WO2011034582A2 - Anticorps anti-vih-1 - Google Patents

Anticorps anti-vih-1 Download PDF

Info

Publication number
WO2011034582A2
WO2011034582A2 PCT/US2010/002515 US2010002515W WO2011034582A2 WO 2011034582 A2 WO2011034582 A2 WO 2011034582A2 US 2010002515 W US2010002515 W US 2010002515W WO 2011034582 A2 WO2011034582 A2 WO 2011034582A2
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
cells
antibodies
hiv
infection
Prior art date
Application number
PCT/US2010/002515
Other languages
English (en)
Other versions
WO2011034582A3 (fr
Inventor
Barton F. Haynes
Georgia Tomaras
Shaunna Shen
Dimiter S. Dimitrov
Zhongyu Zhu
Kwan-Ki Hwang
Nicholas Chiorazzi
Original Assignee
Duke University
The Government Of The United States Of America As Represented By The Secretary, Department Of Health And Human Services
The Feinstein Institute For Medical Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Duke University, The Government Of The United States Of America As Represented By The Secretary, Department Of Health And Human Services, The Feinstein Institute For Medical Research filed Critical Duke University
Priority to EP10817555A priority Critical patent/EP2477658A2/fr
Priority to CA2774446A priority patent/CA2774446A1/fr
Priority to JP2012529742A priority patent/JP2013505236A/ja
Priority to AU2010296058A priority patent/AU2010296058A1/en
Publication of WO2011034582A2 publication Critical patent/WO2011034582A2/fr
Publication of WO2011034582A3 publication Critical patent/WO2011034582A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1036—Retroviridae, e.g. leukemia viruses
    • C07K16/1045—Lentiviridae, e.g. HIV, FIV, SIV
    • C07K16/1063—Lentiviridae, e.g. HIV, FIV, SIV env, e.g. gp41, gp110/120, gp160, V3, PND, CD4 binding site
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55—Fab or Fab'
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding

