WO2011009975A2 - Method for detecting and identifying species of the family engraulidae - Google Patents

Method for detecting and identifying species of the family engraulidae Download PDF

Info

Publication number
WO2011009975A2
WO2011009975A2 PCT/ES2010/000314 ES2010000314W WO2011009975A2 WO 2011009975 A2 WO2011009975 A2 WO 2011009975A2 ES 2010000314 W ES2010000314 W ES 2010000314W WO 2011009975 A2 WO2011009975 A2 WO 2011009975A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
species
engraulis
identification
sequence
Prior art date
Application number
PCT/ES2010/000314
Other languages
Spanish (es)
French (fr)
Other versions
WO2011009975A3 (en
Inventor
Laureana REBORDINOS GONZÁLEZ
Hicham Chairi
Original Assignee
Universidad De Cádiz
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universidad De Cádiz filed Critical Universidad De Cádiz
Publication of WO2011009975A2 publication Critical patent/WO2011009975A2/en
Publication of WO2011009975A3 publication Critical patent/WO2011009975A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates, in a broad sense, to the genetic analysis of different species of the Engraulidae family through specific primers and specifically to a method for the simultaneous detection and identification of the Engraulis encrasicolus, Engraulis mordax and Engraulis ringens species by means of use of PCR techniques for the amplification of the sequence of the non-transcribed space of the 5S rDNA.
  • Anchovy or anchovy, Engraulis encrasicolus is a species distributed in the Mediterranean and on the eastern Atlantic coasts, from Norway to Angola. It is an objective species of commercial fisheries in Spain and therefore has been subject to overfishing, which raises the need to establish a management and conservation program for this resource.
  • One of these programs is
  • Trachurus trachurus (Atlantic horse mackerel) and Trachurus mediterraneus (Mediterranean horse mackerel).
  • the authors of the present invention after an important research work, have developed a method that allows to detect and identify simultaneously 3 species of anchovy, one European (Engraulis encrasicolus) and two American (Engraulis mordax and Engraulis r ⁇ ngens ) with a simple technique, such as multiplex PCR, in a single step, which amplifies the sequence of the non-transcribed spacer of the 5S rDNA, using species-specific primers designed for this purpose and using a single sample of the fish or the processed product.
  • This method allows to ensure the authenticity of anchovy-based foods (E. encrasicolus) against those based on other American species, allowing initiatives such as designations of origin.
  • Ribosomal DNA is a DNA sequence contained in the chromosomes of the nucleolus that encodes ribosomal RNA. These sequences regulate the transcription and initiation of the amplification. It consists of numerous repeating units separated from each other by an intergenic spacer.
  • the 5S rDNA repeating unit is composed of a highly conserved 120 bp coding region and a non-transcribed space (NTS) that presents great variability in size and sequence, which makes it a very useful tool for comparing closely related species .
  • NTS non-transcribed space
  • the use of the non-transcribed spacer of the 5s rDNA sequence as a genetic marker for the detection and identification of these species allows to develop a faster and more reliable method than those previously performed.
  • the characteristics of the method of the invention allow the traceability of these species to be carried out quickly and efficiently, thus solving the problems of labeling errors. of processed products (filleting, packaging, etc.), as well as the fraudulent sale of them.
  • the object of the invention is a method for the simultaneous detection and identification in a sample of the presence or absence of at least one of the species of the Engraulidae family, selected from Engraulis encrasicolus, Engraulis mordax and Engraulis rhinogens, by PCR amplification of at least one of the corresponding sequences with the non-transcribed spacer (NTS) of the 5S ribosomal DNA of these three species.
  • NTS non-transcribed spacer
  • NTS non-transcribed spacer
  • each of the primers used in the amplification of the non-transcribed spacer of the 5S ribosomal DNA of each of the aforementioned species of sequences SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8 and SEQ ID NO 9.
  • Figure 1 Summary scheme of the identification process among the 3 anchovy species by multiplex PCR with specific primers.
  • Figure 2 Location of the specific primers (SEQ ID NO 4 and SEQ ID NO 5) in the NTS sequence of the 5S rDNA of E. encrasicolus.
  • Figure 3 Location of the specific primers (SEQ ID NO 6 and SEQ ID NO 7) in the NTS sequence of the 5S rDNA of E. mordax.
  • Figure 4 Location of the specific primers (SEQ ID NO 8 and SEQ ID NO 9) in the NTS sequence of the 5S rDNA of E. ringens.
  • the present invention faces the problem of detecting and simultaneously identifying in a sample the presence of up to three species of the Engraulidae family (E. encrasicolus, E. mordax and E. ringens) quickly, specifically and efficiently.
  • NTS non-transcribed spacer
  • 5S ribosomal DNA as a genetic marker of these species and in the design of three pairs of species-specific primers that amplify said sequence in each species, obtaining differential amplified product bands depending on the species / s present in the sample.
  • the 5S ribosomal gene repeat unit is formed by a coding region of 120 bp and a non-transcribed spacer (NTS) of variable length and sequence.
  • NTS non-transcribed spacer
  • a main aspect of the invention refers to the method for the simultaneous detection and identification in a sample of at least one of the species of the Engraulidae family selected from among Engraulis encrasicolus, Engraulis mordax and Engraulis ringens, by PCR amplification of at minus one of the sequences, selected from SEQ ID NO 1, 2 and 3, corresponding, respectively, with the non-transcribed spacer (NTS) of the 5S ribosomal DNA of the cited species (hereinafter, method of the invention).
  • NTS non-transcribed spacer
  • each of the isolated sequences corresponding to the NTS of the 5S rDNA of each of the cited species used as genetic markers in the method of the invention is contemplated.
  • an isolated DNA molecule that corresponds to the sequence of the non-transcribed spacer of the 5S ribosomal DNA of the Engraulis encrasicolus species, shown in SEQ ID NO 1; a molecule of
  • sample means both a sample of a fish, fresh or frozen, (in which one or none of the species would be detected) and a sample of a processed product (where they could detect and identify up to all 3 species simultaneously).
  • Processed product means those products, fresh or frozen, made from anchovies.
  • Non-limiting examples of “processed products” are canned fillets, food stuffed with anchovy paste, anchovy pate, etc.
  • the PCR used to carry out the amplification of the method of the invention is a multiplex PCR in a single step, which allows to simultaneously employ as many primers as necessary, in this case the three pairs of primers, instead of only one as in the standard PCR, Io which allows the simultaneous detection and identification of the presence or absence of the three species cited in the present invention, from a single sample.
  • the DNA extraction from the sample can be carried out by means of any DNA extraction kit known in the state of the art.
  • PCRs have been designed that can be performed in a wide range of conditions. Any reaction mixture of those usually used in PCR will give good results, although in preferred embodiments of the invention final concentrations of 10ng of genomic DNA, 3mM of MgCI 2 , 200 ⁇ M dNTP's, 0.2 ⁇ M of each primer and 2U of the enzyme polymerase are used Taq.
  • any normal thermal cycler can be used, although in particular embodiments of the invention a Gene Amp ® PCR System 2700 thermal cycler and times are used
  • the use of the combination of sequence primers SEQ ID NO 4 and SEQ ID NO 5 is contemplated, for the amplification of a 599 bp fragment, specific to Engraulis encrasicolus.
  • Another particular embodiment of the method of the present invention refers to the use of the combination of sequence primers SEQ ID NO 6 and SEQ ID NO 7, for the amplification of a fragment of 382 bp, specific to Engraulis mordax.
  • Another particular embodiment of the method of the present invention refers to the use of the combination of sequence primers SEQ ID NO 8 and SEQ ID NO 9, for the amplification of a 250 bp fragment, specific to Engraulis ringens.
  • the sequencing of the NTS of the studied species and their subsequent alignments have revealed polymorphic sites in the different sequences and specific to each species, which has allowed to design these specific species primers that allow the identification of each of these species and the differentiation between them simultaneously in a single step.
  • an oligonucleotide is contemplated, with sequence shown in SEQ ID NO 4, for use as a primer in the detection and identification of the Engraulis encrasicolus species.
  • an oligonucleotide is contemplated, with sequence shown in SEQ ID NO 5, for use as a primer in the detection and identification of the Engraulis encrasicolus species.
  • an oligonucleotide is contemplated, with sequence shown in SEQ ID NO 6, for use as a primer in the detection and identification of the Engraulis mordax species.
  • an oligonucleotide is contemplated, with sequence shown in SEQ ID NO 7, for use as a primer in the detection and identification of the Engraulis mordax species.
  • an oligonucleotide is contemplated, with sequence shown in SEQ ID NO 8, for use as a primer in the detection and identification of the Engraulis ringens species.
  • an oligonucleotide is contemplated, with sequence shown in SEQ ID NO 9, for use as a primer in the detection and identification of the Engraulis ringens species.
  • the method of the present invention is faster and more reliable than those previously described in the state of the art.
  • kits for carrying out the method of detection and identification of at least one of the aforementioned species, described in the present invention which comprises a solution formed by at least one of the pairs of primers selected from SEQ ID NO 4 and SEQ ID NO 5; SEQ ID NO 6 and SEQ ID NO 7; and SEQ ID NO 8 and SEQ ID NO 9.
  • the sequence analysis of the 5S rDNA gene has been carried out in the Engraulis encrasicolus species of the Gulf of Cádiz, Engraulis mordax of Baja California in
  • the 5S rDNA gene was amplified with the 5S1F universal primers (5'- TACGCCCGATCTCGTCCGATC-S 1 ) (SEQ ID NO 13) and 5S2R (5'- CAGGCTGGTATGGCCGTAAGC- 3 ') (SEQ ID NO 14) described by Céspedes et al., (1999) designed to join with opposite orientation to a region of the 5S coding area.
  • 5S1F universal primers 5'- TACGCCCGATCTCGTCCGATC-S 1
  • 5S2R 5'- CAGGCTGGTATGGCCGTAAGC- 3 '
  • the PCR was performed in a final volume of 50 ⁇ l, containing 4 ⁇ l of genomic DNA, 3mM of MgCI2, 200 ⁇ M dNTP's, 0.2 ⁇ M of each primer, 2U of the Taq polymerase enzyme (Euro-Clone, Italy) and the appropriate buffer for the enzyme .
  • the reaction was carried out by an initial cycle of 5 min at 94 0 C and 35 cycles of 45 sec at 94 0 C, 45 sec at 59 0 C and 1 min at 72 0 C, and a final extension of 10 min at 72 0 C.
  • the products were visualized on a 2% agarose gel with ethidium bromide (0.5 ⁇ g / ml) after an electrophoresis of 1.5h at 8OV.
  • the DNA bands were observed in the gels by ultraviolet light and the size of the bands was determined by the molecular weight marker.
  • the PCR products obtained were purified by the Nucleospin kit
  • the transformation of competent bacteria of high efficiency JM109 was carried out by a thermal shock of 42 0 C for 45 sec. Once plated with LB / ampicillin / YPTG / X-Gal medium, white colonies were selected, which contain the cloned PCR product. Finally, plasmids were extracted and purified from the selected colonies by NucleoSpin® Plasmid QuickPure Kit (Macherey-Nagel) and were sequenced using T7 and SP6 promoters of RNA polymerase.
  • Sequencing was carried out by means of a sequencing kit (BigDye Terminator v 3.1 Cycle Sequencing Kit; Applied Biosystems) in an automatic sequencer in the Genomics Unit of the Central Service of
  • E.mordax and E.ringens are shown in SEQ ID NO 10, SEQ ID NO 11 and SEQ ID NO 12. Sequence peaks were analyzed with the Chromas program
  • E. mordax E.M1F (TGAAAAGACATTCTCACGTTGTG) (forward) (SEQ ID NO 6) and E.M2R (ACGGTCCTCCTCTCACAGTC) (reverse) (SEQ ID NO 5); for E. mordax: E.M1F (TGAAAAGACATTCTCACGTTGTG) (forward) (SEQ ID NO 6) and E.M2R (ACGGTCCTCCTCTCACAGTC) (reverse) (SEQ ID NO 5); for E. mordax: E.M1F (TGAAAAGACATTCTCACGTTGTG) (forward) (SEQ ID NO 6) and E.M2R (ACGGTCCTCCTCTCACAGTC) (reverse) (SEQ ID NO 5); for E. mordax: E.M1F (TGAAAAGACATTCTCACGTTGTG) (forward) (SEQ ID NO 6) and E.M2R (ACGGTCCTCCTCTCACAGTC) (reverse) (SEQ
  • FIGS 2, 3 and 4 show the location of these primers.
  • the reaction was carried out by an initial cycle of 5 min at 94 0 C and 35 cycles of 45 sec at 94 0 C, 45 sec at 59 0 C and 1 min at 72 0 C, and a final extension of 10 min at 72 0 C.
  • the products were visualized on a 1.5% agarose gel with ethidium bromide (0.5 ⁇ g / ml) after an electrophoresis of 1h at 80 V.
  • the DNA bands are observed in the gels by ultraviolet light and the size of the bands is determined by the molecular weight marker.
  • the PCR products were purified with the kit described above and directly sequenced in the SCAI of the University of Córdoba using the same primers to verify that the amplified products were the same as those previously designed. These primers not only indicated the presence or absence of amplification, but also allowed to differentiate the size of the products, which facilitated once again the reading of the results.
  • the scheme in Figure 1 summarizes the entire process and the final result.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Method for detecting and identifying species of the family Engraulidae. The present invention relates to a method for the simultaneous detection and identification in a sample of at least one of the species of the family Engraulidae selected from Engraulidis encrasicolus, Engraulis mordax and Engraulis ringens, by multiplex PCR amplification of at least one of the sequences selected from SEQ ID NO 1, SEQ ID NO 2 and SEQ ID NO 3, corresponding to the non-transcribed spacer (NTS) of the 5S ribosomal DNA of at least one of the 3 species, using at least one of the pairs of sequence primers selected from: SEQ ID NO 4 and SEQ ID NO 5; SEQ ID NO 6 and SEQ ID NO 7; and SEQ ID NO 8 and SEQ ID NO 9.

