WO2010113507A1 - Molécule bicaténaire inhibant l'expression de gpc3 - Google Patents

Molécule bicaténaire inhibant l'expression de gpc3 Download PDF

Info

Publication number
WO2010113507A1
WO2010113507A1 PCT/JP2010/002379 JP2010002379W WO2010113507A1 WO 2010113507 A1 WO2010113507 A1 WO 2010113507A1 JP 2010002379 W JP2010002379 W JP 2010002379W WO 2010113507 A1 WO2010113507 A1 WO 2010113507A1
Authority
WO
WIPO (PCT)
Prior art keywords
double
gpc3
stranded molecule
cancer
stranded
Prior art date
Application number
PCT/JP2010/002379
Other languages
English (en)
Inventor
Yusuke Nakamura
Ryuji Ohsawa
Akiko Konuma
Original Assignee
Oncotherapy Science, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oncotherapy Science, Inc. filed Critical Oncotherapy Science, Inc.
Publication of WO2010113507A1 publication Critical patent/WO2010113507A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the present invention relates to the field of biological science, more specifically to the field of cancer research.
  • the present invention relates to a double- stranded nucleic acid molecule that inhibits the expression of GPC3, and a composition containing the same.
  • the present invention further relates to methods of treating cancer using the molecules or compositions.
  • RNA interference can be induced by transfection of double- stranded molecules, including short interfering RNA (siRNA).
  • siRNA short interfering RNA
  • one strand of double- stranded molecule has the polynucleotide sequence that is identical or substantially identical to the nucleotide sequence of the targeted gene transcript (i.e., the mRNA), whereas the second strand of the double- stranded molecule has a complementary sequence thereto.
  • RISC RNA-induced silencing complex
  • the RISC then guides the small double- stranded molecule to the mRNA where the two strands of the double- stranded molecule separate, at which point the antisense strand associates with the mRNA and a nuclease cleaves the mRNA at the antisense strand : double- stranded molecule binding site (NPL I/Hammond SM et al., Nature 2000 Mar 16, 404(6775): 293-6).
  • the mRNA is subsequently further degraded by cellular nucleases.
  • Short hairpin types have been shown to be potent RNAi triggers and, in some instances, may be more effective than double- stranded molecules (NPL 2/Siolas D et al., Nat Biotechnol 2005 Feb, 23(2): 227-31, Epub 2004 Dec 26).
  • Short hairpin RNAs may be produced by chemical synthesis as well as recombinant methods.
  • Glypican 3 (GPC3: Genbank Accession No. NM_004484; SEQ ID NO: 1) encodes a protein (SEQ ID NO: 2) having a molecular weight of 66 kD.
  • GPC3 is a member of the family of cell surface heparan sulfate proteoglycans known to link to the extracy- toplasmic cell-surface membrane by means of a glycosylphosphatidylinositol anchor (NPL 9/Filmus J and Selleck SB, J Clin Invest 2001; 108: 497-501).
  • GPC3 is also a candidate serum marker for the disease because GPC3 is detectable in the serum of cancer patients (NPL 13/Hippo Y et al., Cancer Res 2004; 64: 2418-23, NPL 14/Capurro M et al., Gastroenterology 2003; 125: 89-97). GPC3 may also find utility as a target for cancer immunotherapy (NPL 15/Nakatsura T et al., Clin Can Res 2004; 10: 8630-40).
  • the present invention is based, at least in part, on the discovery that double-stranded nucleic acid molecules having specific nucleotide sequences (in particular, SEQ ID NOs: 16 and 28) are effective in inhibiting cellular growth of esophagus cancer cell line.
  • the present invention provides small interfering RNAs (siRNAs) that target the GPC3 gene.
  • the double- stranded nucleic acid molecules and vectors of the present invention have the ability to inhibit cell growth of cells expressing the GPC3 gene.
  • Such methods may include administering to a subject a composition containing one or more of the double- stranded nucleic acid molecules or vectors.
  • compositions for treating GPC3-related disease containing at least one of the double- stranded nucleic acid molecules or vectors of the present invention.
  • Part (B) depicts the results of treatment with GPC3-si#4 and GPC3-si#8 demonstrating the knock down effect. Knock down effects by siRNA treatment were assessed using siRNA transfected TE8 cells by RT-PCR. Treatments with GPC3-si#4 or GPC3-si#8 decreased mRNA expression of GPC3 in the TE8 cells.
  • Figure 2 depicts the measurement of inhibition of cell proliferation using optimized siRNA sequences against the GPC3 gene.
  • siRNAs against the GPC3 gene GPC3-si#l ⁇ si#9 were synthesized and used in this experiment. Transfection with no oligonucleotide and with an siRNA against Luciferase were performed as negative control.
  • Part (A) depicts the growth suppression effect and non-specific cell death inducing ability of siRNAs evaluated using nine siRNAs and TE8 cells, en- dogenously expressing the GPC3 gene. Statistics analysis of growth suppression with GPC3-si#4 and GPC3-si#8 treatment was performed.
  • nucleic acid refers to a polymer of nucleic acid residues and, unless otherwise specifically indicated are referred to by their commonly accepted single-letter codes.
  • the terms apply to nucleic acid (nucleotide) polymers in which one or more nucleic acids are linked by ester bonding.
  • the nucleic acid polymers may be composed of DNA, RNA or a combination thereof and encompass both naturally-occurring and non-naturally occurring nucleic acid polymers.
  • polypeptide polypeptide
  • peptide protein
  • protein protein
  • amino acid polymers in which one or more amino acid residue is a modified residue, or a non-naturally occurring residue, such as an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
  • isolated double- stranded molecule refers to a nucleic acid molecule that inhibits expression of a target gene and includes, for example, short interfering RNA (siRNA; e.g., double- stranded ribonucleic acid (dsRNA) or small hairpin RNA (shRNA)) and short interfering DNA/RNA (siD/R-NA; e.g., double- stranded chimera of DNA and RNA (dsD/R-NA) or small hairpin chimera of DNA and RNA (shD/R-NA)).
  • siRNA short interfering RNA
  • dsRNA double- stranded ribonucleic acid
  • shRNA small hairpin RNA
  • siD/R-NA short interfering DNA/RNA
  • dsD/R-NA double- stranded chimera of DNA and RNA
  • shD/R-NA small hairpin chimera of DNA and RNA
  • a target sequence is a nucleotide sequence within mRNA or cDNA sequence of a target gene, which will result in suppress of translation of the whole mRNA of the target gene if the double- stranded molecule is introduced within a cell expressing the gene.
  • a nucleotide sequence within mRNA or cDNA sequence of a target gene can be determined to be a target sequence when a double- stranded molecule having a sequence corresponding to the target sequence inhibits expression of the gene in a cell expressing the gene.
  • a sense strand sequence of a double- stranded cDNA i.e., a sequence that mRNA sequence is converted into DNA sequence
  • a double- stranded molecule is composed of a sense strand that has a sequence corresponding to a target sequence and a antisense strand that has a complementary sequence to the target sequence, and the antisense strand hybridizes with the sense strand at the complementary sequence to form a double- stranded molecule.
  • the phrase " corresponding to” means converting a target sequence according to the kind of nucleic acid that constitutes a sense strand of a double-stranded molecule.
