WO2011037271A1 - Humanized antibodies specific for amino acid sequence rgd of an extracellular matrix protein and the uses thereof - Google Patents

Humanized antibodies specific for amino acid sequence rgd of an extracellular matrix protein and the uses thereof Download PDF

Info

Publication number
WO2011037271A1
WO2011037271A1 PCT/JP2010/067017 JP2010067017W WO2011037271A1 WO 2011037271 A1 WO2011037271 A1 WO 2011037271A1 JP 2010067017 W JP2010067017 W JP 2010067017W WO 2011037271 A1 WO2011037271 A1 WO 2011037271A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
amino acid
hu33e10
sequence
nucleotide sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/JP2010/067017
Other languages
English (en)
French (fr)
Inventor
Shankar Kumar
J. Yun Tso
Naoya Tsurushita
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kidswell Bio Corp
Original Assignee
Gene Techno Science Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gene Techno Science Co Ltd filed Critical Gene Techno Science Co Ltd
Priority to KR1020127010432A priority Critical patent/KR101809761B1/ko
Priority to AU2010299017A priority patent/AU2010299017B2/en
Priority to CA2772230A priority patent/CA2772230C/en
Priority to IN1981DEN2012 priority patent/IN2012DN01981A/en
Priority to US13/497,692 priority patent/US8617829B2/en
Priority to JP2012514276A priority patent/JP5781504B2/ja
Priority to EP10818939A priority patent/EP2480665A4/en
Priority to CN201080042356.1A priority patent/CN102712921B/zh
Publication of WO2011037271A1 publication Critical patent/WO2011037271A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding

