WO2010126211A1 - 오스테오폰틴의 돌연변이체 또는 발현억제제를 함유하는 폐암 예방 및 치료용 조성물 - Google Patents

오스테오폰틴의 돌연변이체 또는 발현억제제를 함유하는 폐암 예방 및 치료용 조성물 Download PDF

Info

Publication number
WO2010126211A1
WO2010126211A1 PCT/KR2009/005608 KR2009005608W WO2010126211A1 WO 2010126211 A1 WO2010126211 A1 WO 2010126211A1 KR 2009005608 W KR2009005608 W KR 2009005608W WO 2010126211 A1 WO2010126211 A1 WO 2010126211A1
Authority
WO
WIPO (PCT)
Prior art keywords
osteopontin
opn
mutant
composition
lung cancer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2009/005608
Other languages
English (en)
French (fr)
Inventor
조명행
장승희
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SNU R&DB Foundation
Original Assignee
SNU R&DB Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SNU R&DB Foundation filed Critical SNU R&DB Foundation
Publication of WO2010126211A1 publication Critical patent/WO2010126211A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/51Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18Growth factors; Growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]

Definitions

  • the present invention relates to a mutant or expression inhibitor of osteopontin and a composition for preventing and treating lung cancer containing the same.
  • Osteopontin is a phosphoprotein that contains a unique Arg-Gly-Asp (RGD) cell-binding sequence, which is expressed in rat osteosarcoma ROS 17 / 2.8. First isolated (Oldberg et al., 1986).
  • OPN is secreted from osteoblasts and osteoclasts and acts as a bridge, Latin pons, and attaches cells to the substrate (Reinholt et al., 1990).
  • OPN is expressed in various tissues such as kidneys, the inner ear, smooth muscles of the arteries, and gut epithelium, in addition to bones, and suggests that the function is also very different (Brown et al., 1992; Denhardt). & Guo, 1993).
  • Osteopontin is a highly phosphorylated sialoprotein, a salient component of the mineralized extracellular matrix of bone and teeth. OPN is characterized by the presence of sites of Ser / Thr phosphorylation mediating polyaspartic acid sequences and hydroxyapatite binding and largely preserved RGD motifs mediating cell adhesion / signaling. Expression of osteopontin in various tissues represents a variety of functions including one or more of these conserved motifs.
  • Osteopontin is also named Eta-1.
  • WO 00/63241 relates to a method of regulating an immune response, in particular a method of regulating type 1 immune response using modulators of Eta-1 (early T lymphocyte activation-1) / osteopontin.
  • Osteopontin modulators are described as useful for the treatment of infections, immune disorders and diseases, autoimmune disorders including MS, various immunodeficiencies, and cancer.
  • PTM post-translational modification
  • Human OPN has 36 phosphoresidues.
  • the present inventors while studying the function of osteopontin, confirmed that the mutant or expression inhibitor of osteopotin is useful for the prevention and treatment of lung cancer, and came to complete the present invention.
  • one object of the present invention is to provide a mutant or expression inhibitor of osteopontin.
  • Another object of the present invention to provide a composition for preventing and treating lung cancer containing the mutant or expression inhibitor.
  • One mutant of osteopontin is a mutation of the phosphorylation site of osteopontin. It is preferred that phosphorylation does not occur due to phosphorylation site shift.
  • the mutants of osteopontin according to the present invention are Ser8, Ser10, Ser11, Ser46, Ser47, Thr50, Ser60, Ser62, Ser65, Ser83, Ser86, Ser89, Ser92, Ser101, Ser104, Ser107 Serine at a position selected from the group consisting of: Ser110, Ser113, Thr169, Ser175, Ser179, Ser199, Ser203, Ser208, Ser212, Ser218, Ser238, Ser247, Ser251, Ser254, Ser259, Ser264, Ser275, Ser287, Ser292 and Ser294 It may be mutated to residues other than.
  • Residues other than serine may be selected from alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, histidine, isoleucine, lysine, leucine, glutamine, methionine, arginine, asparagine, proline, threonine, valine, tryptophan and tyrosine .
  • Another mutant of osteopontin is a mutation in the O-glycosylation position of osteopontin. It is preferable that glycosylation does not occur due to the glycosylation position shift. Preferably, it means that the threonine at a position selected from the group consisting of Thr118, Thr122, Thr127, Thr131, and Thr136 of osteopontin is mutated to a residue other than threonine.
  • Residues other than threonine may be selected from alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, histidine, isoleucine, lysine, leucine, glutamine, methionine, arginine, asparagine, proline, serine, valine, tryptophan and tyrosine .
  • Another mutant of osteopontin is a mutation in the N-glycosylation position of osteopontin. It is preferable that glycosylation does not occur due to the glycosylation position shift. Preferably, it means that asparagine at a position selected from Asn63 and Asn90 of osteopontin is mutated to a residue other than asparagine.
  • Residues other than asparagine may be selected from alanine, cysteine, aspartic acid, glutamic acid, phenylalanine, glycine, histidine, isoleucine, lysine, leucine, glutamine, methionine, arginine, threonine, proline, serine, valine, tryptophan and tyrosine. .
  • the mutants of osteopontin according to the present invention can be prepared according to a conventional gene mutant production method, and in one embodiment, can be prepared using site-directed mutagenesis.
  • “inhibition of expression of osteopontin” includes inhibition of gene transcription and translation into protein. Also included are not only completely stopped gene expression but also reduced expression.
  • Antisense molecules inhibit the expression of target genes by inhibiting transcriptional initiation by triple chain formation, transcriptional inhibition by hybridization at sites where local open loop structure is formed by RNA polymerase, and in RNA where synthesis is in progress. Inhibition of transcription by hybrid formation, inhibition of splicing by hybridization at the junction of introns and exons, inhibition of splicing by hybridization at the site of splicosomal formation, transition from nucleus to cytoplasm by hybridization with mRNA Inhibition of translation initiation by hybridization at the site of translation initiation factor binding. They inhibit the expression of target genes by inhibiting transcription, splicing or translation processes.
  • the antisense molecule used in the present invention may inhibit the expression of the target gene by any of the above actions.
  • Representative antisense molecules include triplets, ribozymes, RNAi, or antisense nucleic acids.
  • the triple agent allows the initiation of transcription to be suppressed by winding around double helix DNA to form a three-stranded helix (Maher et al., Antisense Res. And Dev ., 1 (3): 227, 1991; Helene, C., Anticancer Drug Design , 6 (6): 569, 1991).
  • Ribozymes are RNA enzymes that possess the ability to specifically cleave single-stranded RNA. Ribozymes inhibit protein expression of target genes by recognizing and site-specific cleavage of specific nucleotide sequences in target RNA molecules (Cech, J. Amer. Med. Assn ., 260: 3030, 1998; Sarver et al., Science 247: 1222-1225, 1990).
  • RNAi RNA interference
  • RNA interference is a method of inhibiting gene expression at the transcriptional level or at the post-transcriptional level by using RNA of hairpin type small molecule that acts in sequence (Mette et al., EMBO J. , 19: 5194-). 5201, 2000).
  • the small molecule RNA used in the RNAi method is a double-stranded RNA molecule having homology with the target gene.
  • RNA molecules As a method of preparing the RNA molecule in the above, known chemical synthesis methods and enzymatic methods can be used.
  • the chemical synthesis of RNA molecules can use the methods described in the literature (Verma and Eckstein, Annu. Rev. Biochem. 67, 99-134, 1999), and the enzymatic synthesis of RNA molecules is T7, T3.
  • phage RNA polymerases such as SP6 RNA polymerase are disclosed in the literature (Milligan and Uhlenbeck, Methods Enzymol . 180: 51-62, 1989).
  • Antisense nucleic acids refer to DNA or RNA molecules that are at least partially complementary to a target mRNA molecule (Weintraub, Scientific American , 262: 40, 1990). In cells, antisense nucleic acids hybridize with their corresponding mRNAs to form double-stranded molecules that inhibit protein translation by inhibiting mRNA translation of target genes (Marcus-Sakura, Anal. Biochem ., 172: 289, 1988). The antisense nucleic acid may be prepared by any suitable method known in the art, preferably in the form of oligonucleotides.
  • the antisense oligonucleotides may be used in chemical synthesis, for example, such as phosphoramidite chemistry, which is sulfided with tetraethylthiuram disulfide in acetonitrile as described in Tetrahedron Lett ., 1991, 32, 30005-30008. It can manufacture very easily.
  • the antisense molecule as expression suppression is particularly preferably an shRNA consisting of the nucleotide sequences shown in SEQ ID NO: 7 and SEQ ID NO: 8.
  • mutants or expression inhibitors of osteopontin can be introduced in vivo via conventional gene carriers.