  • a target sequence is shown in DNA sequence and a sense strand of a double-stranded molecule has an RNA region
  • base “t”s within the RNA region is replaced with base “u”s.
  • base "u"s within the DNA region is replaced with "t”s.
  • a target sequence is the DNA sequence shown in SEQ ID NO: 16 or 28 and the antisense strand of the double- stranded molecule is composed of RNA
  • "a complementary sequence to a target sequence is "GCC AC AGUCCUU ACUG A AC” (for SEQ ID NO: 16) or "CAUGGU- UCUCAGGAGCUGG” (for SEQ ID NO: 28).
  • a double- stranded molecule may has one or two 3 'overhangs having 2 to 5 nucleotides in length (e.g., uu) and/or a loop sequence that links a sense strand and an antisense strand to form hairpin structure, in addition to a sequence corresponding to a target sequence and complementary sequence thereto.
  • siRNA refers to a double-stranded RNA molecule which prevents translation of a target mRNA. Standard techniques of introducing siRNA into the cell are used, including those in which DNA is a template from which RNA is transcribed.
  • the siRNA includes sense nucleic acid sequence (also referred to as “sense strand”), complementary antisense nucleic acid sequence (also referred to as “antisense strand”) or both.
  • the siRNA may be constructed such that a single transcript has both the sense and complementary antisense nucleic acid sequences of the target gene, e.g., a hairpin.
  • the siRNA may either be a dsRNA or shRNA.
  • dsRNA refers to a construct of two RNA molecules composed of complementary sequences to one another and that have annealed together via the complementary sequences to form a double- stranded RNA molecule.
  • the nucleotide sequence of two strands may include not only the "sense” or "antisense” RNAs selected from a protein coding sequence of target gene sequence, but also RNA molecule having a nucleotide sequence selected from non-coding region of the target gene.
  • shRNA refers to an siRNA having a stem-loop structure, composed of first and second regions complementary to one another, i.e., sense and antisense strands. The degree of complementarity and orientation of the regions is sufficient such that base pairing occurs between the regions, the first and second regions may be joined by a loop region, and the loop results from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region.
  • the loop region of an shRNA is a single- stranded region intervening between the sense and antisense strands and may also be referred to as "intervening single-strand".
  • siD/R-NA refers to a double- stranded polynucleotide molecule which is composed of both RNA and DNA, and includes hybrids and chimeras of RNA and DNA and prevents translation of a target mRNA.
  • a hybrid indicates a molecule wherein a polynucleotide composed of DNA and a polynucleotide composed of RNA hybridize to each other to form the double-stranded molecule; whereas a chimera indicates that one or both of the strands composing the double stranded molecule may contain RNA and DNA. Standard techniques of introducing siD/R-NA into the cell are used.
  • the siD/R-NA includes sense strand, antisense strand or both.
  • the siD/R-NA may be constructed such that a single transcript has both the sense and complementary antisense nucleic acid sequences from the target gene, e.g., a hairpin.
  • the siD/R-NA may either be a dsD/R-NA or shD/ R-NA.
  • the term "dsD/R-NA” refers to a construct of two molecules composed of complementary sequences to one another and that have annealed together via the complementary sequences to form a double- stranded polynucleotide molecule.
  • the nucleotide sequence of two strands may include not only the "sense” or "antisense” polynucleotides sequence selected from a protein coding sequence of target gene sequence, but also polynucleotide having a nucleotide sequence selected from non-coding region of the target gene.
  • One or both of the two molecules constructing the dsD/R-NA are composed of both RNA and DNA (chimeric molecule), or alternatively, one of the molecules is composed of RNA and the other is composed of DNA (hybrid double- strand).
  • shD/R-NA refers to an siD/R-NA having a stem-loop structure, composed of a first and second regions complementary to one another, i.e., sense and antisense strands.
  • the degree of complementarity and orientation of the regions is sufficient such that base pairing occurs between the regions, the first and second regions being joined by a loop region, the loop results from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region.
  • the loop region of an shD/R-NA is a single-stranded region intervening between the sense and antisense strands and may also be referred to as "intervening single-strand".
  • an "isolated nucleic acid” is a nucleic acid removed from its original environment (e.g., the natural environment if naturally occurring) and thus, synthetically altered from its natural state.
  • examples of isolated nucleic acid includes DNA, RNA, and derivatives thereof.
  • GPC3 (glypican3) belongs to the cell surface heparan sulfate proteoglycan family whose members contain a core protein (about 60 kD) anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage.
  • a typical sequence of the GPC3 gene is shown in SEQ ID NO: 1 (Genbank Accession No. NM_004484) , and the amino acid sequence of the GPC3 protein encoded by the gene sequence is shown in SEQ ID NO: 2 (Genbank Accession No. NP_004475.1).
  • the expression of GPC3 in an esophageal cancer cell line was inhibited by dsRNAs designed against the GPC3 gene (Fig. IB).
  • the dsRNAs inhibited the cell proliferation of the cell line when the dsRNAs were introduced into the cell (Fig. 2A).
  • the present invention provides isolated double-stranded molecules that are capable of inhibiting the expression of the GPC3 gene as well as cell proliferation when introduced into a cell expressing the GPC3 gene.
  • the target sequences of the double- stranded molecules may be designed by an siRNA design algorithm such as that mentioned below:
  • SEQ ID NO: 28 (at the position 1600-1618nt of SEQ ID NO: 1).
  • the present invention provides the following double- stranded molecules of[l] to[16]:
  • [5] The double- stranded molecule of [1], composed of a single polynucleotide having both the sense and antisense strands linked by an intervening single-strand;
  • [6] The double- stranded molecule of [5], having the general formula 5'-[A]-[B]-[A']-3', wherein[A] is the sense strand containing a sequence corresponding to a target sequence selected from among SEQ ID NOs: 16 and 28,[B] is the intervening single- strand composed of 3 to 23 nucleotides, and[A'] is the antisense strand containing a sequence complementary to[A];
  • flanking region is composed of 9 to 13 nucleotides
  • [16] A vector expressing the double- stranded molecule of any one of [1] to[15]; [18] A vector containing a sequence that encodes the sense strand of the double- stranded molecule of any one of [1] to[16];
  • Double-stranded molecules of the present invention are identical to the present invention.
  • the computer program selects target nucleotide sequences for double- stranded molecules based on the following protocol.
  • the target sequences of the double-stranded molecules against the GPC3 gene were designed as:
  • Double- stranded molecules targeting the above-mentioned target sequences were respectively examined for their ability to suppress the growth of cells expressing the target genes.
  • the double- stranded molecules designed for the target sequences shown in SEQ ID NO: 16 or SEQ ID NO: 28 significantly inhibited the cell growth in cells expressing the GPC gene while they had no effect on cells in which the GPC expression was hardly detectable. Therefore, in preferred embodiments, the double- stranded molecules of the present invention target a nucleotide sequence selected from the group consisting of
  • SEQ ID NO: 16 (at the position 931-949nt of SEQ ID NO: 1) and SEQ ID NO: 28 (at the position 1600-1618nt of SEQ ID NO: 1).
  • Examples of double- stranded molecules of the present invention that target the above-mentioned target sequence of the GPC3 gene include isolated polynucleotides that contain the nucleic acid sequences corresponding to target sequences and/or complementary sequences to the target sequences.