Definitions

  • the present invention relates to humanized antibodies that immunospecifically recognize amino acid sequence RGD (Arg-Gly-Asp) of an extracellular matrix protein and to their therapeutic and diagnostic uses for various diseases or disorders including cancer, inflammatory diseases, autoimmune diseases, infectious disease, bone disease and the like.
  • RGD amino acid sequence RGD
  • Cell adhesion plays an important role in sustaining life of multicellular organisms. Cell adhesions of multicellular organisms are classified into cell-extracellular matrix
  • ECM cell-cell adhesion
  • cell-cell adhesion adhesion and cell-cell adhesion. It has been elucidated that the cell-ECM adhesion is mediated by integrins and the cell-cell adhesion is mediated by cadherins, claudins and nectins.
  • Transmembrane adhesion proteins such as integrins constitute cell-ECM adhesions. It is reported that integrin forms heterodimer of a and ⁇ chains. At least 18 types of a chain, 8 types of ⁇ chain and 24 types of ⁇ heterodimer have been identified and confirmed so far. It is known that each type of integrin recognizes a specific ligand. Transmembrane adhesion proteins including integrins relate to, in addition to cell adhesions, intracellular signal transductions from ECM into a cell and regulation of proliferation, mobility and differentiation (F. G Giancotti, et. al., Science, 285, 1028-1032, 1999).
  • ECM proteins which are classified into collagens (such as type I-XIX), non-collagenous glycoproteins (such as osteopontin (OPN), vitronectin, fibronectin, von Willebrand Factor, laminin, tenascin, fibrinogen, thrombospondin), elastins and proteoglycans. These ECM proteins bind to corresponding integrins and activate intracellular signal transduction pathways to regulate cytoskeletal organization, mobility, proliferation, differentiation, and the like. ECM protein-bound integrin regulates these signal activating pathways by transmitting specific signals depending on the type of ECM protein.
  • RGD Arginine - Glycine - Asparagine acid
  • integrins such as ⁇ 3 ⁇ 1 integrin, ⁇ 5 ⁇ 1 integrin, ⁇ integrin, ⁇ integrin, ⁇ 3 integrin, ⁇ 5 integrin, ⁇ integrin, ⁇ 8 integrin have been known to bind to the RGD sequence. Interaction between ⁇ 5 ⁇ 1 integrin and its specific ligand fibronectin has been revealed to investigate mechanisms of integrin-mediated signal transduction, and it is reported that ⁇ 5 ⁇ 1 integrin regulates not only cell adhesion and cell mobility but also cell differentiation and cell mortality (S. M. Frisch et al., Ciirr. Opin. Cell Biol, 9, 701-706, 1997).
  • ⁇ 5 ⁇ 1 integrin is highly expressed on tumor cells and relates to malignant alteration of cancer.
  • Each integrin-mediated signal differs depending on binding ECM proteins. For example, stimulation by growth factor activates growth of fibronectin- bound endothelial cells, but inhibits growth of laminin-1 -bound endothelial cells.
  • the signal transmitted from laminin-10/11 to ⁇ 3 ⁇ 1 integrin is different from the signal transmitted from fibronectin to ⁇ 5 ⁇ 1 integrin, and significantly enhances a mobility of cancerous cells (J. Gu et al., J. Biol. Chem., 276, 27090-27097, 2001) and significantly avoids apoptosis by blood starvation (J.
  • ECM proteins such as collagen, osteopontin (OPN), vitronectin, fibronectin, von Willebrand Factor, laminin, tenascin, fibrinogen and thrombospondin have been known to include RGD sequence.
  • OPN osteopontin
  • fibronectin fibronectin
  • von Willebrand Factor laminin
  • tenascin fibrinogen
  • thrombospondin thrombospondin
  • RGD sequence a virus and some bacterium have been known to possess RGD sequence to adhere to cells.
  • OPN is an acidic glycoprotein with binding properties to calcium which is contained rich in bone. It is reported that OPN plays an important role in cell adhesion, cell migration, tumor formation, immune response and complement mediated cellular lysis.
  • OPN knockout mice and anti-OPN neutralizing antibodies indicate that OPN relates to hepatitis, autoimmune disease such as rheumatoid arthritis and metastasis of cancer. Therefore, it is expected that an inhibitor of binding of ECM proteins to cells may be used for a treatment of osteoporosis or cancer.
  • antagonistic drugs targeted to integrins antagonistic drugs targeted to the ECM proteins which are binding partner of the integrins have been developed.
  • the hybridoma clone designations are interchangeably used as the designations of the monoclonal antibodies produced by the clones. All of these mouse anti-RGD antibodies were of IgGl isotype. These monoclonal antibodies was observed to interfere binding mediated by the RGD sequence between ECM and cell by binding to the RGD sequence of ECM proteins such as osteopontin. Thus, these anti-RGD antibodies are expected to exhibit therapeutic or diagnostic effects on the RGD sequence related disease such as cancer, e.g., the growth or metastasis of cancer cells, and on
  • inflammatory diseases e.g., rheumatoid arthritis, osteoarthritis, infectious disease, hepatitis, bronchial asthma, fibrosis, diabetes mellitus, arteriosclerosis, multiple sclerosis, granuloma, an inflammatory bowel disease (ulcerative colitis and Crohn's disease), an autoimmune disease, osteoporosis, and the like.
  • the present invention provides a humanized antibody or an antigen- binding fragment thereof, which immunospecifically recognizes the RGD sequence, said antibody comprising an antigen-binding region partially derived from a non-human origin and partially derived from a human origin.
  • the humanized antibody or the antigen-binding fragment thereof of the present invention comprises a complementarity determining region (hereinafter abbreviated as "CDR") derived from a non- human source (donor) such as 33E10 and 35B6 monoclonal antibodies, and a framework region (hereinafter abbreviated as "FR”) derived from a human source (acceptor).
  • CDR complementarity determining region
  • donor such as 33E10 and 35B6 monoclonal antibodies
  • FR framework region
  • Said humanized antibody or an antigen-binding fragment thereof may inhibit the binding between the RGD sequence and a ligand thereof.
  • said humanized antibody or an antigen-binding fragment thereof that immunospecifically recognizes the RGD sequence comprises , (i) a heavy chain (hereinafter abbreviated as "H-chain”) comprising at least one H-chain FR (hereinafter abbreviated as "FRH”) derived from a variable region (hereinafter abbreviated as "V-region”) of a human H-chain, and at least one H-chain CDR (hereinafter abbreviated as "CDRH”) derived from at least one of the CDRHs of a non-human antibody that
  • H-chain a heavy chain
  • FRH variable region
  • CDRH H-chain CDR
  • L-chain a light chain comprising at least one L-chain FR (hereinafter abbreviated as "FRL”) derived from a V-region of a human L-chain, and at least one L-chain CDR
  • CDRL derived from at least one of the CDRLs of a non-human antibody that immunospecifically recognizes the RGD sequence; or both (i) and (ii) above.
  • the humanized antibody or an antigen- binding fragment thereof of the present invention comprises: (i) a H-chain comprising a VH, said VH comprising the amino acid sequence of SEQ ID NO: 92, 94 or 96; or (ii) a L-chain comprising a VL, said VL comprising the amino acid sequence of SEQ ID NO: 98 or 100; or (iii) both (i) and (ii) above.
  • said humanized antibody or an antigen-binding fragment thereof of the present invention comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 91 , 92 or 93, and said VL comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 97 or 99.
  • said VH comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 91, 92 or 93
  • said VL comprises the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 97 or 99.
  • said VH comprises the amino acid sequence of SEQ ID NO: 94 and said VL comprises the amino acid sequence of SEQ ID NO: 100.
  • said H-chain comprises the amino acid sequence of SEQ ID NO: 25 or 27 and said L-chain comprises the amino acid sequence of SEQ ID NO: 29 or 31.
  • said H-chain comprises the amino acid sequence of SEQ ID NO: 25
  • said L-chain comprises the amino acid sequence of SEQ ID NO: 31.
  • the present invention further provides a vector, e.g., an expression vector, comprising a nucleotide sequence encoding a H-chain or a L-chain, or both, of the humanized antibody or an antigen-binding fragment thereof of the present invention that immunospecifically recognizes the RGD sequence.
  • a vector e.g., an expression vector
  • the nucleotide sequence of the present invention may be operably linked to one or more regulatory elements.
  • the nucleotide sequence of the present invention may include a nucleotide sequence encoding a signal peptide native to a non-human donor antibody from which a CDR is derived, or a signal peptide of heterologous origin.
  • the present invention provides a host cell comprising the nucleic acid molecule of the present invention, including a vector comprising the nucleic acid molecule of the present invention.
  • the present invention provides an isolated host cell comprising a first nucleic acid molecule encoding a humanized H-chain of the present invention and a second nucleic acid molecule encoding a humanized L-chain of the present invention, said first and second nucleic acid molecules are each operably linked to a regulatory element in such a way that the biologically functional humanized antibody or antigen-binding fragment thereof of the present invention is expressed.
  • the present invention further provides a method for preparing the humanized antibody or an antigen-binding fragment thereof of the present invention, comprising culturing the host cell of the invention under conditions so that the humanized antibody or an antigen-binding fragment thereof is expressed; and collecting the produced humanized antibody.
  • the present invention further provides a composition comprising at least one of the humanized antibodies or an antigen-binding fragment thereof of the present invention.
  • the present invention provides a pharmaceutical composition for preventing or treating a disorder or disease that is associated with the RGD-proteins, comprising at least one of the humanized antibodies or an antigen-binding fragment thereof of the present invention, and a pharmaceutically acceptable carrier.
  • Either of said compositions can further comprise another active compound that can additively or synergistically ameliorate the disorder or disease.
  • Said active compounds include, but not limited to, anti-inflammatory compounds, chemotherapeutic compounds and the like.
  • Said active compounds also include small molecule compounds and antibodies or an antigen-binding fragment thereof, such as human a.4 integrin specific antibody or human a9 integrin specific antibody.
  • the present invention provides a method for preventing or treating a disorder or disease that is associated with or involves the RGD-proteins, said method comprising administering a prophylactically or therapeutically effective amount of at least one of the humanized antibodies or an antigen-binding fragment thereof of the present invention to a subject in need thereof.
  • the humanized antibody or an antigen-binding fragment thereof of the present invention may be conjugated to a therapeutic moiety that enhances the biological effect of the humanized antibody or an antigen-binding fragment thereof.
  • a therapeutic moiety include another antibody, cytotoxins that are cytostatic or cytocidal, radioactive elements, and/or other therapeutic agents, including antiinflammatory agents, antibiotics and the like.
  • the present invention provides a method for diagnosing a disorder or disease, in a subject, that is associated with or involves RGD-proteins, said method comprising administering a diagnostically effective amount of the humanized antibody or an antigen-binding fragment thereof of the present invention to a subject to be examined.
  • the humanized antibody of the present invention may be labeled with detectable markers, such as radioactive elements. .1. Definitions