Description

MÉTODO PARA LA DETECCIÓN E IDENTIFICACIÓN DE ESPECIES DE LA METHOD FOR DETECTION AND IDENTIFICATION OF SPECIES OF THE
FAMILIA ENGRAULIDAE ENGRAULIDAE FAMILY
CAMPO DE LA INVENCIÓN FIELD OF THE INVENTION
La presente invención se refiere, en sentido amplio, al análisis genético de diferentes especies de Ia familia Engraulidae a través de cebadores específicos y en concreto a un método para Ia detección e identificación simultánea de las especies Engraulis encrasicolus, Engraulis mordax y Engraulis ringens mediante el empleo de técnicas PCR para Ia amplificación de Ia secuencia del espacio no transcrito del ADNr 5S. The present invention relates, in a broad sense, to the genetic analysis of different species of the Engraulidae family through specific primers and specifically to a method for the simultaneous detection and identification of the Engraulis encrasicolus, Engraulis mordax and Engraulis ringens species by means of use of PCR techniques for the amplification of the sequence of the non-transcribed space of the 5S rDNA.
ANTECEDENTES DE LA INVENCIÓN BACKGROUND OF THE INVENTION
La anchoa o boquerón, Engraulis encrasicolus, es una especie distribuida en el Mediterráneo y en las costas Atlánticas orientales, desde Noruega hasta Angola. Es una especie objetivo de las pesquerías comerciales en España y por ello se ha sometido a sobrepesca, Io que plantea Ia necesidad de establecer un programa de gestión y conservación de este recurso. Uno de estos programas esAnchovy or anchovy, Engraulis encrasicolus, is a species distributed in the Mediterranean and on the eastern Atlantic coasts, from Norway to Angola. It is an objective species of commercial fisheries in Spain and therefore has been subject to overfishing, which raises the need to establish a management and conservation program for this resource. One of these programs is
Ia seguridad alimentaria y Ia trazabilidad de esta especie para evitar cualquier confusión o fraude, sabiendo que se está produciendo un aumento importante de las importaciones de otras especies de boquerón, entre ellas las que proceden del continente americano, para paliar este problema. Estos productos importados pueden ser frescos, congelados o procesados, Io que supone una dificultad añadida para su identificación morfológica. The food security and traceability of this species to avoid any confusion or fraud, knowing that there is a significant increase in imports of other anchovy species, including those from the Americas, to alleviate this problem. These imported products can be fresh, frozen or processed, which is an added difficulty for their morphological identification.
El creciente interés industrial hacia métodos rápidos ha conducido a Ia elaboración y aplicación de métodos basados en PCR-multiplex para Ia detección e identificación de especies utilizadas en elaboración de alimentos, por ejemplo identificación de materia prima a base de bonito (Wen-Feng Lin and Deng-Fwu Hwang "A multiplex PCR assay for species Identification of raw and cooked bonito" Food Control 19 (2008) 879-885), detección de Ia adulteración de las especies de peces en Ia industria de restaurantes {Asensio L. et al. "Application of multiplex PCR for the identification of grouper meáis in the restaurant industry" Food Control 19 (2008) 1096-1099), alimentos a base de carnes (Ghovvati S. et al. "Fraud identification in industrial meat producís by multiplex PCR assay" Food Control 20 (2009) 696-699) y también para estudiar Ia seguridad alimentaria, como Ia identificación de microbios patógenos en los alimentos (Germini A. et al.The growing industrial interest towards rapid methods has led to the development and application of PCR-multiplex-based methods for the detection and identification of species used in food processing, for example identification of raw material based on bonito (Wen-Feng Lin and Deng-Fwu Hwang "A multiplex PCR assay for species Identification of raw and cooked bonito" Food Control 19 (2008) 879-885), detection of the adulteration of fish species in the restaurant industry {Asensio L. et al. "Application of multiplex PCR for the identification of grouper meáis in the restaurant industry "Food Control 19 (2008) 1096-1099), meat-based foods (Ghovvati S. et al." Fraud identification in industrial meat producís by multiplex PCR assay "Food Control 20 (2009) 696-699) and also to study food safety, such as the identification of pathogenic microbes in food (Germini A. et al.
"Simultaneous detection of Escherichia coli 0175.H7, Salmonella spp., and Listeria monocytogenes by multiplex PCR" Food Control 20 (2009) 733-738) y cereales genéticamente modificados (Forte V. T. et al. "A general multiplex-PCR assay for the general detection of genetically modified soya and maize" Food Control 16 (2005) 535-539). "Simultaneous detection of Escherichia coli 0175.H7, Salmonella spp., And Listeria monocytogenes by multiplex PCR" Food Control 20 (2009) 733-738) and genetically modified cereals (Forte VT et al. "A general multiplex-PCR assay for the general detection of genetically modified soy and maize "Food Control 16 (2005) 535-539).
En relación con el boquerón, hasta el momento han sido descritos dos estudios; el primero (Santaclara et al. "Development of a method forgenetic identification of four species of anchovies: E. encrasicolus, E. anchoita, E. ringens and E. japonicus". Eur Food Res Technol (2006) 223: 609-614) describe un método para identificar genéticamente 4 especies de Ia familia Engraulidae: E. encrasicolus, E. anchoita, E. ringens y E. japonicus mediante Ia técnica PCR-RFLP para Ia amplificación del Citocromo b del ADN mitocondrial. El segundo estudio (Rea S. et al. "Species identification in anchovy pastes from the market by PCR-RFLP technique" Food Control 20 (2009), 515-520) trata de identificar las especies utilizadas en alimentos a base de pasta de boquerón mediante PCR-RFLP del Citocromo b del ADN mitocondrial. Las especies estudiadas fueron: E. encrasicolus (boquerón), Sardina pilchardus (sardina), Sprattus sprattus (espadín), Alosa fallax (sábalo), Sardinella auríta (alacha),In relation to the anchovy, so far two studies have been described; the first (Santaclara et al. "Development of a method forgenetic identification of four species of anchovies: E. encrasicolus, E. anchoita, E. ringens and E. japonicus". Eur Food Res Technol (2006) 223: 609-614) describes a method to genetically identify 4 species of the Engraulidae family: E. encrasicolus, E. anchoita, E. ringens and E. japonicus by means of the PCR-RFLP technique for the amplification of cytochrome b of mitochondrial DNA. The second study (Rea S. et al. "Species identification in anchovy pastes from the market by PCR-RFLP technique" Food Control 20 (2009), 515-520) tries to identify the species used in anchovy pasta-based foods by PCR-RFLP of cytochrome b of mitochondrial DNA. The species studied were: E. encrasicolus (anchovy), Sardina pilchardus (sardine), Sprattus sprattus (sprat), Alosa fallax (tarpon), Sardinella auríta (alacha),
Trachurus trachurus (jurel Atlántico) y Trachurus mediterraneus (jurel Mediterráneo). Trachurus trachurus (Atlantic horse mackerel) and Trachurus mediterraneus (Mediterranean horse mackerel).
Sin embargo, como es bien conocido en el estado de Ia técnica, el ADN mitocondrial acumula mutaciones, y en caso de que no se estudien todas las secuencias posibles, basta con una mutación puntual en Ia diana de restricción para que el método no resulte válido. Tal y como se cita en Santaclara et al. "es importante detectar toda Ia variabilidad intraespecífica de Ia especie para diseñar un buen método que utilice un gran número de muestras que deben incluir todas las zonas de distribución". However, as is well known in the state of the art, mitochondrial DNA accumulates mutations, and if not all possible sequences are studied, a point mutation on the restriction target is sufficient so that the method is not valid. . As cited in Santaclara et al. "It is important to detect all the intraspecific variability of the species to design a good method that uses a large number of samples that should include all distribution areas. "