  • Preferred examples of polynucleotides targeting the GPC3 gene include those containing the sequence corresponding to SEQ ID NO: 16 or 28 and/or complementary sequences to these sequences.
  • a double- stranded molecule is composed of two polynucleotides, one polynucleotide has a sequence corresponding to a target sequence, i.e., sense strand, and another polypeptide has a complementary sequence to the target sequence, i.e., antisense strand.
  • the sense strand polynucleotide and the antisense strand polynucleotide hybridize to each other to form double- stranded molecule.
  • Examples of such double- stranded molecules include dsRNA and dsD/R-NA .
  • a double- stranded molecule is composed of a polynucleotide that has both a sequence corresponding to a target sequence, i.e., sense strand, and a complementary sequence to the target sequence, i.e., antisense strand.
  • the sense strand and the antisense strand are linked by a intervening strand, and hybridize to each other to form a hairpin loop structure.
  • Examples of such double- stranded molecule include shRNA and shD/R-NA.
  • a double-stranded molecule of the present invention comprises a sense strand polynucleotide having a nucleotide sequence of the target sequence and anti-sense strand polynucleotide having a nucleotide sequence complementary to the target sequence, and both of polynucleotides hybridize to each other to form the double- stranded molecule.
  • a part of the polynucleotide of either or both of the strands may be RNA, and when the target sequence is defined with a DNA sequence, the nucleotide "t" within the target sequence and complementary sequence thereto is replaced with "u”.
  • such a double- stranded molecule of the present invention comprises a stem-loop structure, composed of the sense and antisense strands.
  • the sense and antisense strands may be joined by a loop.
  • the present invention also provides the double- stranded molecule comprising a single polynucleotide containing both the sense strand and the antisense strand linked or flanked by an intervening single- strand.
  • double-stranded molecules targeting the GPC3 gene may have a sequence selected from among SEQ ID NOs: 7, 10, 13, 16, 19, 22, 25, 28 and 31 as a target sequence.
  • the target sequence is a sequence of SEQ ID NO: 16 or 28.
  • preferable examples of the double- stranded molecule of the present invention include polynucleotides that hybridize to each other at a sequence corresponding to SEQ ID NO: 16 or 28 and a complementary sequence thereto, and a polynucleotide that has a sequence corresponding to SEQ ID NO: 16 or 28 and a complementary sequence thereto.
  • the present invention is not limited to these examples, and minor modifications in the aforementioned nucleic acid sequences are acceptable so long as the modified molecule retains the ability to suppress the expression of the GPC3 gene.
  • the phrase "minor modification" as used in connection with a nucleic acid sequence indicates one, two or several substitution, deletion, addition or insertion of nucleotides to the sequence.
  • the term "several" as applies to nucleotide substitutions, deletions, additions and/or insertions may mean 3-7, preferably 3-5, more preferably 3-4, even more preferably 3 nucleic acid residues.
  • the number of modified constitute no more than 5% of the total sequence.
  • a double- stranded molecule of the present invention can be tested for its ability using the methods described in the Examples below.
  • double-stranded molecules composed of sense strands of various portions of mRNA of the GPC3 gene and antisense strands complementary thereto were tested in vitro for their ability to decrease production of a GPC3 gene product in esophageal cancer cell lines according to standard methods.
  • Target sequences that inhibit cell growth in in vitro cell-based assay may be further tested for their in vivo ability using animals with cancer, e.g., nude mouse xenograft models, to confirm decreased production of the GPC3 product and decreased cancer cell growth.
  • the isolated polynucleotide is an RNA or derivative thereof
  • base "t" should be replaced with “u” in the nucleotide sequences.
  • the term “com- plementary” refers to Watson-Crick or Hoogsteen base pairing between nucleotides units of a polynucleotide
  • binding means the physical or chemical interaction between two polynucleotides.
  • the polynucleotide includes modified nucleotides and/or non-phosphodiester linkages, these polynucleotides may also bind each other as same manner.
  • the polynucleotide is preferably less than 2,382 nucleotides in length.
  • the polynucleotide is less than 500, 200, 100, 75, 50, or 25 nucleotides in length for all of the genes.
  • the isolated polynucleotides of the present invention are useful for forming double-stranded molecules against the GPC3 gene or preparing template DNAs encoding the double-stranded molecules.
  • the sense strand of polynucleotide may be longer than 19 nucleotides, preferably longer than 21 nucleotides, and more preferably has a length of between about 19 and 25 nucleotides.
  • the present invention provides the double- stranded molecules composed of a sense strand and an antisense strand, wherein the sense strand has a nucleotide sequence corresponding to a target sequence.
  • the sense strand hybridizes with antisense strand at the target sequence to form the double- stranded molecule having between 19 and 25 nucleotide pair in length.
  • the double- stranded molecule serves as a guide for identifying homologous sequences in mRNA for the RISC complex, when the double- stranded molecule is introduced into cells.
  • the identified target RNA is cleaved and degraded by the nuclease activity of Dicer, through which the double- stranded molecule eventually decreases or inhibits production (expression) of the polypeptide encoded by the RNA.
  • a double- stranded molecule of the invention can be defined by its ability to generate a single-strand that specifically hybridizes to the mRNA of the GPC3 gene under stringent conditions.
  • target sequence the portion of the mRNA that hybridizes with the single- strand generated from the double-stranded molecule is referred to as "target sequence", “target nucleic acid” or “target nucleotide”.
  • target sequence the portion of the mRNA that hybridizes with the single- strand generated from the double-stranded molecule is referred to as "target sequence", “target nucleic acid” or “target nucleotide”.
  • target sequence the portion of the mRNA that hybridizes with the single- strand generated from the double-stranded molecule
  • target nucleic acid the portion of the strand generated from the double-stranded molecule.
  • target nucleotide sequence of the "target sequence” can be shown using not only the RNA sequence of the mRNA, but also the DNA sequence of cDNA synthesized from the mRNA.
  • the double- stranded molecules of the invention may contain one or more modified nucleotides and/or non-phosphodiester linkages.
  • Chemical modifications well known in the art are capable of increasing stability, availability, and/or cell uptake of the double- stranded molecule.
  • the skilled person will be aware of other types of chemical modification which may be incorporated into the present molecules (WO03/070744; WO2005/045037).
  • modifications can be used to provide improved resistance to degradation or improved uptake.
  • modifications include, but are not limited to, phosphorothioate linkages, 2'-O-methyl ribonucleotides (especially on the sense strand of a double-stranded molecule), 2'-deoxy-fluoro ribonucleotides, 2'-deoxy ribonucleotides, "universal base” nucleotides, 5'-C- methyl nucleotides, and inverted deoxybasic residue incorporation (US20060122137).
  • modifications can be used to enhance the stability or to increase targeting efficiency of the double-stranded molecule.
  • modifications include, but are not limited to, chemical cross linking between the two complementary strands of a double- stranded molecule, chemical modification of a 3' or 5' terminus of a strand of a double-stranded molecule, sugar modifications, nucleobase modifications and/or backbone modifications, 2-fluoro modified ribonucleotides and 2'-deoxy ribonucleotides (WO2004/029212).