Definitions

  • the present invention relates, in general, to HIV-1 specific antibodies and, in particular, to broadly neutralizing HIV-1 specific antibodies that target the gp41 membrane-proximal external region (MPER).
  • MPER membrane-proximal external region
  • the present invention also relates to a cell culture system, more specifically, to a method of rendering chronic lymphocytic leukemia B-cells immortal and to a method of isolating anti-viral antibodies from clones of such cells.
  • mAbs monoclonal antibodies against gpl 60 have been isolated that can broadly neutralize HIV-1 in vitro, and can protect non-human primates from SHIV infections in vivo (Mascola et al, Nat. Med. 6:207-210 (2000), Baba et al, Nat. Med. 6:200-206 (2000)). These mAbs include antibodies 2F5 and 4E10 against the membrane proximal external region (MPER) of gp41 (Muster et al, J. Virol. 67:6642-6647 (1 93), Stiegler et al, AIDS Res. & Hum. Retro.
  • MPER membrane proximal external region
  • HIV-1 has evolved a number of effective strategies for evasion from neutralizing antibodies, including glycan shielding of neutralizing epitopes (Wei et al, Nature 422:307-312 (2003)), entropic barriers to neutralizing antibody binding (Kwong et al, Nature 420:678-682 (2002)), and masking or diversion of antibody responses by non-neutralizing antibodies (Alam et al, J. Virol. 82: 1 15- 125 (2008)). Despite intense investigation, it remains a conundrum why broadly neutralizing antibodies against either the gpl 20 CD4 binding site or the membrane proximal region of gp41 are not routinely induced in either animals or man.
  • the mAb 2G12 is against carbohydrates that are synthesized and modified by host glycosyltransferases and are, therefore, likely recognized as self carbohydrates (Calarese et al, Proc. Natl. Acad. Sci. USA 102: 13372-13377 (2005)). 2G12 is also a unique antibody with Fabs that assemble into an interlocked VH domain-swapped dimers (Calarese et al, Science 300:2065-2071
  • 2F5 and 4E 10 both have long CDR3 loops, and react with multiple host antigens including host lipids (Zwick et al, J. Virol. 75: 10892-10905 (2001), Alam et al, J. Immun. 178:4424-4435 (2007), Zwick et al, J. Virol. 78:3155-3161
  • IgG lbl 2 also has a long CDR3 loop and reacts with dsD A (Haynes et al, Science 308: 1906-1908 (2005), Saphire et al, Science 293 : 1 155-1 159 (2001)).
  • the present invention results, at least in part, from studies designed to identify 2F5-like mAbs from the patient of Shen et al (J. Virol. 83:3617-25 (2009)) that confer broad neutralizing activity. These studies involved preparing libraries from antibody fragments (scFv, scFab, Fab) displayed on yeast or phage from peripheral blood mononuclear cells (PBMCs) from an HIV-1 infected individual. The libraries were panned and screened with a peptide containing the 2F5 epitope, as well as with gpl40s. Antibodies were identified that bind specifically to the peptide, that binding being competed with 2F5.
  • PBMCs peripheral blood mononuclear cells
  • the present invention relates to HIV-1 specific antibodies. More specifically, the invention relates to broadly neutralizing HIV-1 specific antibodies that target the gp41 MPER, and to methods of using same to both treat and prevent HIV-1 infection. The invention also relates to a method of rendering chronic lymphocytic leukemia B-cells immortal and to a method of isolating antiviral antibodies from clones of such cells.
  • Figure 1 Chronic HIV-1 infections in patients with high levels of bnAbS. Antibodies in peripheral blood from a patient (SC44) with 2F5-like antibodies.
  • FIGS. 4A and 4B IMGT V-Quest analysis of m66 VH and VL.
  • the closet germline V gene segment is aligned with the VH as shown in Fig. 4A and VL as shown in Fig. 4B.
  • the mutation sites differentiated from germline sequences were highlighted in bold font; the frameworks and CDRs also were defined and labeled according to IMGT database.
  • FIGS. 5A and 5B Comparison of m66.6 and 2F5 on binding to both the MPER peptide and JRFL gpl 40 protein through ELISA.
  • FIG. 5A Biotinylated MPER peptide was captured by coated strepatavidin on plate as target for the binding assay.
  • FIG. 5B Purified soluble gpl40 protein was coated directly on plate as target for binding assay.
  • FIG. 7 Phylogenetic tree of m66 variants.
  • Figure 8. Epstein-Barr virus (EBV) transformation of B cells (for B-CLL cells).
  • EBV Epstein-Barr virus
  • Figure 9. Preparation of complete medium.
  • Figure 10. Electro fusion procedure.
  • FIG. 1 EBV-transformation of B-CLL cells and production of monoclonal antibodies.
  • FIGS 12A-12D Comprehensive CLL screening results.
