nucleótidos" hace referencia a ribonucleótidos, desoxirribonucleótidos (dNTPs) o didesoxinucleótidos (ddNTPs) que, preferentemente, se encuentran marcados o modificados para permitir su identificación y/o seguimiento. Preferentemente, el mareaje de los nucleótidos es realizado con fluoróforos (e.g. Cy3, Cy5, fluoresceína) o biotina. A lo largo de la descripción cuando los nucleótidos están marcados con fluoróforos, éstos son referidos como nucleótidos fluorescentes.The term "nucleotides" refers to ribonucleotides, deoxyribonucleotides (dNTPs) or dideoxynucleotides (ddNTPs) that, preferably, are found marked or modified to allow identification and / or tracing. Preferably, the nucleotide mapping is performed with fluorophores (e.g. Cy3, Cy5, fluorescein) or biotin. TO throughout the description when the nucleotides are marked with fluorophores, these are referred to as fluorescent nucleotides.

El término "análogos de nucleótido" hace referencia a compuestos o moléculas que, para una aplicación concreta, se comportan de una manera similar o análoga a un nucleótido y que no tienen una estructura particular o específica, aunque preferentemente su estructura permite la detección de su incorporación a polinucleótidos y/o la parada de la reacción de polimerización. Ejemplos de estos compuestos pueden ser encontrados en otras solicitudes como WO95/07920, WO2005/051530, WO2008/016909.The term "nucleotide analogs" makes reference to compounds or molecules that, for an application concrete, behave in a similar or analogous way to a nucleotide and that do not have a particular or specific structure, although preferably its structure allows the detection of its incorporation into polynucleotides and / or the reaction stop of polymerization. Examples of these compounds can be found. in other applications such as WO95 / 07920, WO2005 / 051530, WO2008 / 016909.

El término "ortólogo" hace referencia a proteínas o genes que codifican para dichas proteínas, con actividad transferasa terminal, que comparten al menos alrededor de un 40% de identidad con la Pol\mu wt, preferentemente con la Pol\mu humana, y en realizaciones sucesivamente más preferidas al menos alrededor de un 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%.The term "ortholog" refers to proteins or genes that code for said proteins, with activity terminal transferase, which share at least about 40% of identity with the Pol [mu] wt, preferably with the Pol [mu] human, and in successively more preferred embodiments at least around 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%.

El término "mutación" preferentemente hace referencia a sustituciones, inserciones o deleciones que se producen a nivel de polipéptidos o polinucleótidos que expresan dichos polipéptidos. Estas mutaciones cuando se producen a nivel de un único aminoácido o triplete que lo codifica son denominadas como puntuales. Dentro las mutaciones puntuales se puede diferenciar entre las conservativas y las no conservativas, entendiéndose a las primeras como aquéllas que se producen cuando un aminoácido es sustituido por otro de similares características, según la Tabla 1.The term "mutation" preferably makes reference to substitutions, insertions or deletions that occur at the level of polypeptides or polynucleotides expressing said polypeptides These mutations when they occur at the level of a only amino acid or triplet that encodes it are referred to as punctual Inside point mutations can be differentiated between conservatives and non-conservatives, understanding the first like those that occur when an amino acid is replaced by another of similar characteristics, according to the Table one.

TABLA 1TABLE 1

1one

La expresión "alrededor de", tal y como se usa a lo largo de la descripción, hace referencia a la variación de entre el \pm 5% que puede presentar un valor dado (e.g., identidad o actividad), preferentemente entre el \pm 3% y más preferentemente \pm1%.The expression "around", as it is used throughout the description, refers to the variation of between ± 5% that can present a given value (e.g., identity or activity), preferably between ± 3% and more preferably ± 1%.

El término "sustancialmente", tal y como se usa a lo largo de la descripción, hace referencia a la variación de entre el \pm 10% que puede presentar un valor dado (e.g. actividad), preferentemente entre el \pm 5% y más preferentemente \pm 1%.The term "substantially", as used throughout the description, refers to the variation of between ± 10% that can present a given value (e.g. activity), preferably between ± 5% and more preferably ± 1%.

Los términos "fragmentos" o "subsecuencias" hacen referencia porciones de polipéptidos o polinucleótidos que codifican para dichos polipéptidos, que mantienen la actividad transferasa terminal incrementada o sustancialmente incrementada.The terms "fragments" or "subsequences" refer to portions of polypeptides or polynucleotides encoding said polypeptides, which maintain increased terminal transferase activity or substantially increased.

Breve descripción de las figurasBrief description of the figures

La figura 1 muestra la actividad transferasa terminal de cada uno de los mutantes [\mu-R387K-F389G, \muQ275M, \muR387K-Q275M, \muR387K-Chloop1, \mu-N457D, \mu-S458N y \mu-N457D-S458N (Ejemplo 1)], en comparación con la de la Pol\mu wt y la de la TdT comercial.Figure 1 shows the transferase activity terminal of each of the mutants [µ-R387K-F389G, µQ275M, µ388K-Q275M, µR387K-Chloop1, µ-N457D, µ-S458N and µ-N457D-S458N (Example 1)], in comparison with that of Pol µwt and that of commercial TdT.

La figura 2 muestra la actividad transferasa terminal de los mutantes dobles (\mu-R387K/Q275M y \mu-R387K/
Chloop1) a dosis decrecientes de polimerasa (400 nM, 200 nM y 100 nM).Figure 2 shows the terminal transferase activity of the double mutants (µ-R387K / Q275M and µ-R387K /
Chloop1) at decreasing doses of polymerase (400 nM, 200 nM and 100 nM).

La figura 3 muestra la actividad transferasa terminal de los mutantes dobles (\mu-R387K/Q275M y \mu-R3 87K/
Chloop1) y de los mutantes simples (\mu-R387K, \mu-Chloop1 y \mu-Q275M y en comparación con la de la Pol\mu wt, con cada uno de los 4 dNTPs por separado.Figure 3 shows the terminal transferase activity of the double mutants (µ-R387K / Q275M and µ-R3 87K /
Chloop1) and of the simple mutants (µ-R387K, µ-Chloop1 and µ-Q275M and compared to that of Pol µ wt, with each of the 4 dNTPs separately.

La figura 4 muestra la actividad transferasa terminal de los mutantes dobles (\mu-R387K/F389G, \mu-R387K/Q275M y \mu-R387K/Chloop1) y de los mutantes simples (\mu-R387K y \mu-Q275M), en comparación con la de la Pol\mu wt, con cada uno los 4 dNTPS en presencia de Co^{2+} como metal activador.Figure 4 shows the transferase activity terminal of the double mutants (µ-R387K / F389G, µ-R387K / Q275M and µR-R387K / Chloop1) and simple mutants (µ-R387K and µ-Q275M), in comparison with that of Pol µ wt, with each 4 dNTPS in presence of Co 2+ as activator metal.

La figura 5 muestra los resultados del ensayo realizado para comparar si los mutantes dobles (M3=\mu-R387K/
Q275M; M7=\mu-R387K/Chloop1) y simples (R= \mu-R387K; Ch=\mu-Chloop1; M2= \mu-Q275M) tienen afectada su capacidad de polimerización dependiente de molde respecto a la de Pol\mu wt.Figure 5 shows the results of the test performed to compare whether double mutants (M3 = µ-R387K /
Q275M; M7 = µ-R387K / Chloop1) and simple (R = µ-R387K; Ch = µ-Chloop1; M2 = µ-Q275M) have their mold-dependent polymerization capacity affected with respect to Pol µwt .

La figura 6 muestra la dependencia de molde de los mutantes dobles (M3 y M7) y de los mutantes simples (R, Ch y M2) en el contexto de un gap de ADN de 1 nucleótido con fosfato.Figure 6 shows the mold dependence of the double mutants (M3 and M7) and the simple mutants (R, Ch and M2) in the context of a 1 nucleotide DNA gap with phosphate.

La figura 7 muestra los resultados del ensayo de mareaje con derivados fluorescentes del DNA o de ddNTPs, con los mutantes indicados de Pol\mu (M1-M7), junto con Pol\mu wt y TdT sobre polinucleótidos de cadena sencilla.Figure 7 shows the test results of marking with fluorescent derivatives of DNA or ddNTPs, with indicated mutants of Pol (M1-M7), together with Pol µwt and TdT on single chain polynucleotides.

La figura 8 muestra los resultados del ensayo de mareaje con derivados fluorescentes del DNA o de ddNTPs, con los mutantes indicados de Pol\mu (R, Ch, M2, M3 y M7), sobre polinucleótidos de cadena sencilla.Figure 8 shows the test results of marking with fluorescent derivatives of DNA or ddNTPs, with indicated mutants of Pol (R, Ch, M2, M3 and M7), about single chain polynucleotides.

La figura 9 muestra los resultados del ensayo de mareaje con derivados fluorescentes del DNA o de ddNTPs, con los mutantes indicados de Pol\mu (R, Ch, M2, M3 y M7), sobre polinucleótidos de cadena sencilla.Figure 9 shows the test results of marking with fluorescent derivatives of DNA or ddNTPs, with indicated mutants of Pol (R, Ch, M2, M3 and M7), about single chain polynucleotides.

La figura 10 muestra los resultados del ensayo de mareaje con derivados fluorescentes del DNA o de ddNTPs, con los mutantes indicados de Pol\mu (R, Ch, M2, M3 y M7), sobre polinucleótidos de cadena sencilla.Figure 10 shows the test results of marking with fluorescent derivatives of DNA or ddNTPs, with indicated mutants of Pol (R, Ch, M2, M3 and M7), about single chain polynucleotides.

La figura 11 muestra cómo la reacción de mareaje con M3 y M7 es altamente eficaz con los 4 ddNTPs fluorescentes, tanto en presencia de Mn^{2+} como de Co^{2+}.Figure 11 shows how the tidal reaction with M3 and M7 it is highly effective with the 4 fluorescent ddNTPs, both in the presence of Mn 2+ and Co 2+.

La figura 12 muestra el alineamiento de las secuencias polipeptídicas de Pol\mu wt de Mus musculus, Rattus norvegicus y Bos taurus con el mutante M3. En la parte superior, la flecha indica el aminoácido 275 de Pol\mu wt humana. En la parte inferior, la flecha indica el aminoácido 387 de Pol\mu wt humana.Figure 12 shows the alignment of the Pol µwt polypeptide sequences of Mus musculus, Rattus norvegicus and Bos taurus with the M3 mutant. At the top, the arrow indicates amino acid 275 of human Pol. At the bottom, the arrow indicates amino acid 387 of human Pol.

La figura 13 muestra el alineamiento de las secuencias polipeptídicas de Pol\mu wt humana y la TdT de origen humano, murino y bovino. Las flechas muestran la posición de los aminoácidos 275, 387, 457 y 458 en la Pol\mu wt humana.Figure 13 shows the alignment of the polypeptide sequences of human Pol [mu] wt and TdT of origin Human, murine and bovine. The arrows show the position of the amino acids 275, 387, 457 and 458 in human Pol.

La figura 14 muestra la estructura tridimensional de la Pol\mu wt humana. A) la flecha indica la posición del aminoácido R387, B) la flecha indica la posición del aminoácido Q275, C) la flecha indica la posición del aminoácido N457 y D) la flecha indica la posición del aminoácido S458.Figure 14 shows the structure three-dimensional human Pol. A) the arrow indicates the amino acid position R387, B) the arrow indicates the position of the amino acid Q275, C) the arrow indicates the position of amino acid N457 and D) the arrow indicates the position of amino acid S458.

Descripción detallada de la invenciónDetailed description of the invention

La enzima TdT, también conocida como deoxinucleotidil-transferasa terminal o transferasa terminal, es una ADN polimerasa especializada que se expresa fundamentalmente en linfocitos B y T inmaduros, además de en determinados tipos de tumores. Hasta el descubrimiento de la Pol\mu en el año 2000 por el laboratorio del Dr. Luis Blanco (Domínguez et al, (2000)), la TdT era la única polimerasa conocida con capacidad de adicionar o unir nucleótidos a un extremo 3 'OH de polinucleótidos sin requerir una cadena molde. Sin embargo, tal y como se ha mencionado anteriormente, la baja actividad deoxinucleotidil transferasa terminal de Pol\mu wt en comparación con la TdT ha imposibilitado que, hasta la fecha, esta enzima haya podido convertirse en una alternativa viable a la TdT.The TdT enzyme, also known as terminal deoxynucleotidyl transferase or terminal transferase, is a specialized DNA polymerase that is primarily expressed in immature B and T lymphocytes, in addition to certain types of tumors. Until the discovery of Pol [mu] in 2000 by the laboratory of Dr. Luis Blanco ( Dominguez et al , (2000) ), TdT was the only known polymerase capable of adding or binding nucleotides to a 3'OH end of polynucleotides without requiring a template chain. However, as mentioned above, the low terminal deoxynucleotidyl transferase activity of Pol [mu] wt compared to TdT has made it impossible for this enzyme to date to become a viable alternative to TdT.

En la presente invención se presentan una serie de mutantes de Pol\mu wt que aumentan la actividad deoxinucleotidil transferasa terminal de la Pol\mu silvestre e incluso de la TdT. Preferentemente, dichos mutantes proceden o se derivan de la Pol\mu wt humana, aunque también pueden ser obtenidos a partir de la Pol\mu de otros vertebrados (polimerasas ortólogas de Pol\mu), preferentemente mamíferos, tales como Mus musculus, Rattus norvegicus, Bos taurus, entre
otros.In the present invention, a series of Pol [mu] wt mutants that increase the terminal deoxynucleotidyl transferase activity of wild Pol [mu] and even TdT are presented. Preferably, said mutants are derived from or derived from human Pol [mu] wt, although they can also be obtained from the Pol [mu] of other vertebrates (orthologous Pol [mu] polymerases), preferably mammals, such as Mus musculus, Rattus norvegicus Bos taurus between
others.

La obtención de mutantes, a partir de polimerasas ortólogas a la Pol\mu wt humana (o del gen que las codifica) y la enseñaza de la presente invención, puede ser llevada a cabo de manera simple por un experto en la materia, tal y como se explica en el Ejemplo 12. Del mismo modo, nuevos mutantes con la actividad transferasa terminal incrementada, tal como sucede con los mutantes de la presente invención, pueden ser también obtenidos fácilmente, tal y como se muestra en el Ejemplo 13.Obtaining mutants, from polymerases orthologous to human Pol [mu] wt (or the gene that code) and the teaching of the present invention can be carried carried out simply by an expert in the field, as explained in Example 12. Similarly, new mutants with the increased terminal transferase activity, as with mutants of the present invention can also be obtained easily, as shown in Example 13.