  • the gene carriers include adenovirus, adeno-associated virus, retrovirus, lentivirus, herpes simplex virus, alpha virus, and the like. However, it is not limited thereto.
  • a non-viral vector useful for delivering a mutant or expression inhibitor of osteopontin to a cell in the present invention means any vector that is commonly used for intracellular delivery of genes, except for the above-described viral vectors, and such examples.
  • various plasmids and liposomes that can be expressed in eukaryotic cells are commonly used for intracellular delivery of genes, except for the above-described viral vectors, and such examples.
  • the gene carrier containing the mutant or expression inhibitor of osteopontin of the present invention will be operably linked to the promoter in order for the mutant or expression inhibitor to be transcribed in the cell.
  • the promoter includes a binding site for the RNA polymerase and may be located upstream of the coding region.
  • the promoter may be any promoter capable of initiating transcription in eukaryotic cells, but preferred promoters are CMV (Cytomegalovirus), SV40 (Simian virus 40), TK (Thymidine kinase), RSV (Respiratory syncytial virus), CMV5, etc. Is a promoter derived from.
  • the gene carrier containing the mutant or expression inhibitor of the osteopontin of the present invention may include the origin of replication of eukaryotic cells, the start codon for efficient transcription or translation of nucleic acid molecules encoding the mutant or expression inhibitor , Termination codons, polyadenylation signals, Kozak, enhancers, signal sequences for membrane targeting and secretion, regulatory sequences consisting of IRES (Internal Ribosome Entry Site) and the like.
  • IRES Internal Ribosome Entry Site
  • operably linked means that the binding between nucleic acid sequences is functionally related.
  • the case where any nucleic acid sequence is operably linked is when any nucleic acid sequence is positioned to be functionally related to another nucleic acid sequence.
  • any transcriptional regulatory sequence affects the transcription of a mutant or expression inhibitor of osteopontin, the transcriptional regulatory sequence is said to be operably linked to the nucleic acid molecule.
  • a mutant or expression inhibitor of osteopontin can be administered through any route.
  • the compositions of the present invention may be used in various forms including topical (including buccal, sublingual, skin and intraocular), parenteral (including subcutaneous, intradermal, intravascular and intraarticular) or transdermal administration. Administration can be by route. In the present invention, in particular, it may be administered through aerosol gene delivery.
  • mutants or expression inhibitors of osteopontin can be administered to a subject by suspending in a suitable diluent, which diluent is used for the protection and maintenance of cells and for ease of use when infused into a desired tissue. do.
  • the diluent may be a saline solution, a buffer solution such as PBS, HBSS, plasma, cerebrospinal fluid (CSF) or blood components.
  • the mutant or expression inhibitor of osteopontin can be used in admixture with a pharmaceutically acceptable carrier according to conventional methods.
  • suitable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • the composition may further include a filler, an anticoagulant, a lubricant, a humectant, a perfume, an emulsifier, a preservative, and the like.
  • compositions of the invention can be formulated using methods well known in the art to provide rapid or delayed release of the active ingredient after administration to a subject.
  • the formulations may be in the form of tablets, powders, pills, emulsions, solutions, syrups, aerosols, soft or hard gelatin capsules, sterile injectable solutions, sterile powders and the like.
  • the formulation will be convenient in a single dosage form.
  • composition of the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease, and an effective dose level may include the severity of the disease; The age, body weight, health and sex of the patient; Sensitivity to the drug of the patient; Time of administration, route of administration, and rate of excretion; Duration of treatment; It may be determined according to factors including drugs used in combination or coincidental with the composition of the present invention and other factors known in the medical field.
  • the pharmaceutical composition of the present invention may vary the effective amount depending on the extent of the disease, preferably 1 to 10,000 g / weight kg / day, more preferably 10 to 1000 mg / kg / day The effective amount may be repeated several times a day.
  • mutants or expression inhibitors of osteopontin are useful for the prevention and treatment of lung cancer.
  • Figure 1 shows the degree of OPN expression for each lung cell line.
  • Figure 3 shows the effect of OPN-3mts in the Akt1-p70S6K pathway.
  • FIG. 4 shows the effect of OPN-3mts in GalNAc-T.
  • Figure 5 shows the effect of reducing OPN at A549 upon lentiviral-OPN treatment.
  • RNA Extraction of total RNA from NHBE (Nontumorigenic Human Bronchial Epithelial), a human lung cancer cell line, and forward primer (5'-GCTCTAGAATGAGAATTGCAGTGATTTG-3 ', SEQ ID NO: 1) and Kpn I restriction enzyme site containing Xba I restriction enzyme site Using a reverse primer (5'-CGGGGTACCTTAATTGACCTCAGAAGATGC-3 ', SEQ ID NO: 2), including 30 minutes at 45 °C, 15 minutes at 94 °C 45 seconds at 45 °C, 45 seconds at 53 °C, 60 seconds at 72 °C After repeating 30 times and left standing at 72 °C for 5 minutes, RT (Reverse Transcription) -PCR under the conditions of storage at 4 °C to obtain a human OPN gene.
  • forward primer 5'-GCTCTAGAATGAGAATTGCAGTGATTTG-3 ', SEQ ID NO: 1
  • Kpn I restriction enzyme site containing Xba I restriction enzyme
  • This gene and the pcDNA3.1 (-) vector (Invitrogen) were treated with Xba I and Kpn I, and then ligated to produce an OPN wild-type construct [OPN-WT / pcDNA3.1 (-)].
  • H226 cell lines were grown in 6-well plates and infected with OPN wild type and OPN variant using Trans ITR-LT1 reagent. After incubation for 24 hours, the medium was replaced and the cell line was incubated for an additional 48 hours in fresh medium. Washed twice in cold PBS and harvested cells for RT-PCR analysis.
  • OPN forward primer 5'-GCAGAATCTCCTACCCCAC -3 '(SEQ ID NO: 3)
  • OPN reverse primer 5'- TCGGAATGCTCATTGCTCTC-3 '(SEQ ID NO: 4)
  • GAPDH forward primer 5'-GAAGGACTCAGACCACAG-3 '(SEQ ID NO: 5)
  • GAPDH reverse primer 5'-CTTCACCACCTTCTTGATG-3 '(SEQ ID NO .: 6)
  • reaction conditions were as follows: after reverse transcription at 45 ° C. for 30 minutes, initial PCR activation at 94 ° C. for 5 minutes, followed by PCR for 60 seconds at 94 ° C., 60 seconds at 49 ° C., and 60 seconds at 72 ° C. 35 was performed twice. PCR products were analyzed on 1% agarose gel.
  • OPN activates the PI3K (Phosphatidylinositol 3-kinase) pathway through the ⁇ v ⁇ 3 integrin in human lung cancer cell lines (Fong et al. Lung Cancer, 2008), and how OPN-3mts affects this pathway.
  • Western blot and immunofluorescence staining were performed (FIG. 3).
  • OPN-WT Wild Type
  • OPN-3mts showed a significant decrease in PI3K downstream Akt1 and their phosphorylation types (Thr308 and Ser473) by Western Blot (A).
  • Western blot (B) and fluorescence immunostaining (C) were also found to decrease p70S6K and p-p70S6K proteins downstream of Akt1.
  • FITC represents the level of protein expression
  • DAPI stains the nuclei of cells.
  • OPN is a glyco-phospho protein and glycosylation is an important process for this protein.
  • O-glycosylation is the connection of GalNAc (N-acetylgalactosamine) to the hydroxyl group of serine and threonine, which causes the reaction of GalNAc Transferase (UDP-N-acetyl-alpha-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase) 1 and 2
  • GalNAc-T1 increased in OPN-WT but did not increase in 3mts as shown in FIG. 4.
  • GalNAc-T2 had no change.
  • the 3mts form shows that O-glycosylation of OPN hardly occurs. Therefore, using this 3mts will be able to prevent or treat cancer formation by OPN.
  • sh-OPN-Top 5'-CACCG GTCAGCTGGATGACCAGAGTG CGAACACTCTGGTCATCCAGCTGAC-3 ', SEQ ID NO: 7
  • sh-OPN-Bottom 5'-AAAA GTCAGCTGGATGACCAGAGTG TTCGCACTCTGGTCATCCAGCTGACC-3', SEQ ID NO: 8).
  • sh-Scramble-Top 5'-CACCG AATCGCATAGCGTATGCCG CGAACGGCATACGCTATGCGATT-3 ', SEQ ID NO: 9
  • sh-Scramble-Bottom 5'-AAAA AATCGCATAGCGTATGCCG TTCGCGGCATACGCTATGCGATTC-3', SEQ ID NO: 10
  • shRNAs were generated based on the shRNA sequences and cloned into pENTR / U6 TM entry vector (Invitrogen, Carlsbad, Calif.). Cassettes containing the U6 promoter and shRNA target sequences were transferred to a lentiviral vector (pLenti6 / BLOCK-iT TM -DEST vector) according to the manufacturer's instructions (BLOCK-iT TM Lentiviral RNAi Expression System, Invitrogen). Recombinant lentiviral vectors were packaged using ViraPower TM Lentiviral Packaging Mix (Invitrogen), and the titer of the virus was determined using HIV-1 p24 ELISA KIT (PerkinElmer Life Sciences, Boston, Mass.).
  • composition of the present invention can be used for the prevention and treatment of lung cancer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Toxicology (AREA)
  • Wood Science & Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 오스테오폰틴(osteopontin)의 돌연변이체 또는 발현억제제 및 이를 함유하는 폐암 예방 및 치료용 조성물에 관한 것이다.