  • antibody refers to an antibody molecule capable of immunospecifically binding to a desired antigen or desired sequence such as the RGD sequence, which encompass an antibody molecule as a whole and may encompass a fragment of the antibody including an antigen-binding fragment of the antibody.
  • an antigen-binding fragment refers to any fragment of an antibody that retains an ability to immunospecifically bind to a target polypeptide, protein or sequence, in particular the RGD sequence, which includes single chain antibodies, Fab fragments, F(ab') 2 fragments, disulfide-linked Fvs and fragments containing either a VL and/or a VH or a CDR that specifically binds to a target polypeptide, protein or sequence.
  • the antigen-binding fragments of humanized antibody may or may not include partial or full- length human constant regions.
  • Various methods for obtaining the antibody fragments described above are well known in the art.
  • immunospecifically recognize refers to an ability of an antibody or an antigen-binding fragment thereof to bind specifically to a target polypeptide, protein or sequence, in particular, human RGD sequence. Such an antibody does not non- specifically bind to other polypeptides or proteins. However, an antibody or an antigen- binding fragment thereof that immunospecifically binds to the target polypeptide or protein (e.g., RGD-protein) may cross-react with other antigens.
  • the humanized antibody or an antigen-binding fragment thereof of the present invention that
  • an antibody or an antigen-binding fragment thereof that is immunospecifically recognizes human RGD-proteins may cross-react with murine RGD- proteins.
  • an antibody or an antigen-binding fragment thereof that is immunospecifically recognizes human RGD-proteins may cross-react with murine RGD- proteins.
  • an antibody or an antigen-binding fragment thereof that is immunospecifically recognizes human RGD-proteins may cross-react with murine RGD- proteins.
  • an antibody or an antigen-binding fragment thereof that is immunospecifically recognizes human RGD-proteins may cross-react with murine RGD- proteins.
  • an antibody or an antigen-binding fragment thereof that is immunospecifically recognizes human RGD-proteins may cross-react with murine RGD- proteins.
  • derived from a human source or "derived from a non-human source” used herein refers to an antibody portion whose amino acid sequence is derived from a
  • an acceptor sequence refers to a nucleotide sequence or an amino acid sequence of FRs from a human antibody VH or VL that serves as an acceptor for CDRs from a donor antibody which is usually a non-human antibody.
  • FIGS. 1-27 reflect a form which is presently preferred; it being understood however, that the invention is not limited to the precise form shown in FIGS. 1-27 in which:
  • FIG. 1 shows the nucleotide sequence of mouse 33E10 VH cDNA is shown along with the deduced amino acid sequence. Amino acid residues are shown in single letter code. The signal peptide sequence is in italic. The N-terminal amino acid residue (E) of the mature VH is double-underlined. CDR sequences according to the definition of Kabat et al. (Sequences of Proteins of Immunological Interests, Fifth edition, NIH Publication No. 91-3242, U.S.
  • FIG. 2 shows the nucleotide sequence of mouse 33E10 VL cDNA is shown along with the deduced amino acid sequence. Amino acid residues are shown in single letter code. The signal peptide sequence is in italic. The N-terminal amino acid residue (D) of the mature VL is double-underlined. CDR sequences according to the definition of Kabat et al. (1991 ) are underlined.
  • FIG. 3 shows the nucleotide sequence of the designed 33E10 VH gene flanked by Spel and HindHI sites (underlined) is shown along with the deduced amino acid sequence. Amino acid residues are shown in single letter code. The signal peptide sequence is in italic. The N- terminal amino acid residue (E) of the mature VH is double-underlined. CDR sequences according to the definition of Kabat et al. (1991) are underlined. The intron sequence is in italic.
  • FIG. 4 shows the nucleotide sequence of the designed 33E10 VL gene flanked by Nhel and EcoRI sites (underlined) is shown along with the deduced amino acid sequence. Amino acid residues are shown in single letter code. The signal peptide sequence is in italic. The N- terminal amino acid residue (D) of the mature VL is double-underlined. CDR sequences according to the definition of Kabat et al. (1991) are underlined. The intron sequence is in italic.
  • FIG. 5 shows schematic structure of the expression vectors for chimeric and humanized 33E10 antibodies (collectively, "Expression Vector”).
  • the plasmid contains the heavy chain transcription unit starting with the human cytomegalovirus (CMV) major immediate early promoter and enhancer (CMV promoter) to initiate transcription of the antibody heavy chain gene.
  • CMV cytomegalovirus
  • CMV promoter major immediate early promoter and enhancer
  • the CMV promoter is followed by the VH exon, a genomic sequence containing the human gamma-1 heavy chain constant region including the CHI , hinge, CH2 and CH3 exons with the intervening introns, and the polyadenylation site following the CH3 exon.
  • the light chain transcription unit begins with the CMV promoter, followed by the VL exon and a genomic sequence containing the human kappa chain constant region exon (CL) with part of the intron preceding it, and the polyadenylation site following the CL exon.
  • the light chain gene is then followed by the SV40 early promoter (SV40 promoter), the E. coli xanthine guanine phosphoribosyl transferase gene (gpt), and a segment containing the SV40
  • the plasmid contains a part of the plasmid pUC19, comprising the bacterial origin of replication (pUC ori) and beta-lactamase gene (beta lactamase). Locations of relevant restriction enzyme sites are shown in this Figure.
  • FIG. 6 shows the alignment of the amino acid sequences of 33E10 VH, humanized
  • FIG. 7 shows the alignment of the amino acid sequences of 33E10 VL, humanized 33E10 (Hu33E10) VL and human acceptor X72452 (GenBank accession number) is shown. Amino acid residues are shown in single letter code. Numbers above the sequences indicate the positions according to Kabat et al. (1991). CDR sequences defined by Kabat et al. (1991) are underlined. CDR residues in X72452 are omitted in this Figure.
  • FIG. 8 shows oligonucleotides used for construction of the Hu33E10 VHl gene.
  • FIG. 9 shows the oligonucleotides used for construction of the Hu33El 0 VLl gene.
  • FIG. 10 shows the oligonucleotides used for construction of the Hu33E10 VHl gene.
  • An arrow denotes the position and orientation (5' to 3') of each oligonucleotide. Amino acid residues are shown in single letter code.
  • FIG. 11 shows oligonucleotides used for construction of the Hu33E10 VL1 gene.
  • An arrow denotes the position and orientation (5' to 3') of each oligonucleotide. Amino acid residues are shown in single letter code.
  • FIG. 12 shows the nucleotide sequence of the Hu33E10 VH1 gene flanked by Spel and Hindin sites (underlined) is shown along with the deduced amino acid sequence. Amino acid residues are shown in single letter code. The signal peptide sequence is in italic. The N- terminal amino acid residue (E) of the mature VH is double-underlined. CDR sequences according to the definition of Kabat et al. (1991 ) are underlined. The intron sequence is in italic.
  • FIG. 13 shows the nucleotide sequence of the Hu33E10 VL1 gene flanked by Nhel and EcoRI sites (underlined) is shown along with the deduced amino acid sequence. Amino acid residues are shown in single letter code. The signal peptide sequence is in italic. The N- terminal amino acid residue (D) of the mature VL is double-underlined. CDR sequences according to the definition of Kabat et al. (1991) are underlined. The intron sequence is in italic.
  • FIG. 14 shows the nucleotide sequence of the Hu33E10 VL6 gene flanked by Nhel and EcoRI sites (underlined) is shown along with the deduced amino acid sequence.
  • the silent mutation to eliminate the splicing donor site in the signal peptide-coding region is double- underlined.
  • Amino acid residues are shown in single letter code.
  • the signal peptide sequence is in italic.
  • the N-terminal amino acid residue (D) of the mature VL is double-underlined.
  • CDR sequences according to the definition of Kabat et al. (1991 ) are underlined.
  • the intron sequence is in italic.
  • FIGS. 15A & 15B show ELIS A analysis of the binding of chimeric and humanized
  • FIG 15B were tested at various concentrations, starting at 100 ⁇ g/ml and serial 2-fold dilutions, for binding to hOPN5-BSA. Experiments were carried out in duplicate.
  • FIG. 16 shows the nucleotide sequence of the Hu33E10 VH5 gene flanked by Spel and HindlH sites (underlined) is shown along with the deduced amino acid sequence. Amino acid residues are shown in single letter code. The signal peptide sequence is in italic. CDR sequences according to the definition of Kabat et al. (1991) are underlined. The intron sequence is in italic. The double-underlined amino acid residue indicates difference from VH1.
  • FIG. 17 shows the nucleotide sequence of the Hu33E10 VH7 gene flanked by Spel and Hindin sites (underlined) is shown along with the deduced amino acid sequence. Amino acid residues are shown in single letter code. The signal peptide sequence is in italic. CDR sequences according to the definition of Kabat et al. (1991 ) are underlined. The intron sequence is in italic. Double-underlined amino acid residues indicate difference from VH1.
  • FIG. 18 shows nucleotide sequence of the Hu33E10 VH7.8 gene flanked by Spel and Hindin sites (underlined) is shown along with the deduced amino acid sequence. Amino acid residues are shown in single letter code. The signal peptide sequence is in italic. CDR sequences according to the definition of Kabat et al. (1991) are underlined. The intron sequence is in italic. Double-underlined amino acid residues indicate difference from VH1.
  • FIG. 19 shows the alignment of the amino acid sequences of 33E10 VL, Hu33E10 VLv2 and human acceptor M29467 (GenBank accession number) is shown. Amino acid residues are shown in single letter code. Numbers above the sequences indicate the positions according to Kabat et al. (1991). CDR sequences defined by Kabat et al. (1991) are underlined. Double-underlined residues were predicted to contact with the CDRs and the mouse residues were retained at these locations in the humanized form. CDR residues in M29467 are omitted in this Figure.
  • FIG. 20 shows the nucleotide sequence of the Hu33E10 VLv2 gene flanked by Nhel and EcoRI sites (underlined) is shown along with the deduced amino acid sequence. Amino acid residues are shown in single letter code. The signal peptide sequence is in italic. The N- terminal amino acid residue (D) of the mature VL is double-underlined. CDR sequences according to the definition of Kabat et al. (1991) are underlined. The intron sequence is in italic.
  • FIGS. 21 A & 21 B show ELIS A analysis of the binding of Ch33E10 and Hu33E10- VH7/VLv2 IgGl/ ⁇ antibodies to hOPN5-BSA.
  • Purified Ch33E10 and Hu33E10-VH7/VLv2 antibodies were tested at various concentrations, starting at 200 ⁇ g/ml (FIG. 21 A) or 100 ⁇ (FIG 21B) and serial 2-fold dilutions, for binding to hOPN5-BSA. The results of two independent experiments in duplicate (FIGS. 21A & 21B) are shown.
  • FIG 22 shows the sequences of oligonucleotides used for PCR amplification and sequencing of Hu33E10 heavy and light chain cDNA.
  • FIG 23 shows the nucleotide sequence of the coding region for VH7 and gamma-1 heavy chain constant regions expressed in NS0-Hu33E10-4 and NS0-Hu33E10-6 is shown along with the deduced amino acid sequence. Amino acid residues are shown in single letter code. A termination codon is denoted by " ⁇ ".
  • FIG 24 shows the nucleotide sequence of the coding region for VH7.8 and gamma-1 heavy chain constant regions expressed in NS0-Hu33E10-5 is shown along with the deduced amino acid sequence. Amino acid residues are shown in single letter code. A termination codon is denoted by " ⁇ ".
  • FIG 25 shows the nucleotide sequence of the coding region for VL6 and kappa light chain constant regions expressed in NS0-Hu33E10-4 and NS0-Hu33E10-5 is shown along with the deduced amino acid sequence. Amino acid residues are shown in single letter code. A termination codon is denoted by