Mutantes de Pol\mu y polinucleótidos de la invenciónPol mutants and polynucleotides of the invention

TdT y Pol\mu wt son dos enzimas que pertenecen a la familia X de ADN polimerasa que se caracterizan por ser de pequeño tamaño (entre 39 y 66 KDa), siendo ambas en general bastante imprecisas durante la síntesis de ADN. Son enzimas distributivas con poca capacidad para sintetizar más que unas pocas bases antes de disociarse del ADN. Además de pertenecer a la misma familia y tener actividad deoxinucleotidil-transferasa terminal, estas polimerasas presentan un dominio BRCT (Dominio C-terminal de BRCA1), implicado en la interacción proteína-proteína, que no se encuentra presente en otros miembros de la familia X como la polimerasa beta (Pol\beta). Cuando este dominio es eliminado junto con el resto del extremo amino (NH2- BRCT-) e incluso con parte del dominio 8 KDa (NH2- BRCT- KDa-) la actividad TdT de estas enzimas no se ve afectada (ver tabla 2).TdT and Pol µwt are two enzymes that belong to the X family of DNA polymerase that are characterized by being small size (between 39 and 66 KDa), both being generally quite inaccurate during DNA synthesis. They are distributive enzymes with poor ability to synthesize more than a few bases before Dissociate from DNA. In addition to belonging to the same family and having terminal deoxynucleotidyl transferase activity, These polymerases present a BRCT domain (Domain C-terminal of BRCA1), involved in the interaction protein-protein, which is not present in other members of the X family such as polymerase beta (Pol?). When this domain is removed along with the rest of the end amino (NH2-BRCT-) and even with part of the 8 KDa domain (NH2-BRCT- KDa-) the TdT activity of these enzymes is not affected (see table 2).

El dominio de 8 KDa es también característico de las enzimas de esta familia, encontrándose presente tanto en Pol\mu wt como en TdT. Este dominio confiere a estas polimerasas la capacidad de anclaje a los gaps que se producen en el ADN, permitiéndoles realizar de manera efectiva su actividad biológica. Incluso, la distribución de aminoácidos entre los diferentes dominios de estas dos enzimas es bastante similar, tal y como se puede ver en la Tabla 2.The 8 KDa domain is also characteristic of the enzymes of this family, being present both in Pol µ wt as in TdT. This domain confers on these polymerases. the ability to anchor the gaps that occur in the DNA, allowing them to effectively perform their biological activity. Even the distribution of amino acids among the different domains of these two enzymes is quite similar, just as You can see in Table 2.

22

A pesar de las claras similitudes estructurales existentes entre ambas proteínas, el grado de identidad que comparten se encuentra en torno al 40% y, por tanto, presentan un gran número de aminoácidos diferentes o no conservados (aproximadamente 300). Mediante alineamiento y comparación de secuencias entre TdT y Pol\mu wt, los autores de la presente invención identificaron y seleccionaron un grupo de aminoácidos conservados en Pol\mu wt y TdT, pero diferentes entre ambas enzimas. Dichos aminoácidos se revertieron en Pol\mu wt hacia el aminoácido de TdT para así obtener una serie de mutantes simples y dobles con una potencial mejor actividad desoxinucleotidil-transferasa terminal. Además de estos mutantes puntuales, se generó otro mutante que comprendía una mutación puntual y la sustitución del subdominio loop-1 por el mismo subdominio de TdT (ver Tabla 2). El ensayo de estos mutantes ha ofrecido resultados sorprendentes en cuanto a su actividad desoxinucleotidil-transferasa terminal, de tal modo que la presente invención aporta una serie de mutantes de Pol\mu que presentan una mayor actividad transferasa terminal que Pol\mu wt e incluso que la propia TdT.Despite the clear structural similarities existing between both proteins, the degree of identity that share is around 40% and therefore have a large number of different or unconserved amino acids (approximately 300). Through alignment and comparison of sequences between TdT and Pol µwt, the authors of the present invention identified and selected a group of amino acids preserved in Pol µt and TdT, but different between both enzymes These amino acids were reversed in Pol µ wt towards TdT amino acid to obtain a series of simple mutants and doubles with a better potential activity terminal deoxynucleotidyl transferase. In addition to these point mutants, another mutant was generated comprising a point mutation and sub-domain replacement loop-1 for the same subdomain of TdT (see Table 2). The assay of these mutants has offered surprising results in regarding its deoxynucleotidyl transferase activity terminal, such that the present invention provides a series of Pol µ mutants that exhibit increased transferase activity terminal that Pol \ mu wt and even that TdT itself.

Así en un primer aspecto de la presente invención, los mutantes de la invención tienen al menos alrededor de un 10% más de actividad desoxinucleotidil-transferasa terminal que la Pol\mu wt, preferentemente que la Pol\mu wt humana. Preferentemente, dicha actividad es al menos alrededor de un 25%, 50%, 75%, 100%, 200%, 300%, 400%, 500% superior a la de la Pol\mu wt. Del mismo modo, los mutantes de la invención también tienen una actividad desoxinucleotidil-transferasa terminal igual o superior a la del mutante R, preferentemente dicha actividad es al menos alrededor de un 10% superior y, más preferentemente, al menos alrededor de un 25%, 50%, 75%, 100%, 200%, 300% superior. Estos mutantes, en combinación o individualmente, son susceptibles de ser empleados como herramientas moleculares, preferentemente, en cualquiera de las técnicas en las que se utiliza TdT, como sustitutivos de ésta o en combinación con la misma. En una realización preferida de este aspecto de la invención los mutantes comprenden al menos dos mutaciones.Thus, in a first aspect of the present invention, the mutants of the invention have at least about 10% more terminal deoxynucleotidyl transferase activity than Pol µwt, preferably human Pol µwt. Preferably, said activity is at least about 25%, 50%, 75%, 100%, 200%, 300%, 400%, 500% higher than that of the Pol. Similarly, the mutants of the invention also have a terminal deoxynucleotidyl transferase activity equal to or greater than that of the R mutant, preferably said activity is at least about 10% higher and, more preferably, at least about 25% , 50%, 75%, 100%, 200%, 300% higher. These mutants, in combination or individually, are likely to be used as molecular tools, preferably, in any of the techniques in which TdT is used, as substitutes for it or in combination with it. In a preferred embodiment of this aspect of the invention the mutants comprise at least two mutations.

En una realización preferida, los mutantes de Pol\mu comprenden una secuencia polipeptídica con al menos un 60% de identidad con la secuencia SEQ ID NO: 17 (Pol\mu wt: UniProtKB/Swiss-Prot Q9NP87), o con cualquiera de sus subsecuencias SEQ ID NO:1 y SEQ ID NO:2, o con fragmentos de las mismas, donde dichos mutantes comprenden al menos dos mutaciones y mantienen una actividad transferasa terminal incrementada. Preferentemente, dichas mutaciones son (i) una primera mutación puntual en la posición 387 y (ii) una segunda mutación que consiste en:In a preferred embodiment, the mutants of Pol µ comprise a polypeptide sequence with at least 60% of identity with the sequence SEQ ID NO: 17 (Pol µt: UniProtKB / Swiss-Prot Q9NP87), or with any of its sub-sequences SEQ ID NO: 1 and SEQ ID NO: 2, or with fragments of the same, where said mutants comprise at least two mutations and maintain an increased terminal transferase activity. Preferably, said mutations are (i) a first mutation punctual at position 387 and (ii) a second mutation consisting in:

a)to)
una mutación puntual en un aminoácido conservado de Pol\mu, donde preferentemente dicha mutación puntual consiste en una reversión hacia el aminoácido homólogo presente en TdT, oa point mutation in a conserved amino acid of Pol, where preferably said point mutation consists of a reversal towards the homologous amino acid present in TdT, or

b)b)
una mutación en el subdominio loop-1.a mutation in the subdomain loop-1.

En realizaciones más preferidas el grado de identidad de los mutantes de Pol\mu con la secuencia Q9NP87, cualquiera de sus subsecuencias SEQ ID NO:1 y SEQ ID NO:2, o fragmentos de las mismas es alrededor de al menos un 65,% 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%.In more preferred embodiments the degree of Identity of Pol µ mutants with the sequence Q9NP87, any of its sub-sequences SEQ ID NO: 1 and SEQ ID NO: 2, or fragments thereof is about at least 65, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%

También, preferentemente, la primera mutación puntual (i) de los mutantes de Pol\mu consiste en la sustitución del aminoácido que se encuentra en la posición 387 por cualquiera de los aminoácidos seleccionados del grupo que comprende: Glutamina, Asparragina, Cisteína, Treonina, Serina, Metionina, Lisina, Arginina, Histidina o análogos de los mismos, aunque todavía más preferentemente dicha mutación puntual consiste en la sustitución o reversión R387K (mutación no conservativa).Also, preferably, the first mutation point (i) of the Pol µ mutants consists of substitution of the amino acid found at position 387 by any of the amino acids selected from the group comprising: Glutamine, Asparagine, Cysteine, Threonine, Serine, Methionine, Lysine, Arginine, Histidine or analogues thereof, although still more preferably said point mutation consists in the substitution or R387K reversal (non-conservative mutation).

Preferentemente, la segunda mutación (ii) correspondiente a la mutación puntual (a) se localiza en la posición 275. Preferentemente, esta mutación consiste en la sustitución del aminoácido que se encuentra en dicha posición (275) por cualquiera de los aminoácidos seleccionados del grupo que comprende: Glutamina, Asparragina, Cisteína, Treonina, Serina, Metionina o análogos de los mismos, aunque todavía más preferentemente dicha mutación puntual consiste en la sustitución Q275M (mutación conservativa).Preferably, the second mutation (ii) corresponding to the point mutation (a) is located in the position 275. Preferably, this mutation consists in the replacement of the amino acid found in said position (275) by any of the amino acids selected from the group comprising: Glutamine, Asparagine, Cysteine, Threonine, Serine, Methionine or analogues of same, but even more preferably said point mutation It consists of the Q275M substitution (conservative mutation).

En otra realización también preferida, la segunda mutación (ii) consiste en (b) una mutación en el subdominio loop-1, tal como la sustitución o modificación del subdominio loop-1 o fragmentos del mismo por: i) una secuencia con al menos alrededor de un 10% de identidad con la SEQ ID NO: 3 (loop-1 de Pol\mu), preferentemente, con al menos alrededor de un 15%, 20%, 25%, 30%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, o ii) por una secuencia con al menos alrededor de un 10% de identidad con la SEQ ID NO: 4 (loop-1 de TdT), preferentemente, con al menos alrededor de un 15%, 20%, 25%, 30%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%. En una realización particular, dicha secuencia es la SEQ ID NO:4, la cual comparte alrededor de un 20% de identidad con la SEQ ID NO:3.In another also preferred embodiment, the second mutation (ii) consists of (b) a mutation in the subdomain loop-1, such as the replacement or modification of the subdomain loop-1 or fragments thereof by: i) a sequence with at least about 10% identity with the SEQ ID NO: 3 (Pol-1 loop-1), preferably, with at least about 15%, 20%, 25%, 30%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or ii) by a sequence with at less about 10% identity with SEQ ID NO: 4 (loop-1 of TdT), preferably, with at least about 15%, 20%, 25%, 30%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%. In a particular embodiment, said sequence is SEQ ID NO: 4, which shares about 20% of identity with SEQ ID NO: 3.

Más específicamente, los mutantes de la invención tienen las secuencias SEQ ID NO:5, que comprende las mutaciones puntuales R387K y Q275M (en adelante, mutante M3), o SEQ ID NO:6, que comprende la mutación puntual R387K y la inserción del loop-1 de TdT en el lugar del loop-1 de Pol\mu (en adelante, mutante M7). Del mismo modo, la invención también comprende fragmentos o subsecuencias de las secuencias SEQ ID NO:5 o SEQ ID NO:6 que comprendan las referidas mutaciones y, preferentemente, mantengan sustancialmente su actividad deoxinucleotidil-transferasa terminal incrementada. Preferentemente dichos fragmentos tienen las secuencias SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, o SEQ ID NO:10.More specifically, the mutants of the invention have the sequences SEQ ID NO: 5, which comprises the point mutations R387K and Q275M (hereinafter, mutant M3 ), or SEQ ID NO: 6, which comprises the point mutation R387K and the insertion of the TdT loop-1 in place of Pol µ-loop (hereafter, mutant M7 ). In the same way, the invention also comprises fragments or sub-sequences of the sequences SEQ ID NO: 5 or SEQ ID NO: 6 comprising said mutations and, preferably, substantially maintaining their increased terminal deoxynucleotidyl transferase activity. Preferably said fragments have the sequences SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10.

De acuerdo con la invención, ésta también proporciona un mutante que comprende una secuencia polipeptídica con al menos un 60% de identidad con la secuencia Q9NP87 (Pol\mu wt humana: SEQ ID NO: 17) y al menos una mutación puntual en la posición 275, donde dicho mutante presenta una actividad deoxinucleotidil-transferasa terminal mejorada o incrementada. Esta actividad es al menos alrededor de un 10%, 25%, 50%, 75%, 100%, 200%, 300% superior a la de la Pol\mu wt. Preferentemente, dicha mutación en la posición 275 consiste en la sustitución del aminoácido que se encuentra en dicha posición por Glutamina, Asparragina, Cisteína, Treonina, Serina, Glicina, Alanina, Valina, Leucina, Isoleucina, Metionina, Prolina, Fenilalanina y Triptófano, aunque todavía más preferentemente dicha mutación puntual consiste en la sustitución Q275M. Más específicamente, este mutante tiene la secuencia SEQ ID NO:11 (en adelante, mutante M2) o fragmentos de la misma que comprendan la mutación en la posición 275 y, preferentemente, mantengan sustancialmente su actividad transferasa terminal incrementada. Ejemplos de estos fragmentos o subsecuencias son las secuencias SEQ ID NO:12 y la SEQ ID NO: 13.According to the invention, it also provides a mutant comprising a polypeptide sequence with at least 60% identity with the sequence Q9NP87 (Human Pol: WQ ID NO: 17) and at least one point mutation in the position 275, wherein said mutant exhibits enhanced or increased terminal deoxynucleotidyl transferase activity. This activity is at least about 10%, 25%, 50%, 75%, 100%, 200%, 300% higher than that of the Pol. Preferably, said mutation at position 275 consists in the substitution of the amino acid found in said position by Glutamine, Asparagine, Cysteine, Threonine, Serine, Glycine, Alanine, Valine, Leucine, Isoleucine, Methionine, Proline, Phenylalanine and Tryptophan, although even more preferably said point mutation consists in the Q275M substitution. More specifically, this mutant has the sequence SEQ ID NO: 11 (hereinafter, mutant M2 ) or fragments thereof that comprise the mutation at position 275 and, preferably, substantially maintain its increased terminal transferase activity. Examples of these fragments or subsequences are the sequences SEQ ID NO: 12 and SEQ ID NO: 13.