  • the J774A.1 feeder cells enhance growth and production of IgM from B-CLL cells (CLL246) after Epstein Barr virus (EBV) infection. After incubation with EBV, the B-CLL cells were plated at 5,000 cells/well (A) in the absence of J774A.1 cells or (B) in the presence of irradiated J774A.1 cells (50,000 cells/well). Three weeks after infection, levels of IgM were detected by ELISA and expressed in ⁇ g/ml.
  • FIG. 15 A B-CLL cell line, CLL246, produces IgM against both HIV-1 gpl 40 and hepatitis virus C E2 (HCV E2) envelope proteins. IgM against the test antigens was detected by ELISA and expressed in OD.
  • the present invention relates, in one embodiment, to a method of inhibiting infection of cells (e.g., T-cells) of a subject by HIV-1.
  • the invention also relates to a method of controlling the initial viral load and preserving the CD4+ T cell pool and preventing CD4+ T cell destruction.
  • the method comprises administering to the subject (e.g., a human subject) an HIV-1 specific antibody (other than 2F5) that binds the 2F5 epitope, or fragment thereof, in an amount and under conditions such that the antibody, or fragment thereof, inhibits infection.
  • the antibodies can be administered prior to contact of the subject or the subject's immune system/cells with HIV-1 or after infection of vulnerable cells. Administration prior to contact or shortly thereafter can maximize inhibition of infection of vulnerable cells of the subject (e.g., T-cells).
  • One preferred antibody for use in the invention is a mAb having the variable heavy and variable light sequences of the M66 antibody as set forth in Table 1.
  • Libraries were prepared from antibody fragments (scFv, scFab, Fab) displayed on yeast or phage from peripheral blood mononuclear cells (PBMCs) from an HIV-1 infected individual. The libraries were panned and screened with a peptide containing the 2F5 epitope (see Fig. 1 , "QQE NEQELLELD- KWASLWN", as well as with gpl 40s. Antibodies were identified that bound specifically to the peptide, that binding being competed with 2F5. The M66 antibody neutralized four out of four tested isolates from clade B.
  • VH germline variable heavy
  • CDR heavy chain complementary determining region
  • Another preferred antibody for use in the invention is a mAb having the variable heavy and variable light sequences as the M66.6 antibody set forth in Table 3. Details of the identification of the M66.6 antibody are provided in Example 3.
  • either the intact antibody or fragment e.g., antigen binding fragment thereof can be used in the method of the present invention.
  • exemplary functional fragments (regions) include scFv, Fv, Fab', Fab and F(ab') 2 fragments.
  • Single chain antibodies can also be used. Techniques for preparing suitable fragments and single chain antibodies are well known in the art. (See, for example, USPs 5,855,866; 5,877,289; 5,965,132; 6,093,399; 6,261 ,535;
  • the invention also includes variants of the antibodies (and fragments) disclosed herein, including variants that retain the binding properties of the antibodies (and fragments) specifically disclosed, and methods of using same in the present method.
  • the invention includes an isolated human antibody or fragment thereof that binds selectively to gp41 MPER and that comprises one or more CDRs as set forth in Table 2 and Fig. 4.
  • Modifications of M66 and M66.6 that can be used therapeutically in accordance with the invention include IgA, IgM and IgG l , 2, 3 or 4 versions of the M66 M66.6 VH and VL chains.
  • compositions can comprise the antibody (or antibody fragment) dissolved or dispersed in a pharmaceutically acceptable carrier (e.g., an aqueous medium).
  • a pharmaceutically acceptable carrier e.g., an aqueous medium.
  • the compositions can be sterile and can in an injectable form.
  • the antibodies (and fragments thereof) can also be formulated as a composition appropriate for topical administration to the skin or mucosa.
  • Such compositions can take the form of liquids, ointments, creams, gels and pastes. Standard formulation techniques can be used in preparing suitable compositions.
  • the antibodies can be formulated so as to be administered as a post-coital douche or with a condom.
  • the antibodies and antibody fragments of the invention show their utility for prophylaxis in, for example, the following settings: i) in the setting of anticipated known exposure to HIV-1 infection, the antibodies described herein (or binding fragments thereof) can be administered prophylactically (e.g., IV or topically) as a microbiocide,
  • the antibodies described herein in the setting of known or suspected exposure, such as occurs in the setting of rape victims, or commercial sex workers, or in any heterosexual transmission with out condom protection, can be administered as post-exposure prophylaxis, e.g., IV or topically,