Description

오스테오폰틴의 돌연변이체 또는 발현억제제를 함유하는 폐암 예방 및 치료용 조성물
본 발명은 오스테오폰틴의 돌연변이체 또는 발현억제제 및 이를 함유하는 폐암 예방 및 치료용 조성물에 관한 것이다.
Osteopontin (OPN)은 고유한 Arg-Gly-Asp (RGD) 세포부착 서열(cell-binding sequence)을 포함하고 있는 인단백질(phosphoprotein)로, 흰쥐의 배양된 뼈세포(rat osteosarcoma ROS 17/2.8)에서 처음 분리되었다 (Oldberg et al., 1986).
OPN은 뼈모세포와 뼈파괴세포에서 분비되어 일종의 가교(bridge, Latin pons) 역할을 하며 세포들을 기질에 부착시키는 역할을 한다 (Reinholt et al., 1990). 그러나 많은 연구자들은 OPN이 뼈 외에도 콩팥을 비롯한 속귀, 동맥의 평활근육, 소화관상피 등의 다양한 조직에서 발현되는 것을 확인하였으며 그 기능 또한 매우 다를 것이라는 의견을 제시하고 있다(Brown et al., 1992; Denhardt & Guo, 1993).
오스테오폰틴(Osteopontin)은 골 및 치아의 광물화된 세포외의 매트릭스의 현저한 구성성분인 높게 인산화된 시알로프로테인이다. OPN은 폴리아스파르트 산 시퀀스 및 하이드록시아파타이트 결합(hydroxyapatite binding)을 매개하는 Ser/Thr 인산화반응의 사이트의 존재와 세포 부착/신호화를 매개하는 크게 보전된 RGD 모티브(motif)에 의해 특징되어진다. 다양한 조직에서의 오스테오폰틴의 발현은 하나 또는 그 이상의 이들 보전된 모티브를 포함하는 기능의 다양성을 나타낸다. OPN '녹아웃' 마우스들에서 명확한 표현형의 결여가 조직에서의 오스테오폰틴에 대한 명확한 역할이 확립되지 않았지만, 최근 연구는 전개적 과정, 상처 치료, 면역학적 반응, 종양형성, 골 흡수, 및 칼슘침착을 포함하는 다양한 생물학적 사건에 있어 이들 프로테인의 다양성에 있어 몇몇 신규하고 암시적인 통찰을 제공한다. 몇몇 상호활성인 신호화 경로에 연결된 복합 수용체를 통한 세포 활성을 자극하기 위한 오스테오폰틴의 능력은 상당한 기능적 다양성에 고려될 수 있다(Sodek 등). 오스테오폰틴은 또한 Eta-1로 명명된다. WO 00/63241은 면역 반응을 조절하는 방법, 특히 Eta-1(조기 T 림프구 활성화-1)/오스테오폰틴의 조절자를 사용하여 타입1의 면역 반응을 조절하는 방법에 관한 것이다. 오스테오폰틴 조절자는 감염, 면역 장애 및 질환, MS를 포함하는 자가면역 장애, 다양한 면역결핍증, 및 암의 치료에 유용하다고 기술된다.
OPN 기능의 중요한 조절은 post-translational modification (PTM)에 의하여 일어난다.
사람의 OPN는 36개의 인산화 위치 (phosphoresidue)를 가지고 있다.
29개의 phosphorylations (Ser8, Ser10, Ser11, Ser46, Ser47, Thr50, Ser60, Ser62, Ser65, Ser83, Ser86, Ser89, Ser92, Ser104, Ser110, Ser113, Thr169, Ser179, Ser208, Ser218, Ser238, Ser247, Ser254, Ser259, Ser264, Ser275, Ser287, Ser292, Ser294)는 MGCK(mammary gland casein kinase Golgi kinase (S/T-X-E/S(P)/D)에 위치하고 있으며, 6개의 phosphorylations (Ser101, Ser107, Ser175, Ser199, Ser212, Ser251)은 CKII (casein kinase II) [S-X-X-E/S(P)/D]에 위치하고 있다. phosphorylation Ser203은 MGCK나 CKII가 아닌 단독으로 위치하고 있다.
5개의 threonine residues (Thr118, Thr122, Thr127, Thr131, Thr136)는 O-glycosylaion 위치이다(Christensen et al. Biochem J. 390:285-292 (2005)).
본 발명자는 오스테오폰틴의 기능에 대하여 연구하던 중 오스테오포틴의 돌연변이체 또는 발현억제제가 폐암의 예방 및 치료에 유용하다는 것을 확인하고, 본 발명을 완성하기에 이르렀다.
따라서, 본 발명의 한 목적은 오스테오폰틴의 돌연변이체 또는 발현억제제를 제공하는데 있다.
본 발명의 다른 목적은 상기 돌연변이체 또는 발현억제제를 함유하는 폐암 예방 및 치료용 조성물을 제공하는데 있다.
오스테오폰틴(Osteopontin)의 한 돌연변이체는 오스테오폰틴의 인산화 위치가 변이된 것이다. 인산화 위치 변이로 인해 인산화가 일어나지 않는 것이 바람직하다. 바람직하게는, 본 발명에 따른 오스테오폰틴의 돌연변이체는 오스테오폰틴의 Ser8, Ser10, Ser11, Ser46, Ser47, Thr50, Ser60, Ser62, Ser65, Ser83, Ser86, Ser89, Ser92, Ser101, Ser104, Ser107, Ser110, Ser113, Thr169, Ser175, Ser179, Ser199, Ser203, Ser208, Ser212, Ser218, Ser238, Ser247, Ser251, Ser254, Ser259, Ser264, Ser275, Ser287, Ser292 및 Ser294로 이루어진 그룹으로부터 선택된 위치의 세린이 세린 이외의 잔기로 변이된 것일 수 있다. 세린 이외의 잔기는, 알라닌, 시스테인, 아스파르트산, 글루탐산, 페닐알라닌, 글리신, 히스티딘, 이소루신, 리신, 루신, 글루타민, 메티오닌, 아르기닌, 아스파라긴, 프롤린, 트레오닌, 발린, 트립토판 및 티로신 중에서 선택될 수 있다.
오스테오폰틴의 다른 돌연변이체는 오스테오폰틴의 O-당화(O-glycosylation) 위치가 변이된 것이다. 당화 위치 변이로 인해 당화가 일어나지 않는 것이 바람직하다. 바람직하게는, 오스테오폰틴의 Thr118, Thr122, Thr127, Thr131 및 Thr136로 이루어진 그룹으로부터 선택된 위치의 트레오닌이 트레오닌 이외의 잔기로 변이된 것을 의미한다. 트레오닌 이외의 잔기는, 알라닌, 시스테인, 아스파르트산, 글루탐산, 페닐알라닌, 글리신, 히스티딘, 이소루신, 리신, 루신, 글루타민, 메티오닌, 아르기닌, 아스파라긴, 프롤린, 세린, 발린, 트립토판 및 티로신 중에서 선택될 수 있다.