En base a estas limitaciones, los autores de Ia presente invención, tras una importante labor de investigación, han desarrollado un método que permite detectar e identificar simultáneamente 3 especies de boquerón, una europea (Engraulis encrasicolus) y dos americanas (Engraulis mordax y Engraulis ríngens) con una simple técnica, como Ia PCR múltiplex, en un solo paso, que amplifica Ia secuencia del espaciador no transcrito del ADNr 5S, utilizando cebadores especie-específicos diseñados para este fin y empleando una sola muestra del pez o del producto procesado. Este método permite asegurar Ia autenticidad de los alimentos a base de boquerón (E. encrasicolus) frente a aquellos a base de otras especies americanas, permitiendo iniciativas como denominaciones de origen. Based on these limitations, the authors of the present invention, after an important research work, have developed a method that allows to detect and identify simultaneously 3 species of anchovy, one European (Engraulis encrasicolus) and two American (Engraulis mordax and Engraulis ríngens ) with a simple technique, such as multiplex PCR, in a single step, which amplifies the sequence of the non-transcribed spacer of the 5S rDNA, using species-specific primers designed for this purpose and using a single sample of the fish or the processed product. This method allows to ensure the authenticity of anchovy-based foods (E. encrasicolus) against those based on other American species, allowing initiatives such as designations of origin.
El nuevo marcador en el que se basa el método desarrollado, el espaciador no transcrito (NTS) de Ia secuencia del ADNr 5S, no había sido secuenciado hasta el momento para estas especies. El ADN ribosómico (ADNr) es una secuencia de ADN contenida en los cromosomas del nucléolo que codifica ARN ribosómico. Estas secuencias regulan Ia transcripción e iniciación de Ia amplificación. Está formado por numerosas unidades de repetición separadas unas de otras por un espaciador intergénico. The new marker on which the developed method is based, the non-transcribed spacer (NTS) of the 5S rDNA sequence, had not been sequenced so far for these species. Ribosomal DNA (rDNA) is a DNA sequence contained in the chromosomes of the nucleolus that encodes ribosomal RNA. These sequences regulate the transcription and initiation of the amplification. It consists of numerous repeating units separated from each other by an intergenic spacer.
La unidad de repetición del ADNr 5S se compone de una región codificante de 120 pb muy conservada y un espacio no transcrito (NTS) que presenta una gran variabilidad en tamaño y secuencia, Io que hace de éste una herramienta muy útil para comparar especies estrechamente relacionadas. The 5S rDNA repeating unit is composed of a highly conserved 120 bp coding region and a non-transcribed space (NTS) that presents great variability in size and sequence, which makes it a very useful tool for comparing closely related species .
El empleo del espaciador no transcrito de Ia secuencia de ADNr 5s como marcador genético para Ia detección e identificación de estas especies, permite desarrollar un método más rápido y fiable que los anteriormente realizados. Teniendo en cuenta que el boquerón europeo, E. encrasicolus, pasa por una fase de sobrepesca, las características del método de Ia invención permiten llevar a cabo Ia trazabilidad de estas especies de una forma rápida y eficaz, resolviendo así los problemas de errores de etiquetado de productos procesados (fileteado, envasado, etc), así como Ia venta fraudulenta de las mismas. The use of the non-transcribed spacer of the 5s rDNA sequence as a genetic marker for the detection and identification of these species, allows to develop a faster and more reliable method than those previously performed. Taking into account that the European anchovy, E. encrasicolus, goes through an overfishing phase, the characteristics of the method of the invention allow the traceability of these species to be carried out quickly and efficiently, thus solving the problems of labeling errors. of processed products (filleting, packaging, etc.), as well as the fraudulent sale of them.
OBJETO DE LA INVENCIÓN En primer lugar, es objeto de Ia invención un método para Ia detección e identificación simultánea en una muestra de Ia presencia o ausencia de al menos una de las especies de Ia familia Engraulidae, seleccionada entre Engraulis encrasicolus, Engraulis mordax y Engraulis ríngens, mediante amplificación por PCR de al menos una de Ia secuencias correspondiente con el espaciador no transcrito (NTS) del ADN ribosómico 5S de estas tres especies. OBJECT OF THE INVENTION First, the object of the invention is a method for the simultaneous detection and identification in a sample of the presence or absence of at least one of the species of the Engraulidae family, selected from Engraulis encrasicolus, Engraulis mordax and Engraulis rhinogens, by PCR amplification of at least one of the corresponding sequences with the non-transcribed spacer (NTS) of the 5S ribosomal DNA of these three species.
Son también objeto de Ia invención las secuencias del espaciador no transcrito (NTS) del ADN ribosómico de cada una de estas especies, mostradas en SEQ ID NO 1 , SEQ ID NO 2 y SEQ ID NO 3, respectivamente, empleadas como marcador genético para Ia detección e identificación de las especies citadas. The non-transcribed spacer (NTS) sequences of the ribosomal DNA of each of these species, shown in SEQ ID NO 1, SEQ ID NO 2 and SEQ ID NO 3, respectively, used as a genetic marker for Ia are also object of the invention. detection and identification of the cited species.
Son también objeto de Ia invención cada uno de los cebadores empleados en Ia amplificación del espaciador no transcrito del ADN ribosómico 5S de cada una de las especies citadas, de secuencias SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8 y SEQ ID NO 9. They are also the subject of the invention each of the primers used in the amplification of the non-transcribed spacer of the 5S ribosomal DNA of each of the aforementioned species, of sequences SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7, SEQ ID NO 8 and SEQ ID NO 9.
Finalmente, es objeto de Ia invención un kit para llevar a cabo el método descrito. Finally, a kit for carrying out the described method is the subject of the invention.
DESCRIPICIÓN DE LAS FIGURAS DESCRIPTION OF THE FIGURES
Figura 1: Esquema resumen del proceso de identificación entre las 3 especies de boquerón mediante PCR Múltiplex con cebadores específicos. Figure 1: Summary scheme of the identification process among the 3 anchovy species by multiplex PCR with specific primers.
Figura 2: Localización de los cebadores específicos (SEQ ID NO 4 y SEQ ID NO 5) en Ia secuencia del NTS del ADNr 5S de E. encrasicolus. Figura 3: Localización de los cebadores específicos (SEQ ID NO 6 y SEQ ID NO 7) en Ia secuencia del NTS del ADNr 5S de E. mordax. Figure 2: Location of the specific primers (SEQ ID NO 4 and SEQ ID NO 5) in the NTS sequence of the 5S rDNA of E. encrasicolus. Figure 3: Location of the specific primers (SEQ ID NO 6 and SEQ ID NO 7) in the NTS sequence of the 5S rDNA of E. mordax.
Figura 4: Localización de los cebadores específicos (SEQ ID NO 8 y SEQ ID NO 9) en Ia secuencia del NTS del ADNr 5S de E. ringens.  Figure 4: Location of the specific primers (SEQ ID NO 8 and SEQ ID NO 9) in the NTS sequence of the 5S rDNA of E. ringens.
DESCRIPCIÓN DE LA INVENCIÓN DESCRIPTION OF THE INVENTION
La presente invención se enfrenta al problema de detectar e identificar simultáneamente en una muestra Ia presencia de hasta tres especies de Ia familia Engraulidae (E. encrasicolus, E. mordax y E. ringens) de forma rápida, específica y eficaz. The present invention faces the problem of detecting and simultaneously identifying in a sample the presence of up to three species of the Engraulidae family (E. encrasicolus, E. mordax and E. ringens) quickly, specifically and efficiently.
La solución planteada por los autores de Ia presente invención se basa en el empleo de Ia secuencia correspondiente al espaciador no transcrito (NTS) delThe solution proposed by the authors of the present invention is based on the use of the sequence corresponding to the non-transcribed spacer (NTS) of the
ADN ribosómico 5S como marcador genético de estas especies y en el diseño de tres pares de cebadores especie-específicos que amplifican dicha secuencia en cada especie, obteniéndose unas bandas de producto amplificado diferenciales en función de la/las especie/s presentes en Ia muestra. 5S ribosomal DNA as a genetic marker of these species and in the design of three pairs of species-specific primers that amplify said sequence in each species, obtaining differential amplified product bands depending on the species / s present in the sample.