  • modifications can be used to increased or decreased affinity for the complementary nucleotides in the target mRNA and/or in the complementary double- stranded molecule strand (WO2005/044976).
  • an unmodified pyrimidine nucleotide can be substituted for a 2-thio, 5-alkynyl, 5-methyl, or 5-propynyl pyrimidine.
  • an unmodified purine can be substituted with a 7-deaza, 7-alkyl, or 7-alkenyl purine.
  • the double-stranded molecule when the double-stranded molecule is a double-stranded molecule with a 3' overhang, the 3'- terminal nucleotide overhanging nucleotides may be replaced with deoxyribonucleotides (Elbashir SM et al., Genes Dev 2001 Jan 15, 15(2): 188-200).
  • deoxyribonucleotides Elbashir SM et al., Genes Dev 2001 Jan 15, 15(2): 188-200.
  • published documents such as US20060234970 are available.
  • the present invention is not limited to these examples and any known chemical modifications may be employed for the double- stranded molecules of the present invention so long as the resulting molecule retains the ability to inhibit the expression of the target gene.
  • the double-stranded molecules of the invention may include both DNA and RNA, e.g., dsD/R-NA or shD/R-NA.
  • RNA e.g., dsD/R-NA or shD/R-NA.
  • a hybrid polynucleotide of a DNA strand and an RNA strand or a DNA-RNA chimera polynucleotide shows increased stability.
  • RNA i.e., a hybrid type double-stranded molecule composed of a DNA strand (polynucleotide) and an RNA strand (polynucleotide), a chimera type double-stranded molecule containing both DNA and RNA on either or both of the single strands (polynucleotides), or the like may be formed for enhancing stability of the double- stranded molecule.
  • the hybrid of a DNA strand and an RNA strand may be either where the sense strand is DNA and the antisense strand is RNA, or the opposite so long as it can inhibit expression of the target gene when introduced into a cell expressing the gene.
  • the sense strand polynucleotide is DNA and the antisense strand polynucleotide is RNA.
  • the chimera type double- stranded molecule may be either where both of the sense and antisense strands are composed of DNA and RNA, or where any one of the sense and antisense strands are composed of DNA and RNA so long as it has an activity to inhibit expression of the target gene when introduced into a cell expressing the gene.
  • the molecule preferably contains as much DNA as possible, whereas to induce inhibition of the target gene expression, the molecule is required to be RNA within a range to induce sufficient inhibition of the expression.
  • an upstream partial region i.e., a region flanking to the target sequence or complementary sequence thereof within the sense or antisense strands
  • the upstream partial region indicates the 5' side (5 '-end) of the sense strand and the 3' side (3 '-end) of the antisense strand.
  • regions flanking to 5 '-end of sense strand and/or 3 '-end of antisense strand are referred to upstream partial region.
  • a region flanking to the 3'-end of the antisense strand, or both of a region flanking to the 5 '-end of the sense strand and a region flanking to the 3 '-end of the antisense strand are composed of RNA.
  • the chimera or hybrid type double- stranded molecule of the present invention include following combinations: sense strand:
  • antisense strand antisense strand, sense strand:
  • antisense strand antisense strand, and sense strand:
  • the double- stranded molecule may form a hairpin, such as a short hairpin RNA (shRNA) and short hairpin consisting of DNA and RNA (shD/R-NA).
  • shRNA or shD/R-NA is a sequence of RNA or mixture of RNA and DNA making a tight hairpin turn that can be used to silence gene expression via RNA interference.
  • the shRNA or shD/R-NA includes a sense strand containing a sequence corresponding to the target sequence and a antisense strand containing a complementary sequence to the target sequence on a single strand wherein the sequences are separated by a loop sequence.
  • the hairpin structure is cleaved by the cellular machinery into dsRNA or dsD/R-NA, which is then bound to the RNA- induced silencing complex (RISC).
  • RISC RNA- induced silencing complex
  • the present invention is not limited to these examples, and the target sequence in[A] may be modified sequences from these examples so long as the double-stranded molecule retains the ability to suppress the expression of the targeted GPC3 gene.
  • the region[A] hybridizes to[A'] to form a loop composed of the region[B].
  • the intervening single-stranded portion[B], i.e., loop sequence may be preferably 3 to 23 nucleotides in length.
  • the loop sequence for example, can be selected from among the following sequences (www.ambion.com/techlib/tb/tb_506.html).
  • a loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque JM et al., Nature 2002 JuI 25, 418(6896): 435-8, Epub 2002 Jun 26):
  • loop sequence can be selected from among AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC, and UUCAAGAGA; however, the present invention is not limited thereto:
  • nucleotides can be added to 3 'end of the sense strand and/or antisense strand of the double- stranded molecule, as 3' overhangs.
  • the number of nucleotides to be added is at least 2, generally 2 to 10, preferably 2 to 5.
  • the added nucleotides form single strand at the 3 'end of the sense strand and/or antisense strand of the double- stranded molecule.
  • the nucleotides for 3' overhang are preferably "u" or "t", but are not limited to.
  • the method for preparing the double- stranded molecule is not particularly limited, though it is preferable to use a chemical synthetic method known in the art.
  • sense and antisense single- stranded polynucleotides are separately synthesized and then annealed together via an appropriate method to obtain a double- stranded molecule.
  • Specific example for the annealing includes wherein the synthesized single- stranded polynucleotides are mixed in a molar ratio of preferably at least about 3:7, more preferably about 4:6, and most preferably substantially equimolar amount (i.e., a molar ratio of about 5:5).
  • the mixture is heated to a temperature at which double- stranded molecules dissociate and then is gradually cooled down.
  • the annealed double- stranded polynucleotide can be purified by usually employed methods known in the art. Examples of purification methods include methods utilizing agarose gel electrophoresis. Remaining single- stranded polynucleotides may be optionally removed by, e.g., degradation with appropriate enzyme.
  • the double-stranded molecules may be transcribed intracellularly by cloning its coding sequence into a vector containing a regulatory sequence that directs the expression of the double-stranded molecule in an adequate cell (e.g., a RNA poly III transcription unit from the small nuclear RNA (snRNA) U6 or the human Hl RNA promoter) adjacent to the coding sequence.
  • a regulatory sequence that directs the expression of the double-stranded molecule in an adequate cell e.g., a RNA poly III transcription unit from the small nuclear RNA (snRNA) U6 or the human Hl RNA promoter
  • the regulatory sequences flanking the coding sequences of double- stranded molecule may be identical or different, such that their expression can be modulated independently, or in a temporal or spatial manner. Details of vectors which are capable of producing the double-stranded molecules will be described bellow.
  • vectors containing one or more of the double- stranded molecules described herein and a cell containing such a vector.
  • a vector of the present invention preferably encodes a double-stranded molecule of the present invention in an expressible form.
  • the phrase "in an expressible form” indicates that the vector, when introduced into a cell, will express the molecule.
  • the vector includes regulatory elements necessary for expression of the double- stranded molecule.
  • Such vectors of the present invention may be used for producing the present double- stranded molecules, or directly as an active ingredient for treating cancer.