Un segundo aspecto de la invención proporciona una secuencia polinucleotídica que codifica cualquiera de los mutantes de la invención. Del mismo modo, también forman parte de la invención: (i) un vector, que comprende cualquiera de las secuencias polinucleotídicas de acuerdo con la invención, y (ii) una célula huésped que comprende cualquiera de las secuencias polinucleótidicas o vectores de la invención.A second aspect of the invention provides a polynucleotide sequence encoding any of the mutants of the invention. Similarly, they are also part of the invention: (i) a vector, comprising any of the sequences polynucleotides according to the invention, and (ii) a cell host comprising any of the polynucleotide sequences or vectors of the invention.

Más concretamente, la secuencia polinucleotídica de la invención comprende cualquiera de las secuencias SEQ ID NO:14, SEQ ID NO:15, o SEQ ID NO:16, las cuales codifican respectivamente para los mutantes M3, M7 y M2. También forman parte de la invención las subsecuencias o fragmentos de la secuencia polinucleotídica de la invención que codifique para cualquiera de las subsecuencias o fragmentos de los mutantes de la invención. Todas estas secuencias y subsecuencias pueden ser modificadas mediante mutaciones silenciosas (e.g. mutaciones puntuales, deleciones, inserciones o sustituciones) que no tengan efecto sobre la actividad del mutante en cuestión o no modifiquen su actividad sustancialmente o que, simplemente, debido a la degeneración del código genético, no modifiquen su secuencia y consecuentemente tampoco su actividad. De este modo, también forman parte de la presente invención cualquier secuencia con al menos alrededor de un 40% de identidad con cualquiera de las SEQ ID NO: 14, SEQ ID NO:15 y SEQ ID NO.16 que, preferentemente, no modifique su actividad o no la modifiquen sustancialmente. Preferentemente, dicha identidad es de al menos alrededor de un 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%.More specifically, the polynucleotide sequence of the invention comprises any of the sequences SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16, which encode respectively for mutants M3, M7 and M2. They are also part of the invention. the subsequences or fragments of the polynucleotide sequence of the invention that codes for any of the sub-sequences or fragments of the mutants of the invention. All these sequences and Subsequences can be modified by silent mutations (e.g. point mutations, deletions, insertions or substitutions) that have no effect on the activity of the mutant in question or not modify your activity substantially or that, simply, due to the degeneracy of the genetic code, do not modify its sequence and consequently neither its activity. In this way, they also form part of the present invention any sequence with at least About 40% identity with any of SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO.16 that, preferably, does not modify its activity or not substantially modify it. Preferably said identity is at least about 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%.

Métodos de producción de los mutantes de Pol\muProduction methods of Pol µ mutants

Con el objeto de producir los mutantes de la invención, las secuencias polinucleotídicas de la invención son preferentemente incorporadas en un vector que comprende una secuencia promotora o reguladora operativamente relacionada con la secuencia que codifica para el mutante de la invención. De este modo, un tercer aspecto de la invención también se refiere a un método para la producción de los mutantes de la invención que comprende: i) el cultivo de una célula huésped que comprende cualquiera de los polinucleótidos o vectores de la invención y ii) el aislamiento del mutante producido. Preferentemente, el cultivo de la célula es realizado bajo condiciones que promuevan el crecimiento de la célula huésped y/o la expresión del polinucleótido de la invención. Prácticamente cualquier célula huésped que permita la expresión del polinucleótido de la invención puede ser utilizada (e.g., bacterias, levaduras, etc.). Del mismo modo, la invención también comprende la expresión o producción de los mutantes de la invención mediante síntesis química u otros sistemas de expresión in vitro libres de células ("Cell-Free Expression Systems") sobradamente conocidos en el estado de la técnica.In order to produce the mutants of the invention, the polynucleotide sequences of the invention are preferably incorporated into a vector comprising a promoter or regulatory sequence operatively related to the sequence encoding the mutant of the invention. Thus, a third aspect of the invention also relates to a method for the production of the mutants of the invention comprising: i) the cultivation of a host cell comprising any of the polynucleotides or vectors of the invention and ii) Isolation of the mutant produced. Preferably, the cell culture is performed under conditions that promote the growth of the host cell and / or the expression of the polynucleotide of the invention. Virtually any host cell that allows expression of the polynucleotide of the invention can be used (eg, bacteria, yeasts, etc.). Similarly, the invention also comprises the expression or production of the mutants of the invention by chemical synthesis or other systems in vitro cell free ( "Cell-Free Expression Systems") well known in the prior art expression.

Usos de los mutantes Pol\muUses of Pol µ Mutants

Un cuarto aspecto de la invención se refiere al empleo de los mutantes de la invención como herramienta molecular, preferentemente, en todas aquellas técnicas donde se emplea la TdT. Los mutantes pueden ser empleados en este tipo de técnicas, como sustitutivos de la TdT o en combinación con la misma. Más concretamente, los mutantes de la invención en combinación o individualmente son susceptibles de ser empleados preferentemente en: i) ensayos de mareaje de extremos de polinucleótidos de cadena simple (heteropolímeros u homopolímeros) y cadena doble (extremos protuberantes o romos), ii) reunión de extremos protuberantes y romos, iii) polimerización dependiente o independiente de molde, iv) rellenado de gaps (gap-filling), v) detección de roturas de ADN (mismatch detection; e.g. TUNEL), vi) mutagénesis, etc.A fourth aspect of the invention relates to the use of the mutants of the invention as a molecular tool, preferably, in all those techniques where TdT is used. Mutants can be used in these types of techniques, as substitutes for TdT or in combination with it. More specifically, the mutants of the invention, in combination or individually, are likely to be used preferably in: i) single-stranded polynucleotide (heteropolymer or homopolymer) and double-stranded (double-ended (bulging or blunt), ii) assembly tests protuberant and blunt ends, iii) mold-dependent or independent polymerization, iv) gaps filling ( gap-filling ), v) DNA breakage detection ( mismatch detection; eg TUNEL ), vi) mutagenesis, etc.

De este modo, este aspecto proporciona un método para la elongación de un polinucleótido diana que comprende: i) poner en contacto a un polinucleótido diana con el mutante de la invención y nucleótidos o análogos de nucleótidos (mezcla de reacción) y ii) someter la mezcla de reacción a condiciones que favorezcan la inserción de al menos un nucleótido o análogos de nucleótidos en el extremo 3'OH del polinucleótido diana. En una realización preferida el número de nucleótidos o análogos de nucleótidos insertado es de al menos 1, 2, 3, 4 ó 5 nucleótidos y en realizaciones sucesivamente más preferidas entre 1 y 20, 3 y 20, 5 y 20, 1 y 10, 3 y 10, 5 y 10.In this way, this aspect provides a method for elongation of a target polynucleotide comprising: i) contacting a target polynucleotide with the mutant of the invention and nucleotides or nucleotide analogs (mixture of reaction) and ii) subject the reaction mixture to conditions that favor the insertion of at least one nucleotide or analogues of nucleotides at the 3'OH end of the target polynucleotide. In a preferred embodiment the number of nucleotides or analogs of inserted nucleotides is at least 1, 2, 3, 4 or 5 nucleotides and in successively more preferred embodiments between 1 and 20, 3 and 20, 5 and 20, 1 and 10, 3 and 10, 5 and 10.

La invención también proporciona métodos para el mareaje de polinucleótidos que comprende i) poner en contacto a un polinucleótido diana con el mutante de la invención y nucleótidos o análogos de nucleótidos marcados (mezcla de reacción), ii) someter la mezcla de reacción a condiciones que favorezcan la inserción de al menos un nucleótido o análogo del mismo en el extremo 3'OH del polinucleótido diana, y iii) detectar la presencia o no de inserción. En una realización preferida el número de nucleótidos o análogos de nucleótidos marcados insertado es de al menos 1, 2, 3, 4 ó 5 nucleótidos y en realizaciones sucesivamente más preferidas entre 1 y 20, 3 y 20, 5 y 20, 1 y 10, 3 y 10, 5 y 10.The invention also provides methods for polynucleotide mapping comprising i) contacting a target polynucleotide with the mutant of the invention and nucleotides or labeled nucleotide analogs (reaction mixture), ii) subject the reaction mixture at conditions that favor the insertion of at least one nucleotide or analogue thereof at the 3'OH end of the target polynucleotide, and iii) detect the presence or not of insertion. In a preferred embodiment the number of nucleotides or Inserted labeled nucleotide analogs is at least 1, 2, 3, 4 or 5 nucleotides and in successively more preferred embodiments between 1 and 20, 3 and 20, 5 and 20, 1 and 10, 3 and 10, 5 and 10.

Los mutantes de la invención también son susceptibles de ser empleados en métodos o técnicas de gap filing que comprenden: i) poner en contacto a un polinucleótido diana, que comprende al menos un gap o hueco de al menos un nucleótido, con el mutante de la invención y nucleótidos o análogos de nucleótidos (mezcla de reacción), y ii) someter la mezcla de reacción a condiciones que favorezcan la inserción de al menos un nucleótido o análogo de nucleótido en el extremo 3'OH del gap. Adicionalmente, este método comprende iii) detectar si se ha producido o no el rellenado del gap y/o iv) la adición de enzimas (e.g. nucleasas, ligasas), que liguen a los nucleótidos o análogos de nucleótidos introducidos en el polinucleótido diana, o hidrolicen al polinucleótido diana. En una realización más preferida el tamaño del gap es de al menos 1, 2, 3, 4 ó 5 nucleótidos y, más preferentemente, entre 1 y 10 nucleótidos. Estas reacciones pueden favorecerse además mediante la presencia de un grupo fosfato en las regiones 5'P del polinucleótido diana.The mutants of the invention are also capable of being employed in gap filing methods or techniques comprising: i) contacting a target polynucleotide, comprising at least one gap or gap of at least one nucleotide, with the mutant of the invention and nucleotides or nucleotide analogs (reaction mixture), and ii) subjecting the reaction mixture to conditions that favor the insertion of at least one nucleotide or nucleotide analog at the 3'OH end of the gap . Additionally, this method comprises iii) detecting whether or not the gap has been filled in and / or iv) the addition of enzymes (eg nucleases, ligases), which bind to nucleotides or nucleotide analogs introduced into the target polynucleotide, or Hydrolyze the target polynucleotide. In a more preferred embodiment the gap size is at least 1, 2, 3, 4 or 5 nucleotides and, more preferably, between 1 and 10 nucleotides. These reactions can be further enhanced by the presence of a phosphate group in the 5'P regions of the target polynucleotide.

Debido a que los mutantes de la invención tienen la capacidad de incorporar nucleótidos independientemente de molde son excelentes candidatos para ser empleados en técnicas de reunión de extremos, tanto si estos son protuberantes como si son romos. Así, la invención también proporciona un método para la reunión de extremos de polinucleótidos de doble cadena que comprende: i) poner en contacto a un polinucleótido diana de doble cadena con el mutante de la invención y al menos dos nucleótidos o análogos de nucleótidos complementarios (mezcla de reacción), y ii) poner la mezcla de reacción bajo condiciones que favorezcan la introducción de un número suficiente de nucleótidos o análogos de nucleótido en cada uno de los extremos del polinucleótido diana para que se produzca la reunión. Adicionalmente, este método comprende iii) la adición de enzimas (e.g. ligasas) que liguen los extremos una vez están reunidos. En una realización preferida el número de nucleótidos o análogos de nucleótidos insertado es de al menos 1, 2, 3, 4 ó 5 nucleótidos y en realizaciones sucesivamente más preferidas entre 1 y 20, 3 y 20, 5 y 20, 1 y 10, 3 y 10, 5 y 10.Because the mutants of the invention have the ability to incorporate nucleotides regardless of template They are excellent candidates to be employed in meeting techniques of extremes, whether they are bulging or blunt. Thus, the invention also provides a method for the gathering of ends of double stranded polynucleotides comprising: i) putting in contact with a double stranded target polynucleotide with the mutant of the invention and at least two nucleotides or nucleotide analogs complementary (reaction mixture), and ii) put the mixture of reaction under conditions that favor the introduction of a sufficient number of nucleotides or nucleotide analogs in each one of the ends of the target polynucleotide to produce the meeting. Additionally, this method comprises iii) the addition of enzymes (e.g. ligases) that link the ends once they are together. In a preferred embodiment the number of nucleotides or inserted nucleotide analogs is at least 1, 2, 3, 4 or 5 nucleotides and in successively more preferred embodiments among 1 and 20, 3 and 20, 5 and 20, 1 and 10, 3 and 10, 5 and 10.