  • FIG 26 shows the nucleotide sequence of the coding region for VLv2 and kappa light chain constant regions expressed in NS0-Hu33E10-6 is shown along with the deduced amino acid sequence. Amino acid residues are shown in single letter code. A termination codon is denoted by " -”.
  • FIG. 27 shows the humanized anti-OPN antibodies inhibited the adhesion of MDA- MB-435S to hOPN5-BSA.
  • MDA-MB-435S (4 xl04 cell/well) was allowed to adhere to 96- well plates pre-coated with hOPN5-BSA (2mg/ml) in the presence of various concentration of antibodies, human IgG, Ch33E10, EJ3-1-1 (Hu33E10-VH7.8/VL6), R3-1 (Hu33E10- VH7/VL6), SP2-1 (Hu33E10-VH7/VLv2), and m33E10. Data is presented at as a mean of triplicate experiments.
  • Antibodies that immunospecifically recognize the RGD sequence may be generated by any suitable method known in the art.
  • RGD-protein or peptides which includes cell adhesive "RGD” sequence may be (1 ) derived from human ECMs that express RGD-protein or from all tissues where these ECMs are present, (2) recombinant proteins or peptides which are obtained by expression of the DNA (preferably cDNA) encoding the RGD-protein or RGD-peptide by transfecting into bacteria, yeast, cell lines such as animal cells, etc., or (3) synthetic proteins or peptides.
  • the RGD-peptides used as an antigen in the present invention may be able to produce antibodies against the RGD sequence by immunization.
  • the RGD-peptides include the RGD- peptides an amino acid sequence CVDVPNGRGDSLAYGLR (SEQ ID NO:71 ) which is a cell adhesive sequence of murine ECM protein.
  • the RGD-proteins or the RGD-peptides include such as OPN, vitronectin, fibronectin, von Willebrand Factor, collagens, laminin, tenascin, fibrinogen, thrombospondin and RGD including fragment thereof.
  • the variant proteins or peptides may comprise an amino acid sequence, wherein multiple amino acids, preferably 1 to 10 amino acids and more preferably 1 to several (e.g., 1 to 5) amino acids are substituted deleted, modified, added or inserted.
  • the RGD-peptide comprises at least about 5 amino acids, preferably about 5 to 50 amino acids, and more preferably about 10 to 20 amino acids.
  • the RGD-proteins or the RGD-peptides as an antigen in the present invention can be produced by using methods well known in the art, such as chemical synthesis method, cell culture method, gene recombinant method and its proper modification.
  • the RGD-peptide can be obtained by cleaving ECM protein with protease appropriately.
  • the RGD-protein or the RGD-peptide can be derived from mammal such as murine, rat, rabbit, swine, bovine, monkey and human. Any methods well known in the art can be used for preparing the RGD-protein or the RGD-peptide which can be used for preparing an anti-RGD antibody.
  • Examples of the methods for producing variant polypeptides include a synthetic oligonucleotide site-directed mutagenesis (gapped duplex method), a point mutagenesis method which involves introducing a point mutation at random by treatment with nitrite or sulfite, a method which involves preparing a deletion mutant with Bal31 enzyme, or other enzymes, a cassette mutagenesis, a linker scanning method, a miss incorporation method, a mismatch primer method, a DNA segment synthesis method, and the like.
  • the RGD-peptide can be bound with other biologic macromolecule such as thyrogloblin, Keyhole Limpet Haemocyanin (KLH), bovine serum albumin (BSA), ovalbumin (OVA) or bovine globulin, preferably thyrogloblin.
  • the method for binding RGD-peptide to a biologic macromolecule may be achieved by using coupling reagent such as a binding reagent having active ester group and maleic imide group (the active ester group binds to amino group of a protein or a peptide and the maleic imide group binds to thiol group of a protein or a peptide; S. yoshirake et al., Eur. J.
  • the method for binding RGD-peptide to a biologic macromolecule is preferably achieved by using coupling reagent.
  • a cell per se that overexpresses the RGD-protein or the RGD-peptide can be also used.
  • Cells overexpressing the RGD-protein or the RGD-peptide may be prepared by recombinant DNA technologies well known in the art.
  • antibodies specific for the RGD sequence may be prepared by various methods well known in the art.
  • Polyclonal antibodies to the RGD sequence can be produced by various procedures well known in the art.
  • an antigen of interest can be administered to various host animals including, but not limited to, rabbits, mice, rats, etc., to induce the production of antisera containing polyclonal antibodies specific for the antigen.
  • adjuvants may be used to increase the immunological response, depending on the host species, which include but are not limited to, Freund's (complete and incomplete) adjuvant, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful adjuvants for humans such as BCG (Bacille Calmette-Guerin) and Corynebacterium parvum.
  • BCG Bacille Calmette-Guerin
  • Corynebacterium parvum Such adjuvants are also well known in the art.
  • Monoclonal antibodies can be prepared by using a wide variety of techniques known in the art including the use of hybridoma, recombinant and phage display technologies, or a combination thereof.
  • monoclonal antibodies can be produced by using hybridoma techniques including those known in the art and taught in, for example, Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas, pp. 563-681 (Elsevier, N.Y, 1981) (both of which are incorporated by reference in their entireties).
  • “monoclonal antibody” as used herein is not limited to antibodies produced through hybridoma technology.
  • the term “monoclonal antibody” refers to an antibody derived from a single clone, and includes any eukaryotic, prokaryotic or phage clone, but not limited to the method it is produced.
  • mice can be immunized with an antigen of interest or a cell expressing such an antigen.
  • an immune response e.g., antibodies specific for the antigen are detected in the mouse serum
  • the mouse spleen is harvested and splenocytes isolated.
  • the splenocytes are then fused by well known techniques to any suitable myeloma cells (e.g., P3U1 , P3X63-Ag8, P3X63-Ag8- Ul, P3NS1 -Ag4, SP2/0-Agl4, P3X63-Ag8-653, etc.).
  • Hybridomas are selected and cloned by limiting dilution.
  • the hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding the antigen.
  • Ascites fluid which generally contains high levels of antibodies, can be generated by inoculating mice intraperitoneally with positive hybridoma clones.
  • Antibody fragments what recognize specific epitopes may be generated by known techniques.
  • Fab and F(ab') 2 fragments may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab') 2 fragments).
  • F(ab') 2 fragments contain the complete L-chain, and the V-region, the CHI region and the hinge region of the H-chain.
  • the antibodies of the invention or an antigen-binding fragment thereof may be produced by any method known in the art for synthesis of antibodies, in particular, by chemical synthesis or preferably by recombinant expression techniques.
  • nucleotide sequence encoding an antibody may be obtained from any information available to those skilled in the art (i.e., from Genbank, the literature, or by routine cloning and sequence analysis). If a clone containing a nucleic acid encoding a particular antibody or an epitope-binding fragment thereof is not available, but the sequence of the antibody molecule or epitope-binding f agment thereof is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody) by PCR amplification using synthetic primers hybridizable to the and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., from
  • the nucleotide sequence of the antibody may be manipulated by using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR and the like (see, for example, the techniques described in Sambrook et al., supra; and Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY, which are both incorporated by reference herein in their entireties).
  • Antibodies may be introduced mutations such as substitutions, deletions and/or insertions of amino acid at epitope-binding domain regions or at any portion to enhance or reduce biological activities.
  • An expression vector containing a nucleotide sequence that encodes the antibody can be used for recombinant expression of an antibody or an antigen-binding fragment thereof.
  • the vector including a nucleotide sequence encoding an antibody molecule, a H-chain and/or a L-chain of an antibody or a portion thereof for production of the antibody or an antigen- binding fragment thereof may be produced by recombinant DNA technology using techniques well known in the art as discussed in the previous sections. Methods which are well known to those skilled in the art can be used to construct expression vectors containing antibody or an antigen-binding fragment thereof coding sequences and appropriate transcriptional and translational control signals.
  • the nucleotide sequence encoding the VH, the VL, both of the VH and the VL, an antigen-binding fragment of the VH and/or VL, or one or more CDRs of an antibody may be cloned into such a vector for expression.
  • Such a sequence may be fused with a polynucleotide encoding a signal peptide which may be native or a heterologous to the original antibody.
  • the expression vector thus- prepared can be then introduced into appropriate host cells for the expression of the antibody.
  • the invention includes host cells containing a polynucleotide encoding a humanized antibody or an antigen-binding fragment thereof that immunospecifically recognizes the RGD sequence.
  • the host cell may be co-transfected with two expression vectors of the invention, wherein the first vector encodes a H-chain derived polypeptide and the second vector encodes a L-chain derived polypeptide.
  • the two vectors may contain identical selectable markers which enable equal expression of H-chain and L-chain polypeptides or different selectable markers to ensure maintenance of both plasmids.
  • a single vector may be used which encodes, and is capable of expressing, both of H-chain and L-chain polypeptides.
  • the coding sequences for the H-chain and L-chain may comprise cDNA or genomic DNA.
  • antibodies can also be generated using various phage display methods known in the art.
  • phage display methods functional antibody domains are displayed on the surface of phage particles which carry the
  • phage can be utilized to display antigen binding domains, such as Fab and Fv or disulfide- bond stabilized Fv, expressed from a repertoire or combinatorial antibody library (e.g., human or murine).
  • antigen binding domains such as Fab and Fv or disulfide- bond stabilized Fv
  • Phage expressing an antigen binding domain that binds the antigen of interest can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead.
  • Phages used in these methods are typically filamentous phage, including fd and Ml 3.
  • the antigen binding domains are expressed as a recombinantly fused protein to either the phage gene ⁇ or gene VIII protein.
  • phage display methods that can be used to make the immunoglobulins, or fragments thereof, of the present invention include those disclosed in Brinkman et al., J. Immunol. Methods, 182:41 -50, 1995; Ames et al., J. Immunol. Methods, 184:177-186, 1995; Kettleborough et al., Eur. J. Immunol., 24:952- 958, 1994; Persic et al., Gene, 187:9-18, 1997; Burton et al., Advances in Immunology, 57: 191-280, 1994; PCT application No.
  • the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired fragments, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described in detail below.
  • an antibody molecule of the invention may then be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A or Protein G purification, and sizing column chromatography), centrifugation, differential solubility, or by any other standard techniques for the purification of proteins.
  • chromatography e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A or Protein G purification, and sizing column chromatography