Como se ha mencionado anteriormente, Ia unidad de repetición del gen ribosómico 5S está formada por una región codificante de 120 pb y un espaciador no transcrito (NTS) de longitud y secuencia variable. El alineamiento de las secuencias completas del ADNr 5S de las tres especies estudiadas (E. encrasicolus, E mordax y E. ringens) (mostradas en SEQ ID NO 10, SEQ ID NO 11 y SEQ ID NO 12, respectivamente) revela una diferencia muy significativa en los NTS de dichas especies, Io que ha permitido desarrollar el método objeto de Ia presente invención. As mentioned above, the 5S ribosomal gene repeat unit is formed by a coding region of 120 bp and a non-transcribed spacer (NTS) of variable length and sequence. The alignment of the complete sequences of the 5S rDNA of the three species studied (E. encrasicolus, E mordax and E. ringens) (shown in SEQ ID NO 10, SEQ ID NO 11 and SEQ ID NO 12, respectively) reveals a very different significant in the NTS of said species, which has allowed to develop the method object of the present invention.
Así, un aspecto principal de Ia invención se refiere al método para Ia detección e identificación simultánea en una muestra de al menos una de las especies de Ia familia Engraulidae seleccionada de entre Engraulis encrasicolus, Engraulis mordax y Engraulis ringens, mediante amplificación por PCR de al menos una de las secuencias, seleccionada de entre SEQ ID NO 1 , 2 y 3, correspondientes, respectivamente, con el espaciador no transcrito (NTS) del ADN ribosómico 5S de las especies citadas (de aquí en adelante, método de Ia invención). La secuencia NTS de cada una de estas especies no había sido secuenciada anteriormente y, por tanto, no había sido descrita nunca como marcador genético para Ia detección y/o identificación de especies de Ia familia Engraulidae. Thus, a main aspect of the invention refers to the method for the simultaneous detection and identification in a sample of at least one of the species of the Engraulidae family selected from among Engraulis encrasicolus, Engraulis mordax and Engraulis ringens, by PCR amplification of at minus one of the sequences, selected from SEQ ID NO 1, 2 and 3, corresponding, respectively, with the non-transcribed spacer (NTS) of the 5S ribosomal DNA of the cited species (hereinafter, method of the invention). The NTS sequence of each of these species had not been sequenced before and, therefore, had never been described as a genetic marker for the detection and / or identification of species of the Engraulidae family.
Por tanto, en otro aspecto principal de Ia invención se contempla cada una de las secuencias aisladas correspondientes a los NTS del ADNr 5S de cada una de las especies citadas empleadas como marcadores genéticos en el método de Ia invención. Therefore, in another main aspect of the invention, each of the isolated sequences corresponding to the NTS of the 5S rDNA of each of the cited species used as genetic markers in the method of the invention is contemplated.
Concretamente, se contempla una molécula de ADN aislada que se corresponde con Ia secuencia del espaciador no transcrito del ADN ribosómico 5S de Ia especie Engraulis encrasicolus, mostrada en SEQ ID NO 1 ; una molécula deSpecifically, an isolated DNA molecule that corresponds to the sequence of the non-transcribed spacer of the 5S ribosomal DNA of the Engraulis encrasicolus species, shown in SEQ ID NO 1; a molecule of
ADN aislada que se corresponde con Ia secuencia del espaciador no transcrito del ADN ribosómico 5S de Ia especie Engraulis mordax, mostrada en SEQ ID NOIsolated DNA that corresponds to the sequence of the non-transcribed spacer of the 5S ribosomal DNA of the Engraulis mordax species, shown in SEQ ID NO
2; y una molécula de ADN aislada que se corresponde con Ia secuencia del espaciador no transcrito del ADN ribosómico 5S de Ia especie Engraulis ringens, mostrada en SEQ ID NO 3. 2; and an isolated DNA molecule that corresponds to the sequence of the non-transcribed spacer of the 5S ribosomal DNA of the Engraulis ringens species, shown in SEQ ID NO 3.
En Ia presente invención, por "muestra" se entiende tanto una muestra de un pez, fresco o congelado, (en Ia que se detectaría una o ninguna de las especies) como una muestra de un producto procesado (donde se podrían detectar e identificar hasta las 3 especies simultáneamente). Por "producto procesado" se entiende aquellos productos, frescos o congelados, elaborados a base de boquerón. Ejemplos no limitantes de "productos procesados" son filetes de conservas, alimentos rellenos con pasta de boquerón, paté de anchoas, etc. In the present invention, "sample" means both a sample of a fish, fresh or frozen, (in which one or none of the species would be detected) and a sample of a processed product (where they could detect and identify up to all 3 species simultaneously). "Processed product" means those products, fresh or frozen, made from anchovies. Non-limiting examples of "processed products" are canned fillets, food stuffed with anchovy paste, anchovy pate, etc.
En una realización preferida, Ia PCR empleada para llevar a cabo Ia amplificación del método de Ia invención es una PCR multiplex en un solo paso, que permite emplear simultáneamente tantos cebadores como sea necesario, en este caso los tres pares de cebadores, en lugar de uno solo como en Ia PCR estándar, Io que permite Ia detección e identificación simultánea de Ia presencia o ausencia de las tres especies citadas en Ia presente invención, a partir de una sola muestra. La extracción del ADN de Ia muestra se puede llevar a cabo mediante cualquier kit de extracción de ADN conocido en el estado de Ia técnica. In a preferred embodiment, the PCR used to carry out the amplification of the method of the invention is a multiplex PCR in a single step, which allows to simultaneously employ as many primers as necessary, in this case the three pairs of primers, instead of only one as in the standard PCR, Io which allows the simultaneous detection and identification of the presence or absence of the three species cited in the present invention, from a single sample. The DNA extraction from the sample can be carried out by means of any DNA extraction kit known in the state of the art.
Para Ia realización del método se han diseñado PCRs que puedan ser realizadas en un rango amplio de condiciones. Cualquier mezcla de reacción de las habitualmente empleadas en PCR dará buenos resultados, aunque en realizaciones preferidas de Ia invención se emplean concentraciones finales de 10ng de ADN genómico, 3mM de MgCI2, 200μM dNTP's, 0.2μM de cada cebador y 2U de Ia enzima polimerasa Taq. Por otra parte, se puede emplear cualquier termociclador normal, aunque en realizaciones particulares de Ia invención se emplea un termociclador Gene Amp® PCR System 2700 y tiemposTo carry out the method, PCRs have been designed that can be performed in a wide range of conditions. Any reaction mixture of those usually used in PCR will give good results, although in preferred embodiments of the invention final concentrations of 10ng of genomic DNA, 3mM of MgCI 2 , 200μM dNTP's, 0.2μM of each primer and 2U of the enzyme polymerase are used Taq. On the other hand, any normal thermal cycler can be used, although in particular embodiments of the invention a Gene Amp ® PCR System 2700 thermal cycler and times are used
(desnaturalización, anillamiento y extensión) entre 30 y 75 segundos y 25 y 40 ciclos, y en realizaciones preferidas se emplean tiempos de 45 segundos para desnaturalización y anillamiento, 60 segundos para extensión, y 35 ciclos. Las diferencias alélicas entre los NTSs se pueden resolver y ser visualizados mediante diversos tipos de electroforesis, aunque en realizaciones particulares de Ia invención Ia combinación de cebadores seleccionados para Ia realización del PCR multiplex genera productos de PCR diferenciables visualmente mediante electroforesis en gel de agarosa. (denaturation, banding and extension) between 30 and 75 seconds and 25 and 40 cycles, and in preferred embodiments times of 45 seconds are used for denaturation and banding, 60 seconds for extension, and 35 cycles. Allelic differences between the NTSs can be resolved and visualized by various types of electrophoresis, although in particular embodiments of the invention the combination of primers selected for the performance of multiplex PCR generates visually differentiable PCR products by agarose gel electrophoresis.