Otra de las importantes aplicaciones de la actividad TdT es su uso en los ensayos TUNEL (TdT-mediated dUTP-biotin nick end labeling) que permiten la detección de muestras biológicas que están sufriendo apoptosis (Gavrieli, Y. et al. (1992) Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell. Biol. 119, 493.501). Cuando las señales de apoptosis se disparan en la célula se produce un proceso de rotura o fragmentación del ADN. Una polimerasa con actividad deoxinucleotidil transferasa terminal tiene la capacidad de introducir nucleótidos o análogos de nucleótidos en dichas roturas haciendo así visible el proceso apoptótico. Así, la presente invención proporciona un método para la detección de muestras apoptóticas, preferentemente en sus estadios tempranos. Dicho método comprende i) poner en contacto una muestra, que contiene material genético de células potencialmente apoptóticas, con el mutante de la invención y al menos un nucleótido o análogo de nucleótido (mezcla de reacción), ii) someter la mezcla de reacción a condiciones que favorezcan la inserción de nucleótidos o análogos de los mismos, y iii) detectar la presencia o no de inserción, preferentemente mediante fluorescencia, donde la detección de inserción es indicativa de la presencia de material genético fragmentado y, consecuentemente, del comienzo del proceso apoptótico en la muestra. Este mismo método puede emplearse también en técnicas destinadas a comprobar la viabilidad de una muestra biológica, como es el caso de los análisis de esperma en técnicas de reproducción asistida, donde en los espermatozoides con ADN normal sólo se detecta fluorescencia de fondo, mientras que los espermatozoides con ADN fragmentado (múltiples 3'OH terminales) se tiñen con una fluorescencia intensa. La fluorescencia puede detectarse, preferentemente, tanto por citometría de flujo como a través de microscopía fluorescente.Another of the important applications of the TdT activity is its use in the TUNEL trials ( TdT-mediated dUTP-biotin nick end labeling ) that allow the detection of biological samples that are undergoing apoptosis ( Gavrieli, Y. Et al . (1992) Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell. Biol. 119, 493.501 ). When apoptosis signals are triggered in the cell, a process of DNA breakage or fragmentation occurs. A polymerase with terminal deoxynucleotidyl transferase activity has the ability to introduce nucleotides or nucleotide analogs into such breaks thus making the apoptotic process visible. Thus, the present invention provides a method for the detection of apoptotic samples, preferably in their early stages. Said method comprises i) contacting a sample, containing genetic material of potentially apoptotic cells, with the mutant of the invention and at least one nucleotide or nucleotide analogue (reaction mixture), ii) subjecting the reaction mixture to conditions that favor the insertion of nucleotides or analogs thereof, and iii) detect the presence or not of insertion, preferably by fluorescence, where the detection of insertion is indicative of the presence of fragmented genetic material and, consequently, of the beginning of the apoptotic process In the sample. This same method can also be used in techniques aimed at checking the viability of a biological sample, such as sperm analysis in assisted reproduction techniques, where in the sperm with normal DNA only background fluorescence is detected, while the Spermatozoa with fragmented DNA (multiple 3'OH terminals) are stained with intense fluorescence. The fluorescence can be detected, preferably, both by flow cytometry and by fluorescent microscopy.

En cualquiera de los métodos mencionados en los que es necesario detectar la presencia o ausencia de inserción de nucleótidos o análogos de los mismos, esta detección se puede hacer por múltiples metodologías sobradamente conocidas en el estado de la técnica, como puede ser la fluorescencia. Preferentemente, las muestras a marcar o detectar son comparadas con muestras control, de tal forma que la muestra problema es considerada positiva cuando presenta al menos alrededor de un 5% más de inserción que la muestra control y en realizaciones sucesivamente más preferidas al menos alrededor de un 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%.In any of the methods mentioned in the that it is necessary to detect the presence or absence of insertion of nucleotides or analogs thereof, this detection can be done by multiple methodologies well known in the state of technique, such as fluorescence. Preferably, the samples to be marked or detected are compared with control samples, of such that the problem sample is considered positive when It has at least about 5% more insertion than the sample control and in successively more preferred embodiments at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%

Tal y como se ha mencionado anteriormente, en cualquiera de los métodos descritos los mutantes de la invención pueden encontrarse en combinación con TdT o mutantes de la misma, como una forma de mejorar la eficiencia de las técnicas. Incluso varios mutantes de la invención pueden ser combinados con TdT con la misma finalidad. Otra forma de aumentar la eficiencia de los métodos mencionados comprende la adición de iones, preferentemente Mn^{2+} o Co^{2+}, a las mezclas de reacción, ya que éstos son capaces de aumentar la eficiencia catalítica de los mutantes de la invención.As mentioned above, in any of the methods described the mutants of the invention they can be found in combination with TdT or mutants thereof, as a way to improve the efficiency of techniques. Even several mutants of the invention can be combined with TdT with the same purpose. Another way to increase the efficiency of the methods mentioned comprises the addition of ions, preferably Mn 2+ or Co 2+, to the reaction mixtures, since these are capable of increase the catalytic efficiency of mutants in the invention.

Kits Kits

Un quinto aspecto de la invención se relaciona con kits que incorporan cualquiera de los mutantes de la invención, preferentemente, para llevar a cabo cualquiera de los métodos mencionados anteriormente. Adicionalmente, además de los componentes necesarios para poner en marcha el correspondiente ensayo (e.g. tampones, cebadores, dNTPs, ddNTPs, hNTPs, análogos de nucleótidos, iones, etc.), los kits pueden también comprender la TdT o mutantes de la misma como una forma de mejorar así la eficiencia de dichos ensayos.A fifth aspect of the invention relates to with kits incorporating any of the mutants of the invention, preferably, to carry out any of the methods mentioned above. Additionally, in addition to the components necessary to launch the corresponding test (e.g. buffers, primers, dNTPs, ddNTPs, hNTPs, nucleotide analogs, ions, etc.), the kits can also comprise TdT or mutants of it as a way to improve the efficiency of these essays.

El empleo de dichos kits para las aplicaciones previamente mencionadas, por ejemplo, en ensayos de: i) mareaje de extremos de polinucleótidos de cadena simple (heteropolímeros u homopolímeros) y cadena doble (extremos protuberantes o romos), ii) reunión de extremos protuberantes y romos, iii) polimerización dependiente o independiente de molde, iv) rellenado de gaps o huecos (gap-filling), v) detección de roturas de ADN (mismatch detection; e.g. TUNEL), vi) mutagénesis o generación de variabilidad, etc., constituye un aspecto adicional de esta invención.The use of such kits for the aforementioned applications, for example, in tests of: i) single-stranded (single-stranded or homopolymer) and double-stranded polynucleotide ends (protruding or blunt ends), ii) protruding ends and blunt, iii) mold-dependent or independent polymerization, iv) filling gaps or gaps ( gap-filling ), v) DNA breakage detection ( mismatch detection; eg TUNEL ), vi) mutagenesis or generation of variability, etc., It constitutes an additional aspect of this invention.

Ejemplo 1Example one

Reacción de transferasa terminalTerminal Transferase Reaction

Este ensayo muestra la actividad transferasa terminal de cada uno de los mutantes, en comparación con la Pol\mu humana wt [SEQ ID NO: 17] y la TdT comercial de Promega (Fig. 1). Se analiza la extensión máxima con cada uno de los 4 dNTPS por separado, sobre un extremo 3'OH de ADN homopolimérico de cadena sencilla (PoliT). En un primer momento, se seleccionaron aquéllos mutantes que produjeron una estimulación llamativa de la actividad transferasa terminal respecto a Pol\mu wt, para la realización de ensayos de mareaje del extremo 3'OH del ADN.This assay shows the transferase activity. terminal of each of the mutants, compared to the Pol µ human wt [SEQ ID NO: 17] and the commercial TdT of Promega (Fig. 1). Be analyze the maximum extension with each of the 4 dNTPS per separated, on a 3'OH end of chain homopolymeric DNA simple (PoliT). At first, those were selected mutants that produced a striking stimulation of activity terminal transferase with respect to Pol µwt, for the realization of 3'OH end labeling assays of DNA.

Materiales y métodosMaterials and methods

El oligonueleótido fluorescente utilizado para evaluar la actividad transferasa terminal fue PoliT-Cy5 (PoliT15-CY5), que fue comprado a Sigma. Los dNTPs (dATP, dCTP, dGTP y dTTP) fueron comprados a GE Healthcare. Las reacciones de polimerización se llevaron a cabo en un volumen de 10 \mul, en presencia de 1 mM MnCl_{2}, 50 mM TrisHCl (pH 7,5), 1 mM ditiotreitol (DTT), 4% glicerol, 0.1 mg/ml seroalbúmina bovina (BSA), 20 nM del oligonueleótido fluorescente indicado en cada caso, 100 \muM del dNTP indicado en cada caso, y 600 nM de la proteína indicada en cada caso, a excepción de la TdT comercial de Promega (1 unidad). Tras una incubación de 30 min a 37ºC, las reacciones se pararon añadiendo 5,6 \mul de tampón de carga (95% formamida, 10 mM EDTA (ácido etilendiaminotetraacético)). Estas muestras se analizaron mediante electroforesis en geles de poliacrilamida al 20% y urea 8 M y posterior lectura de señal fluorescente utilizando un equipo Typhoon 9410 (GE Healthcare).The fluorescent oligonueleotide used to evaluate terminal transferase activity was PoliT-Cy5 (PoliT15-CY5), which was bought from Sigma. The dNTPs (dATP, dCTP, dGTP and dTTP) were purchased from GE Healthcare. The polymerization reactions are carried out in a volume of 10 µl, in the presence of 1 mM MnCl 2, 50 mM TrisHCl (pH 7.5), 1 mM dithiothreitol (DTT), 4% glycerol, 0.1 mg / ml bovine serum albumin (BSA), 20 nM of fluorescent oligonueleotide indicated in each case, 100 µM of dNTP indicated in each case, and 600 nM of the protein indicated in each case case, except for the commercial TdT of Promega (1 unit). After a 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 µl of loading buffer (95% formamide, 10 mM EDTA (acid ethylenediaminetetraacetic acid)). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent fluorescent signal reading using Typhoon equipment 9410 (GE Healthcare).

Resultados (ver Figura 1)Results (see Figure 1)

--
El mutante combinado R387K-F389G (M1) tiene muy reducida la actividad transferasa terminal intrínseca de Pol\mu wt.The combined mutant R387K-F389G ( M1 ) has greatly reduced the intrinsic terminal transferase activity of Pol.

--
La mutación Q275M (M2) por sí sola parece estimular ligeramente la transferasa terminal respecto a Pol\mu wt.The Q275M ( M2 ) mutation alone seems to slightly stimulate the terminal transferase with respect to Pol µwt.

--
Los cambios R387K-Q275M (M3) y R387K-Chloop1 (M7) son los verdaderamente espectaculares, ya que consumen todo el sustrato de partida (lo cual es muy aplicable a mareaje del extremo 3'OH ya que puede suponer una eficiencia de mareaje cercana al 100%) y elongan hasta grandes tamaños (lo cual puede tener aplicación en reacciones de "tailing").The changes R387K-Q275M ( M3 ) and R387K-Chloop1 ( M7 ) are the truly spectacular ones, since they consume all the starting substrate (which is very applicable to 3'OH end marking since it can be a near tidal efficiency 100%) and extend to large sizes (which can be applied in " tailing " reactions).

--
Los cambios N457D (M4), S458N (M5) y su combinación también logra estimular la actividad transferasa terminal.The changes N457D ( M4 ), S458N ( M5 ) and their combination also stimulate terminal transferase activity.

Las mutaciones puntuales Q275M, N457D, S458N y R387K se corresponden a reversiones (sustituciones) hacia el aminoácido que se encuentra conservado en TdT tal como se puede apreciar en la Figura 13. Las tres primeras mutaciones son mutaciones conservativas, puesto que el aminoácido al que se revierte pertenece al mismo grupo (ver Tabla 1), y en cambio la mutación R387K es no conservativa.Point mutations Q275M, N457D, S458N and R387K correspond to reversals (substitutions) towards the amino acid that is conserved in TdT as can be appreciate in Figure 13. The first three mutations are conservative mutations, since the amino acid to which revert belongs to the same group (see Table 1), and instead the R387K mutation is non-conservative.

Ejemplo 2Example 2

Prueba comparativa de transferasa terminal entre los dos mutantes dobles de la serie: \mu-R387K/Q275M y \mu-R387K/ Chloop1Comparative terminal transferase test between the two double mutants of the series: µ-R387K / Q275M and µR387K / Chloop1

Se llevó a cabo una reacción similar a la del Ejemplo 1, pero a dosis decrecientes de polimerasa (400 nM, 200 nM y 100 nM). A 400 nM de proteína se mantuvo la extensión de cerca del 100% del sustrato original de partida. A dosis inferiores de proteína, si bien la actividad transferasa terminal siguió estando fuertemente estimulada, la extensión del sustrato original de partida no fue tan eficaz (Figura 2).A reaction similar to that of Example 1, but at decreasing doses of polymerase (400 nM, 200 nM and 100 nM). At 400 nM protein the extent of near 100% of the original starting substrate. At lower doses of protein, although terminal transferase activity remained strongly stimulated, the extension of the original substrate of departure was not as effective (Figure 2).

Materiales y métodosMaterials and methods

El oligonucleótido fluorescente utilizado para evaluar la actividad transferasa terminal fue PoliT-Cy5 (PoliT15-CY5), que fue comprado a Sigma. Los dNTPs fueron comprados a GE Healthcare. Las reacciones de polimerización se llevaron a cabo en un volumen de 10 \mul, en presencia de 1 mM MnCl_{2}, 50 mM TrisHCl (pH 7,5), 1 mM DTT, 4% glicerol, 0,1 mg/ml BSA, 20 nM del oligonucleótido fluorescente indicado en cada caso, 100 \muM del dNTP indicado en cada caso, y la dosis de proteína indicada en cada caso. Tras una incubación de 30 min a 37ºC, las reacciones se pararon añadiendo 5,6 \mul de tampón de carga (95% formamida, 10 mM EDTA). Estas muestras se analizaron mediante electroforesis en geles de poliacrilamida al 20% y urea 8 M y posterior lectura de señal fluorescente utilizando un equipo Typhoon 9410 (GE Healthcare).The fluorescent oligonucleotide used to evaluate terminal transferase activity was PoliT-Cy5 (PoliT15-CY5), which was bought from Sigma. The dNTPs were purchased from GE Healthcare. The polymerization reactions were carried out in a volume of 10 µl, in the presence of 1 mM MnCl2, 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol, 0.1 mg / ml BSA, 20 nM oligonucleotide fluorescent indicated in each case, 100 µM of the dNTP indicated in each case, and the protein dose indicated in each case. After one 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 µl of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in gels of 20% polyacrylamide and 8 M urea and subsequent signal reading fluorescent using a Typhoon 9410 (GE Healthcare).