  • centrifugation e.g., centrifugation, differential solubility, or by any other standard techniques for the purification of proteins.
  • the antibodies of the present invention or fragments thereof may be fused to heterologous polypeptide sequences described herein or otherwise known in the art to facilitate purification.
  • Chimeric antibodies and humanized antibodies are discussed in details in Section 5.3, infra.
  • Antibodies fused or conjugated to other compounds or heterologous polypeptides may be used in in vitro immunoassays, in purification methods (e.g., affinity chromatography), as well as in vivo therapeutic or diagnostic uses. See e.g., PCT publication Number WO
  • antibodies can be labeled in various ways using a known method or commercially available kit (e.g., biotin labeling, FITC labeling, APC labeling).
  • antibodies may be conjugated to a therapeutic moiety that enhances the biological effect of the antibodies in vivo.
  • Examples of such a therapeutic moiety include another antibody, cytotoxins that are cytostatic or cytocidal, radioactive element, and/or other therapeutic agents, including anti-inflammatory agents, antibiotics, and the like.
  • the humanized anti-RGD antibody may be conjugated to another antibody to form a bispecific antibody.
  • the humanized antibody of the present invention may be labeled with detectable markers, such as radioactive elements, for in vivo diagnostic uses. 53 Chimeric and Humanized Antibodies
  • a chimeric antibody is a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a V-region derived from a murine monoclonal antibody and a constant region derived from a human immunoglobulin.
  • Methods for producing chimeric antibodies are known in the art. See, e.g., Morrison, Science, 229:1202, 1985; Oi et al., BioTechniques, 4:214 1986; Gillies et al., J. Immunol. Methods, 125:191-202, 1989; U.S. Patent Nos. 5,807,715; 4,816,567; and 4,816,397, which are incorporated herein by reference in their entireties.
  • a humanized antibody is a molecule that binds a desired antigen and comprises a V- region containing one or more CDRs derived from a non-human species and one or more FRs derived from a human immunoglobulin molecule.
  • the typical methods for humanizing non- human antibodies have been described in various references, such as those: by Queen et al., 1989, Proc. Natl. Acad. Sci. USA 86:10029-10033 and U.S. Patent Nos. 5,585,089 and 5,693,762; by Riechmann et al., Nature, 332:323, 1988; and by Tsurushita et al., Methods 36:69-83, 2005, all of which are incorporated herein by reference in their entireties).
  • Tsurushita provides a practical and instructive protocol for the humanization of mouse monoclonal antibodies based on the antibody-humanization method originally developed by Queen et al. (1989, supra).
  • the general protocol disclosed in Tsurushita is briefly summarized below. 53.1 General protocol for preparing humanized antibodies
  • 5' RACE rapid amplification of cDNA ends
  • a gene-specific primer for 5' RACE can be prepared based on the isotypes of the H-chain and the L-chain of the target monoclonal antibody so that it can bind immediately downstream of the VH and VL.
  • 5' RACE primer may be designed to be specific for each subtype in mouse, such as ⁇ , y2a, y2b or ⁇ 3.
  • a common primer for all subtypes may be designed based on the consensus or highly homologous region among the subtypes.
  • Tsurushita the following 5' RACE primers are disclosed as examples:
  • PCR-amplified V-region gene fragments can be directly cloned into a plasmid vector, for example, using the Zero Blunt TOPO PCR Cloning Kit (Invitrogen), and their DNA sequences determined.
  • the obtained sequences should be confirmed by, for example, comparing their encoding amino acid sequences with those of the target monoclonal antibody determined by the N-terminal amino acid sequencing, using, for example a Model 241 Protein Sequencer (Hewlett-Packard, CA).
  • the determination of at least 15-20 amino acid residues at the N-terminus of the target antibody is sufficient to confirm the authenticity of the cloned DNA sequences.
  • Tsurushita cautions that when glutamine, which is one of the two most common N-terminal amino acid in mouse, is the N-terminal amino acid, it might have been converted to pyroglutamine and blocks the sequencing at the N-terminus. In that case, it is necessary to deblock the N-terminus to obtain the sequence.
  • each of the VH and VL is divided into 14 structurally meaningful segments, which are ⁇ strands and loop-like structures comprising the domain structure of the immunoglobulin superfamily.
  • the amino acid sequence of each of the segments from the target antibody is aligned with the corresponding segments of antibodies of known structures, in the PDB database (see H.M.
  • the amino acid sequences deduced from the cDNA cloning of the mouse VH and VL, respectively, are compared to human V-region sequences in the databases, for example, the Kabat database (see Johnson et al, 2000, Nucleic Acids Res. 28:214-218 ), GenBank, and so forth.
  • Human FRs that have overall sequence identity of at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least 95% identity, with the mouse sequence can be searched using, for example, the Smith-Waterman algorithm (by Gusfield, 1997, in “Algorithms on Strings, Trees, and Sequences", Cambridge University Press,
  • the selected human acceptor contains "atypical" amino acids, which occur in less than about 10-20% of the V region sequences, they may be the result of somatic hypermutation during affinity maturation and should be replaced with the donor residues in order to avoid potential immunogenicity in humans.
  • Humanized antibodies may contain a human constant region or a portion thereof from the human ⁇ or ⁇ L-chain, and/or the ⁇ , ⁇ 2, ⁇ 3, ⁇ 4, ⁇ , ⁇ , ⁇ 2, ⁇ , or ⁇ H-chain of human antibodies, or variants thereof, depending on the effector functions required or to be eliminated for therapeutic uses.
  • a Fc portion of the constant region containing a mutation may be fused to the V-region of the chimeric or humanized antibody of the present invention so as to reduce the binding of the antibody to Fc receptors and/or to reduce its ability to fix complement (see, for example, Winter et al., GB 2,209,757 B; Morrison et al., WO 89/07142, Morgan et al., WO 94/29351).
  • Such manipulations of antibody molecules can be carried out by recombinant DNA technology as described in Section 5.2.
  • the resulting chimeric or humanized antibody has the same specificity as the non-human donor antibody and an affinity similar to or at least about 1/3, at least about 1/2, or at least about 2/3, of that of the non-human donor antibody
  • the resulting chimeric or humanized antibody has an affinity constant of at least about 1 x 10 7 M "1 , preferably at least about 1 x 10 8 M "1 , and most preferably at least about 1 x 10 9 M "1 .
  • antibodies can be humanized using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Patent Nos. 5,225,539; 5,530,101 and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology,
  • an appropriate expression vector for humanized antibodies is prepared by inserting H- chain and L-chain sequences, and a high-productivity cell line transfected with the expression vector can be obtained as a seed cell for a master cell bank (MCB), which serves as a stable and semi-permanent source for a working cell bank (WCB).
  • MBB master cell bank
  • WCB working cell bank
  • Humanized antibodies can be then prepared by culturing working cells from the WCB and collecting the culture medium.
  • Various expression vectors with appropriate regulatory genes can be used for the preparation of such a production cell line.
  • a host cell those commonly used for expressing mammalian proteins can be used for the expression of humanized antibodies.
  • Examples of such host cells include, but are not limited to, Chinese Hamster Ovary (CHO) cells, SP2/0- Agl4.19 cells, NSO cells, and the like.
  • the productivity of humanized antibodies can be maximized by selecting the best combination of an expression vector and a host cell.
  • composition of culture media should be explored in order to select suitable media, from various serum-free culture media and supplements, so that the expression of humanized antibodies by the host cell can be optimized.
  • the humanized antibodies produced by the host cell can be purified from the culture supernatant using various methods well known in the art, including affinity chromatography, ion-exchange chromatography, hydrophobic interaction chromatography, and the like.
  • the present invention provides a pharmaceutical composition comprising the humanized antibody or an antigen-binding fragment thereof, described above, that immunospecifically recognizes the RGD sequence.
  • the pharmaceutical composition comprising the humanized antibody of the present invention as an active ingredient can be used as an agent for preventing and/or treating a disorder or disease that is associated with RGD proteins, including, but not limited to, cancer, e.g., the growth or metastasis of cancer cells, and an inflammatory disease, e.g., rheumatoid arthritis, osteoarthritis, hepatitis, bronchial asthma, fibrosis, diabetes mellitus, arteriosclerosis, multiple sclerosis, granuloma, an inflammatory bowel disease (ulcerative colitis and Crohn's disease), an autoimmune disease, and the like.
  • cancer e.g., the growth or metastasis of cancer cells
  • an inflammatory disease e.g., rheumatoid arthritis, osteoarthritis, hepatit
  • the pharmaceutical composition comprising the humanized antibody of the present invention can also be used to treat chronic rejection after organ transplantation, and an autoimmune disease such as systemic autoimmune disease, erythematosus, uveitis, Behcet's disease, polymyositis, glomerular proliferative nephritis, sarcoidosis, and the like.
  • an autoimmune disease such as systemic autoimmune disease, erythematosus, uveitis, Behcet's disease, polymyositis, glomerular proliferative nephritis, sarcoidosis, and the like.
  • the preventive and/or therapeutic agent for preventing or treating the disorders or diseases described above, comprising the humanized antibody of the present invention, has low toxicity and can be administered to humans orally or parenterally, directly as a liquid preparation by mixing in a suitable solvent, or as a pharmaceutical composition in an appropriate dosage form.
  • the pharmaceutical composition used for the administration described above contains the aforesaid antibody or salts thereof and pharmaceutically acceptable carriers, diluents or excipients. Such a composition is provided in a dosage form suitable for oral or parenteral administration.
  • the dose may vary depending upon the age and the size of a subject to be
  • the antibody When the antibody is used for preventing and/or treating, for example, rheumatoid arthritis in an adult patient, it is advantageous to intravenously administer the antibody of the present invention normally at a single dose of about 0.01 to about 20 mg/kg body weight, preferably about 0.1 to about 10 mg/kg body weight, and more preferably about 0.1 to about 5 mg/kg body weight, approximately 1 to 5 times per day, preferably approximately 1 to 3 times per day.
  • the antibody can be administered in a dose corresponding to the dose given above. When the condition is especially severe, the dose may be increased according to the condition.
  • Various delivery systems are known and can be used to administer the pharmaceutical composition of the invention, e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the mutant viruses, receptor mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429 4432).
  • Methods of introduction include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes.
  • the compounds may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local. Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.
  • compositions of the invention locally to the area in need of treatment; this may be achieved by, for example, and not by way of limitation, local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, by means of nasal spray, or by means of an implant, said implant being of a porous, non porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