  • antibodies described herein in the setting of Acute HIV infection (AHI) can be administered as a treatment for AHI to control the initial viral load and preserve the CD4+ T cell pool and prevent CD4+ T cell destruction, and
  • Suitable dose ranges can depend, for example, on the antibody and on the nature of the formulation and route of administration. Optimum doses can be determined by one skilled in the art without undue experimentation. Doses of antibodies in the range of 1 Ong to 20 ⁇ g ml can be suitable.
  • the present invention provides a cell culture system that makes possible the production of monoclonal anti-viral antibodies from B-chronic lymphocytic leukemia (B-CLL) cell repertoires.
  • B-CLL B-chronic lymphocytic leukemia
  • macrophage cells are used as feeder cells to grow B-CLL cells in culture following EBV-infection.
  • a protocol suitable for use in generating immortalized clones of B-CLL cells is set forth in Figure 8.
  • a macrophage cell line e.g., a rodent macrophage cell line
  • a preferred macrophage cell line is the mouse line J774A.1.
  • J774A.1 macrophage cells have been shown to produce growth factors suitable for hybridoma growth and cloning (Rathjen and Geczy, Hybridoma 5:255-261 (1986)).
  • Conditioned medium prepared from J774A.1 cells has been widely used for enhancing hybridoma viability.
  • the macrophage cell line is subjected to irradiation to prevent outgrowth of the feeder cells.
  • the optimum ⁇ -irradiation dose can be determined experimentally, for example, by testing the cell line to determine the minimum dose required to completely inhibit cell proliferation (e.g., about 4,000 Rad).
  • the irradiated cells can then be distributed into culture containers (for example, when 96-well plates are used, about 50,000 cells can distributed/well (about 100 ⁇ /well)).
  • the optimum number of irradiated cells can be determined experimentally by testing the cells at different densities.
  • EBV infection of B-CLL cells can be effected using standard techniques.
  • peripheral blood mononuclear cells PBMCs
  • PBMCs peripheral blood mononuclear cells
  • PS 2006 a Tolllike receptor 9 (TLR-9) agonist
  • TLR-9 Tolllike receptor 9
  • Cyclosporin A can be added to suppress any EBV-B cell-specific cytotoxic T cell response.
  • Optimal concentrations can be determined
  • an EBV suspension is then added to the cell suspension.
  • the EBV-infected cells can be resuspended in complete medium comprising, for example, PS2006, distributed into the culture container with the irradiated macrophage cells and incubated at about 37°C.
  • the medium can be changed periodically and antibody production assessed using, for example, ELISA when the EBV-infected cells have grown sufficiently (e.g., about 3-about 4 weeks post-infection).
  • IgM producing hybridoma cell lines derived from CLL cells can then be produced, for example, using a hybridoma cell fusion method, such as that described in Fig. 10, and cloned.
  • a hybridoma cell fusion method such as that described in Fig. 10, and cloned.
  • Fig. 1 1 Three monoclonal B-CLL hybridoma cell lines have been derived from CLL246 (VH1 -69, unmutated case), CLL1075 (VH1 -69, mutated case), and CLL493 (VH1-69, unmutated case).
  • Therapeutic antibodies e.g., anti-HIV antibodies, anti-hepatitis C antibodies or anti-influenza antibodies
  • B-CLL cells immortalized in accordance with the method described above, or fragments thereof e.g., antigen binding fragments - exemplary functional fragments (regions) include scFv, Fv, Fab', Fab and F(ab') 2 fragments
  • a composition e.g., a pharmaceutical composition
  • Suitable compositions can comprise the antibody (or antibody fragment) dissolved or dispersed in a pharmaceutically acceptable carrier (e.g., an aqueous medium).
  • the compositions can be sterile and can be in an injectable form.
  • the antibodies (and fragments thereof) can also be formulated as a composition appropriate for topical administration to the skin or mucosa.
  • Such compositions can take the form of liquids, ointments, creams, gels, pastes or aerosols. Standard formulation techniques can be used in preparing suitable compositions.
  • anti-HIV antibodies and fragments thereof show their utility for prophylaxis in, for example, the following settings:
  • the antibodies described herein can be administered prophylactically (e.g., IV or topically) as a microbiocide,
  • the antibodies described herein in the setting of known or suspected exposure, such as occurs in the setting of rape victims, or commercial sex workers, or in any heterosexual transmission with out condom protection, can be administered as post-exposure prophylaxis, e.g., IV or topically,