Ejemplo 3Example 3

Ensayo de actividad transferasa terminal de los mutantes dobles (\mu-R387K/0275M y \mu-R387K/Chloop1) en comparación con los mutantes simples de cada uno de ellosTerminal transferase activity assay of double mutants (µ-R387K / 0275M and µ-R387K / Chloop1) compared to mutants simple of each of them

Se analiza la extensión máxima con cada uno de los 4 dNTPS por separado sobre un extremo 3'OH de ADN homopolimérico de cadena sencilla (Poli T). Se determina si las mutaciones sencillas son suficientes por sí solas para estimular la actividad transferasa terminal en la medida en que se ha comprobado, o bien es necesaria la combinación de varias mutaciones para lograr la potente actividad alcanzada en los ensayos anteriores.The maximum extent is analyzed with each of the 4 dNTPS separately on a 3'OH end of homopolymeric DNA single chain (Poly T). It is determined if the mutations simple ones alone are enough to stimulate activity terminal transferase to the extent that it has been proven, or it is necessary the combination of several mutations to achieve the powerful activity achieved in previous trials.

Materiales y métodosMaterials and methods

El oligonueleótido fluorescente utilizado para evaluar la actividad transferasa terminal fue PoliT-Cy5 (PoliT15-CY5), que fue comprado a Sigma. Los dNTPs fueron comprados a GE Healthcare. Las reacciones de polimerización se llevaron a cabo en un volumen de 10 \mul, en presencia de 1 mM MnCl_{2}, 50 mM TrisHCl (pH 7,5), 1 mM DTT, 4% glicerol, 0,1 mg/ml BSA, 20 nM del oligonueleótido fluorescente indicado en cada caso, 100 \muM del dNTP indicado en cada caso, y 600 nM de la proteína indicada en cada caso, a excepción de la TdT comercial de Promega (1 unidad). Tras una incubación de 30 min a 37ºC, las reacciones se pararon añadiendo 5,6 \mul de tampón de carga (95% formamida, 10 mM EDTA). Estas muestras se analizaron mediante electroforesis en geles de poliacrilamida al 20% y urea 8 M y posterior lectura de señal fluorescente utilizando un equipo Typhoon 9410 (GE Healthcare).The fluorescent oligonueleotide used to evaluate terminal transferase activity was PoliT-Cy5 (PoliT15-CY5), which was bought from Sigma. The dNTPs were purchased from GE Healthcare. The polymerization reactions were carried out in a volume of 10 µl, in the presence of 1 mM MnCl2, 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol, 0.1 mg / ml BSA, 20 nM oligonucleotide fluorescent indicated in each case, 100 µM of the dNTP indicated in each case, and 600 nM of the protein indicated in each case, to exception of the commercial TdT of Promega (1 unit). After one 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 µl of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in gels of 20% polyacrylamide and 8 M urea and subsequent signal reading fluorescent using a Typhoon 9410 (GE Healthcare).

Resultados (ver Figura 3)Results (see Figure 3)

--
El mutante simple R387K (R) logra un aumento eficaz de la actividad transferasa terminal intrínseca de Pol\mu wt, especialmente con dT y dC. Sin embargo dista mucho de llegar a los niveles alcanzados por cualquiera de los mutantes combinados (M3 y M7).He simple mutant R387K (R) achieves an effective increase in activity intrinsic terminal transferase of Pol µ wt, especially with dT and dC. However, it is far from reaching the levels reached by any of the combined mutants (M3 and M7).

--
El mutante simple \mu-Chloop1 (Ch) logra un cambio en el patrón de inserción de dNTPs respecto a Pol\mu wt, pero no supone un estímulo especialmente llamativo de su actividad transferasa terminal.The simple mutant µ-Chloop1 ( Ch ) achieves a change in the pattern of insertion of dNTPs with respect to Pol [mu] wt, but does not imply a particularly striking stimulus of its terminal transferase activity.

--
El mutante Q275M (M2) logra un cierto estímulo de la actividad transferasa terminal en comparación con Pol\mu wt.He Q275M mutant (M2) achieves a certain activity stimulus terminal transferase compared to Pol µ wt.

La combinación de las dos mutaciones que componen cada mutante seleccionado (\mu-R387K/Q275M y \mu-R387K/
Chloop1) da lugar a niveles espectaculares de actividad transferasa terminal. Cada una de las mutaciones simples por separado supone una cierta mejora respecto a Pol\mu wt en este sentido.The combination of the two mutations that make up each selected mutant (µ-R387K / Q275M and µ-R387K /
Chloop1) results in spectacular levels of terminal transferase activity. Each of the simple mutations separately assumes a certain improvement over Pol µwt in this regard.

Ejemplo 4Example 4

Ensayo de actividad transferasa terminal de los mutantes dobles (\mu-R387K/Q275M y \mu-R387K/Chloop1) en comparación con los mutantes simples de cada uno de ellos y en presencia de Co^{2+} como metal activadorTerminal transferase activity assay of double mutants (µ-R387K / Q275M and µ-R387K / Chloop1) compared to mutants simple of each of them and in the presence of Co 2+ as metal activator

En este caso, aunque el patrón de inserción de dNTPs es algo diferente respecto al de Mn^{2+}, y en general está menos avanzado, resulta evidente que los mutantes dobles (\mu-R387K/Q275M y \mu-R387K/Chloop1) destacan claramente respecto a los mutantes simples en cuanto a actividad transferasa terminal.In this case, although the insertion pattern of dNTPs is somewhat different from that of Mn 2+, and in general it is less advanced, it is clear that double mutants (µ-R387K / Q275M and µR387K / Chloop1) clearly stand out from simple mutants in terms of terminal transferase activity.

Materiales y métodosMaterials and methods

El oligonucleótido fluorescente utilizado para evaluar la actividad transferasa terminal fue PoliT-Cy5 (PoliT15-CY5), que fue comprado a Sigma. Los dNTPs fueron comprados a GE Healthcare. Las reacciones de polimerización se llevaron a cabo en un volumen de 10 \mul, en presencia de 100 mM de tampón cacodilato (pH 6,8), 1 mM CoCl_{2}, 0.1 mM DTT, 20 nM del oligonucleótido fluorescente indicado en cada caso, 100 \muM del dNTP indicado en cada caso, y 600 nM de la proteína indicada en cada caso, a excepción de la TdT comercial de Promega (1 unidad). Tras una incubación de 30 min a 37ºC, las reacciones se pararon añadiendo 5,6 \mul de tampón de carga (95% formamida, 10 mM EDTA). Estas muestras se analizaron mediante electroforesis en geles de poliacrilamida al 20% y urea 8 M y posterior lectura de señal fluorescente utilizando un equipo Typhoon 9410 (GE Healthcare).The fluorescent oligonucleotide used to evaluate terminal transferase activity was PoliT-Cy5 (PoliT15-CY5), which was bought from Sigma. The dNTPs were purchased from GE Healthcare. The polymerization reactions were carried out in a volume of 10 µl, in the presence of 100 mM cacodylate buffer (pH 6.8), 1 mM CoCl 2, 0.1 mM DTT, 20 nM fluorescent oligonucleotide indicated in each case, 100 µM of the dNTP indicated in each case, and 600 nM of the protein indicated in each case, with the exception of TdT Promega commercial (1 unit). After a 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 µl of load (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent fluorescent signal reading using a device Typhoon 9410 (GE Healthcare).

Resultados (ver Figura 4)Results (see Figure 4)

La combinación de las dos mutaciones que componen cada mutante seleccionado (\mu-R387K/Q275M y \mu-R387K/
Chloop1) logra niveles espectaculares de actividad transferasa terminal. Cada una de las mutaciones simples por separado supone una cierta mejora respecto a Pol\mu wt en este sentido.The combination of the two mutations that make up each selected mutant (µ-R387K / Q275M and µ-R387K /
Chloop1) achieves spectacular levels of terminal transferase activity. Each of the simple mutations separately assumes a certain improvement over Pol µwt in this regard.

Ejemplo 5Example 5

Ensayo de dependencia de moldeMold Dependency Test

Con este ensayo se comprueba si los mutantes dobles han visto afectada su capacidad de polimerización dependiente de molde respecto a Pol\mu wt. Resulta conveniente que esta actividad se mantenga dentro de unos determinados niveles, ya que esto permitiría su aplicación en reacciones de mareaje con sustratos de ADN de cadena doble o con molde.With this test it is checked whether the mutants doubles have affected their ability to dependent polymerization of mold with respect to Pol. It is convenient that this activity stays within certain levels, since this would allow its application in substrate reaction reactions of double strand or template DNA.

Materiales y métodosMaterials and methods

El oligonucleótido fluorescente SP1C-FLO (GATCACAGTGAGTAC-FLO) fue hibridado con el oligonucleótido T13(G) (AGAAGTGTATCTGGTACTCACTGTGATC) para generar el sustrato de ADN indicado en la parte superior de la Figura 5. Ambos oligonucleótidos fueron comprados a Sigma. Los dNTPs fueron comprados a GE Healthcare. Las reacciones de polimerización se llevaron a cabo en un volumen de 10 \mul, en presencia de 2,5 mM MgCl_{2}, 50 mM TrisHCl (pH 7,5), 1 mM DTT, 4% glicerol, 0,1 mg/ml BSA, 10 nM del híbrido fluorescente de ADN, la dosis de dNTP/dNTPs indicada en cada caso, y 100 nM de la proteína indicada en cada caso. Tras una incubación de 30 min a 37ºC, las reacciones se pararon añadiendo 5,6 \mul de tampón de carga (95% formamida, 10 mM EDTA). Estas muestras se analizaron mediante electroforesis en geles de poliacrilamida al 20% y urea 8 M y posterior lectura de señal fluorescente utilizando un equipo Typhoon 9410 (GE Healthcare).Fluorescent oligonucleotide SP1C-FLO (GATCACAGTGAGTAC-FLO) was hybridized with oligonucleotide T13 (G) (AGAAGTGTATCTGGTACTCACTGTGATC) to generate the DNA substrate indicated at the top of Figure 5. Both oligonucleotides They were bought from Sigma. The dNTPs were purchased from GE Healthcare The polymerization reactions were carried out in a volume of 10 µL, in the presence of 2.5 mM MgCl2, 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol, 0.1 mg / ml BSA, 10 nM of fluorescent DNA hybrid, the dose of dNTP / dNTPs indicated in each case, and 100 nM of the protein indicated in each case. After one 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 µl of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in gels of 20% polyacrylamide and 8 M urea and subsequent signal reading fluorescent using a Typhoon 9410 (GE Healthcare).

Resultados Results

Tal y como se aprecia en la parte izquierda de la Figura 5 se suministran los 4 dNTPs, para tratar de comprobar la extensión máxima que puede llevar a cabo la proteína sobre el sustrato de ADN indicado en la parte superior. Únicamente la mutación simple Chloop1 parece producir una pequeña disminución en la elongación, sin que desaparezca la capacidad de polimerización. El mutante M7, que contiene la mutación Chloop1 también se ve afectado en el mismo grado. Los mutantes M2 y M3 incluso parecen mejorar la propia capacidad de elongación de Pol\mu wt, lo cual resulta muy positivo.As seen on the left side of Figure 4 provides the 4 dNTPs, to try to check the maximum extent that the protein can carry out on the DNA substrate indicated at the top. Only the simple mutation Chloop1 seems to produce a small decrease in elongation, without the polymerization capacity disappearing. The M7 mutant, which contains the Chloop1 mutation is also seen affected in the same degree. M2 and M3 mutants even seem improve Pol \ mu wt's own elongation capacity, which It is very positive.

En la parte derecha de la Figura 5 se lleva a cabo una reacción similar, pero suministrando sólo el nucleótido complementario a la primera posición en el molde. El paso a +1 se realiza de modo muy eficiente con todos los
casos.A similar reaction is carried out on the right side of Figure 5, but supplying only the complementary nucleotide to the first position in the mold. The step to +1 is done very efficiently with all
cases.

Ejemplo 6Example 6

Ensayo de dependencia de moldeMold Dependency Test

En este ensayo se comprobó la dependencia de molde con los mutantes de dobles (M3 y M7) (ver Figura 6) y los mutantes simples en el contexto de un gap de ADN de 1 nucleótido con fosfato.In this trial the dependence of template with the double mutants (M3 and M7) (see Figure 6) and the simple mutants in the context of a 1 nucleotide DNA gap with phosphate.

Materiales y métodosMaterials and methods

El oligonueleótido fluorescente SP1C-FLO (GATCACAGTGAGTAC-FLO) fue hibridado con el oligonueleótido T13(G) (AGAAGTGTATCTGGTACTCACTGTGATC) y Dgl-P (AGATACACTTCT-P) para generar el sustrato de ADN indicado en la parte superior de la Figura 6. Los oligonucleótidos fueron comprados a Sigma. El dNTP fue comprado a GE Healthcare. Las reacciones de polimerización se llevaron a cabo en un volumen de 10 \mul, en presencia de 2,5 mM MgCl_{2}, 50 mM TrisHCl (pH 7,5), 1 mM DTT, 4% glicerol, 0,1 mg/ml BSA, 10 nM del híbrido fluorescente de ADN, la dosis de dNTP/dNTPs indicada en cada caso, y 100 nM de la proteína indicada en cada caso. Tras una incubación de 30 min a 37ºC, las reacciones se pararon añadiendo 5,6 \mul de tampón de carga (95% formamida, 10 mM EDTA). Estas muestras se analizaron mediante electroforesis en geles de poliacrilamida al 20% y urea 8 M y posterior lectura de señal fluorescente utilizando un equipo Typhoon 9410 (GE
Healthcare).The fluorescent oligonueleotide SP1C-FLO (GATCACAGTGAGTAC-FLO) was hybridized with oligonueleotide T13 (G) (AGAAGTGTATCTGGTACTCACTGTGATC) and Dgl-P (AGATACACTTCT-P) to generate the DNA substrate indicated in the upper part of the oligonucleotide in Figure 6. oligonucleotide They were bought from Sigma. The dNTP was purchased from GE Healthcare. The polymerization reactions were carried out in a volume of 10 µL, in the presence of 2.5 mM MgCl2, 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol, 0.1 mg / ml BSA, 10 nM of the fluorescent DNA hybrid, the dose of dNTP / dNTPs indicated in each case, and 100 nM of the protein indicated in each case. After a 30 min incubation at 37 ° C, the reactions were stopped by adding 5.6 µl of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent fluorescent signal reading using Typhoon 9410 (GE
Healthcare)

Resultados Results

Tal y como se puede apreciar en la Figura 6, en este tipo de contexto de ADN todos los mutantes muestran una eficiencia de inserción similar.As can be seen in Figure 6, in this type of DNA context all mutants show a similar insertion efficiency. 