En una realización particular del método de Ia presente invención se contempla el empleo de Ia combinación de cebadores de secuencias SEQ ID NO 4 y SEQ ID NO 5, para Ia amplificación de un fragmento de 599 pb, específico de Engraulis encrasicolus. In a particular embodiment of the method of the present invention, the use of the combination of sequence primers SEQ ID NO 4 and SEQ ID NO 5 is contemplated, for the amplification of a 599 bp fragment, specific to Engraulis encrasicolus.
Otra realización particular del método de Ia presente invención se refiere al empleo de Ia combinación de cebadores de secuencias SEQ ID NO 6 y SEQ ID NO 7, para Ia amplificación de un fragmento de 382 pb, específico de Engraulis mordax. Otra realización particular del método de Ia presente invención se refiere al empleo de Ia combinación de cebadores de secuencias SEQ ID NO 8 y SEQ ID NO 9, para Ia amplificación de un fragmento de 250 pb, específico de Engraulis ringens. Another particular embodiment of the method of the present invention refers to the use of the combination of sequence primers SEQ ID NO 6 and SEQ ID NO 7, for the amplification of a fragment of 382 bp, specific to Engraulis mordax. Another particular embodiment of the method of the present invention refers to the use of the combination of sequence primers SEQ ID NO 8 and SEQ ID NO 9, for the amplification of a 250 bp fragment, specific to Engraulis ringens.
Como se ha citado anteriormente, Ia secuenciación de los NTS de las especies estudiadas y sus posteriores alineamientos han revelado sitios polimórficos en las distintas secuencias y propios de cada especie, Io que ha permitido diseñar estos cebadores específicos de especie que permiten Ia identificación de cada una de estas especies y Ia diferenciación entre ellas de forma simultánea en un solo paso. As mentioned above, the sequencing of the NTS of the studied species and their subsequent alignments have revealed polymorphic sites in the different sequences and specific to each species, which has allowed to design these specific species primers that allow the identification of each of these species and the differentiation between them simultaneously in a single step.
Así, en otro aspecto de Ia invención se contempla un oligonucleótido, con secuencia mostrada en SEQ ID NO 4, para su uso como cebador en Ia detección e identificación de Ia especie Engraulis encrasicolus. Thus, in another aspect of the invention an oligonucleotide is contemplated, with sequence shown in SEQ ID NO 4, for use as a primer in the detection and identification of the Engraulis encrasicolus species.
En otro aspecto de Ia invención, se contempla un oligonucleótido, con secuencia mostrada en SEQ ID NO 5, para su uso como cebador en Ia detección e identificación de Ia especie Engraulis encrasicolus. In another aspect of the invention, an oligonucleotide is contemplated, with sequence shown in SEQ ID NO 5, for use as a primer in the detection and identification of the Engraulis encrasicolus species.
En otro aspecto de Ia invención se contempla un oligonucleótido, con secuencia mostrada en SEQ ID NO 6, para su uso como cebador en Ia detección e identificación de Ia especie Engraulis mordax. In another aspect of the invention an oligonucleotide is contemplated, with sequence shown in SEQ ID NO 6, for use as a primer in the detection and identification of the Engraulis mordax species.
En otro aspecto de Ia invención, se contempla un oligonucleótido, con secuencia mostrada en SEQ ID NO 7, para su uso como cebador en Ia detección e identificación de Ia especie Engraulis mordax. En otro aspecto de Ia invención se contempla un oligonucleótido, con secuencia mostrada en SEQ ID NO 8, para su uso como cebador en Ia detección e identificación de Ia especie Engraulis ringens. En otro aspecto de Ia invención se contempla un oligonucleótido, con secuencia mostrada en SEQ ID NO 9, para su uso como cebador en Ia detección e identificación de Ia especie Engraulis ringens. El método de Ia presente invención es más rápido y fiable que los anteriormente descritos en el estado de Ia técnica. Más rápido porque el empleo de Ia secuencia NTS como marcador genético permite llevar a cabo el método en un solo paso, utilizando únicamente Ia técnica PCR, en vez de Ia técnica PCR-RFLP con enzimas de restricción, empleada en otros trabajos, y más fiable por que se emplean cebadores especie-específicos, diseñados exclusivamente para Ia realización de este método, que amplifican solamente en una especie concreta. Así por ejemplo, estos cebadores fueron probados en sardina y dieron resultado negativo. Finalmente, otro aspecto principal de Ia invención se refiere a un kit para llevar a cabo el método de detección e identificación de al menos una de las especies citadas, descrito en Ia presente invención, que comprende una solución formada por al menos uno de los pares de cebadores seleccionados entre SEQ ID NO 4 y SEQ ID NO 5; SEQ ID NO 6 y SEQ ID NO 7; y SEQ ID NO 8 y SEQ ID NO 9. In another aspect of the invention, an oligonucleotide is contemplated, with sequence shown in SEQ ID NO 7, for use as a primer in the detection and identification of the Engraulis mordax species. In another aspect of the invention an oligonucleotide is contemplated, with sequence shown in SEQ ID NO 8, for use as a primer in the detection and identification of the Engraulis ringens species. In another aspect of the invention an oligonucleotide is contemplated, with sequence shown in SEQ ID NO 9, for use as a primer in the detection and identification of the Engraulis ringens species. The method of the present invention is faster and more reliable than those previously described in the state of the art. Faster because the use of the NTS sequence as a genetic marker allows the method to be carried out in a single step, using only the PCR technique, instead of the PCR-RFLP technique with restriction enzymes, used in other works, and more reliable because species-specific primers are used, designed exclusively for the realization of this method, which amplify only in a specific species. Thus, for example, these primers were tested on sardines and gave negative results. Finally, another main aspect of the invention relates to a kit for carrying out the method of detection and identification of at least one of the aforementioned species, described in the present invention, which comprises a solution formed by at least one of the pairs of primers selected from SEQ ID NO 4 and SEQ ID NO 5; SEQ ID NO 6 and SEQ ID NO 7; and SEQ ID NO 8 and SEQ ID NO 9.
Los ejemplos que siguen a continuación ilustran Ia presente invención, pero no deben ser considerados como limitaciones a los aspectos esenciales del objeto de Ia misma, tal como han sido expuestos en los apartados anteriores de esta descripción. The following examples illustrate the present invention, but should not be considered as limitations on the essential aspects of the object thereof, as they have been set forth in the previous sections of this description.
Ejemplo 1 Example 1
Obtención de las muestras Sample collection
El análisis de Ia secuencia del gen ADNr 5S se ha realizado en las especies Engraulis encrasicolus del golfo de Cádiz, Engraulis mordax de baja California en The sequence analysis of the 5S rDNA gene has been carried out in the Engraulis encrasicolus species of the Gulf of Cádiz, Engraulis mordax of Baja California in
Méjico y Engraulis ringens de Valparaíso en Chile. Amplificación del gen ADNr 5S Mexico and Engraulis ringens of Valparaíso in Chile. 5S rDNA gene amplification
Después de extraer el ADN genómico de las 3 especies mediante el FastDNA® Kit, se amplificó el gen ADNr 5S con los cebadores universales 5S1F (5'- TACGCCCGATCTCGTCCGATC-S1) (SEQ ID NO 13) y 5S2R (5'- CAGGCTGGTATGGCCGTAAGC-3') (SEQ ID NO 14) descritos por Céspedes et al., (1999) diseñados para unirse con orientación opuesta a una región de Ia zona codificante del 5S. After extracting the genomic DNA from the 3 species using the FastDNA® Kit, the 5S rDNA gene was amplified with the 5S1F universal primers (5'- TACGCCCGATCTCGTCCGATC-S 1 ) (SEQ ID NO 13) and 5S2R (5'- CAGGCTGGTATGGCCGTAAGC- 3 ') (SEQ ID NO 14) described by Céspedes et al., (1999) designed to join with opposite orientation to a region of the 5S coding area.
La PCR se realizó en un volumen final de 50μl, conteniendo 4μl de ADN genómico, 3mM de MgCI2, 200μM dNTP's, 0.2μM de cada cebador, 2U de Ia enzima polimerasa Taq (Euro-Clone, Italy) y el tampón apropiado para Ia enzima.The PCR was performed in a final volume of 50μl, containing 4μl of genomic DNA, 3mM of MgCI2, 200μM dNTP's, 0.2μM of each primer, 2U of the Taq polymerase enzyme (Euro-Clone, Italy) and the appropriate buffer for the enzyme .