오스테오폰틴의 또 다른 돌연변이체는 오스테오폰틴의 N-당화(N-glycosylation) 위치가 변이된 것이다. 당화 위치 변이로 인해 당화가 일어나지 않는 것이 바람직하다. 바람직하게는, 오스테오폰틴의 Asn63 및 Asn90 중에서 선택된 위치의 아스파라긴이 아스파라긴 이외의 잔기로 변이된 것을 의미한다. 아스파라긴 이외의 잔기는, 알라닌, 시스테인, 아스파르트산, 글루탐산, 페닐알라닌, 글리신, 히스티딘, 이소루신, 리신, 루신, 글루타민, 메티오닌, 아르기닌, 트레오닌, 프롤린, 세린, 발린, 트립토판 및 티로신 중에서 선택될 수 있다.
본 발명에 따른 오스테오폰틴의 돌연변이체는 통상의 유전자 돌연변이체 제조방법에 따라 제조할 수 있으며, 한 양태로서, 위치 지정 돌연변이(site-directed mutagenesis)를 이용하여 제조할 수 있다.
본 발명에서 "오스테오폰틴의 발현 억제"에는 유전자 전사의 억제 및 단백질로의 번역 억제가 포함된다. 또한, 유전자 발현이 완전히 정지된 것 뿐만 아니라 발현이 감소된 것도 포함된다.
유전자의 발현을 억제하는 방법으로는 안티센스 분자를 이용하는 것이 바람직하다. 안티센스 분자가 표적 유전자의 발현을 억제하는 작용으로는 삼중쇄 형성에 의한 전사개시 저해, RNA 폴리머라제에 의해 국부적인 개상 루프 구조가 만들어진 부위에서 하이브리드 형성에 의한 전사 억제, 합성이 진행되고 있는 RNA에서 하이브리드 형성에 의한 전사 저해, 인트론과 엑손과의 접합점에서 하이브리드 형성에 의한 스플라이싱 억제, 스플라이소좀 형성 부위에서 하이브리드 형성에 의한 스플라이싱 억제, mRNA와의 하이브리드 형성에 의한 핵으로부터 세포질로의 이행 억제, 번역 개시인자 결합 부위에서 하이브리드 형성에 의한 번역개시 억제 등이 있다. 이들은 전사, 스플라이싱 또는 번역 과정을 저해하여 표적 유전자의 발현을 억제한다.
본 발명에 사용되는 안티센스 분자는 상기의 어느 작용으로든지 표적 유전자의 발현을 억제해도 좋다. 대표적인 안티센스 분자로는 3중제, 리보자임(ribozyme), RNAi, 또는 안티센스 핵산 등이 포함된다.
3중제는 이중 나선 DNA 주변을 감아 3 본쇄 나선을 형성하도록 함으로써 전사 개시가 억제되도록 한다(Maher et al., Antisense Res. and Dev., 1(3):227, 1991; Helene, C., Anticancer Drug Design, 6(6):569, 1991).
리보자임은 1 본쇄 RNA를 특이적으로 절단하는 능력을 보유한 RNA 효소이다. 리보자임은 표적 RNA 분자 내 특정 뉴클레오티드 서열을 인식하여 부위 특이적으로 절단시킴으로써 표적 유전자의 단백질 발현을 억제한다(Cech, J. Amer. Med. Assn., 260:3030, 1998; Sarver et al., Science 247:1222-1225, 1990).
RNAi(RNA interference)는 염기서열 특이적으로 작용하는 헤어핀 형태의 소분자의 RNA를 사용하여 전사 수준 혹은 전사 후 수준에서 유전자 발현을 억제시키는 방법이다(Mette et al., EMBO J., 19: 5194-5201, 2000). 상기 RNAi 방법에 사용되는 소분자 RNA는 표적 유전자와 상동성을 가지는 이중가닥 RNA 분자이다.
상기에서 RNA 분자를 제조하는 방법으로는 공지된 화학적 합성 방법 및 효소적 방법을 사용할 수 있다. 예를 들면, RNA 분자의 화학적 합성은 문헌에 개시되어 있는 방법을 사용할 수 있으며(Verma and Eckstein, Annu. Rev. Biochem. 67, 99-134, 1999), RNA 분자의 효소적 합성은 T7, T3 및 SP6 RNA 폴리머라제와 같은 파아지 RNA 폴리머라제를 이용하는 방법이 문헌에 개시되어 있다(Milligan and Uhlenbeck, Methods Enzymol. 180:51-62, 1989).
안티센스 핵산은 표적 mRNA 분자와 적어도 일부분이 상보적인 DNA 또는 RNA 분자를 말한다(Weintraub, Scientific American, 262:40, 1990). 세포 내에서, 안티센스 핵산은 이에 상응하는 mRNA와 혼성화되어 2본쇄 분자를 형성함으로써 표적 유전자의 mRNA 해독을 저해하여 단백질 발현을 억제한다(Marcus-Sakura, Anal. Biochem., 172:289, 1988). 상기 안티센스 핵산은 바람직하게는 올리고뉴클레오타이드 형태로서 당업계에 공지된 임의의 적합한 방법에 의해 제조할 수 있다. 상기 안티센스 올리고뉴클레오타이드는 화학 합성법, 예를 들어 문헌(Tetrahedron Lett., 1991, 32, 30005-30008)에 기재된 바와 같이 아세토니트릴 중에서 테트라에틸티우람 디술파이드로 황화시키는 포스포아미다이트 화학과 같은 방법에 의해 매우 용이하게 제조할 수 있다.
본 발명에서, 발현억제로서의 안티센스 분자는 서열번호: 7 및 서열번호: 8에 나타낸 염기서열로 이루어진 shRNA인 것이 특히 바람직하다.
본 발명에서, 오스테오폰틴의 돌연변이체 또는 발현억제제는 통상의 유전자 전달체를 통하여 생체내로 도입될 수 있다. 상기 유전자 전달체로는 아데노바이러스(adenovirus), 아데노부속바이러스(adeno-associated virus), 레트로바이러스(retrovirus), 렌티바이러스(lentivirus), 단순포진바이러스(herpes simplex virus), 알파바이러스(alpha virus) 등이 있지만, 이에 제한되는 것은 아니다.
또한, 본 발명에서 오스테오폰틴의 돌연변이체 또는 발현억제제를 세포로 전달하기에 유용한 비바이러스 벡터로는 전술한 바이러스 벡터를 제외한 통상적으로 유전자의 세포내 전달에 사용되는 모든 벡터를 의미하며, 그러한 예로는 진핵세포에서 발현 가능한 다양한 플라스미드 및 리포좀 등이 있다.
한편, 본 발명의 오스테오폰틴의 돌연변이체 또는 발현억제제를 함유하는 유전자 전달체는 상기 돌연변이체 또는 발현억제제가 세포내에서 전사되도록 하기 위해서 프로모터에 작동가능하게 연결되어야 할 것이다. 프로모터는 RNA 중합효소에 대한 결합 부위를 포함하고, 암호화 영역의 상류(upstream)에 위치할 수 있다. 상기 프로모터는 진핵세포에서 전사를 개시할 수 있는 프로모터라면 어떤 것이든지 무방하나, 바람직한 프로모터는 CMV(Cytomegalovirus), SV40(Simian virus 40), TK(Thymidine kinase), RSV(Respiratory syncytial virus), CMV5 등으로부터 유래된 프로모터이다.