       \newpage\ newpage

Ejemplo 7Example 7

Prueba de marcaje de extremo 3'OH3'OH end marking test

Se probó la serie completa de mutantes de Pol\mu, junto con Pol\mu wt y TdT en una reacción de mareaje en el extremo 3'OH de un oligonucleótido de cadena sencilla. Se utilizó como sustrato un oligonucleótido de cadena sencilla marcado con Cy5 en su extremo 5' para su seguimiento. Se suministró ddATP marcado con fluoresceína (FLO) susceptible de ser incorporado por la polimerasa en el extremo 3OH' del ADN. El canal ADN permite realizar el seguimiento del ADN original, y comprobar la proporción de oligo que ha sido marcada (posición +1) frente al resto no marcado (posición 0). El canal del ddNTP permite comprobar la entrada en la posición +1 del ddNTP marcado con
FLO.The complete series of Pol µ mutants was tested, together with Pol µt and TdT in a 3'OH end reaction reaction of a single chain oligonucleotide. A single chain oligonucleotide labeled with Cy5 at its 5 'end was used as a substrate for monitoring. Fluorescein-labeled ddATP (FLO) capable of being incorporated by the polymerase at the 3OH 'end of the DNA was supplied. The DNA channel allows you to track the original DNA, and check the proportion of oligo that has been marked (position +1) against the unmarked remainder (position 0). The ddNTP channel allows you to check the entry at the +1 position of the ddNTP marked with
FLO.

Materiales y métodosMaterials and methods

El oligonucleótido fluorescente utilizado fue: SP1C-Cy5 (GATCACAGTGAGTAC-Cy5), que fue comprado a Sigma. El ddATP-Cy5 fue comprado a Perkin-Elmer. Las reacciones se llevaron a cabo en un volumen de 10 \mul, en presencia de 1 mM MnCl_{2}, 50 mM TrisHCl (pH 7,5), 1 mM DTT, 4% glicerol y 0,1 mg/ml BSA (excepto el canal de TdT, que llevaba 100 mM de tampón cacodilato, 1 mM CoCl_{2} y 0,1 mM DTT), 10 nM del oligo fluorescente de ADN, 1 \muM ddATP-FLO, y 600 nM de la proteína indicada en cada caso. Tras una incubación de 30 min a 37ºC, las reacciones se pararon añadiendo 5,6 \mul de tampón de carga (95% formamida, 10 mM EDTA). Estas muestras se analizaron mediante electroforesis en geles de poliacrilamida al 20% y urea 8 M y posterior lectura de señal fluorescente utilizando un equipo Typhoon 9410 (GE Healthcare).The fluorescent oligonucleotide used was: SP1C-Cy5 (GATCACAGTGAGTAC-Cy5), which It was bought from Sigma. The ddATP-Cy5 was purchased from Perkin-Elmer. The reactions were carried out in a volume of 10 µL, in the presence of 1 mM MnCl2, 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol and 0.1 mg / ml BSA (except for TdT channel, which carried 100 mM of cacodylate buffer, 1 mM CoCl 2 and 0.1 mM DTT), 10 nM of the fluorescent DNA oligo, 1 µd ddATP-FLO, and 600 nM of the indicated protein in each case. After a 30 min incubation at 37 ° C, the reactions they stopped by adding 5.6 µl of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent reading of fluorescent signal using a Typhoon 9410 (GE Healthcare)

Resultados Results

Tal y como puede apreciarse en la Figura 7, Pol\mu wt es capaz de marcar en torno al 50% del oligo suministrado. Los mutantes M4, M5 y M6 (\mu-N457D-S458N) presentan un comportamiento similar. El mutante MI ve muy reducida su capacidad de mareaje respecto a Pol\mu wt. El mutante M2 supone una mejora respecto a Pol\mu wt aunque no llega a marcar el 100% del sustrato de partida. Los M3 y M7 son capaces de marcar el 100% del sustrato original de partida, superando incluso los niveles logrados con la TdT comercial de Promega.As can be seen in Figure 7, Pol µ wt is capable of marking around 50% of the oligo supplied M4, M5 and M6 mutants (µ-N457D-S458N) have a similar behavior. The mutant MI sees its capacity greatly reduced of tide relative to Pol. The M2 mutant is an improvement with respect to Pol [mu] wt although it does not mark 100% of the substrate of departure. The M3 and M7 are capable of marking 100% of the substrate original starting, even exceeding the levels achieved with the Commercial TdT of Promega.

Ejemplo 8Example 8

Prueba de mareaje de extremo 3'OH3'OH end maze test

Ensayo similar al realizado en el Ejemplo 7, en el que se compara la eficacia de los mutantes M3 y M7 en reacciones de mareaje, respecto a las mutaciones simples que componen cada uno de los mutantes.Test similar to that performed in Example 7, in which compares the efficacy of the M3 and M7 mutants in reactions of mareaje, with respect to the simple mutations that make up each one of the mutants.

Materiales y métodosMaterials and methods

El oligonueleótido fluorescente utilizado fue: SP1C-Cy5 (GATCACAGTGAGTAC-Cy5), que fue comprado a Sigma. El ddATP-Cy5 fue comprado a Perkin-Elmer. Las reacciones se llevaron a cabo en un volumen de 10 \mul, en presencia de 1 mM MnCl_{2}, 50 mM TrisHCl (pH 7,5), 1 mM DTT, 4% glicerol y 0,1 mg/ml BSA (excepto el canal de TdT, que llevaba 100 mM de tampón cacodilato, 1 mM CoCl_{2} y 0,1 mM DTT), 10 nM del oligo fluorescente de ADN, 1 \muM ddATP-FLO, y 600 nM de la proteína indicada en cada caso. Tras una incubación de 30 minutos a 37ºC, las reacciones se pararon añadiendo 5,6 \mul de tampón de carga (95% formamida, 10 mM EDTA). Estas muestras se analizaron mediante electroforesis en geles de poliacrilamida al 20% y urea 8 M y posterior lectura de señal fluorescente utilizando un equipo Typhoon 9410 (GE Healthcare).The fluorescent oligonueleotide used was: SP1C-Cy5 (GATCACAGTGAGTAC-Cy5), which It was bought from Sigma. The ddATP-Cy5 was purchased from Perkin-Elmer. The reactions were carried out in a volume of 10 µL, in the presence of 1 mM MnCl2, 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol and 0.1 mg / ml BSA (except for TdT channel, which carried 100 mM of cacodylate buffer, 1 mM CoCl 2 and 0.1 mM DTT), 10 nM of the fluorescent DNA oligo, 1 µd ddATP-FLO, and 600 nM of the indicated protein in each case. After a 30 minute incubation at 37 ° C, the reactions were stopped by adding 5.6 µl of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent fluorescent signal reading using Typhoon equipment 9410 (GE Healthcare).

Resultados (ver Figura 8)Results (see Figure 8)

--
Las mutaciones simples R387K (R) y Ch-loop-1 (Ch) no logran ninguna mejora respecto a Pol\mu wt en ese tipo de reacciones.The simple mutations R387K ( R ) and Ch-loop-1 ( Ch ) do not achieve any improvement over Pol µwt in such reactions.

--
El mutante M2, como ya se vio en la figura 7, sí supone una mejora puesto que es capaz de acabar con casi todo el sustrato de partida, aunque no con el 100%.He mutant M2, as already seen in figure 7, it is an improvement since it is capable of destroying almost the entire starting substrate, although not with 100%.

--
M3 y M7 no logran el mareaje del 100% del sustrato de partida.M3 and M7 does not achieve 100% marking of the starting substrate.

Ejemplo 9Example 9

Prueba de marcaje de extremo 3'OH3'OH end marking test

Ensayo similar al realizado en el ejemplo 8, en el que se compara la eficacia de los mutantes M3 y M7 en reacciones de mareaje, respecto a las mutaciones simples que componen cada uno de los mutantes. En este caso se utiliza un sustrato de ADN de cadena sencilla diferente (PoliT) para descartar que el resultado sea dependiente de secuencia.Test similar to that performed in example 8, in which compares the efficacy of the M3 and M7 mutants in reactions of mareaje, with respect to the simple mutations that make up each one of the mutants. In this case a DNA substrate of different single string (PoliT) to rule out that the result Be sequence dependent.

Materiales y métodosMaterials and methods

El oligonucleótido fluorescente utilizado fue: PoliT-Cy5 (PoliT 15-Cy5), que fue comprado a Sigma. El ddATP-Cy5 fue comprado a Perkin-Elmer. Las reacciones se llevaron a cabo en un volumen de 10 \mul, en presencia de 1 mM MnCl_{2}, 50 mM TrisHCl (pH 7,5), 1 mM DTT, 4% glicerol y 0,1 mg/ml BSA (excepto el canal de TdT, que llevaba 100 mM de tampón cacodilato, 1 mM CoCl_{2} y 0,1 mM DTT), 10 nM del oligo fluorescente de ADN, 1 \muM ddATP-FLO, y 600 nM de la proteína indicada en cada caso. Tras una incubación de 30 min a 37ºC, las reacciones se pararon añadiendo 5,6 \mul de tampón de carga (95% formamida, 10 mM EDTA). Estas muestras se analizaron mediante electroforesis en geles de poliacrilamida al 20% y urea 8 M y posterior lectura de señal fluorescente utilizando un equipo Typhoon 9410 (GE Healthcare).The fluorescent oligonucleotide used was: PoliT-Cy5 (PoliT 15-Cy5), which was bought from Sigma. The ddATP-Cy5 was purchased from Perkin-Elmer. The reactions were carried out in a volume of 10 µL, in the presence of 1 mM MnCl2, 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol and 0.1 mg / ml BSA (except for TdT channel, which carried 100 mM of cacodylate buffer, 1 mM CoCl 2 and 0.1 mM DTT), 10 nM of the fluorescent DNA oligo, 1 µd ddATP-FLO, and 600 nM of the indicated protein in each case. After a 30 min incubation at 37 ° C, the reactions they stopped by adding 5.6 µl of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent reading of fluorescent signal using a Typhoon 9410 (GE Healthcare)

Resultados (ver Figura 9)Results (see Figure 9)

--
El mutante simple Ch no logra ninguna mejora respecto a Pol\mu wt en ese tipo de reacciones.He simple mutant Ch does not achieve any improvement over Pol µt in That kind of reactions.

--
El mutante R en este caso particular mejora levemente respecto a Pol\mu wt, lo cual puede deberse a un efecto de secuencia.He R mutant in this particular case improves slightly with respect to Pol µt, which may be due to an effect of sequence.

--
El mutante M2, como ya se vio en la figura 8, sí supone una mejora, pero no logra el mareaje del 100% del sustrato de partida, como sí ocurre en los casos de M3 y M7.He mutant M2, as already seen in Figure 8, it is an improvement, but it does not achieve 100% marking of the starting substrate, as if It occurs in cases of M3 and M7.

Ejemplo 10Example 10

Prueba de mareaje de extremo 3'OH3'OH end maze test

En este ensayo, similar al mostrado en el Ejemplo 9, se compara la eficacia de los mutantes M3 y M7 en reacciones de mareaje, respecto a las mutaciones simples que componen cada uno de los mutantes. En este caso se utiliza un sustrato de ADN de cadena sencilla diferente (PoliA) para contrastar con los anteriores.In this essay, similar to that shown in the Example 9, the efficacy of the M3 and M7 mutants is compared in mareaje reactions, regarding the simple mutations that make up each of the mutants. In this case a different single strand DNA (PolyA) substrate to contrast with the previous ones.

Materiales y métodosMaterials and methods

El oligonueleótido fluorescente utilizado fue: PoliA-Cy5 (PoliA15-Cy5), que fue comprado a Sigma. El ddATP-Cy5 fue comprado a Perkin-Elmer. Las reacciones se llevaron a cabo en un volumen de 10 \mul, en presencia de 1 mM MnCl_{2}, 50 mM TrisHCl (pH 7,5), 1 mM DTT, 4% glicerol y 0,1 mg/ml BSA (excepto el canal de TdT, que llevaba 100 mM de tampón cacodilato, 1 mM CoCl_{2} y 0,1 mM DTT), 10 nM del oligo fluorescente de ADN, 1 \muM ddATP-FLO, y 600 nM de la proteína indicada en cada caso. Tras una incubación de 30 min a 37ºC, las reacciones se pararon añadiendo 5,6 \mul de tampón de carga (95% formamida, 10 mM EDTA). Estas muestras se analizaron mediante electroforesis en geles de poliacrilamida al 20% y urea 8 M y posterior lectura de señal fluorescente utilizando un equipo Typhoon 9410 (GE Healthcare).The fluorescent oligonueleotide used was: PoliA-Cy5 (PoliA15-Cy5), which was bought from Sigma. The ddATP-Cy5 was purchased from Perkin-Elmer. The reactions were carried out in a volume of 10 µL, in the presence of 1 mM MnCl2, 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol and 0.1 mg / ml BSA (except for TdT channel, which carried 100 mM of cacodylate buffer, 1 mM CoCl 2 and 0.1 mM DTT), 10 nM of the fluorescent DNA oligo, 1 µd ddATP-FLO, and 600 nM of the indicated protein in each case. After a 30 min incubation at 37 ° C, the reactions they stopped by adding 5.6 µl of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent reading of fluorescent signal using a Typhoon 9410 (GE Healthcare)

Resultados (ver Figura 10)Results (see Figure 10)

--
Los mutantes simples R y Ch no logran ninguna mejora respecto a Pol\mu wt en ese tipo de reacciones. Parece confirmarse que el efecto de mejora con R que se veía en la figura anterior era dependiente de secuencia.The simple mutants R and Ch do not achieve any improvement over Pol µ wt in that kind of reactions. It seems to be confirmed that the effect of improvement with R seen in the previous figure was dependent on sequence.

--
El mutante M2, como ya se vio en ejemplos anteriores, sí supone una mejora, pero no logra el mareaje del 100% del sustrato de partida, como sí ocurre en los casos de M3 y M7.He mutant M2, as already seen in previous examples, it does suppose a improves, but does not achieve 100% marking of the starting substrate, as it does in the cases of M3 and M7.

Ejemplo 11Example eleven

Prueba de mareaje de extremo 3' con los 4 ddNTPs fluorescentes3 'end tide test with the 4 ddNTPs fluorescent

Este ensayo muestra que la reacción de mareaje con M3 y M7 es altamente eficaz con los 4 ddNTPs fluorescentes, tanto en presencia de Mn^{2+} como de Co^{2+} (Fig. 11).This test shows that the tidal reaction with M3 and M7 it is highly effective with the 4 fluorescent ddNTPs, both in the presence of Mn 2+ and Co 2+ (Fig. 11).