La reacción se llevó a cabo mediante un ciclo inicial de 5 min a 940C y 35 ciclos de 45 seg a 940C, 45 seg a 590C y 1 min a 720C, y una extensión final de 10 min a 720C. Los productos se visualizaron en un gel de agarosa al 2% con bromuro de etidio (0.5μg/ml) tras una electroforesis de 1 ,5h a 8OV. Las bandas de ADN se observaron en los geles mediante luz ultravioleta y el tamaño de las bandas se determinó por el marcador de peso molecular. The reaction was carried out by an initial cycle of 5 min at 94 0 C and 35 cycles of 45 sec at 94 0 C, 45 sec at 59 0 C and 1 min at 72 0 C, and a final extension of 10 min at 72 0 C. The products were visualized on a 2% agarose gel with ethidium bromide (0.5μg / ml) after an electrophoresis of 1.5h at 8OV. The DNA bands were observed in the gels by ultraviolet light and the size of the bands was determined by the molecular weight marker.
Clonación y secuenciación del ADNr 5S Cloning and sequencing of the 5S rDNA
Los productos de PCR obtenidos fueron purificados mediante el Nucleospin kitThe PCR products obtained were purified by the Nucleospin kit
(Macherey-Nagel) y clonados usando el kit de clonación pGEM®-T Easy Vector Systems (promega). (Macherey-Nagel) and cloned using the cloning kit pGEM®-T Easy Vector Systems (Promise).
A partir de estos productos se realizó una ligación al vector de clonación p- GEM®-T Easy Vector (Promega), Ia reacción de ligación que contiene producto de PCR, ligasa de ADN T4, tampón de Ia ligasa y agua se llevó a cabo durante una noche a 40C. From these products, a ligation to the cloning vector p-GEM®-T Easy Vector (Promega) was performed, the ligation reaction containing PCR product, T4 DNA ligase, ligase buffer and water was carried out overnight at 4 0 C.
La transformación de bacterias competentes de alta eficiencia JM109 se realizó mediante un choque térmico de 420C durante 45 seg. Una vez sembradas en placas con medio LB/ampicilina/YPTG/X-Gal, se seleccionaron las colonias blancas, las cuales contienen el producto de PCR clonado. Finalmente, a partir de las colonias seleccionadas se extrajeron y purificaron plásmidos mediante el NucleoSpin® Plasmid QuickPure Kit (Macherey-Nagel) y se secuenciaron usando los promotores T7 y SP6 de Ia ARN polimerasa. The transformation of competent bacteria of high efficiency JM109 was carried out by a thermal shock of 42 0 C for 45 sec. Once plated with LB / ampicillin / YPTG / X-Gal medium, white colonies were selected, which contain the cloned PCR product. Finally, plasmids were extracted and purified from the selected colonies by NucleoSpin® Plasmid QuickPure Kit (Macherey-Nagel) and were sequenced using T7 and SP6 promoters of RNA polymerase.
Las secuenciaciones se llevaron a cabo mediante un kit de secuenciación (BigDye Terminator v 3.1 Cycle Sequencing Kit; Applied Biosystems) en un secuenciador automático en Ia Unidad de Genómica del Servicio Central deSequencing was carried out by means of a sequencing kit (BigDye Terminator v 3.1 Cycle Sequencing Kit; Applied Biosystems) in an automatic sequencer in the Genomics Unit of the Central Service of
Apoyo a Ia Investigación de Ia Universidad de Córdoba. Las secuencias correspondientes al ADNr 5S de cada una de las especies (£. encrasicolus,Support to the Research of the University of Córdoba. The sequences corresponding to the 5S rDNA of each species (£. Encrasicolus,
E.mordax y E.ringens) se muestran en las SEQ ID NO 10, SEQ ID NO 11 y SEQ ID NO 12. Los picos de secuenciación se analizaron con el programa ChromasE.mordax and E.ringens) are shown in SEQ ID NO 10, SEQ ID NO 11 and SEQ ID NO 12. Sequence peaks were analyzed with the Chromas program
2.0 y las secuencias obtenidas se alinearon usando el programa ClustalW. Se analizaron un total de 37 clones entre las 3 especies. 2.0 and the sequences obtained were aligned using the ClustalW program. A total of 37 clones among the 3 species were analyzed.
Diseño de cebadores especies-específicos Design of species-specific primers
El alineamiento de las secuencias del ADNr 5S de las 3 especies estudiadas reveló una diferencia muy significativa en los NTS de E. encrasicolus, E. mordax y E. ringens. The alignment of the 5S rDNA sequences of the 3 species studied revealed a very significant difference in the NTS of E. encrasicolus, E. mordax and E. ringens.
Para poder diferenciar entre estas especies, se diseñaron cebadores especies específicos localizados en el espaciador mediante el programa Primer3. Las secuencias de estos cebadores fueron, para E. encrasicolus: E.E1 FIn order to differentiate between these species, specific species primers located in the spacer were designed using the Primer3 program. The sequences of these primers were, for E. encrasicolus: E.E1 F
(CCCAAAAAGGTAAGGAGAAAG) (cebador forward (sentido)) (SEQ ID NO 4) y(CCCAAAAAGGTAAGGAGAAAG) (forward (sense) primer) (SEQ ID NO 4) and
E.E2R (TGCAACATTGCAACAAAACTT) (cebador reverse (antisentido)) (SEQ IDE.E2R (TGCAACATTGCAACAAAACTT) (reverse primer (antisense)) (SEQ ID
NO 5); para E. mordax: E.M1F (TGAAAAGACATTCTCACGTTGTG) (forward) (SEQ ID NO 6) y E.M2R (ACGGTCCTCCTCTCACAGTC) (reverse) (SEQ ID NONO 5); for E. mordax: E.M1F (TGAAAAGACATTCTCACGTTGTG) (forward) (SEQ ID NO 6) and E.M2R (ACGGTCCTCCTCTCACAGTC) (reverse) (SEQ ID NO
7); y para E. ringens: E.R1F (TGAAAAAGGGAATGGGGTTT) (forward) (SEQ ID7); and for E. ringens: E.R1F (TGAAAAAGGGAATGGGGTTT) (forward) (SEQ ID
NO 8) y E.R2R (CGGTCCTTTTAGGGTTAGGG) (reverse) (SEQ ID NO 9). NO 8) and E.R2R (CGGTCCTTTTAGGGTTAGGG) (reverse) (SEQ ID NO 9).
Las figuras 2, 3 y 4 muestran Ia localización de estos cebadores. Figures 2, 3 and 4 show the location of these primers.
La realización de las PCR múltiplex para Ia identificación simultanea de las diferentes especies de Ia familia Engraulidae, se llevó a cabo en un volumen final de 50μl, conteniendo 2μl del ADN, 0.2μM de cada cebador (E.E1F (SEQ ID NO 4), E.E2R (SEQ ID NO 5), E.M1F (SEQ ID NO 6), E.M2R (SEQ ID NO 7), E.R1 F (SEQ ID NO 8) y E.R2R (SEQ ID NO 9), 3mM de MgCI2, 200μM dNTP's, 2U de Ia enzima polimerasa Taq y el tampón apropiado para Ia enzima. La reacción se llevó a cabo mediante un ciclo inicial de 5 min a 940C y 35 ciclos de 45 seg a 940C, 45 seg a 590C y 1 min a 720C, y una extensión final de 10 min a 720C. Los productos se visualizaron en un gel de agarosa al 1.5% con bromuro de etidio (0.5μg/ml) tras una electroforesis de 1h a 80 V. Las bandas de ADN se observan en los geles mediante luz ultravioleta y el tamaño de las bandas se determina por el marcador de peso molecular. Los productos de PCR fueron purificados con el kit descrito anteriormente y directamente secuenciados en el SCAI de Ia Universidad de Córdoba usando los mismos cebadores para comprobar que los productos amplificados eran los mismos que los diseñados previamente. Estos cebadores no solamente indicaron Ia presencia o ausencia de amplificación, si no que además permitieron diferenciar el tamaño de los productos, Io que facilitó una vez más Ia lectura de los resultados. El esquema de Ia figura 1 resume todo el proceso y el resultado final. The realization of multiplex PCR for the simultaneous identification of the different species of the Engraulidae family, was carried out in a final volume of 50μl, containing 2μl of DNA, 0.2μM of each primer (E.E1F (SEQ ID NO 4)) , E.E2R (SEQ ID NO 5), E.M1F (SEQ ID NO 6), E.M2R (SEQ ID NO 7), E.R1 F (SEQ ID NO 8) and E.R2R (SEQ ID NO 9), 3mM MgCl2, 200μM dNTP's, 2U of the Taq polymerase enzyme and the appropriate buffer for the enzyme. The reaction was carried out by an initial cycle of 5 min at 94 0 C and 35 cycles of 45 sec at 94 0 C, 45 sec at 59 0 C and 1 min at 72 0 C, and a final extension of 10 min at 72 0 C. The products were visualized on a 1.5% agarose gel with ethidium bromide (0.5μg / ml) after an electrophoresis of 1h at 80 V. The DNA bands are observed in the gels by ultraviolet light and the size of the bands is determined by the molecular weight marker. The PCR products were purified with the kit described above and directly sequenced in the SCAI of the University of Córdoba using the same primers to verify that the amplified products were the same as those previously designed. These primers not only indicated the presence or absence of amplification, but also allowed to differentiate the size of the products, which facilitated once again the reading of the results. The scheme in Figure 1 summarizes the entire process and the final result.