  • antibodies described herein in the setting of Acute HIV infection (AHI) can be administered as a treatment for AHI to control the initial viral load and preserve the CD4+ T cell pool and prevent CD4+ T cell destruction, and
  • Anti-hepatitis C and anti -influenza antibodies, or fragments thereof as described above, can be used to treat or prevent hepatitis C and influenza infection, respectively.
  • Suitable dose ranges can depend, for example, on the antibody, on the nature of the formulation, on the route of administration, and on the patient (e.g., a human patient). Optimum doses can be determined by one skilled in the art without undue experimentation. Doses of antibodies in the range of l Ong to 20 ⁇ g/ml can be suitable.
  • IgM and IgG libraries from a patient with acute infection and a patient with 2F5-like antibodies were generated and analyzed by high throughput (454) sequencing and other methods.
  • HIV- 1 -specific antibodies from IgG libraries derived from the blood of an acutely infected patient at two time points (40 days and 8 months) were identified. These antibodies bound envelope glycoproteins (Envs) with high affinity but did not neutralize a panel of 9 pseudo viruses.
  • Antibodies from samples at 40 days were not found at 8 months and antibodies from samples at 8 months did not bind a dominant Env at 40 days. Panning of bone marrow derived libraries from the same patient did not result in selection of any antibodies.
  • Novel antibodies were selected from IgM+IgG phage and yeast display libraries derived from a patient with 2F5-like antibodies.
  • One of these antibodies, M66 has long (23 residues) heavy chain CDR3 and its VH gene has relatively low number of somatic mutations. It bound specifically to a gp41 MPER peptide containing the 2F5 epitope and cross-reactively neutralized HIV-1 isolates. The other antibodies are being characterized. These results could have implications for understanding humoral immune responses and design of vaccine immunogens. (See Figs. 1 and 2.)
  • cDNA was prepared using the total RNA extracted from PBML taken from Patient SC44 at 12 month after enrollment (Shen et al, J. Virol. 83 :3617-25 (2009)). HIV-1 gp41 MAbs 2F5 was obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIA1D, NIH (Hermann
  • Phage display Fab libraries were constructed primarily following a published protocol (Zhu et al, Methods Mol. Biol. 525: 129-42, xv (2009)) using the cDNA prepared from PBMC of patient SC44 as template for the antibody gene repertoire cloning. Sequential pannings were performed using biotinylated Peptide SP62 and gpl40 proteins with the first three rounds of panning on ⁇ ig of biotinylated peptide on streptavidin conjugated magnetic bead and the fourth and fifth pannings on gpl 40 (JRFL) coated at l ug/well on 96 well ELISA plates. Bound phage on the beads or plate wells were directly used to infect
  • the Fd fragment of m66 Fab construct was PCR amplified and fused with the light chain gene repertoire obtained during the original Fab library
  • Antigens for capturing the biotinylated peptide or gpl40 were coated on narrow-well, 96-well plate at 50 ng/well in PBS overnight at 4°C.
  • phage ELISA 10 10 phage from each round of panning was incubated with antigen. Bound phage was detected with anti-M13- HRP polyclonal antibody (Pharmacia, Piscataway, J).
  • anti-Flag HRP conjugate was used to detect the binding.
  • IgGl binding ELISA HRP conjugated goat anti-human IgG antibodies was used for detecting.
  • Viruses pseudotyped with HIV-1 Envs were prepared by cotransfection of 70-80% confluent 293T cells with pNL4-3.luc.E-R- and pSV7d constructs encoding HIV-1 Envs (a gift from G. Quinnan, USUHS, Bethesda, MD) by using the PolyFect transfection reagent (Qiagen) according to manufacturer's
  • Pseudotyped viruses were obtained after 24 h by centrifugation and filtration of cell culture through 0.45- ⁇ filters. For neutralization, viruses were mixed with different concentrations of antibodies for 1 h at 37 °C, and then the mixture was added to -1.5 ⁇ 10 4 HOS-CD4-CCR5 (used for all R5 and dual tropic viruses) or HOS-CD4-CXCR4 cells grown in each well of 96-well plates. Luminesence was measured after 48 h by using the Bright-Glo Luciferase Assay System (Promega, Madison, WI) and a LumiCount microplate luminometer (Turner Designs). Mean relative light units (RLU) for duplicate wells were determined. Percentage inhibition was calculated by the following formula: (1 - average RLU of antibody-containing wells/average RLU of virus-only wells) ⁇ 100.
  • Neutralization of HIV-1 in the PBMC assay was measured as a reduction in LucR reporter gene expression after multiple rounds of virus replication.
  • Virus was incubated with serial 3-fold dilutions of test sample (eight dilutions total) in duplicate in a total volume of 150 ⁇ of IL-2-containing growth medium for 1 h at 37°C in a 96-well U-bottom culture plate.