Materiales y métodosMaterials and methods

El oligonueleótido fluorescente utilizado fue: SP1C-Cy5 (GATCACAGTGAGTAC-Cy5), que fue comprado a Sigma. Los dideoxinucleótidos fluorescentes (ddATP-FLO, ddUTP-FLO, ddCTP-FLO, ddGTP-FLO) fueron comprados a Perkin-Elmer. Las reacciones se llevaron a cabo en un volumen de 10 \mul, en presencia de 1 mM MnCl_{2}, 50 mM TrisHCl (pH 7,5), 1 mM DTT, 4% glicerol y 0,1 mg/ml BSA (en el caso de reacciones con 1 mM Mn^{2+}) y 100 mM de tampón cacodilato, 1 mM CoCl_{2} y 0,1 mM DTT (en el caso de reacciones con 1 mM Co^{2+}), 10 nM del oligo fluorescente de ADN, 1 \muM ddATP-FLO, y 600 nM de la proteína indicada en cada caso. Tras una incubación de 30 min a 37ºC, las reacciones se pararon añadiendo 5,6 \mul de tampón de carga (95% formamida, 10 mM EDTA). Estas muestras se analizaron mediante electroforesis en geles de poliacrilamida al 20% y urea 8 M y posterior lectura de señal fluorescente utilizando un equipo Typhoon 9410 (GE Healthcare).The fluorescent oligonueleotide used was: SP1C-Cy5 (GATCACAGTGAGTAC-Cy5), which It was bought from Sigma. Fluorescent dideoxynucleotides (ddATP-FLO, ddUTP-FLO, ddCTP-FLO, ddGTP-FLO) were purchased from Perkin-Elmer. The reactions took carried out in a volume of 10 µL, in the presence of 1 mM MnCl 2, 50 mM TrisHCl (pH 7.5), 1 mM DTT, 4% glycerol and 0.1 mg / ml BSA (in the case of reactions with 1 mM Mn 2+) and 100 mM buffer cacodylate, 1 mM CoCl2 and 0.1 mM DTT (in the case of reactions with 1 mM Co 2+), 10 nM of the fluorescent DNA oligo, 1 µM ddATP-FLO, and 600 nM of the protein indicated in each case. After a 30 min incubation at 37 ° C, the reactions are they stopped adding 5.6 µl of loading buffer (95% formamide, 10 mM EDTA). These samples were analyzed by electrophoresis in 20% polyacrylamide gels and 8 M urea and subsequent reading of fluorescent signal using a Typhoon 9410 (GE Healthcare) 

       \newpage\ newpage

Ejemplo 12Example 12

Obtención de nuevos mutantes homólogosObtaining new homologous mutants

Tal y como se muestra en la Figura 12, el alineamiento por FASTA, empleando los parámetros establecidos por defecto, de las secuencias correspondientes a las Pol\mu wt de diferentes mamíferos, más concretamente, Mus musculus, Rattus norvegicu y Bos taurus con el mutante M3, proporciona aquellos aminoácidos homólogos al 275 y 387 de M3 (o Pol\mu wt humana).As shown in Figure 12, the alignment by FASTA, using the parameters established by default, of the sequences corresponding to the Pol µwt of different mammals, more specifically, Mus musculus, Rattus norvegicu and Bos taurus with the mutant M3, provides those amino acids homologous to 275 and 387 of M3 (or human Pol).

La mutación de los aminoácidos homólogos de la Pol\mu wt de Mus musculus, Rattus norvegicu y Bos taurus correspondientes a las posiciones 275 y 387 de M3, daría lugar a la obtención de nuevos mutantes, que potencialmente tendrían la actividad desoxinucleotidil-transferasa terminal mejorada debido al elevado grado de identidad existente entre las diferentes polimerasas (Tabla 3). Tal y como se puede comprobar a partir de la Figura 12, los aminoácidos homólogos no necesariamente se encuentran en la misma posición en relación con su secuencia.Mutation of the homologous amino acids of the Mus µwt of Mus musculus, Rattus norvegicu and Bos taurus corresponding to positions 275 and 387 of M3, would result in the obtaining of new mutants, which would potentially have enhanced terminal deoxynucleotidyl transferase activity due to the high degree of identity existing between the different polymerases (Table 3). As can be seen from Figure 12, homologous amino acids are not necessarily in the same position in relation to their sequence.

TABLA 3TABLE 3

33

Ejemplo 13Example 13

Obtención de nuevos mutantes con actividad transferasa terminal incrementadaObtaining new mutants with terminal transferase activity increased

Los datos estructurales de Pol\mu wt utilizados convenientemente pueden ser empleados para la obtención de nuevos mutantes con actividad transferasa terminal incrementada, mediante la identificación y mutación de aminoácidos que se encuentren en el sitio catalítico de la enzima o cercanos a éste, preferentemente en superficie, esto es, en interacción directa con el ADN. Así por ejemplo, el análisis tridimensional de la estructura de la polimerasa puede dar lugar a la identificación de residuos que permitan la creación de un puente salino, la introducción de un grupo hidrofóbico o la creación de cualquier otro tipo de interacción que posibilite una mejor interacción con el ADN con el objetivo de obtener mutantes con actividad transferasa terminal incrementada.The structural data of Pol used properly can be used to obtain of new mutants with increased terminal transferase activity, by identifying and mutating amino acids that found at or near the enzyme catalytic site, preferably on the surface, that is, in direct interaction with the DNA. Thus, for example, the three-dimensional analysis of the structure of polymerase can lead to the identification of residues that allow the creation of a salt bridge, the introduction of a hydrophobic group or the creation of any other type of interaction that allows a better interaction with DNA with the objective of obtaining mutants with terminal transferase activity increased

Para la identificación de los aminoácidos candidatos son sobradamente conocidas determinadas técnicas de laboratorio, como por ejemplo la cristalografía por rayos X y la resonancia magnética nuclear (RMN), que permiten conocer la estructura tridimensional de las proteínas. Además de este tipo de técnicas, existen multitud de programas informáticos que posibilitan, a partir de la estructura primaria de la enzima, predecir cual es su configuración espacial (e.g. Swiss PDB Viewer). De este modo, resulta sencillo mediante la inspección visual de las estructuras determinar qué aminoácidos pueden ser candidatos para su mutación.For the identification of amino acids candidates are well known certain techniques of laboratory, such as X-ray crystallography and nuclear magnetic resonance (NMR), which allow to know the three-dimensional structure of proteins. In addition to this type of techniques, there are many computer programs that enable, from the primary structure of the enzyme, predict what your spatial configuration is (e.g. Swiss PDB Viewer). In this way, it is simple by visual inspection of the structures determine which amino acids can be candidates for their mutation.

El empleo de este tipo de técnicas en combinación con la comparación de las estructuras primarias de enzimas homologas y/o con actividades similares permite incluso afinar aún más en la selección de aquellos mutantes que potencialmente van a tener una actividad incrementada.The use of these types of techniques in combination with the comparison of the primary structures of homologous enzymes and / or with similar activities allows even further refine the selection of those mutants that They are potentially going to have increased activity.

A modo de ejemplo, la recopilación de todas las secuencias conocidas de Pol\mu y TdT de diferentes especies, su alineamiento y comparación de la estructura primaria permite la identificación de aquellos aminoácidos que se encuentran conservados en ambas familias de polimerasas y que sean diferentes entre sí. Cuando se realiza este proceso, algunos de los aminoácidos candidatos de Pol\mu que podrían seleccionarse son los Q275, R387, N457 y S458, los cuales tras un análisis visual de la estructura tridimensional de la enzima se comprueba que se encuentran en superficie y cercanos al centro catalítico (Figura 14). La mutación de estos aminoácidos hacia el aminoácido homólogo de TdT (Q275M, R387K, N457D y S458N) y, opcionalmente, la combinación de estas mutaciones da lugar a la obtención de mutantes de Pol\mu con una actividad transferasa terminal incrementada, tal y como se puede comprobar a lo largo de la descripción.As an example, the collection of all known sequences of Pol and TdT of different species, their alignment and comparison of the primary structure allows the identification of those amino acids that are conserved in both polymerase families and that are different from each other. When this process is done, some of the amino acids Pol µ candidates that could be selected are the Q275, R387, N457 and S458, which after a visual analysis of the structure Three-dimensional enzyme is found to be found in surface and close to the catalytic center (Figure 14). Mutation of these amino acids towards the homologous amino acid of TdT (Q275M, R387K, N457D and S458N) and, optionally, the combination of these mutations results in obtaining Pol µ mutants with a increased terminal transferase activity, as can be Check throughout the description.

<110> XPOL Biotech, S.L.<110> XPOL Biotech, S.L. 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<120> Mutantes de la ADN polimerasa mu<120> Mutants of DNA polymerase mu 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<130> P5299ES00 - XPOL-01<130> P5299ES00 - XPOL-01 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<160> 17<160> 17 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<170> PatentIn version 3.5<170> PatentIn version 3.5 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 1<210> 1 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 373<211> 373 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> PRT<212> PRT 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo Sapiens (Pol mu NH2- BRCT-)<213> Homo Sapiens (Pol mu NH2- BRCT-) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 1<400> 1 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \hskip0,8cm\ hskip0,8cm
1212 

         \hskip0,8cm\ hskip0,8cm
1313 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 2<210> 2 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 357<211> 357 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> PRT<212> PRT 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (Pol mu NH2- BRCT- 8 KDa)<213> Homo sapiens (Pol mu NH2- BRCT- 8 KDa) 

         \newpage\ newpage
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 2<400> 2 

         \hskip0,8cm\ hskip0,8cm
1414 

         \hskip0,8cm\ hskip0,8cm
15fifteen 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 3<210> 3 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 19<211> 19 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> PRT<212> PRT 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (Ch-loop-1 Pol mu)<213> Homo sapiens (Ch-loop-1 Pol mu) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 3<400> 3 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \hskip0,8cm\ hskip0,8cm
1616 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 4<210> 4 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 20<211> 20 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> PRT<212> PRT 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (Ch-loop-1 TdT)<213> Homo sapiens (Ch-loop-1 TdT) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 4<400> 4 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \hskip0,8cm\ hskip0,8cm
1717 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 5<210> 5 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 494<211> 494 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> PRT<212> PRT 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (Pol mu, mutante M3)<213> Homo sapiens (Pol mu, mutant M3) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 5<400> 5 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \hskip0,8cm\ hskip0,8cm
1818 

         \hskip0,8cm\ hskip0,8cm
1919 

         \hskip0,8cm\ hskip0,8cm
20twenty 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 6<210> 6 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 493<211> 493 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> PRT<212> PRT 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (Pol mu, mutante M7)<213> Homo sapiens (Pol mu, mutant M7) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 6<400> 6 

         \hskip0,8cm\ hskip0,8cm
21twenty-one 

         \hskip0,8cm\ hskip0,8cm
2222 

         \hskip0,8cm\ hskip0,8cm
232. 3 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 7<210> 7 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 375<211> 375 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> PRT<212> PRT 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (M3: NH2- BRCT-)<213> Homo sapiens (M3: NH2- BRCT-) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 7<400> 7 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \hskip0,8cm\ hskip0,8cm
2424 

         \hskip0,8cm\ hskip0,8cm
2525 

         \hskip0,8cm\ hskip0,8cm
2626 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 8<210> 8 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 357<211> 357 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> PRT<212> PRT 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (M3: NH2- BRCT- 8 KDa-)<213> Homo sapiens (M3: NH2- BRCT- 8 KDa-) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 8<400> 8 

         \hskip0,8cm\ hskip0,8cm
2727 

         \hskip0,8cm\ hskip0,8cm
2828 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 9<210> 9 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 374<211> 374 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> PRT<212> PRT 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (M7: NH2- BRCT-)<213> Homo sapiens (M7: NH2- BRCT-) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 9<400> 9 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \hskip0,8cm\ hskip0,8cm
2929 

         \hskip0,8cm\ hskip0,8cm
3030 

         \hskip0,8cm\ hskip0,8cm
3131 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 10<210> 10 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 356<211> 356 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> PRT<212> PRT 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (M7: NH2- BRCT- 8 KDa-)<213> Homo sapiens (M7: NH2- BRCT- 8 KDa-) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 10<400> 10 

         \hskip0,8cm\ hskip0,8cm
3232 

         \hskip0,8cm\ hskip0,8cm
3333 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 11<210> 11 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 494<211> 494 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> PRT<212> PRT 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (Mutante M2)<213> Homo sapiens (Mutant M2) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 11<400> 11 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \hskip0,8cm\ hskip0,8cm
343. 4 

         \hskip0,8cm\ hskip0,8cm
3535 

         \hskip0,8cm\ hskip0,8cm
3636 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 12<210> 12 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 375<211> 375 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> PRT<212> PRT 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (M2: NH2- BRCT-)<213> Homo sapiens (M2: NH2- BRCT-) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 12<400> 12 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \hskip0,8cm\ hskip0,8cm
3737 

         \hskip0,8cm\ hskip0,8cm
3838 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 13<210> 13 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 357<211> 357 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> PRT<212> PRT 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (M2: NH2- BRCT- 8 KDa-)<213> Homo sapiens (M2: NH2- BRCT- 8 KDa-) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 13<400> 13 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \hskip0,8cm\ hskip0,8cm
3939 

         \hskip0,8cm\ hskip0,8cm
4040 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 14<210> 14 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 1485<211> 1485 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> DNA<212> DNA 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (Mutante M3)<213> Homo sapiens (M3 mutant) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 14<400> 14 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \hskip0,8cm\ hskip0,8cm
4141 

         \hskip0,8cm\ hskip0,8cm
4242 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 15<210> 15 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 1488<211> 1488 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> DNA<212> DNA 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (Mutante M7)<213> Homo sapiens (M7 mutant) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 15<400> 15 

         \hskip0,8cm\ hskip0,8cm
4343 

         \hskip0,8cm\ hskip0,8cm
4444 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 16<210> 16 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 1485<211> 1485 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> DNA<212> DNA 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens (Mutante M2)<213> Homo sapiens (Mutant M2) 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 16<400> 16 