  • administration can be by direct injection at the site (or former site) infected tissues.
  • the pharmaceutical composition can be delivered in a vesicle, in particular a liposome (see Langer, 1990, Science 249: 1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid. , pp. 317-327; see generally ibid.).
  • a liposome see Langer, 1990, Science 249: 1527-1533; Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid. , pp. 317-327; see generally ibid.).
  • the pharmaceutical composition can be delivered in a controlled release system.
  • a pump may be Used (see Langer, supra, Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201 ; Buchwald et al.,1980, Surgery 88:507; and Saudek et al., 1989, N. Engl. J. Med. 321 :574).
  • polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974);
  • a controlled release system can be placed in proximity of the composition's target, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical
  • compositions for oral administration include solid or liquid dosage forms, specifically, tablets (including dragees and film-coated tablets), pills, granules, powdery preparations, capsules (including soft capsules), syrup, emulsions, suspensions, etc.
  • a composition is manufactured by publicly known methods and contains a vehicle, a diluent or an excipient conventionally used in the field of pharmaceutical preparations.
  • vehicle or excipient for tablets are lactose, starch, sucrose, magnesium stearate, and the like.
  • the injectable preparations may include dosage forms for intravenous, subcutaneous, intracutaneous and intramuscular injections, drip infusions, etc. These injectable preparations may be prepared by methods publicly known.
  • the injectable preparations may be prepared, e.g., by dissolving, suspending or emulsifying the antibody or its salt described above in a sterile aqueous medium or an oily medium conventionally used for injections.
  • aqueous medium for injections there are, for example, physiological saline, an isotonic solution containing glucose and other auxiliary agents, etc., which may be used in combination with an appropriate solubilizing agent such as an alcohol (e.g., ethanol), a polyalcohol (e.g., propylene glycol, polyethylene glycol), a nonionic surfactant [e.g., polysorbate 80, HCO-50, etc.
  • an alcohol e.g., ethanol
  • a polyalcohol e.g., propylene glycol, polyethylene glycol
  • a nonionic surfactant e.g., polysorbate 80, HCO-50
  • the injection thus prepared is preferably filled in an appropriate ampoule.
  • the suppository used for rectal administration may be prepared by blending the aforesaid antibody or its salt with conventional bases for suppositories.
  • the pharmaceutical compositions for oral or parenteral use described above are prepared into dosage forms in a unit dose suited to fit a dose of the active ingredients.
  • dosage forms in a unit dose include, for example, tablets, pills, capsules, injections (ampoules), suppositories, etc.
  • the amount of the aforesaid antibody contained is generally about 5 to 500 mg per dosage form in a unit dose; especially in the form of injection, it is preferred that the aforesaid antibody is contained in about 5 to 100 mg and in about 10 to 250 mg for the other dosage forms.
  • composition described above may further contain other active components unless formulation causes any adverse interaction with the antibodies described above.
  • the present invention also relates to an inhibitor and/or promoter for cell and/or tissue remodeling, which comprises an RGD sequence-binding functional molecule (e.g., integrins, etc.) as an active ingredient; and a method for inhibiting and/or promoting cell and/or tissue remodeling, which comprises contacting the RGD protein expressing cell and/or tissue (e.g., a tumor cell, neutrophil, smooth muscle, etc.) with the RGD protein binding functional molecule.
  • the dose, method for administration, pharmaceutical preparation, etc. of the active ingredient in such a therapeutic agent can be appropriately determined by referring to the foregoing description of medicaments comprising the humanized antibodies of the present invention.
  • the present invention further provides a method for preventing or treating a disorder or disease that is associated with or involves RGD proteins, said method comprising administering an effective amount of at least one of the humanized antibodies of the present invention to a subject in need thereof. .5 Diagnostic Uses
  • the pharmaceutical composition comprising the humanized antibody of the present invention can be used as a diagnostic agent for cancer, e.g., the growth or metastasis of cancer cells, and an inflammatory disease, e.g., rheumatoid arthritis, osteoarthritis, hepatitis, bronchial asthma, fibrosis, diabetes mellitus, cancer metastasis, arteriosclerosis, multiple sclerosis, granuloma, etc., or as a diagnostic agent for chronic rejection after organ
  • cancer e.g., the growth or metastasis of cancer cells
  • an inflammatory disease e.g., rheumatoid arthritis, osteoarthritis, hepatitis, bronchial asthma, fibrosis, diabetes mellitus, cancer metastasis, arteriosclerosis, multiple sclerosis, granuloma, etc.
  • an inflammatory disease e.g., rheumatoid arthritis, osteoarthritis, hepatitis
  • an autoimmune disease such as systemic autoimmune disease, erythematosus, uveitis, Behcet's disease, polymyositis, glomerular proliferative nephritis, sarcoidosis, and so forth.
  • the humanized antibodies of the present invention are capable of specifically recognizing the RGD sequence and hence can be used to quantify the RGD proteins in a test fluid, especially for quantification by the sandwich immunoassay, competitive assay, immunometry, nephrometry, etc., immunostaining, or the like.
  • the RGD proteins may be quantified with high sensitivity by using the antibodies of the present invention.
  • the humanized antibodies of the present inventions are particularly useful for diagnosing various diseases associated with the RGD proteins by applying the method for quantifying the RGD proteins in vivo. For instance, where an increase or decrease in the expression level of the RGD proteins is detected, it can be diagnosed that it is highly likely that one now suffers from diseases associated with the RGD protein, e.g., cancer or an inflammatory disease, or it is highly likely that one will suffer from these diseases in the future.
  • the present invention also provides a method for diagnosing a disorder or disease associated with or involve the RGD proteins in a subject, said method comprising administering an effective amount of at least one of the humanized antibodies of the present invention or both to a subject in need thereof.
  • Required dosages for such an in vivo diagnosis may be less than those required for therapeutic uses and can be determined by one skilled in the art according to routine procedures.
  • the humanized antibodies of the present invention can also be used for specifically detecting the RGD proteins present in a test sample (e.g., a test fluid such as a body fluid, a tissue, etc).
  • a test sample e.g., a test fluid such as a body fluid, a tissue, etc.
  • the humanized antibodies can also be used for preparation of antibody columns for purification of the RGD proteins, for detection of the RGD proteins contained in each fraction upon purification or for analysis of behaviors of the RGD proteins in cells to be tested.
  • the sequence identification numbers in the sequence listing of the specification indicate the following sequences.
  • SEQ ID NO: 9 This shows the nucleotide sequence of the Hu33E10 VH7 gene including a sequence encoding a signal peptide and the intron sequence, flanked by Spel and Hindin sites.
  • Hu33E10 VH7.8 gene including a signal peptide.
  • oligonucleotide [CMV2] used for PCR amplification and sequencing of Hu33E10 heavy and light chain cDNA.
  • SEQ ID NO: 36 This shows the nucleotide sequence of mouse 33E10 VL cDNA.
  • Mouse 33E10 hybridoma cells were grown in TIL Media I (Immuno-Biological Laboratories, Gunma, Japan) containing 10% fetal bovine serum (FBS; HyClone, Logan, UT) at 37°C in a 7.5% C0 2 incubator.
  • Total RNA was extracted from approximately 3 x 10 6 hybridoma cells using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the supplier's protocol.
  • Oligo dT -primed cDNA was synthesized using the GeneRacer Kit (Invitrogen) following the supplier's protocol.
  • variable region cDNAs for 33E10 heavy and light chains were amplified by polymerase chain reaction (PCR) with Phusion DNA polymerase (New England Biolabs, Beverly, MA) using 3' primers that anneal respectively to the mouse gamma- 1 and kappa chain constant regions, and a GeneRacer 5' primer (5'- CGACTGGAG ACGAGGAC ACTGA-3 ' (SEQ ID NO: 84)) provided in the GeneRacer Kit.
  • the 3' primer has the sequence 5'- GCC AGTGGAT AGAC AGATGG-3 ' (SEQ ID NO: 85).
  • VL light chain variable region
  • the 3' primer has the sequence 5'-GATGGATACAGTTGGTGCAGC-3' (SEQ ID NO: 86).
  • the amplified VH and VL cDNAs were cloned into the pCR4Blunt-TOPO vector (Invitrogen) for sequence determination. DNA sequencing of the variable regions was carried out at Tocore (Menlo Park, CA). Several heavy and light chain clones were sequenced and unique sequences homologous to typical mouse heavy and light chain variable regions were identified. The consensus cDNA sequences along with deduced amino acid sequences of 33E10 VH and VL are shown in FIGS. 1 and 2, respectively. 6.2. Construction of chimeric 33E10 IgGl/ ⁇ antibody
  • a gene encoding 33E10 VH was generated as an exon including a splice donor signal and appropriate flanking restriction enzyme sites by PCR using 33E10 VH cDNA as a template, 5 '-GGGACTAGTACCACC ATGAAGTTGTGGCTGAACTGGATT-3 ' (SEQ ID NO: 87) (Spel site is underlined) as a 5' primer, and 5'- GGGAAGCTTGAAGTTAGGACTCACCTGCAGAGACAGTGACCAGAGTCCC-3 ' (SEQ ID NO: 88) (HindEH site is underlined) as a 3 ' primer (FIG. 3).
  • a gene encoding 33E10 VL was generated as an exon including a splice donor signal and appropriate flanking restriction enzyme sites by PCR using 33E10 VL cDNA as a template, 5'- GGGGCJAGCACCACCATGAAGTTGCCTGTTAGGCTGTTG-3' (SEQ ID NO: 89) (Nhel site is underlined) as a 5' primer, and 5'-
  • GGGG ATTCTTTGGATTCTACTTACGTTTGATTTCC AGCTTGGTGCCTCC-3 ' (SEQ ID NO: 90) (EcoRI site is underlined) as a 3' primer (FIG. 4).
  • the splice donor signals of the 33E10 VH and VL exons were derived from the mouse germline JH3 and JKI sequences, respectively (Kabat et al., Sequences of Proteins of Immunological Interests, Fifth edition, NIH Publication No. 91-3242, U.S. Department of Health and Human Services, 1991).
  • PCR- amplified fragments were gel-purified using QIAquick Gel Extraction Kit (Qiagen, Valencia, CA), digested with Spel and Hindlll (for VH) or Nhel and EcoRI (for VL), and cloned into a mammalian expression vector carrying human gamma- 1 and kappa constant regions for production of chimeric 33E10 IgGl/ ⁇ antibody.
  • the schematic structure of the resulting expression vector, pCh33E10 is shown in FIG. 5. 6.3. Generation of humanized 33E10 VH and VL genes
  • Humanization of the 33E10 variable regions was carried out as outlined by Queen et al. (Proc. Natl. Acad. Sci. USA 86: 10029-10033, 1989).
  • a three-dimensional molecular model of the 33E10 variable regions was constructed with the aid of computer programs.
  • the human VH amino acid sequence of U03400 (GenBank accession number), which has a high homology to 33E10 VH, was chosen as an acceptor to provide the frameworks for humanized 33E10 VH.
  • the human VL amino acid sequence of X72452 was chosen as an acceptor for humanization of 33E10 VL.
  • a gene encoding each of Hu33E10 VH1 and VLl was designed as an exon including a signal peptide, a splice donor signal, and appropriate restriction enzyme sites for subsequent cloning into a mammalian expression vector.
  • the splice donor signals of the Hu33E10 VHl and VLl exons were derived from the human germline JH3 and JKI sequences (Kabat et al., 1991), respectively.
  • the signal peptide sequence of the mouse 33E10 VLl gene was indicated to be suboptimal for precise cleavage by the SIG-Pred signal peptide prediction software (http://bmbpcu36.leeds.ac.uk/prot_analysis/Signal.html).