  • One-day-old PHA-PBMCs (2 ⁇ 10 5 cells in 50 ⁇ of IL-2 -containing growth medium) were added to each well.
  • One set of control wells received cells plus virus (virus control) and another set received cells only (background control).
  • TZM bl cells and TZM-bl cells expressing FcyRI based pseudovirus neutralization assay was previously described in Perez et al (J. Virol.
  • IgG-derived Fd fragments were PCR amplified by using the cDNA isolated from the patient as a template.
  • the sense primers used were described previously (Zhu et al, Methods Mol. Biol. 525: 129-42, xv (2009)); the antisense primer was IgGR (5'-
  • the PCR was performed in a volume of 50 ⁇ for 25 cycles.
  • the products were gel-purified and then used as a template for additional 12 cycles of secondary PCR amplification with primers (HF12: 5'- CCATCTCATCCCTGCGTGTCTCCGACTCAGTACTGAGCTAGCTGCCCA ACCAGCCATGGCC-3 ' and HR2:
  • m66 VH is derived from VH51 -1 V gene, there are 8 mutations in the heavy chain V gene segment; m66VL is derived from VK-1 -39 , there are 3 mutation in the light chain V gene segment.
  • m66 VH and VL bear a significantly lower number of mutations from their germline predecessors, which might indicate m66 is still in the early stage of the antibody maturation process. It was observed that the heavy chain CDR3 has 23 residues with multiple tyrosines and one phenylalanine.
  • light chain shuffling library with size at 2x10 was constructed as described above.
  • a chain shuffling library was panned two rounds against MPER peptide followed by Phage ELISA screening using g l40 protein as target.
  • Six unique clones were identified which share the same heavy chain as expected but paired with different light chains with several mutations from the same VL subfamily. ELISA data showed they all bind similarly well to both the peptide and gpl40 (data not shown).
  • one which has 9 mutations in the light chain V gene segment was designated as m66.6 and converted to IgG l for further characterization. Specific binding of m66 to both MPER peptide and gpl40
  • m66.6 and 2F5 IgGl s bind equally well to both the MPER peptide and JRFL gpl40 protein, overall, the neutralization potency of m66.6 is less than that of 2F5 in this set of neutralization assay.
  • ' Values are the concentration ( ⁇ g/ml) at which relative luminescence units (RLUs) were reduced 50% compared to virus control wells (no test sample).
  • VH germline gene segments from each of 7 VH subfamilies namely VH 1 -69, VH2-5, VH3-23, VH4-1 , VH51 -1 , VH6- 1 and VH7-l were used as probes to do similarity search against the whole VH gene repertoire. All the sequences from each search were ranked according to the similarity to the probes and were plotted against the similarity percentages and 7 probes as shown in Fig. 6. It was found that VH51 -1 derived genes were disproportionally expanded in this repertoire at the specific time point when the blood sample was taken in this patient.
  • J774A.1 feeder cells enhance growth and production of IgM from B-CLL cells (CLL246) after Epstein Barr virus (EBV) infection. After incubation with EBV, the B-CLL cells were plated at 5,000 cells/well (A) in the absence of J774A.1 cells or (B) in the presence of irradiated J774A.1 cells (50,000 cells/well). Three weeks after infection, levels of IgM were detected by ELISA and expressed in ⁇ g ml.
  • the CLL246 cells produce IgM against both HIV-1 gpl40 and hepatitis virus C E2 (HCV E2) envelope proteins. IgM against the test antigens was detected by ELISA and expressed in OD. (See also Fig. 16.)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • AIDS & HIV (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Oncology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Hematology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Communicable Diseases (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne, en général, des anticorps spécifiques de VIH-1, et en particulier des anticorps spécifiques de VIH-1 à neutralisation large qui ciblent la région externe proximale de la membrane (MPER) de gp41. La présente invention concerne également un système de culture cellulaire, plus spécifiquement un procédé pour immortaliser des lymphocytes B de leucémie lymphoïde chronique et un procédé d'isolement d'anticorps antiviraux à partir de clones de telles cellules.
PCT/US2010/002515 2009-09-16 2010-09-16 Anticorps anti-vih-1 WO2011034582A2 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP10817555A EP2477658A2 (fr) 2009-09-16 2010-09-16 Anticorps anti-vih-1
CA2774446A CA2774446A1 (fr) 2009-09-16 2010-09-16 Anticorps anti-vih-1
JP2012529742A JP2013505236A (ja) 2009-09-16 2010-09-16 Ｈｉｖ−１抗体
AU2010296058A AU2010296058A1 (en) 2009-09-16 2010-09-16 HIV-1 antibodies