         \hskip0,8cm\ hskip0,8cm
45Four. Five 

         \hskip0,8cm\ hskip0,8cm
4646 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<210> 17<210> 17 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<211> 494<211> 494 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<212> PRT<212> PRT 

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<213> Homo sapiens <213> Homo sapiens 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \vskip0.400000\baselineskip\ vskip0.400000 \ baselineskip

<400> 17<400> 17 

         \vskip1.000000\baselineskip\ vskip1.000000 \ baselineskip
      

         \hskip0,8cm\ hskip0,8cm
4747 

         \hskip0,8cm\ hskip0,8cm
4848 

         \hskip0,8cm\ hskip0,8cm
4949

Claims (16)

1. ADN polimerasa mu (Pol\mu) mutada que presenta una actividad desoxinucleotidil-transferasa terminal al menos alrededor de un 10% superior a la actividad desoxinucleotidil-transferasa terminal de la ADN polimerasa mu mutada R387K.1. Mutated DNA polymerase (Pol) that it has a deoxynucleotidyl transferase activity terminal at least about 10% higher than the activity DNA terminal deoxynucleotidyl transferase R387K mutated mu polymerase. 2. ADN polimerasa mu mutada según la reivindicación 1, que comprende al menos dos mutaciones.2. Mutated DNA polymerase according to claim 1, comprising at least two mutations. 3. ADN polimerasa mu mutada según cualquiera de las reivindicaciones 1 ó 2, que comprende una secuencia con al menos un 60% de identidad con la SEQ ID NO: 17, o con cualquiera de sus subsecuencias SEQ ID NO:1 y SEQ ID NO:2, o con un fragmento de cualquiera de dichas secuencias que mantiene la actividad transferasa terminal incrementada o sustancialmente incrementada.3. Mutated DNA polymerase according to any of claims 1 or 2, comprising a sequence with at least 60% identity with SEQ ID NO: 17, or with any of its Sequences SEQ ID NO: 1 and SEQ ID NO: 2, or with a fragment of any of said sequences that maintains the activity terminal transferase increased or substantially increased 4. ADN polimerasa mu mutada según la reivindicación 3, que comprende al menos dos mutaciones que consisten en (i) una primera mutación puntual en la posición 387 y (ii) una segunda mutación que consiste en:4. Mutated DNA polymerase according to claim 3, comprising at least two mutations that consist of (i) a first point mutation at position 387 and (ii) a second mutation consisting of:
(a)(to)
una mutación puntual en un aminoácido conservado de Pol\mu wt y distinto al aminoácido homólogo presente en la enzima TdT, oa point mutation in a conserved amino acid of Pol µ wt and other than the homologous amino acid present in the enzyme TdT, or
(b)(b)
una mutación en el subdominio loop-1 de Pol\mu.a mutation in the subdomain loop-1 of Pol.
5. ADN polimerasa mu mutada según la reivindicación 4, donde la primera mutación puntual (i) en la posición 387 consiste en la sustitución del aminoácido que se encuentra dicha posición por cualquiera de los aminoácidos seleccionados del siguiente grupo: Glutamina, Asparragina, Cisteína, Treonina, Serina, Metionina, Lisina, Arginina, Histidina o análogos de los mismos.5. Mutated DNA polymerase according to claim 4, wherein the first point mutation (i) in the position 387 consists of the amino acid substitution that find that position by any of the amino acids selected from the following group: Glutamine, Asparagine, Cysteine, Threonine, Serine, Methionine, Lysine, Arginine, Histidine or the like thereof. 6. ADN polimerasa mu mutada según la reivindicación 5, donde la segunda mutación puntual (a) es una mutación puntual en el aminoácido que se encuentra en la la posición 275 y consiste en la sustitución del aminoácido que se encuentra en dicha posición por cualquiera de los aminoácidos seleccionados del siguiente grupo: Glutamina, Asparragina, Cisteína, Treonina, Serina, Metionina o análogos de los mismos.6. Mutated DNA polymerase according to claim 5, wherein the second point mutation (a) is a point mutation in the amino acid found in the position 275 and consists of the substitution of the amino acid found in said position by any of the amino acids selected from the Next group: Glutamine, Asparagine, Cysteine, Threonine, Serine, Methionine or analogs thereof. 7. ADN polimerasa mu mutada según cualquiera de las reivindicaciones anteriores, donde la segunda mutación (b) consiste en la deleción y sustitución del loop-1 de Pol\mu o de un fragmento del mismo por:7. Mutated DNA polymerase according to any of the preceding claims, wherein the second mutation (b) consists of deletion and replacement of loop-1 of Pol or a fragment thereof by:
i)i)
una secuencia con al menos alrededor de un 10% de identidad con la SEQ ID NO: 3 (loop-1 de Pol\mu), oa sequence with at least about 10% of identity with SEQ ID NO: 3 (Pol-1 loop-1), or
ii)ii)
por una secuencia con al menos alrededor de un 10% de identidad con la SEQ ID NO: 4 (loop-1 de TdT).by a sequence with at least about 10% Identity with SEQ ID NO: 4 (loop-1 of TdT).
8. ADN polimerasa mutada según cualquiera de las reivindicaciones anteriores, cuya secuencia es seleccionada el grupo formado por SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, fragmentos o subsecuencias de las mismas que mantengan sustancialmente su actividad transferasa terminal.8. Mutated DNA polymerase according to any of the previous claims, whose sequence the group is selected formed by SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, fragments or sub-sequences thereof that substantially maintain its terminal transferase activity. 9. Polinucleótido que codifica una ADN polimerasa mu mutada, o un fragmento o subsecuencia de la misma, de acuerdo a cualquiera de las reivindicaciones 1 a 8.9. Polynucleotide encoding a DNA mutated mu polymerase, or a fragment or sub-sequence thereof, of according to any of claims 1 to 8. 10. Polinucleótido según la reivindicación 9, donde su secuencia es seleccionada del grupo que comprende las secuencias SEQ ID NO: 14 y SEQ ID NO: 15.10. Polynucleotide according to claim 9, where its sequence is selected from the group that includes the sequences SEQ ID NO: 14 and SEQ ID NO: 15. 11. Vector que comprende un polinucleótido según cualquiera de las reivindicaciones 9 ó 10.11. Vector comprising a polynucleotide according to any of claims 9 or 10. 12. Célula huésped que comprende un polinucleótido según cualquiera de las reivindicaciones 9 ó 10, o un vector según la reivindicación 11.12. Host cell comprising a polynucleotide according to any one of claims 9 or 10, or a vector according to claim 11. 13. Método para la producción de una ADN polimerasa mu mutada según cualquiera de las reivindicaciones 1 a 8, que comprende: i) el cultivo de una célula huésped según la reivindicación 12 bajo condiciones que promuevan la expresión del polinucleótido según cualquiera de las reivindicaciones 9 ó 10, y ii) el aislamiento del mutante producido.13. Method for the production of a DNA mutated mu polymerase according to any one of claims 1 to 8, comprising: i) the culture of a host cell according to the claim 12 under conditions that promote the expression of polynucleotide according to any of claims 9 or 10, and ii) isolation of the mutant produced. 14. Método para la elongación de un polinucleótido diana que comprende: i) poner en contacto al polinucleótido diana con la ADN polimerasa mu mutada según cualquiera de las reivindicaciones 1 a 8 y nucleótidos o análogos de nucleótidos (mezcla de reacción), y ii) someter la mezcla de reacción a condiciones que favorezcan la inserción de al menos un nucleótido o un análogo del mismo en el extremo 3'OH del polinucleótido diana.14. Method for elongation of a target polynucleotide comprising: i) contacting the target polynucleotide with muted DNA polymerase according to any of claims 1 to 8 and nucleotides or analogs of nucleotides (reaction mixture), and ii) subject the mixture of reaction to conditions that favor the insertion of at least one nucleotide or an analog thereof at the 3'OH end of the target polynucleotide. 15. Método para el rellenado de huecos que comprende: i) poner en contacto a un polinucleótido diana, que comprende al menos un gap o hueco de al menos un nucleótido, con la ADN polimerasa mu mutada según cualquiera de las reivindicaciones 1 a 8 y nucleótidos o análogos de nucleótidos (mezcla de reacción), y ii) someter la mezcla de reacción a condiciones que favorezcan la inserción de al menos un nucleótido o análogo de nucleótido en el extremo 3'OH de gap.15. Method for filling voids comprising: i) contacting a target polynucleotide, comprising at least one gap or gap of at least one nucleotide, with the mutated DNA polymerase according to any one of claims 1 to 8 and nucleotides or nucleotide analogs (reaction mixture), and ii) subjecting the reaction mixture to conditions that favor the insertion of at least one nucleotide or nucleotide analogue at the 3'OH end of the gap . 16. Método para la detección de muestras apoptóticas que comprende: i) poner en contacto una muestra, que contiene material genético de células potencialmente apoptóticas, con la ADN polimerasa mu mutada según cualquiera de las reivindicaciones 1 a 8 y al menos un nucleótido o análogo de nucleótido (mezcla de reacción), ii) someter la mezcla de reacción a condiciones que favorezcan la inserción de nucleótidos o análogos de los mismos, y iii) detectar la presencia o no de inserción, donde la detección de inserción es indicativa de que la muestra es apoptótica.16. Method for sample detection apoptotic comprising: i) contacting a sample, which contains genetic material of potentially apoptotic cells, with the mutated DNA polymerase according to any of the claims 1 to 8 and at least one nucleotide or analog of nucleotide (reaction mixture), ii) subject the reaction mixture to conditions that favor the insertion of nucleotides or analogs of the same, and iii) detect the presence or not of insertion, where the Insertion detection is indicative that the sample is apoptotic
ES200901943A 2009-10-02 2009-10-02 MUTANTS OF MU POLYMERASE DNA Withdrawn - After Issue ES2364010B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
ES200901943A ES2364010B1 (en) 2009-10-02 2009-10-02 MUTANTS OF MU POLYMERASE DNA
PCT/ES2010/000402 WO2011039390A2 (en) 2009-10-02 2010-10-02 Mutants of dna polymerase mu

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
ES200901943A ES2364010B1 (en) 2009-10-02 2009-10-02 MUTANTS OF MU POLYMERASE DNA

Publications (2)

Publication Number Publication Date
ES2364010A1 true ES2364010A1 (en) 2011-08-23
ES2364010B1 ES2364010B1 (en) 2012-06-20

Family

ID=43826709

Family Applications (1)

Application Number Title Priority Date Filing Date
ES200901943A Withdrawn - After Issue ES2364010B1 (en) 2009-10-02 2009-10-02 MUTANTS OF MU POLYMERASE DNA

Country Status (2)

Country Link
ES (1) ES2364010B1 (en)
WO (1) WO2011039390A2 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001064909A1 (en) * 2000-03-03 2001-09-07 Consejo Superior De Investigaciones Cientificas Dna polymerase mu and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001064909A1 (en) * 2000-03-03 2001-09-07 Consejo Superior De Investigaciones Cientificas Dna polymerase mu and uses thereof

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ANDRADE, P. et al., 'Limited terminal transferase in human DNA polymerase mu defines the required balance between accuracy and efficiency in NHEJ.', PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, Sep 2009, Vol.106, No. 38, paginas 16203-16208, ISSN: 0027-8424. Epub: 04-09-2009, Resultados; Discusión. *
DOMÍNGUEZ, O. et al., 'DNA polymerase mu (Pol mu), homologous to TdT, could act as a DNA mutator in eukaryotic cells.', THE EUROPEAN MOLECULAR BIOLOGY ORGANIZATION JOURNAL, 2000, Vol. 19, No. 7, paginas 1731-1742, ISSN: 0261-4189, todo el documento. *
JUÁREZ, R, et al., 'A specific loop in human DNA polymerase mu allows switching between creative and DNA-instructed synthesis.', NUCLEIC ACIDS RESEARCH, 2006, Vol. 34, No. 16, paginas 4572-4582, ISSN: 0305-1048, Materiales y Métodos; Resultados. *
MOON, A.F. et al., 'Structural insight into the substrate specificity of DNA Polymerase mu.', NATURE STRUCTURAL & MOLECULAR BIOLOGY, 2007, Vol. 14, No. 1, paginas 45-53, ISSN: 1545-9985, todo el documento. *
MOON, A.F. et al., 'The X family portrait: structural insights into biological functions of X family polymerases.', DNA REPAIR, 2007, Vol. 6, No. 12, páginas 1709-1725, ISSN: 1568-7864, todo el documento. *
ROMAIN, F. et al., 'Conferring a template-dependent polymerase activity to terminal deoxynucleotidyltransferase by mutations in the Loop1 region.', NUCLEIC ACIDS RESEARCH, Aug 2009, Vol. 37, No.14, paginas 4642-4656, ISSN: 0305-1048, Epub: 05-06-2009, Resultados; Discusión. *

Also Published As

Publication number Publication date
WO2011039390A8 (en) 2011-06-03
WO2011039390A2 (en) 2011-04-07
WO2011039390A3 (en) 2011-07-21
ES2364010B1 (en) 2012-06-20

Similar Documents

Publication Publication Date Title
ES2374910T3 (en) THERMOSTABLE DNA POLYMERASES MODIFIED FOR SEQUENCING.
ES2520025T3 (en) Mutant DNA Polymerases and Related Methods
US9840698B2 (en) DNA polymerases with increased 3′-mismatch discrimination
JP2010532979A (en) Mutant DNA polymerase and related methods
JP5926248B2 (en) DNA polymerase with increased 3 &#39;terminal mismatch discrimination
US10647967B2 (en) DNA polymerases with increased 3′-mismatch discrimination
JP5926246B2 (en) DNA polymerase with increased 3 &#39;terminal mismatch discrimination
ES2364010B1 (en) MUTANTS OF MU POLYMERASE DNA
US20180023063A1 (en) Dna polymerases with increased 3&#39;-mismatch discrimination
JP5926247B2 (en) DNA polymerase with increased 3 &#39;terminal mismatch discrimination
US9284542B2 (en) DNA polymerases with increased 3′-mismatch discrimination
US10144918B2 (en) DNA polymerases with increased 3′-mismatch discrimination

Legal Events

Date Code Title Description
FA2A Application withdrawn

Effective date: 20110105

FG2A Definitive protection

Ref document number: 2364010

Country of ref document: ES

Kind code of ref document: B1

Effective date: 20120620

FA2A Application withdrawn

Effective date: 20121121