Claims

REIVINDICACIONES
1. Método para Ia detección e identificación simultánea en una muestra de al menos una de las especies de Ia familia Engraulidae seleccionada entre Engraulis encrasicolus, Engraulis mordax y Engraulis ringens, mediante amplificación por PCR de al menos una de Ia secuencias, seleccionada de entre SEQ ID NO 1 , SEQ ID NO 2 y SEQ ID NO 3, correspondiente con el espaciador no transcrito (NTS) del ADN ribosómico 5S. 1. Method for the simultaneous detection and identification in a sample of at least one of the species of the family Engraulidae selected from Engraulis encrasicolus, Engraulis mordax and Engraulis ringens, by PCR amplification of at least one of the sequences, selected from SEQ ID NO 1, SEQ ID NO 2 and SEQ ID NO 3, corresponding to the non-transcribed spacer (NTS) of the 5S ribosomal DNA.
2. Método, según Ia reivindicación 1 , caracterizado porque Ia amplificación se lleva a cabo mediante PCR multiplex. 2. Method according to claim 1, characterized in that the amplification is carried out by multiplex PCR.
3. Método según Ia reivindicación 1 , caracterizado porque el empleo de Ia combinación de cebadores de secuencias SEQ ID NO 4 y SEQ ID NO 5, permite Ia amplificación de un fragmento 599 pb, específico de Engraulis encrasicolus. 3. Method according to claim 1, characterized in that the use of the combination of sequence primers SEQ ID NO 4 and SEQ ID NO 5, allows the amplification of a 599 bp fragment, specific to Engraulis encrasicolus.
4. Método según Ia reivindicación 1 , caracterizado porque el empleo de Ia combinación de cebadores de secuencias SEQ ID NO 6 y SEQ ID NO 7, permite Ia amplificación de un fragmento de 382 pb, específico de Engraulis mordax. 4. Method according to claim 1, characterized in that the use of the combination of sequence primers SEQ ID NO 6 and SEQ ID NO 7, allows the amplification of a fragment of 382 bp, specific to Engraulis mordax.
5. Método según Ia reivindicación 1 , caracterizado porque el empleo de Ia combinación de cebadores de secuencias SEQ ID NO 8 y SEQ ID NO 9, permite Ia amplificación de un fragmento de 250 pb, específico de Engraulis ringens. 5. Method according to claim 1, characterized in that the use of the combination of sequence primers SEQ ID NO 8 and SEQ ID NO 9, allows the amplification of a 250 bp fragment, specific to Engraulis ringens.
6. Oligonucleótido, con secuencia mostrada en SEQ ID NO 4, para su uso como cebador en Ia detección e identificación de Ia especie Engraulis encrasicolus, según el método de Ia reivindicación 1. 6. Oligonucleotide, with sequence shown in SEQ ID NO 4, for use as a primer in the detection and identification of the Engraulis encrasicolus species, according to the method of claim 1.
7. Oligonucleótido, con secuencia mostrada en SEQ ID NO 5, para su uso como cebador en Ia detección e identificación de Ia especie Engraulis encrasicolus, según el método de Ia reivindicación 1. 7. Oligonucleotide, with sequence shown in SEQ ID NO 5, for use as a primer in the detection and identification of the Engraulis encrasicolus species, according to the method of claim 1.
8. Oligonucleótido, con secuencia mostrada en SEQ ID NO 6, para su uso como cebador en Ia detección e identificación de Ia especie Engraulis mordax, según el método de Ia reivindicación 1. 8. Oligonucleotide, with sequence shown in SEQ ID NO 6, for use as a primer in the detection and identification of the Engraulis mordax species, according to the method of claim 1.
9. Oligonucleótido, con secuencia mostrada en SEQ ID NO 7, para su uso como cebador en Ia detección e identificación de Ia especie Engraulis mordax, según el método de Ia reivindicación 1. 9. Oligonucleotide, with sequence shown in SEQ ID NO 7, for use as a primer in the detection and identification of the Engraulis mordax species, according to the method of claim 1.
10. Oligonucleótido, con secuencia mostrada en SEQ ID NO 8, para su uso como cebador en Ia detección e identificación de Ia especie Engraulis ringens, según el método de Ia reivindicación 1. 10. Oligonucleotide, with sequence shown in SEQ ID NO 8, for use as a primer in the detection and identification of the Engraulis ringens species, according to the method of claim 1.
11. Oligonucleótido, con secuencia mostrada en SEQ ID NO 9, para su uso como cebador en Ia detección e identificación de Ia especie Engraulis ringens, según el método de Ia reivindicación 1. 11. Oligonucleotide, with sequence shown in SEQ ID NO 9, for use as a primer in the detection and identification of the Engraulis ringens species, according to the method of claim 1.
12. Molécula de ADN aislada que se corresponde con Ia secuencia del espaciador no transcrito del ADN ribosómico 5S de Ia especie Engraulis encrasicolus mostrada en SEQ ID NO 1. 12. Isolated DNA molecule that corresponds to the sequence of the non-transcribed spacer of the 5S ribosomal DNA of the Engraulis encrasicolus species shown in SEQ ID NO 1.
13. Molécula de ADN aislada que se corresponde con Ia secuencia del espaciador no transcrito del ADN ribosómico 5S de Ia especie Engraulis ringens mostrada en SEQ ID NO 2. 13. Isolated DNA molecule that corresponds to the sequence of the non-transcribed spacer of the 5S ribosomal DNA of the Engraulis ringens species shown in SEQ ID NO 2.
14. Molécula de ADN aislada que se corresponde con Ia secuencia del espaciador no transcrito del ADN ribosómico 5S de Ia especie Engraulis mordax mostrada en SEQ ID NO 3. 14. Isolated DNA molecule that corresponds to the sequence of the non-transcribed spacer of the 5S ribosomal DNA of the Engraulis mordax species shown in SEQ ID NO 3.
15. Kit para llevar a cabo el método de las reivindicaciones 1-5 que comprende una solución formada por al menos uno de los pares de cebadores seleccionados entre SEQ ID NO 4 y SEQ ID NO 5; SEQ ID NO 6 y SEQ ID NO 7; y SEQ ID NO 8 y SEQ ID NO 9. 15. Kit for carrying out the method of claims 1-5 comprising a solution formed by at least one of the pairs of primers selected from SEQ ID NO 4 and SEQ ID NO 5; SEQ ID NO 6 and SEQ ID NO 7; and SEQ ID NO 8 and SEQ ID NO 9.
PCT/ES2010/000314 2009-07-22 2010-07-19 Method for detecting and identifying species of the family engraulidae WO2011009975A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ESP200901649 2009-07-22
ES200901649A ES2376683B1 (en) 2009-07-22 2009-07-22 METHOD FOR DETECTION AND IDENTIFICATION OF SPECIES OF THE ENGRAULIDAE FAMILY.