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US27234909P 2009-09-16 2009-09-16
US61/272,349 2009-09-16
US24879609P 2009-10-05 2009-10-05
US61/248,796 2009-10-05

Publications (2)

Publication Number Publication Date
WO2011034582A2 true WO2011034582A2 (fr) 2011-03-24
WO2011034582A3 WO2011034582A3 (fr) 2011-09-15

Family

ID=43759219

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/002515 WO2011034582A2 (fr) 2009-09-16 2010-09-16 Anticorps anti-vih-1

Country Status (5)

Country Link
EP (1) EP2477658A2 (fr)
JP (1) JP2013505236A (fr)
AU (1) AU2010296058A1 (fr)
CA (1) CA2774446A1 (fr)
WO (1) WO2011034582A2 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3271022A4 (fr) * 2015-03-19 2018-10-31 Duke University Anticorps neutralisant le vih-1 et leurs utilisations
WO2020010107A1 (fr) 2018-07-03 2020-01-09 Gilead Sciences, Inc. Anticorps se liant spécifiquement à la gp120 du vih pd-1 et leurs methodes d'utilisation
WO2021011544A1 (fr) 2019-07-16 2021-01-21 Gilead Sciences, Inc. Vaccins contre le vih et leurs procédés de fabrication et d'utilisation
US11071783B2 (en) 2015-03-19 2021-07-27 Duke University HIV-1 neutralizing antibodies and uses thereof
WO2022046644A1 (fr) 2020-08-25 2022-03-03 Gilead Sciences, Inc. Molécules de liaison à un antigène multi-spécifiques ciblant le vih et méthodes d'utilisation
WO2022087149A2 (fr) 2020-10-22 2022-04-28 Gilead Sciences, Inc. Protéines de fusion d'interleukine-2-fc et méthodes d'utilisation
WO2024015741A1 (fr) 2022-07-12 2024-01-18 Gilead Sciences, Inc. Polypeptides immunogènes du vih et vaccins et utilisations de ceux-ci
WO2024097957A1 (fr) * 2022-11-03 2024-05-10 Duke University Nouveaux anticorps contre le vih et leurs procédés de fabrication et d'utilisation

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020081723A1 (en) * 1995-06-07 2002-06-27 Peter Brams Neutralizing high affinity human monoclonal antibodies specific to rsv f-protein and methods for their manufacture and theraputic use thereof
US20040198661A1 (en) * 2000-12-08 2004-10-07 Bowdish Katherine S. Polypeptides and antibodies derived from chronic lymphocytic leukemia cells and uses thereof
WO2006110831A2 (fr) * 2005-04-12 2006-10-19 Duke University Methode pour induire des anticorps neutralisant le virus de l'immunodeficience humaine

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020081723A1 (en) * 1995-06-07 2002-06-27 Peter Brams Neutralizing high affinity human monoclonal antibodies specific to rsv f-protein and methods for their manufacture and theraputic use thereof
US20040198661A1 (en) * 2000-12-08 2004-10-07 Bowdish Katherine S. Polypeptides and antibodies derived from chronic lymphocytic leukemia cells and uses thereof
WO2006110831A2 (fr) * 2005-04-12 2006-10-19 Duke University Methode pour induire des anticorps neutralisant le virus de l'immunodeficience humaine

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
VIDAR WENDEL-HANSEN ET AL.: 'Epstein-Barr virus (EBV) can immortalize B-CLL cells activated by cytokines.' LEUKEMIA vol. 8, no. 3, 1994, pages 476 - 484, XP008154323 *
XIAOYING SHEN ET AL.: 'In vivo gp41 antibodies targeting the 2F5 monoclonal antibody epitope mediate human immunodeficiency virus type 1 neutralization breadth.' JOURNAL OF VIROLOGY vol. 83, no. 8, April 2009, pages 3617 - 3625, XP008154322 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3271022A4 (fr) * 2015-03-19 2018-10-31 Duke University Anticorps neutralisant le vih-1 et leurs utilisations
US11071783B2 (en) 2015-03-19 2021-07-27 Duke University HIV-1 neutralizing antibodies and uses thereof
AU2016232693B2 (en) * 2015-03-19 2021-08-12 Duke University HIV-1 neutralizing antibodies and uses thereof
US11944681B2 (en) 2015-03-19 2024-04-02 Duke University HIV-1 neutralizing antibodies and uses thereof
WO2020010107A1 (fr) 2018-07-03 2020-01-09 Gilead Sciences, Inc. Anticorps se liant spécifiquement à la gp120 du vih pd-1 et leurs methodes d'utilisation
EP4257600A2 (fr) 2018-07-03 2023-10-11 Gilead Sciences, Inc. Anticorps se liant spécifiquement à la gp120 du vih pd-1 et leurs methodes d'utilisation
WO2021011544A1 (fr) 2019-07-16 2021-01-21 Gilead Sciences, Inc. Vaccins contre le vih et leurs procédés de fabrication et d'utilisation
WO2022046644A1 (fr) 2020-08-25 2022-03-03 Gilead Sciences, Inc. Molécules de liaison à un antigène multi-spécifiques ciblant le vih et méthodes d'utilisation
WO2022087149A2 (fr) 2020-10-22 2022-04-28 Gilead Sciences, Inc. Protéines de fusion d'interleukine-2-fc et méthodes d'utilisation
WO2024015741A1 (fr) 2022-07-12 2024-01-18 Gilead Sciences, Inc. Polypeptides immunogènes du vih et vaccins et utilisations de ceux-ci
WO2024097957A1 (fr) * 2022-11-03 2024-05-10 Duke University Nouveaux anticorps contre le vih et leurs procédés de fabrication et d'utilisation