또한, 본 발명의 오스테오폰틴의 돌연변이체 또는 발현억제제를 함유하는 유전자 전달체는 진핵세포의 복제원점을 포함할 수 있으며, 돌연변이체 또는 발현억제제를 암호화하는 핵산분자의 효율적인 전사 또는 해독을 위하여 개시코돈, 종결코돈, 폴리아데닐화 시그널, 코작(Kozak), 인핸서, 막 표적화 및 분비를 위한 신호서열, IRES(Internal Ribosome Entry Site) 등으로 이루어진 조절서열을 포함할 수 있다.
여기서, 이용된 용어 ‘작동가능하게 연결된’이란 핵산 서열간의 결합이 기능적으로 연관되어 있는 것을 의미한다. 임의의 핵산서열이 작동가능하게 연결된 경우는 임의의 핵산서열이 다른 핵산서열과 기능적으로 관련성을 가지도록 위치해 있는 경우이다. 본 발명에 있어서, 임의의 전사 조절서열이 오스테오폰틴의 돌연변이체 또는 발현억제제를 암호화하는 핵산분자의 전사에 영향을 미치는 경우, 상기 전사 조절서열이 상기 핵산분자와 작동가능하게 연결되어 있다고 말한다.
본 발명에서는 오스테오폰틴의 돌연변이체 또는 발현억제제를 어떠한 경로를 통해서든지 투여 가능하다. 따라서, 본 발명의 조성물은 국소 (협측(buccal), 설하, 피부 및 안내의 투여를 포함), 비경구(피하, 피내 근육내, 혈관내 및 관절내의 투여를 포함) 또는 경피성 투여를 포함한 여러 경로를 통해 투여할 수 있다. 본 발명에서는 특히, 에어로졸 유전자 전달(aerosol gene delivery)을 통해 투여할 수도 있다.
한 양태로서, 오스테오폰틴의 돌연변이체 또는 발현억제제는 적합한 희석제에 현탁시켜 개체에 투여할 수 있는데, 이 희석제는 세포를 보호 및 유지하고, 목적하는 조직에 주입시 사용에 용이하도록 하는 용도로서 사용된다. 상기 희석제는 생리식염수, PBS, HBSS 등의 완충용액, 혈장, 뇌척수액(cerebrospinal fluid, CSF) 또는 혈액성분 등이 있을 수 있다.
다른 양태로서, 오스테오폰틴의 돌연변이체 또는 발현억제제는 통상적인 방법에 따라 약제학적으로 허용되는 담체와 혼합하여 사용할 수 있다. 적합한 담체의 예로는, 락토오스, 덱스트로오스, 수크로오스, 솔비톨, 만니톨, 자일리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로오스, 메틸 셀루로오스, 미정질 셀루로오스, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 필요에 따라 상기 조성물에 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명의 조성물은 개체에 투여된 후 유효 성분의 신속 또는 지연된 방출을 제공할 수 있도록 당업계에 잘 알려진 방법을 사용하여 제형화될 수 있다. 제형은 정제, 분말, 환제, 에멀전, 용액, 시럽, 에어로졸, 연질 또는 경질 젤라틴 캅셀, 멸균 주사용액, 멸균 분말 등의 형태일 수 있다. 상기 제형은 1회용 투약 형태가 편리할 것이다.
본 발명의 조성물은 약제학적으로 유효한 양으로 투여한다. 본 발명에서 “약제학적으로 유효한 양”은 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 질환의 중증도; 환자의 연령, 체중, 건강, 성별; 환자의 약물에 대한 민감도; 투여 시간, 투여 경로 및 배출 비율; 치료 기간; 사용된 본 발명의 조성물과 배합 또는 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 알려진 요소에 따라 결정될 수 있다. 바람직하게는, 본 발명의 약학적 조성물은 질환의 정도에 따라 유효량을 달리할 수 있으나, 바람직하게는 1~10000㎍/체중kg/day, 더욱 바람직하게는 10~1000㎎/체중kg/day의 유효량으로 하루에 수회 반복 투여될 수 있다.
본 발명에 의하면, 오스테오폰틴의 돌연변이체 또는 발현억제제는 폐암의 예방 및 치료에 유용하다.
도 1은 각 폐 세포주 별 OPN 발현정도를 나타낸 것이다.
도 2는 H226 세포에서의 OPN-WT 및 돌연변이의 발현을 나타낸 것이다.
도 3은 Akt1-p70S6K pathway에서의 OPN-3mts 효과를 나타낸 것이다.
도 4는 GalNAc-T에서의 OPN-3mts 효과를 나타낸 것이다.
도 5는 렌티바이러스-OPN 처리시 A549에서의 OPN의 감소 효과를 나타낸 것이다.
이하, 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1: 플라스미드 컨스트럭트 제작
사람의 폐암 세포주인 NHBE (Nontumorigenic Human Bronchial Epithelial)로부터 전체 RNA를 추출하고, Xba I 제한효소위치를 포함하는 포워드 프라이머 (5'-GCTCTAGAATGAGAATTGCAGTGATTTG-3', 서열번호: 1)와 Kpn I 제한효소위치를 포함하는 리버스 프라이머 (5'-CGGGGTACCTTAATTGACCTCAGAAGATGC-3', 서열번호: 2)를 이용하여 45℃에서 30분, 94℃에서 15분 94℃에서 45초, 53℃에서 45초, 72℃에서 60초를 30회 반복하고 72℃에서 5분간 정치 후 4℃에서 보관하는 조건으로 RT (Reverse Transcription)-PCR을 수행하여 사람의 OPN 유전자를 얻었다. 이 유전자와 pcDNA3.1 (-) vector (Invitrogen)를 Xba I와 Kpn I로 처리한 후, 라이게이션하여 OPN 야생형 컨스트럭트 [OPN-WT / pcDNA3.1 (-)]를 만들었다.
이 OPN-WT을 주형으로 점돌연변이 키트 (QuikChange II Site Directed Mutagenesis Kit, Stratagene)를 이용하여 각각 5개의 당화위치의 트레오닌(Threonine)을 알라닌(Alanine)으로 치환 (T118A, T122A, T127A, T131A, T136A)하여 당화위치 돌연변이 구조를 만들었다.
또한 T122A, T131A, T136A를 동시에 돌연변이 시킨 삼중 변이체 (triple mutant, 3-mts)와 5개 위치 모두 돌연변이화한 5-mts 구조를 만들었다.