  • the signal peptide of the VL gene of the mouse monoclonal antibody 35B6 (Gene Techno Science), which was predicted to be cleaved efficiently and precisely by the SIG-Pred software, was used in the Hu33E10 VLl exon.
  • the signal peptide sequence in the Hu33E10 VHl exon was derived from the corresponding mouse 33E10 VH sequence.
  • the SIG-Pred software indicated that the signal peptide of the Hu33E10 VHl gene is cleaved efficiently and precisely.
  • the Hu33E10 VH1 and VL1 genes were constructed by extension and PCR
  • FIGS. 10 and 11 The location of the oligonucleotides in the Hu33E10 VH1 and VL1 genes is shown in FIGS. 10 and 11, respectively.
  • PCR-amplified fragments were gel-purified using QIAquick Orel Extraction Kit (Qiagen) and cloned into pCR4Blunt-TOPO vector for sequence determination. After digestion with Spel and Hindlll (for VH) or Nhel and EcoRI (for VL), Hu33E10 VH1 and VL1 genes were subcloned into corresponding sites in a mammalian expression vector for production of the human IgGl/ ⁇ form.
  • the schematic structure of the resulting expression vector, pHu33E10-l is shown in FIG. 5.
  • the nucleotide sequences of the obtained Hu33E10 VH1 and VL1 genes along with deduced amino acid sequences are shown in FIGS. 12 and 13, respectively. 6.4. Expression of chimeric and humanized 33E10
  • the expression vectors pCh33E10 and pHu33E10-l were introduced into the chromosome of a mouse myeloma cell line NS0 (European Collection of Animal Cell Cultures, Salisbury, Wiltshire, UK). NS0 cells were grown in DME medium containing 10% FBS at 37°C in a 7.5% C0 2 incubator. Stable transfection into NS0 cells was carried out by electroporation as described in Bebbington et al. (Bio/Technology 10: 169-175, 1992). Before transfection, each expression vector was linearized using Fspl.
  • the expression level of recombinant antibodies expressed from pCh33E10 and pHu33E10-l (Ch33E10 and Hu33E10-VHl/VLl , respectively) in culture supernatant was measured by sandwich ELISA.
  • sandwich ELISA an ELISA plate was coated overnight at 4°C with 100 ⁇ /well of 1/2,000-diluted goat anti-human IgG Fcy-chain-specific polyclonal antibody (SouthernBiotech, Birmingham, AL) in PBS, washed with Wash Buffer (PBS containing 0.05% Tween 20), and blocked for 1 hr at room temperature with 300 ⁇ /well of Blocking Buffer (PBS containing 2% Skim Milk and 0.05% Tween 20).
  • NSO-Ch33E10 2C1 1 also called L4-2C11
  • Hybridoma SFM Invitrogen
  • Irvine Scientific Cat # 96857 Ultrafiltrated Soy Hydrolyzate
  • Hu33E10-VHl/VLl The analysis of heavy and light chain mRNA revealed the presence of aberrant light chain mRNA lacking the VL coding region due to an accidentally generated splice donor site in the signal peptide-coding region of the VL1 gene. To solve this problem, the splicing donor site in the signal peptide-coding region was eliminated by site-directed mutagenesis using the overlap-extension PCR method (Higuchi, R., in PCR Technology . Principles and Applications for DNA Amplification. Erlich, H. A., ed. pp. 61-70, Stockton Press, New York, 1989). The sequence of the resulting variant Hu33El 0 VL gene, VL6, is shown in FIG. 14.
  • the VL region amino acid sequence is identical to each other between the VLl and VL6 genes.
  • the VL6 gene was replaced for VLl in the expression vector pHu33E10-l to generate pHu33E10-2.
  • NSO cells stably transfected with pHu33E10-2 and producing a high level of recombinant antibody (Hu33E10-VHl /VL6) were obtained by the methods described above. No aberrant light chain mR A was observed in the NSO cells stably transfected with pHu33E10-2.
  • One of the NSO stable transfectants producing a high level of Hu33E10-VHl VL6 was adapted to and expanded in
  • Hybridoma SFM and the culture supernatant was used for purification of Hu33E10-VHl/VL6 as described above.
  • Binding of Ch33E10 and Hu33E10-VHl/VL6 IgGl/ ⁇ antibodies to hOPN5-BSA was examined by ELISA.
  • synthetic oligopeptide Cys-Val-Asp-Thr-Tyr-Asp-Gly- Arg-Gly-Asp-Ser-Val-Val-Tyr-Gly-Leu-Arg-Ser; provided by Gene Techno Science
  • bovine serum albumin hOPN5-BSA
  • an ELISA plate was coated with 100 ⁇ /well of 1 ⁇ g/ml hOPN5-BSA in 0.2 M Na 2 C0 3 buffer (pH 9.4) overnight at 4°C, washed with Wash Buffer, and blocked with 300 ⁇ /well of Blocking Buffer for 1 hr at room temperature. After washing with Wash Buffer, samples appropriately diluted in ELISA Buffer were applied at 100 ⁇ /well in the ELISA plate. After incubating the ELISA plate overnight at 4°C and washing with Wash Buffer, bound antibodies were detected using 100 ⁇ /well of 1/2,000-diluted HRP-conjugated goat anti-human ⁇ chain polyclonal antibody (SouthernBiotech).
  • Hu33E10-VHl/VL6 was roughly 100-fold weaker for binding to hOPN5-BSA than Ch33E10.
  • VH5 VH5
  • Ser at 76 and He at 77 Asn and Ser, respectively, in VH7
  • VH5, VH7 and VH7.8 genes digested with Spel and Hindm was substituted for VHl in pHu33E10-2 to construct expression vectors pHu33E10-3, pHu33E10- 4 and pHu33E10-5, respectively.
  • NSO cells stably transfected with each of pHu33E10-3, pHu33E10-4 and pHu33E10-5 were generated as described in Section 4.
  • Hu33E10-VH5/VL6, Hu33E10-VH7/VL6 and Hu33E10-VH7.8/VL6 antibodies were purified from corresponding culture supernatant using a protein A column as described in Section 4.
  • Hu33E10-VH5/VL6, Hu33E10-VH7/VL6 and Hu33E10-VH7.8/VL6 antibodies to hOPN5-BSA was compared to that of Ch33E10 by ELISA as described in Section 5.
  • the affinity of Hu33E10-VH5/VL6 to hOPN5-BSA was slightly improved when compared to Hu33E10-VHl /VL6, but it was still much weaker than that of Ch33E10 (FIG. 15A).
  • the binding affinity of Hu33E10-VH7/VL6 to hOPN5-BSA was 3 to 4 fold weaker than that of Ch33E10 (FIG. 15A).
  • Hu33E10-VH7.8/VL6 The affinity of Hu33E10-VH7.8/VL6 was approximately 3-fold lower than that of Ch33E10 in this experiment (FIG. 15B). In repeated experiments, Hu33E10-VH7/VL6 and Hu33E10-VH7.8/VL6 behaved similarly to each other for binding to hOPN5-BSA.
  • the Hu33E10 VLv2 gene flanked by Nhe I and EcoRI sites was synthesized at GenScript USA Inc. (Piscataway, NJ).
  • the Hu33E10 VLv2 gene digested with Nhel and EcoRI was substituted for VLl in pHu33El 0-4 to construct a new expression vector pHu33El 0-6.
  • NS0 cells stably transfected with pHu33E10-6 to produce Hu33E10-VH7/VLv2 IgGl/ ⁇ were generated as described in Section 4.
  • One of the transfectants, NS0-Hu33E10-6 1-15 (also called SP2-1 1-15) was adapted to and expanded in Hybridoma SFM, and Hu33E10-VH7/VLv2 antibody was purified from culture supernatant using the procedures described in Section 4.
  • NS0-Ch33E10 2C11, NS0-Hu33E10-4 5D3, NSO-Hu33E10-5 1E5 and NS0- Hu33E10-6 1-15 were all negative for the presence of mycoplasma.
  • the coding region of gamma- 1 heavy chain was amplified by PCR using CMV2 and J T098 as primers (FIG. 22) and Phusion DNA polymerase. PCR fragments were gel-purified and subjected to sequencing with CMV2, J T082, JNT097 and JNT098 as primers (FIG. 22). Similarly, the coding region of kappa light chain was amplified using CMV2 and J T026 (FIG. 22) and gel-purified DNA fragments were subjected to sequencing with CMV2, JNT026, JNT080 and JNT084 as primers (FIG. 22).
  • the obtained sequences for heavy and light chain coding regions matched perfectly with the corresponding sequences in the expression vector for each of NS0- Hu33E10-4 5D3, NS0-Hu33E10-5 1E5 and NS0-Hu33E10-6 1-15 stable transfectants.
  • the sequences for the entire coding region of gamma- 1 heavy chain consisting of Hu33E10 VH7 and VH7.8 are shown FIGS. 23 and 24, respectively.
  • the sequences for the entire coding region of kappa light chain consisting of Hu33E10 VL6 and VLv2 are shown FIGS. 25 and 26.
  • VH and VL regions of Ch33El 0 IgGl / ⁇ antibody produced in NS0-Ch33E10 2C1 1 was confirmed by cDNA sequencing. Extraction of total RNA and cDNA synthesis was carried out as described above.
  • the VH coding region was amplified by PCR using CMV2 and JNT082 as primers and Phusion polymerase. PCR fragments were gel-purified and subjected to sequencing with CMV2 and JNT082 as primers.
  • the VL coding region was amplified using CMV2 and JNT026 and gel-purified DNA fragments were subjected to sequencing with CMV2 and JNT026 as primers.
  • the obtained nucleotide sequences of the VH and VL regions matched perfectly with the corresponding sequences in the pCh33E10 expression vector (FIGS. 3 and 4, respectively).
  • FIG. 27 shows humanized anti-OPN antibodies inhibited the adhesion of MDA-MB- 435S to hOPN5-BSA.
  • MDA-MB-435S human breast cancer cell line was obtained from the American Type Culture Collection (ATCC), and cultured in DMEM supplement with 10% fetal bovine serum.
  • the 96-well plates were coated with hOPN5-BSA (2 ⁇ g/ml) for lh at 37°C, followed by treatment with 0.5%BSA for lh at room temperature.
  • Human immunoglobulin Gl kappa, Ch33E10, Hu33E10-VH7.8/VL6 (EJ3-1-1), Hu33E10-VH7/VL6 (E3-1), Hu33E10- VH7/VLv2 (SP-2), and mouse33E10 antibodies were dissolved in 0.25%BSA, DMEM, and treated at various concentrations, started at 100 ⁇ and serial 2-fold dilutions, for 20 min at 37°C. 2 xlO 4 MDA-MB-435S cells were added to each well. After lh incubation at 37°C, the medium was removed and washed twice with warm PBS (warmed up to 37°C) gently. The adherent cells were fixed and stained with 0.5% crystal violet dissolved in 20% methanol, and lysed with 20% acetic acid. The absorbance was measured at 590 nm. The inhibition ratio was normalized with the absorbance without adding antibody.
  • hybridomas designated herein as 33E10 and 35B6 producing mouse anti-RGD monoclonal antibodies were deposited on October 27, 2005 with International Patent
  • the humanized monoclonal antibodies of the present invention inhibit the function of RGD proteins to exhibit therapeutic effects on cancer, e.g., the growth or metastasis of cancer cells, and an inflammatory disease, e.g., rheumatoid arthritis, osteoarthritis, hepatitis, bronchial asthma, fibrosis, diabetes mellitus, cancer metastasis, arteriosclerosis, multiple sclerosis, granuloma, an inflammatory bowel disease (ulcerative colitis and Crohn's disease), an autoimmune disease, and the like.
  • the pharmaceutical composition comprising both the anti-RGD antibody and anti-integrin antibody of the present invention exerts more improved therapeutic effects on cancer and an inflammatory disease.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Biophysics (AREA)
  • Rheumatology (AREA)
  • Diabetes (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Oncology (AREA)
  • Emergency Medicine (AREA)
  • Hematology (AREA)
  • Communicable Diseases (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Endocrinology (AREA)
  • Cardiology (AREA)
  • Vascular Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Obesity (AREA)
  • Pain & Pain Management (AREA)
  • Pulmonology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/JP2010/067017 2009-09-24 2010-09-22 Humanized antibodies specific for amino acid sequence rgd of an extracellular matrix protein and the uses thereof Ceased WO2011037271A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
KR1020127010432A KR101809761B1 (ko) 2009-09-24 2010-09-22 세포 외 기질 단백질의 아미노산 서열 rgd에 특이적인 인간화된 항체 및 그의 용도
AU2010299017A AU2010299017B2 (en) 2009-09-24 2010-09-22 Humanized antibodies specific for amino acid sequence RGD of an extracellular matrix protein and the uses thereof
CA2772230A CA2772230C (en) 2009-09-24 2010-09-22 Humanized antibodies specific for amino acid sequence rgd of an extracellular matrix protein and the uses thereof
IN1981DEN2012 IN2012DN01981A (cg-RX-API-DMAC7.html) 2009-09-24 2010-09-22
US13/497,692 US8617829B2 (en) 2009-09-24 2010-09-22 Humanized antibodies specific for amino acid sequence RGD of an extracellular matrix protein and the uses thereof
JP2012514276A JP5781504B2 (ja) 2009-09-24 2010-09-22 細胞外マトリックスタンパク質のアミノ酸配列rgdに特異的なヒト化抗体およびそれらの使用
EP10818939A EP2480665A4 (en) 2009-09-24 2010-09-22 HUMANIZED ANTIBODIES TO THE AMINO ACID SEQUENCE RGD OF EXTRACELLULAR MATRIX PROTEIN AND ITS USE
CN201080042356.1A CN102712921B (zh) 2009-09-24 2010-09-22 特异用于胞外基质蛋白的氨基酸序列rgd的人源化抗体及其用途