Publications (2)

Publication Number Publication Date
WO2011009975A2 true WO2011009975A2 (en) 2011-01-27
WO2011009975A3 WO2011009975A3 (en) 2011-07-14

Family

ID=43499465

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2010/000314 WO2011009975A2 (en) 2009-07-22 2010-07-19 Method for detecting and identifying species of the family engraulidae

Country Status (2)

Country Link
ES (1) ES2376683B1 (en)
WO (1) WO2011009975A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2392610A1 (en) * 2011-04-04 2012-12-12 Universidad Del Pais Vasco - Euskal Herriko Unibertsitatea Method of genetic identification of european anchovy and its geographical origin or population. (Machine-translation by Google Translate, not legally binding)
NO337188B1 (en) * 2013-04-08 2016-02-08 Niva COMPAS-PCR Method and Methods for Detecting, Identifying or Monitoring Salmon Species, Kits, and Using the Method and Kits
CN109439739A (en) * 2018-08-16 2019-03-08 浙江海洋大学 Yellow crucian carp high density SNP marker screening technique and application

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
ASENSIO, L.: 'Application of multiplex PCR for the identification of grouper meals in the restaurant industry.' FOOD CONTROL. vol. 19, no. 11, November 2008, ISSN 0956-7135 pages 1096 - 1999 *
HICHAM, C. ET AL.: 'Analisis molecular de familias multigenicas ribosomales y de snRNAs y su uso como herramientas para diferenciar entre especies de la famila de Engraulidae. XVII Seminario de Genetica de Poblaciones y Evolucion.' RIBADESELLA., [Online] November 2008, page 30. Retrieved from the Internet: <URL:http://www.segenetica.es/secciones/res umenes/XVII SGPE Ribadesella 2008.pdf> [retrieved on 2010-11-24] *
MARTINS, C. ET AL.: 'Organization and evolution of 5S ribosomal DNA in the fish genome.' FOCUS ON GENOME RESEARCH. 2004, pages 335 - 363 *
PINHAL, D. ET AL.: 'Discrimination of shark species by simple PCR of 5S rDNA repeats.' GENETICS AND MOLECULAR BIOLOGY. vol. 31, no. 1, April 2008, ISSN 1415-4757 pages 361 - 365 *
RASMUSSEN, R. S. ET AL.: 'Application of DNA-based methods to identify fish and seafood substitution on the commercial market.' COMPREHENSIVE REVIEWS IN FOOD SCIENCE AND FOOD SAFETY. vol. 8, no. 2, April 2009, pages 118 - 154 *
RASMUSSEN, R. S. ET AL.: 'DNA-based methods for the identification of commercial fish and seafood species.' COMPREHENSIVE REVIEWS IN FOOD SCIENCE AND FOOD SAFETY. vol. 7, no. 3, June 2008, pages 280 - 295 *
WASKO, A. P. ET AL.: 'Molecular organization of 5S rDNA in fishes of the genus Brycon.' GENOME. vol. 44, no. 5, October 2001, ISSN 0831-2796 pages 893 - 902 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2392610A1 (en) * 2011-04-04 2012-12-12 Universidad Del Pais Vasco - Euskal Herriko Unibertsitatea Method of genetic identification of european anchovy and its geographical origin or population. (Machine-translation by Google Translate, not legally binding)
NO337188B1 (en) * 2013-04-08 2016-02-08 Niva COMPAS-PCR Method and Methods for Detecting, Identifying or Monitoring Salmon Species, Kits, and Using the Method and Kits
CN109439739A (en) * 2018-08-16 2019-03-08 浙江海洋大学 Yellow crucian carp high density SNP marker screening technique and application

Also Published As

Publication number Publication date
ES2376683B1 (en) 2013-01-28
ES2376683A1 (en) 2012-03-16
WO2011009975A3 (en) 2011-07-14

Similar Documents

Publication Publication Date Title
ES2690753T3 (en) Increased confidence in allele identifications with molecular count
BR112020006757A2 (en) Crispr effector system based diagnostics
do Carmo Bittencourt-Oliveira et al. Cylindrospermopsin in water supply reservoirs in Brazil determined by immunochemical and molecular methods
WO2014135838A1 (en) Enzyme stalling method
JP2008206521A5 (en)
JP2013055956A5 (en)
RU2017131622A (en) METHODS FOR HIGH-PARALLEL AND PRECISE MEASUREMENT OF NUCLEIC ACIDS
WO2007123386A1 (en) Method for detection and multiple, simultaneous quantification of pathogens by means of real-time polymerase chain reaction
Tian et al. Visual single cell detection of dual-pathogens based on multiplex super PCR (MS-PCR) and asymmetric tailing HCR (AT-HCR)
CN104531887A (en) Identification method for Klebsiella pneumoniae and adopted primers
CN105567789A (en) PCR primer pair composition for identification or assisted identification of idioplasm of sturgeon, and applications thereof
RU2014107908A (en) MUTATIONS IN THE EPIDERMAL GROWTH FACTOR RECEPTOR GENE
Zahn et al. Development of a DNA mini-barcoding protocol targeting COI for the identification of elasmobranch species in shark cartilage pills
WO2011009975A2 (en) Method for detecting and identifying species of the family engraulidae
WO2022051667A1 (en) Crispr effector system based diagnostics for virus detection
Huang et al. High-throughput gender identification of three Columbidae species using melting curve analysis
CN103014175A (en) PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) method for identifying seven sea cucumber species
CN105821155A (en) Molecular marker related to prawn WSSV resistance and application thereof
WO2008066730A3 (en) Pna-dna oligomers and methods of use thereof
ES2821751T3 (en) Procedures and kits for the detection of powdery mildew
WO2015044472A1 (en) Method for the simultaneous detection of pathogenic micro-organisms
KR101648252B1 (en) Method of collecting nucleic acid fragments separated from the sequencing process
CN108251534B (en) Multiple PCR detection kit for rapidly detecting meat-derived food
ES2319009B2 (en) METHOD OF IDENTIFICATION OF SPECIES OF THE PENAEOID SUPERFAMILY BY DNA ANALYSIS.
CN102851361B (en) Detection primer kit for salmonella, salmonella enteritidis and salmonella typhimurium by PCR pyrophosphoric acid method and detection method

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10801980

Country of ref document: EP

Kind code of ref document: A2