  • Vectors of the present invention can be produced, for example, by cloning GPC3 sequence (i.e., sequence encoding a sense strand and an antisense strand of the doubles-stranded molecule) into an expression vector so that regulatory sequences are operatively-linked to GPC3 sequence in a manner to allow expression (by transcription of the DNA molecule) of both strands (Lee NS et al., Nat Biotechnol 2002 May, 20(5): 500-5).
  • GPC3 sequence i.e., sequence encoding a sense strand and an antisense strand of the doubles-stranded molecule
  • RNA molecule that is the antisense strand is transcribed by a first promoter (e.g., a promoter sequence flanking to the 3' end of the cloned DNA) and RNA molecule that is the sense strand is transcribed by a second promoter (e.g., a promoter sequence flanking to the 5' end of the cloned DNA).
  • a first promoter e.g., a promoter sequence flanking to the 3' end of the cloned DNA
  • RNA molecule that is the sense strand is transcribed by a second promoter (e.g., a promoter sequence flanking to the 5' end of the cloned DNA).
  • the sense and antisense strands hybridize to each other to generate a double- stranded molecule constructs for silencing of the gene.
  • the sense strand and the antisense strand of the double- stranded molecule may be encoded by two vectors respectively.
  • the vectors respectively express the sense and anti-sense strands and then the transcribed strands hybridize to each other to form a double- stranded molecule construct.
  • the cloned sequence may encode a construct having a secondary structure (e.g., hairpin); namely, a single transcript of a vector contains both the sense strand and antisense strand sequences of the double- stranded molecule.
  • the vectors of the present invention may also be prepared to achieve stable insertion into the genome of the target cell (see, e.g., Thomas KR & Capecchi MR, Cell 1987, 51: 503-12 for a description of homologous recombination cassette vectors). See, e.g., Wolff et al., Science 1990, 247: 1465-8; US Patent Nos. 5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524; 5,679,647; and WO 98/04720.
  • DNA-based delivery technologies include "naked DNA”, facilitated (bupivacaine, polymers, peptide-mediated) delivery, cationic lipid complexes, and particle-mediated (“gene gun”) and pressure-mediated delivery (see, e.g., US Patent No. 5,922,687).
  • the vectors of the present invention include, for example, viral or bacterial vectors.
  • expression vectors include attenuated viral hosts, such as vaccinia or fowlpox (see, e.g., US Patent No. 4,722,848). This approach involves the use of vaccinia virus, e.g., as a vector to express nucleotide sequences that encode the double- stranded molecule.
  • the recombinant vaccinia virus When introduced into a cell expressing the target gene, expresses the double- stranded molecule and thereby suppresses the proliferation of the cell.
  • Another example of useable vector includes Bacille Calmette Guerin (BCG).
  • BCG vectors are described in Stover et al., Nature 1991, 351: 456-60.
  • a wide variety of other vectors are useful for therapeutic administration and production of the double-stranded molecules; examples include adeno and adeno-associated virus vectors, retroviral vectors, Salmonella typhi vectors, detoxified anthrax toxin vectors, and the like. See, e.g., Shata et al., MoI Med Today 2000, 6: 66-71; Shedlock et al., J Leukoc Biol 2000, 68: 793-806; and Hipp et al., In Vivo 2000, 14: 571-85.
  • the present invention provides vectors including each of a combination of polynucleotide having a sense strand nucleic acid and an antisense strand nucleic acid, wherein the sense strand has a sequence corresponding to a target sequence selected from among SEQ ID NOs: 7, 10, 13, 16, 19, 22, 25, 28 and 31, and the antisense strand nucleic acid consists of a sequence complementary to the sense strand, wherein the transcripts of the sense strand and the antisense strand hybridize to each other to form a double- stranded molecule, and wherein the vectors, when introduced into a cell expressing the GPC3, inhibits expression of the gene.
  • the polynucleotide is an oligonucleotide of between about 19 and 25 nucleotides pair in length (e.g., contiguous nucleotides from the nucleotide sequence of SEQ ID NO: 1. More preferably, the combination of polynucleotide includes a single nucleotide transcript having the sense strand and the antisense strand linked via a single- stranded nucleotide sequence.
  • the present invention provides methods for inhibiting cell growth, e.g., growth of esophageal cancer cell, gastric cancer cell, hepatic cancer cell, osteosarcoma cell, soft tissue cancer cell or endometriosis related cell, by inducing dysfunction of the GPC3 gene via inhibiting the expression of GPC3.
  • GPC3 gene expression can be inhibited by any of the aforementioned double- stranded molecules of the present invention which specifically target of the GPC3 gene or the vectors of the present invention that can express any of the double- stranded molecules. [0063] Such ability of the present double-stranded molecules and vectors to inhibit GPC3 expressing cell growth indicates that they can be used for methods for treating GPC3 - related disease.
  • the present invention provides methods to treat patients with GPC3 -related disease, e.g., esophageal cancer, gastric cancer, hepatic cancer, osteosarcoma, soft tissue cancer or endometriosis, by administering a double- stranded molecule against the GPC3 gene or a vector expressing the molecule.
  • the treatment methods of the present invention are expected to cause little adverse effect because the GPC3 gene was hardly detected in normal organs.
  • the present invention provides the following methods of[l] to[18]:
  • a method for inhibiting a growth of GPC3 expressing cell and treating GPC3 - related disease which method includes the step of administering at least one isolated double- stranded molecule inhibiting the expression of GPC3 in the cell and the cell proliferation, wherein the molecule is composed of a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double- stranded molecule.
  • a method for inhibiting a growth of GPC3 expressing cell and treating GPC3 - related disease which method includes the step of administering at least one vector that encoding at least one isolated double- stranded molecule inhibiting the expression of GPC3 in the cell and the cell proliferation, wherein the molecule is composed of a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double-stranded molecule.
  • the growth of cells expressing the GPC3 gene may be inhibited by contacting the cells with a double- stranded molecule against the GPC3 gene, a vector expressing the molecule or a composition containing the same.
  • the cells may be further contacted with a transfection agent. Suitable transfection agents are known in the art.
  • the phrase "inhibition of cell growth" indicates that the cell proliferates at a lower rate or has decreased viability as compared to a cell not exposed to the molecule.
  • Cell growth may be measured by methods known in the art, e.g., using the MTT cell proliferation assay.
  • the growth of any kind of cells may be suppressed according to the present method so long as the cell expresses or over-expresses the GPC3 gene.
  • Exemplary cells include esophageal cancer cell, gastric cancer cell, hepatic cancer cell, osteosarcoma cell, soft tissue cancer cell or endometriosis related cell.
  • patients suffering from or at risk of developing disease related to GPC3 may be treated by administering at least one of the present double- stranded molecules, at least one vector expressing at least one of the molecules or at least one composition containing at least one of the molecules.
  • patients of esophageal cancer, gastric cancer, hepatic cancer, osteosarcoma, soft tissue cancer or endometriosis may be treated according to the present methods.
  • the type of disease may be identified by standard methods.
  • patients treated by the methods of the present invention may be selected by detecting the expression of GPC3 in a biopsy specimen from the patient, for example by RT-PCR or immunoassay.
  • the biopsy specimen from the subject is confirmed for GPC3 gene over-expression by methods known in the art, for example, immunoassay such as immunohistochemical analysis and ELISA, or RT-PCR.
  • plural kinds of the double- stranded molecules against the GPC3 gene may be administered to a subject.