실시예 2: 세포 배양
10% 열-불활성화한 FBS, 100 U/ml 페니실린 및 100 ㎍/ml 스트렙토마이신이 보충된 RPMI에서 WI-38, A549, H226, H322, H460 및 H520 세포주를 37°C, 5% CO2로 유지하여 배양하였다.
실시예 3: 일시적 형질감염(Transient transfection)
H226 세포주는 6-웰 플레이트에서 성장시키고, Trans ITR-LT1 시약을 이용하여 OPN 야생형 및 OPN 변이형으로 감염시켰다. 24시간 배양한 후, 배지를 교체하고 세포주는 신선한 배지에서 추가적으로 48시간 배양하였다. 차가운 PBS에서 두 번 세척하고 RT-PCR 분석을 위해 세포들을 수확하였다.
실시예 4: RT-PCR과 단백질 발현 효율 확인
전체 RNA는 제조사의 지시에 따라 TRI 시약을 사용하여 분리하였다. RT-PCR은 ONE-STEP RT-PCR 키트(Intron, Korea)로 다음의 프라이머를 사용하여 실시하였다.
OPN forward primer: 5'-GCAGAATCTCCTACCCCAC -3' (서열번호: 3)
OPN reverse primer: 5'- TCGGAATGCTCATTGCTCTC-3' (서열번호: 4)
GAPDH forward primer: 5'-GAAGGACTCAGACCACAG-3' (서열번호: 5)
GAPDH reverse primer: 5'-CTTCACCACCTTCTTGATG-3' (서열번호: 6)
반응조건은 다음과 같다: 45℃에서 30분간 역전사한 후, 94℃에서 5 분간 초기 PCR 활성화시킨 다음, 94℃에서 60초, 49℃에서 60초, 72℃에서 60초동안 PCR 수행하는 것을 35회 수행하였다. PCR 산물은 1% 아가로스 겔에서 분석하였다.
또한, OPN이 사람의 폐암 세포주에서 αvβ3 인테그린을 통하여 PI3K (Phosphatidylinositol 3-kinase) 경로를 활성화시킨다는 것이 알려져 있으므로 (Fong et al. Lung Cancer, 2008), OPN-3mts가 이러한 경로에서 어떤 영향이 있는지를 알아보기 위하여, 웨스턴 블랏 및 면역형광염색을 실시하였다(도 3). OPN-3mts는 OPN-WT (Wild Type)과 비교하여 볼 때, PI3K 다운스트림인 Akt1과 이들 인산화 형(Thr308과 Ser473)에서 현저하게 감소하는 것을 Western Blot으로 확인하였다(A). 또한, Akt1의 downstream인 p70S6K와 p-p70S6K 단백질도 감소하는 것을 Western Blot (B)과 형광면역염색 (C)으로 확인하였다. FITC는 단백질의 발현 정도를 나타내고, DAPI는 세포의 핵을 염색한 것이다.
OPN은 glyco-phospho protein으로 당화는 이 단백질에 있어 중요한 과정이다. O-당화는 세린과 트레오닌의 히드록시기에 GalNAc(N-acetylgalactosamine)이 연결되는 것인데, 이 반응을 일으키는 GalNAc Transferase (UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase) 1과 2를 RT-PCR을 통하여 본 결과, 도 4에 나타낸 바와 같이 GalNAc-T1은 OPN-WT에서는 증가하였으나, 3mts에서는 증가하지 않았다. GalNAc-T2는 아무런 변화가 없었다.
이 결과로 3mts 형태는 OPN의 O-당화가 거의 일어나지 않는다는 것을 알 수 있다. 따라서 이 3mts를 이용한다면 OPN에 의한 암 형성을 예방 또는 치료할 수 있을 것이다.
실시예 5: 사람 OPN을 타겟으로 하는 siRNA를 포함한 렌티바이러스의 생산
사람 OPN mRNA를 타겟으로 하는 shRNA를 설계하였다. OPN 녹다운을 위한 서열은 다음과 같다:
sh-OPN-Top (5'-CACCGGTCAGCTGGATGACCAGAGTGCGAACACTCTGGTCATCCAGCTGAC-3', 서열번호: 7) 및 sh-OPN-Bottom (5'-AAAAGTCAGCTGGATGACCAGAGTGTTCGCACTCTGGTCATCCAGCTGACC-3', 서열번호: 8).
대조군으로 이용된 서열은 다음과 같다:
sh-Scramble-Top (5'-CACCGAATCGCATAGCGTATGCCGCGAACGGCATACGCTATGCGATT-3', 서열번호: 9) 및 sh-Scramble-Bottom (5'-AAAAAATCGCATAGCGTATGCCGTTCGCGGCATACGCTATGCGATTC-3', 서열번호: 10).
shRNA는 상기 shRNA 서열을 기반으로 생성하였고, pENTR/U6™ entry vector (Invitrogen, Carlsbad, CA)로 클로닝하였다. U6 프로모터 및 shRNA 타겟 서열을 포함하는 카세트를 제조업자의 설명문(BLOCK-iT™ Lentiviral RNAi Expression System, Invitrogen)에 따라 렌티바이러스 벡터(pLenti6/BLOCK-iT™-DEST vector)로 전달하였다. 재조합 렌티바이러스 벡터는 ViraPower™ Lentiviral Packaging Mix (Invitrogen)를 이용하여 패키징하고, 바이러스의 역가는 HIV-1 p24 ELISA KIT (PerkinElmer Life Sciences, Boston, MA)를 이용하여 결정하였다.
실시예 6: 세포 배양 및 렌티바이러스 감염
A549 (Adenocarcinoma; non-small cell lung cancer, NSCLC) 세포를 5% CO2 및 37℃ 습한 배양기에서 10 % FBS, 100 units/ml 페니실린 G 소듐 및 100 mg/ml 스트렙토마이신 설페이트로 보충된 RPMI 1640에서 배양하였다. 렌티바이러스 감염 24시간 전에 세포를 T25 또는 T75 플라스크에 접종하고, 세포를 shRNA를 타겟으로 하는 AIMP2-DX2 및 대조군(10ng/ml)으로 24시간 동안 감염시켰다. 24시간 후에 배지를 제거하고 신선한 배지로 교환하였다. 48시간 추가로 정치배양한 후 세포를 분리하여 OPN의 발현양을 웨스턴 블롯으로 조사하였다. 도 5에 나타낸 바와 같이 Lentivirus-shOPN 처리시 A549에서 OPN이 감소되었다.
따라서 이 sh-OPN을 이용한다면 OPN에 의한 암 형성을 예방 또는 치료할 수 있을 것이다.
본 발명의 조성물은 폐암 예방 및 치료에 이용할 수 있다.