Also Published As

Publication number Publication date
JP2013505236A (ja) 2013-02-14
AU2010296058A1 (en) 2012-05-03
CA2774446A1 (fr) 2011-03-24
EP2477658A2 (fr) 2012-07-25
WO2011034582A3 (fr) 2011-09-15

Similar Documents

Publication Publication Date Title
US20120269821A1 (en) Hiv-1 antibodies
McCoy et al. Potent and broad neutralization of HIV-1 by a llama antibody elicited by immunization
Tudor et al. HIV-1 gp41-specific monoclonal mucosal IgAs derived from highly exposed but IgG-seronegative individuals block HIV-1 epithelial transcytosis and neutralize CD4+ cell infection: an IgA gene and functional analysis
WO2011034582A2 (fr) Anticorps anti-vih-1
Xiao et al. Germline-like predecessors of broadly neutralizing antibodies lack measurable binding to HIV-1 envelope glycoproteins: implications for evasion of immune responses and design of vaccine immunogens
CN102272158B (zh) 源自记忆b细胞的人单克隆抗体的快速表达克隆
WO2016149710A2 (fr) Anticorps neutralisant le vih-1 et leurs utilisations
EP2788026A2 (fr) Immunogènes v1v2
Choudhry et al. Cross-reactive HIV-1 neutralizing monoclonal antibodies selected by screening of an immune human phage library against an envelope glycoprotein (gp140) isolated from a patient (R2) with broadly HIV-1 neutralizing antibodies
US20070292390A1 (en) Broadly Cross-Reactive Hiv-1 Neutralizing Human Monoclonal Antibodies
US20150252099A1 (en) High affinity human antibodies to human cytomegalovirus (cmv) gb protein
WO2011092593A2 (fr) Anticorps neutralisant le vih-1 et leurs utilisations
EP3110844B1 (fr) Anticorps monoclonaux neutralisants à large spectre contre la région v1v2 env du vih-1
Sun et al. Brief introduction of current technologies in isolation of broadly neutralizing HIV-1 antibodies
CN110483636B (zh) 人源抗HIVgp120特异性抗体Z166及其应用方法
EP0577243A2 (fr) Anticorps monoclonaux recombinants, neutralisant le HIV pour la prévention et traitement des infections du HIV
Dorgham et al. Immunogenicity of HIV type 1 gp120 CD4 binding site phage mimotopes
Yang et al. Identification of non-HIV immunogens that bind to germline b12 predecessors and prime for elicitation of cross-clade neutralizing HIV-1 antibodies
Yuan et al. Putative rhesus macaque germline predecessors of human broadly HIV-neutralizing antibodies: Differences from the human counterparts and implications for HIV-1 vaccine development
CN107383190B (zh) 人源抗HIV gp41特异性抗体及其应用
Houimel et al. Isolation and characterization of human neutralizing antibodies to rabies virus derived from a recombinant immune antibody library
WO2018053328A1 (fr) Molécules bispécifiques comprenant un bras ciblant l'enveloppe du vih-1
Wrotniak et al. Antibody dependent cell cytotoxicity is maintained by the unmutated common ancestor of 6F5, a Gp41 conformational epitope targeting antibody that utilizes heavy chain VH1-2
Li et al. N-terminal residues of an HIV-1 gp41 membrane-proximal external region antigen influence broadly neutralizing 2F5-like antibodies
US20240228595A1 (en) Methods for Monoclonal Antibody Generation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10817555

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2012529742

Country of ref document: JP

Ref document number: 2774446

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2010817555

Country of ref document: EP

NENP Non-entry into the national phase in:

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2010296058

Country of ref document: AU

ENP Entry into the national phase in:

Ref document number: 2010296058

Country of ref document: AU

Date of ref document: 20100916

Kind code of ref document: A