  • each of the molecules may have different structures but may act at mRNA which matches the same target sequence of GPC3.
  • plural kinds of the double-stranded molecules may acts at mRNA which matches different target sequence of the same gene.
  • a double- stranded molecule of the present invention may be directly introduced into the cells in a form to achieve binding of the molecule with corresponding mRNA transcripts.
  • a DNA encoding the double- stranded molecule may be introduced into cells as a vector.
  • transfection-enhancing agent such as FuGENE (Roche diagnostics), Lipofectamine 2000 (Invitrogen), Oligo- fectamine (Invitrogen), and Nucleofector (Wako pure Chemical), may be employed.
  • an effective amount of the double- stranded molecules of the invention can readily determine an effective amount of the double- stranded molecules of the invention to be administered to a given subject, by taking into account factors such as body weight, age, sex, type of disease, symptoms and other conditions of the subject; the route of administration; and whether the administration is regional or systemic.
  • an effective amount of the double- stranded molecules of the invention is an intercellular concentration of from about 1 nanomolar (nM) to about 100 nM, preferably from about 2 nM to about 50 nM, more preferably from about 2.5 nM to about 10 nM. It is contemplated that greater or smaller amounts of the double- stranded molecules can be administered. The precise dosage required for a particular circumstance may be readily and routinely determined by one of skill in the art.
  • the present methods can be used to inhibit the growth or metastasis of GPC3-related disease; for example, esophageal cancer, gastric cancer, hepatic cancer, osteosarcoma, soft tissue cancer or endometriosis.
  • a double-stranded molecule containing a target sequence of GPC3 i.e., SEQ ID NO: 16 or 28
  • SEQ ID NO: 16 or 28 is particularly preferred for the treatment of esophageal cancer, gastric cancer, hepatic cancer, osteosarcoma, soft tissue cancer or endometriosis.
  • the double- stranded molecule of the invention can also be administered to a subject in combination with a pharmaceutical agent different from the double- stranded molecule.
  • the double- stranded molecule of the invention can be administered to a subject in combination with another therapeutic method designed to treat disease.
  • the double-stranded molecule of the invention can be administered in combination with therapeutic methods currently employed for treating cancer or preventing cancer metastasis (e.g., radiation therapy, surgery and treatment using chemotherapeutic agents, such as cisplatin, carboplatin, cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin or tamoxifen).
  • the double-stranded molecule can be administered to a subject either as a naked double- stranded molecule, in conjunction with a delivery reagent, or as a recombinant plasmid or viral vector which expresses the double- stranded molecule.
  • Suitable delivery reagents for administration in conjunction with the present double- stranded molecule include LipoTrustTM; Mirus Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; or polycations (e.g., polylysine), or liposomes.
  • a preferred delivery reagent is a liposome.
  • Liposomes can aid in the delivery of the double- stranded molecule to a particular tissue, such as tumor tissue, and can also increase the blood half-life of the double- stranded molecule.
  • Liposomes suitable for use in the invention are formed from standard vesicle-forming lipids, which generally include neutral or negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of factors such as the desired liposome size and half- life of the liposomes in the blood stream. A variety of methods are known for preparing liposomes, for example, as described in Szoka et al., Ann Rev Biophys Bioeng 1980, 9: 467; and US Pat. Nos. 4,235,871; 4,501,728; 4,837,028; and 5,019,369, the entire disclosures of which are herein incorporated by reference.
  • the liposomes encapsulating the present double- stranded molecule includes a ligand molecule that can deliver the liposome to the seat of disease.
  • Ligands which bind to receptors prevalent in tumor or vascular endothelial cells such as monoclonal antibodies that bind to tumor antigens or endothelial cell surface antigens, are preferred.
  • the liposomes encapsulating the present double-stranded molecule may be modified so as to avoid clearance by the mononuclear macrophage and reticuloendothelial systems, for example, by having opsonization-inhibition moieties bound to the surface of the structure.
  • a liposome of the invention can include both opsonization-inhibition moieties and a ligand.
  • Opsonization-inhibiting moieties for use in preparing the liposomes of the invention are typically large hydrophilic polymers that are bound to the liposome membrane.
  • an opsonization-inhibiting moiety is "bound" to a liposome membrane when it is chemically or physically attached to the membrane, e.g., by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids.
  • opsonization-inhibiting hydrophilic polymers form a protective surface layer which significantly decreases the uptake of the liposomes by the macrophage-monocyte system ("MMS") and reticuloendothelial system ("RES"); e.g., as described in US Pat. No. 4,920,016, the entire disclosure of which is herein incorporated by reference.
  • MMS macrophage-monocyte system
  • RES reticuloendothelial system
  • Stealth liposomes are known to accumulate in tissues fed by porous or "leaky" mi- crovasculature.
  • target tissue characterized by such microvasculature defects for example, solid tumors, will efficiently accumulate these liposomes; see Gabizon et al., Proc Natl Acad Sci USA 1988, 18: 6949-53.
  • the reduced uptake by the RES lowers the toxicity of stealth liposomes by preventing significant accumulation in liver and spleen.
  • liposomes that are modified with opsonization-inhibition moieties can effectively deliver the present double-stranded molecule to target cells.
  • Opsonization-inhibiting moieties suitable for modifying liposomes are preferably water-soluble polymers with a molecular weight from about 500 to about 40,000 daltons, and more preferably from about 2,000 to about 20,000 daltons.
  • Such polymers include polyethylene glycol (PEG) or polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG, and PEG or PPG stearate; synthetic polymers such as poly- acrylamide or poly N- vinyl pyrrolidone; linear, branched, or dendrimeric polyami- doamines; polyacrylic acids; polyalcohols, e.g., polyvinylalcohol and polyxylitol to which carboxylic or amino groups are chemically linked, as well as gangliosides, such as ganglioside GMl. Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives thereof, are also suitable.
  • the opsonization-inhibiting polymer can be a block copolymer of PEG and either a polyamino acid, polysaccharide, polyamidoamine, polyethyleneamine, or polynucleotide.
  • the opsonization-inhibiting polymers can also be natural polysaccharides containing amino acids or carboxylic acids, e.g., galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan; aminated polysaccharides or oligosaccharides (linear or branched); or carboxylated polysaccharides or oligosaccharides, e.g., reacted with derivatives of carbonic acids with resultant linking of carboxylic groups.
  • the opsonization-inhibiting moiety is a PEG, PPG, or derivatives thereof.
  • Liposomes modified with PEG or PEG-derivatives are sometimes called "PEGylated liposomes”.
  • the opsonization-inhibiting moiety can be bound to the liposome membrane by any one of numerous well-known techniques.
  • an N-hydroxysuccinimide ester of PEG can be bound to a phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a membrane.
  • a dextran polymer can be derivatized with a stearylamine lipid-soluble anchor via reductive amination using Na(CN)BH 3 and a solvent mixture such as tetrahydrofuran and water in a 30: 12 ratio at 60 degrees C.
  • Vectors expressing a double- stranded molecule of the invention are discussed above. Such vectors expressing at least one double-stranded molecule of the invention can also be administered directly or in conjunction with a suitable delivery reagent, including LipoTrustTM; Mirus Transit LTl lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polylysine) or liposomes.