Claims (9)

  1. 오스테오폰틴(osteopontin)의 Thr118, Thr122, Thr127, Thr131 및 Thr136로 이루어진 그룹으로부터 선택된 위치의 트레오닌이 트레오닌 이외의 잔기로 변이된 오스테오폰틴의 돌연변이체.
  2. 제 1항에 있어서,
    상기 트레오닌 이외의 잔기는 알라닌인 것을 특징으로 하는 돌연변이체.
  3. 제 1항 또는 제 2항에 따른 돌연변이체를 함유하는 폐암 예방 및 치료용 조성물.
  4. 제 3항에 있어서,
    에어로졸 유전자 전달용(aerosol gene delivery)으로 제형화된 것을 특징으로 하는 조성물.
  5. 오스테오폰틴(osteopontin) 유전자에 대한 안티센스 분자.
  6. 제 5항에 있어서,
    상기 안티센스 분자는 3중제, 리보자임, RNAi 또는 안티센스 핵산인 것을 특징으로 하는 분자.
  7. 제 5항에 있어서,
    상기 안티센스 분자는 서열번호: 7 및 서열번호: 8에 나타낸 염기로 이루어진 shRNA인 것을 특징으로 하는 분자.
  8. 제 5항 내지 제 7항 중 어느 한 항에 따른 안티센스 분자를 함유하는 폐암 예방 및 치료용 조성물.
  9. 제 8항에 있어서,
    에어로졸 유전자 전달용(aerosol gene delivery)으로 제형화된 것을 특징으로 하는 조성물.
PCT/KR2009/005608 2009-04-30 2009-09-30 오스테오폰틴의 돌연변이체 또는 발현억제제를 함유하는 폐암 예방 및 치료용 조성물 Ceased WO2010126211A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020090038014A KR101121180B1 (ko) 2009-04-30 2009-04-30 오스테오폰틴의 돌연변이체를 함유하는 폐암 예방 및 치료용 조성물
KR10-2009-0038014 2009-04-30