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US27243809P 2009-09-24 2009-09-24
US61/272,438 2009-09-24

Publications (1)

Publication Number Publication Date
WO2011037271A1 true WO2011037271A1 (en) 2011-03-31

Family

ID=43796008

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2010/067017 Ceased WO2011037271A1 (en) 2009-09-24 2010-09-22 Humanized antibodies specific for amino acid sequence rgd of an extracellular matrix protein and the uses thereof

Country Status (9)

Country Link
US (1) US8617829B2 (cg-RX-API-DMAC7.html)
EP (1) EP2480665A4 (cg-RX-API-DMAC7.html)
JP (1) JP5781504B2 (cg-RX-API-DMAC7.html)
KR (1) KR101809761B1 (cg-RX-API-DMAC7.html)
CN (1) CN102712921B (cg-RX-API-DMAC7.html)
AU (1) AU2010299017B2 (cg-RX-API-DMAC7.html)
CA (1) CA2772230C (cg-RX-API-DMAC7.html)
IN (1) IN2012DN01981A (cg-RX-API-DMAC7.html)
WO (1) WO2011037271A1 (cg-RX-API-DMAC7.html)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10829560B2 (en) 2015-04-20 2020-11-10 Consejo Superior De Investigaciones Cientificas Agents binding specifically to human cadherin-17, human cadherin-5, human cadherin-6 and human cadherin-20 RGD motif
US11667724B2 (en) 2017-07-07 2023-06-06 Astellas Pharma Inc. Anti-human CEACAM5 antibody Fab fragment
US12065503B2 (en) 2018-10-10 2024-08-20 Astellas Pharma Inc. Pharmaceutical composition containing tagged site-antihuman antibody fab fragment complex

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2703785T3 (es) * 2013-04-08 2019-03-12 Regentys Corp Método y composición para tratar una enfermedad inflamatoria intestinal sin colectomía
EP3543337B1 (en) * 2016-11-18 2022-04-20 Astellas Pharma Inc. Novel anti-human muc1 antibody fab fragment
EP3795590A4 (en) 2018-05-17 2022-05-04 Astellas Pharma Inc. COMPLEX WITH ANTI-HUMAN MUC1 ANTIBODY FAB FRAGMENT, PEPTIDE LINKER AND/OR LIGAND

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003027151A1 (en) * 2001-09-25 2003-04-03 Immuno-Biological Laboratories Co., Ltd. Recombinant anti-osteopontin antibody and use thereof
WO2008050907A1 (fr) * 2006-10-26 2008-05-02 Gene Techno Science Co., Ltd. Anticorps dirigé contre rgd dans une séquence d'acides aminés d'une protéine de matrice extracellulaire et procédé de fabrication et utilisation de celui-ci
WO2009131256A1 (en) * 2008-04-24 2009-10-29 Gene Techno Science Co., Ltd. Humanized antibodies specific for amino acid sequence rgd of an extracellular matrix protein and the uses thereof

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5859205A (en) 1989-12-21 1999-01-12 Celltech Limited Humanised antibodies
GB9519667D0 (en) 1995-09-27 1995-11-29 Univ Manchester Pharmaceutical composition
JP2003517284A (ja) 1999-04-15 2003-05-27 チルドレンズ メディカル センター コーポレーション 免疫応答を変調する方法及び組成物
JP2003528322A (ja) 2000-03-23 2003-09-24 グラクソ グループ リミテッド オステオポンチンのインヒビターのスクリーニング方法
JP2007106767A (ja) * 2001-04-05 2007-04-26 Meneki Seibutsu Kenkyusho:Kk 抗オステオポンチン抗体およびその用途
MXPA03009052A (es) 2001-04-05 2004-10-15 Immuno Biological Lab Co Ltd Anticuerpo anti-osteopontina y uso del mismo.
US20070274993A1 (en) 2003-05-23 2007-11-29 Immuno-Biological Laboratories Co., Ltd. Immunocompetent Cell Activation Inhibitor and Use Thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003027151A1 (en) * 2001-09-25 2003-04-03 Immuno-Biological Laboratories Co., Ltd. Recombinant anti-osteopontin antibody and use thereof
WO2008050907A1 (fr) * 2006-10-26 2008-05-02 Gene Techno Science Co., Ltd. Anticorps dirigé contre rgd dans une séquence d'acides aminés d'une protéine de matrice extracellulaire et procédé de fabrication et utilisation de celui-ci
WO2009131256A1 (en) * 2008-04-24 2009-10-29 Gene Techno Science Co., Ltd. Humanized antibodies specific for amino acid sequence rgd of an extracellular matrix protein and the uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP2480665A4 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10829560B2 (en) 2015-04-20 2020-11-10 Consejo Superior De Investigaciones Cientificas Agents binding specifically to human cadherin-17, human cadherin-5, human cadherin-6 and human cadherin-20 RGD motif
US11667724B2 (en) 2017-07-07 2023-06-06 Astellas Pharma Inc. Anti-human CEACAM5 antibody Fab fragment
US12065503B2 (en) 2018-10-10 2024-08-20 Astellas Pharma Inc. Pharmaceutical composition containing tagged site-antihuman antibody fab fragment complex

Also Published As

Publication number Publication date
CA2772230A1 (en) 2011-03-31
US8617829B2 (en) 2013-12-31
KR20120078725A (ko) 2012-07-10
EP2480665A4 (en) 2013-04-03
CN102712921B (zh) 2017-03-01
CA2772230C (en) 2019-01-08
AU2010299017B2 (en) 2014-02-06
IN2012DN01981A (cg-RX-API-DMAC7.html) 2015-07-24
EP2480665A1 (en) 2012-08-01
AU2010299017A1 (en) 2012-03-15
JP2013505702A (ja) 2013-02-21
JP5781504B2 (ja) 2015-09-24
CN102712921A (zh) 2012-10-03
KR101809761B1 (ko) 2017-12-15
US20120219503A1 (en) 2012-08-30

Similar Documents

Publication Publication Date Title
EP2388323B1 (en) Humanized anti-9 integrin antibodies and the uses thereof
AU2010299017B2 (en) Humanized antibodies specific for amino acid sequence RGD of an extracellular matrix protein and the uses thereof
CA2721716C (en) Humanized antibodies specific for amino acid sequence rgd of an extracellular matrix protein and the uses thereof
AU2010221993B2 (en) Generation, expression and characterization of the humanized K33N monoclonal antibody

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080042356.1

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10818939

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2010299017

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2772230

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1981/DELNP/2012

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2010299017

Country of ref document: AU

Date of ref document: 20100922

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2012514276

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 13497692

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2010818939

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2010818939

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20127010432

Country of ref document: KR

Kind code of ref document: A