  • a suitable delivery reagent including LipoTrustTM; Mirus Transit LTl lipophilic reagent; lipofectin; lipofectamine; cellfectin; polycations (e.g., polylysine) or liposomes.
  • the double-stranded molecule of the invention can be administered to a subject by any means suitable for delivering the double- stranded molecule into seat of disease.
  • the double- stranded molecule can be administered by gene gun, electro- poration, or by other suitable parenteral or enteral administration routes.
  • Suitable enteral administration routes include oral, rectal, or intranasal delivery.
  • Suitable parenteral administration routes include intravascular administration (e.g., intravenous bolus injection, intravenous infusion, intra- arterial bolus injection, intraarterial infusion and catheter instillation into the vasculature); peri- and intra- tissue injection (e.g., peri-tumoral and intra-tumoral injection); subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct application to the area at or near the seat of disease, for example by a catheter or other placement device (e.g., a suppository or an implant composed of a porous, non-porous, or gelatinous material); and inhalation. It is preferred that injections or infusions of the double- stranded molecule or vector be given at or near the seat of disease.
  • intravascular administration e.g., intravenous bolus injection, intravenous infusion, intra- arterial bolus injection, intraarterial infusion and catheter instillation into the vasculature
  • the double- stranded molecule of the invention can be administered in a single dose or in multiple doses.
  • the infusion can be a single sustained dose or can be delivered by multiple infusions.
  • Injection of the agent directly into the tissue is at or near the seat of disease preferred. Multiple injections of the agent into the tissue at or near the seat of disease are particularly preferred.
  • the double- stranded molecule of the invention can be administered to the subject once, for example, as a single injection or deposition at or near the seat of disease.
  • the double- stranded molecule can be administered once or twice daily to a subject for a period of from about three to about twenty-eight days, more preferably from about seven to about ten days.
  • the double-stranded molecule is injected at or near the seat of disease once a day for seven days.
  • compositions containing double- stranded molecules or vectors of the present invention are provided.
  • the present invention also provides pharmaceutical compositions that include at least one of the present double- stranded molecules or the vectors coding for the molecules.
  • the present invention provides the following compositions of [1] to[18]:
  • a composition for inhibiting a growth of GPC3 expressing cell and/or treating GPC3 -related disease which composition contains at least one isolated double- stranded molecule inhibiting the expression of GPC3 and the cell proliferation, wherein the molecule is composed of a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double- stranded molecule;
  • the composition of [1] or[2], wherein the GPC3 -related disease is esophageal cancer, gastric cancer, hepatic cancer, osteosarcoma, soft tissue cancer or endometriosis;
  • [8] The composition of [7], wherein the double-stranded molecule has the general formula 5'-[A]-[B]-[A']-3', wherein [A] is the sense strand containing a sequence corresponding to a target sequence selected from among SEQ ID NOs: 16 and 28, [B] is the intervening single strand composed of 3 to 23 nucleotides, and[A'] is the antisense strand containing a sequence complementary to [A] ;
  • composition of [10], wherein the double-stranded molecule is a hybrid of a DNA polynucleotide and an RNA polynucleotide;
  • composition of [10], wherein the double-stranded molecule is a chimera of DNA and RNA;
  • a composition for inhibiting a growth of GPC3 expressing cell and/or treating GPC3 -related disease which composition contains at least one vector that encoding at least one double- stranded molecule inhibiting the expression of GPC3 and the cell proliferation, wherein the molecule is composed of a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double- stranded molecule;
  • composition of [24], wherein the double- stranded molecule has the general formula 5'-[A]-[B]-[A']-3', wherein[A] is the sense strand containing a sequence corresponding to a target sequence selected from among SEQ ID NOs: 16 and 28,[B] is the intervening single strand composed of 3 to 23 nucleotides, and[A'] is the antisense strand containing a sequence complementary to[A];
  • the double-stranded molecules of the invention are preferably formulated as pharmaceutical compositions prior to administering to a subject, according to techniques known in the art.
  • Pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free.
  • pharmaceutical formulations include formulations for human and veterinary use. Methods for preparing pharmaceutical compositions of the invention are within the skill in the art, for example as described in Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is herein incorporated by reference.
  • the present pharmaceutical formulations contain at least one of the double-stranded molecules or vectors encoding them of the present invention (e.g., 0.1 to 90% by weight), or a physiologically or pharmaceutically acceptable salt of the molecule, mixed with a physiologically or pharmaceutically acceptable carrier medium.
  • physiologically or pharmaceutically acceptable carrier media are water, buffered water, normal saline, 0.4% saline, 0.3% glycine, hyaluronic acid and the like.
  • the composition may contain plural kinds of the double- stranded molecules, each of the molecules may be directed to the same target sequence, or different target sequences of GPC3.
  • the present composition may contain a vector coding for one or plural double- stranded molecules.
  • the vector may encode one or two kinds of the present double-stranded molecules.
  • the present composition may contain plural kinds of vectors, each of the vectors coding for a different double- stranded molecule.
  • the present double-stranded molecules may be contained as liposomes in the present composition. Details of liposomes are described above.
  • compositions of the invention can also include conventional pharmaceutical excipients and/or additives.
  • Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents.
  • Suitable additives include physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (for example calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate).
  • Pharmaceutical compositions of the invention can be packaged for use in liquid form, or can be lyophilized.
  • solid compositions conventional nontoxic solid carriers can be used; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
  • a solid pharmaceutical composition for oral administration can include any of the carriers and excipients listed above and 10-95%, preferably 25-75%, of one or more double-stranded molecule of the invention.
  • a pharmaceutical composition for aerosol (inhalational) administration can include 0.01-20% by weight, preferably 1-10% by weight, of one or more double- stranded molecule of the invention encapsulated in a liposome as described above, and propellant.
  • a carrier can also be included as desired; e.g., lecithin for intranasal delivery.
  • the present composition may contain other pharmaceutical active ingredients so long as they do not inhibit the in vivo function of the present double- stranded molecules.
  • the composition may contain chemotherapeutic agents conventionally used for treating cancers.
  • the present invention also provides the use of the double- stranded nucleic acid molecules of the present invention in manufacturing a pharmaceutical composition for treating disease characterized by the expression of GPC3.
  • the present invention relates to a use of double-stranded nucleic acid molecule inhibiting the expression of the GPC3 gene in a cell, which molecule includes a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double-stranded nucleic acid molecule and targets to a sequence selected from among SEQ ID NOs: 16 and 28, for manufacturing a pharmaceutical composition for treating GPC3 -related disease, e.g., esophageal cancer, gastric cancer, hepatic cancer, osteosarcoma, soft tissue cancer or endometriosis.
  • GPC3 -related disease e.g., esophageal cancer, gastric cancer, hepatic cancer, osteosarcoma, soft tissue cancer or endometriosis.
  • the present invention further provides a method or process for manufacturing a pharmaceutical composition for treating disease characterized by the expression of GPC3, wherein the method or process includes a step for formulating a pharmaceutically or physiologically acceptable carrier with a double-stranded nucleic acid molecule inhibiting the expression of GPC3 in a cell, which over-expresses the gene, which molecule includes a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double-stranded nucleic acid molecule and targets to a sequence selected from among SEQ ID NOs: 16 and 28 as active ingredients.