Publications (1)

Publication Number Publication Date
WO2010126211A1 true WO2010126211A1 (ko) 2010-11-04

Family

ID=43032339

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2009/005608 Ceased WO2010126211A1 (ko) 2009-04-30 2009-09-30 오스테오폰틴의 돌연변이체 또는 발현억제제를 함유하는 폐암 예방 및 치료용 조성물

Country Status (2)

Country Link
KR (1) KR101121180B1 (ko)
WO (1) WO2010126211A1 (ko)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040142865A1 (en) 2002-10-02 2004-07-22 Weber Georg F. Osteopontin-based cancer therapies
EP1514929A1 (en) 2003-09-12 2005-03-16 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Antisense oligonucleotides for prevention of metastasis formation of cancer cells

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CHRISTENSEN, B. ET AL.: "Post-translationally modified residues of native human osteopontin are located in clusters: identification of 36 phosphorylation and five O- glycosylation sites and their biological impolications.", BIOCHEMICAL JOURNAL, vol. 390, 15 August 2005 (2005-08-15), pages 285 - 292 *
EL-TANANI, M. K. ET AL.: "The regulation and role of osteopontin in malignant transformation and cancer.", CYTOKINE GROWTH FACTOR REVIEW., vol. 17, no. 6, 17 November 2006 (2006-11-17), pages 463 - 474, XP005781362, DOI: doi:10.1016/j.cytogfr.2006.09.010 *
JESSEN, K. A. ET AL.: "Molecular analysis of metastasis in a polyomavirus middle T mouse model: the role of osteopontin.", BREAST CANCER RESEARCH., vol. 6, 25 February 2004 (2004-02-25), pages 157 - 169 *
JOHNSTON, N. ET AL.: "Osteopontin as a target for cancer therapy.", FRONTIERS IN BIOSCIENCE., vol. 13, 1 May 2008 (2008-05-01), pages 4361 - 4372 *
MURAMATSU, T. ET AL.: "Inhibition of osteopontin expression and function in oral cancer cell lines by antisense oligonucleotides.", CANCER LETTERS., vol. 217, 10 January 2005 (2005-01-10), pages 87 - 95, XP004681291, DOI: doi:10.1016/j.canlet.2004.05.021 *

Also Published As

Publication number Publication date
KR101121180B1 (ko) 2012-03-23
KR20100119085A (ko) 2010-11-09

Similar Documents

Publication Publication Date Title
EP2970972B1 (en) Mir-204 and mir-211 and uses thereof
US8710026B2 (en) MiR 204, miR 211, their anti-miRs, and therapeutic uses of same
WO2017135795A1 (ko) 간세포성장인자를 발현하는 중간엽줄기세포 및 이의 용도
JP3585180B2 (ja) 新規なヒトタンパク質およびそれをコードする遺伝子
KR20000064276A (ko) 신규 dna 및 그것을 쓴 단백질의 제조방법
HUP0302194A2 (hu) A kemokin-mutánsok a sclerosis multiplex kezelésében
WO2010058824A1 (ja) 間葉系細胞の分化を調節するための薬剤及びその利用
WO1999036103A1 (en) Prevention and treatment of neuropathy by hepatocyte growth factor
US6846647B1 (en) Polypeptides suppressing smooth muscle cell proliferation, the encoding cDNA, and related methods
WO2010126211A1 (ko) 오스테오폰틴의 돌연변이체 또는 발현억제제를 함유하는 폐암 예방 및 치료용 조성물
WO2006094703A1 (en) Use of an antagonist of epac for treating human cardiac hypertrophy
JP5850702B2 (ja) 間葉系細胞の分化調節剤およびこれを用いた医薬、並びに間葉系細胞への分化調節作用を有する物質のスクリーニング方法
WO2019232203A2 (en) Methods and compositions to alleviate vascular permeability
KR20080093334A (ko) Rank 저해 활성을 갖는 폴리펩티드, 그를 포함하는약학적 조성물, 그를 이용한 개체의 파골세포 분화를억제하는 방법 및 파골세포의 분화 및 활성화로 인하여야기되는 질병을 치료 또는 예방하는 방법, 그를 코딩하는핵산, 상기 핵산을 포함하는 벡터 및 숙주세포
KR20120088059A (ko) 대식세포의 자식작용 억제제 및 촉진제
EP1135411B1 (en) Methods and compositions for treating disorders involving excitotoxicity
KR20110081715A (ko) 파골 세포내에서 HIF―1α에 특이적으로 유전자 발현을 감소시키는 siRNA
WO1996034009A1 (en) Chimeric nucleic acids and proteins for inhibiting hiv-1 expression
AU2013323679A1 (en) Treatment of Central Nervous System (CNS) injury
WO2023048529A1 (ko) Aav2-f11 단백질을 유효성분으로 포함하는 녹내장 예방 또는 치료용 조성물
EP1743903A2 (en) Methods and compositions for treating disorders involving excitotoxicity
KR20060130406A (ko) Ras 신호전달경로를 표적으로 하는 혈관신생, 세포증식및 세포전이 억제제
KR20230120409A (ko) Pwar5 발현 촉진제를 유효성분으로 포함하는 c형 간염 바이러스 감염 질환 예방 또는 치료용 약학적 조성물
WO2019103578A1 (ko) 올리고뉴클레오티드 및 이를 포함하는 암의 예방 또는 치료용 약학적 조성물
US20080221037A1 (en) Methods and compositions for treating disorders involving excitotoxicity

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09844093

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09844093

Country of ref document: EP

Kind code of ref document: A1