  • the present invention also provides a method or process for manufacturing a pharmaceutical composition for treating disease characterized by the expression of GPC3, wherein the method or process includes a step for admixing an active ingredient with a pharmaceutically or physiologically acceptable carrier, wherein the active ingredient is a double- stranded nucleic acid molecule inhibiting the expression of GPC3 in a cell, which molecule includes a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double- stranded nucleic acid molecule and targets to a sequence selected from among SEQ ID NOs: 16 and 28.
  • the present invention also provides the use of the double- stranded nucleic acid molecules of the present invention in manufacturing a pharmaceutical composition for treating a cancer expressing the GPC3 gene.
  • the present invention relates to a use of double- stranded nucleic acid molecule inhibiting the expression of a GPC3 gene in a cell, which over-expresses the gene, wherein the molecule includes a sense strand and an antisense strand complementary thereto, hybridized to each other to form the double- stranded nucleic acid molecule and targets to a sequence selected from the group consisting of SEQ ID NOs: 16 and 28, for manufacturing a pharmaceutical composition for treating a cancer expressing the GPC3 gene.
  • the present invention provides a method for treating a cancer (over)expressing GPC3, which method may include the steps of: i) determining the expression level of GPC3 in cancer cells or tissue(s) obtained from a subject with the cancer to be treated; ii) comparing the expression level of GPC3 with normal control; and iii) administrating at least one component selected from the group consisting of
  • the present invention also provides a pharmaceutical composition containing at least one component selected from the group consisting of:
  • the present invention further provides a method for identifying a subject to be treated with:
  • a vector encoding thereof which method may include the step of determining an expression level of GPC3 in subject-derived cancer cells or tissue(s), wherein an increase of the level compared to a normal control level of the gene indicates that the subject has cancer which may be treated with:
  • a subject to be treated by the present method is preferably a mammal.
  • exemplary mammals include, but are not limited to, e.g., human, non-human primate, mouse, rat, dog, cat, horse, and cow.
  • the expression level of GPC3 in cancer cells or tissues obtained from a subject is determined.
  • the expression level can be determined at the transcription (nucleic acid) product level, using methods known in the art.
  • the mRNA of GPC3 may be quantified using probes by hybridization methods (e.g., Northern hybridization). The detection may be carried out on a chip or an array. Those skilled in the art can prepare such probes utilizing the sequence information of GPC3 (e.g., SEQ ID NO: 1).
  • the cDNA of GPC3 may be used as the probes.
  • the probes may be labeled with a suitable label, such as dyes, fluorescent substances and isotopes, and the expression level of the gene may be detected as the intensity of the hybridized labels.
  • the transcription product of GPC3 may be quantified using primers by amplification-based detection methods (e.g., RT-PCR).
  • primers may be prepared based on the available sequence information of the gene (e.g., SEQ ID NO: 1).
  • a probe or primer used for the present method hybridizes under stringent, moderately stringent, or low stringent conditions to the mRNA of GPC3.
  • stringent (hybridization) conditions refers to conditions under which a probe or primer will hybridize to its target sequence, but not to other sequences. Stringent conditions are sequence-dependent and will be different under different circumstances. Specific hybridization of longer sequences is observed at higher temperatures than shorter sequences. Generally, the temperature of a stringent condition is selected to be about 5 degree Centigrade lower than the thermal melting point (Tm) for a specific sequence at a defined ionic strength and pH.
  • the Tm is the temperature (under a defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to their target sequence hybridize to the target sequence at equilibrium. Since the target sequences are generally present at excess, at Tm, 50% of the probes are occupied at equilibrium.
  • stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 degree Centigrade for short probes or primers (e.g., 10 to 50 nucleotides) and at least about 60 degree Centigrade for longer probes or primers. Stringent conditions may also be achieved with the addition of destabilizing agents, such as formamide.
  • the translation product may be detected for the determination of the expression level of GPC3.
  • the quantity of GPC3 protein e.g., SEQ ID NO: 2
  • Methods for determining the quantity of the protein as the translation product include immunoassay methods that use an antibody specifically recognizing the protein.
  • the antibody may be monoclonal or polyclonal.
  • any fragment or modification e.g., chimeric antibody, scFv, Fab, F(ab') 2 , Fv, etc.
  • Methods to prepare these kinds of antibodies for the detection of proteins are well known in the art, and any method may be employed in the present invention to prepare such antibodies and equivalents thereof.
  • the intensity of staining may be measured via immunohisto- chemical analysis using an antibody against the GPC3 protein. Namely, in this measurement, strong staining indicates increased presence/level of the protein and, at the same time, high expression level of the GPC3 gene.
  • the expression level of a target gene, i,e., the GPC3 gene, in cancer cells or tissue(s) obtained from a subject can be determined to be increased if the level increases from the control level (e.g., the level in normal cells) of the target gene by, for example, 10%, 25%, or 50%; or increases to more than 1.1 fold, more than 1.5 fold, more than 2.0 fold, more than 5.0 fold, more than 10.0 fold, or more.
  • the control level e.g., the level in normal cells
  • the control level may be determined at the same time with the cancer cells by using a sample(s) previously collected and stored from a subject/subjects whose disease state(s) (cancerous or non-cancerous) is/are known.
  • disease state(s) cancer or non-cancerous
  • normal cells obtained from non-cancerous regions of an organ that has the cancer to be treated may be used as normal control.
  • the control level may be determined by a statistical method based on the results obtained by analyzing previously determined expression level(s) of the GPC3 gene in samples from subjects whose disease states are known.
  • the control level can be derived from a database of expression patterns from previously tested cells.
  • the expression level of the GPC3 gene in a cancer cells or tissue sample obtained from a subject may be compared to multiple control levels, which are determined from multiple reference samples. It is preferred to use a control level determined from a reference sample derived from a tissue type similar to that of the subject-derived biological sample. Moreover, it is preferred to use the standard value of the expression levels of the GPC3 gene in a population with a known disease state. The standard value may be obtained by any method known in the art. For example, a range of mean +/- 2 S. D. or mean +/- 3 S.D. may be used as the standard value.
  • control level determined from a biological sample that is known to be non-cancerous is referred to as a "normal control level”.
  • control level is determined from a cancerous biological sample known to over-express GPC3, it is referred to as a "cancerous control level”.
  • the expression level of the GPC3 gene in cancer cells or tissue(s) obtained from a subject is increased as compared to the normal control level, or is similar/ equivalent to the cancerous control level, the subject may be diagnosed with cancer to be treated.
  • blood samples such as serum samples may be used for determining the expression level of GPC3 because GPC3 is a serum marker for cancer (WO2004/018667).
  • a standard value determined from multiple reference samples is preferably used as a normal control level.
  • the present invention provides a method of (i) diagnosing whether a subject has the cancer to be treated, and/or (ii) selecting a subject for cancer treatment, which method includes the steps of: a) determining the expression level of GPC3 in cancer cells or tissue(s) obtained from a subject who is suspected to have the cancer to be treated; b) comparing the expression level of GPC3 with a normal control level; c) diagnosing the subject as having the cancer to be treated, if the expression level of GPC3 is increased as compared to the normal control level; and d) selecting the subject for cancer treatment, if the subject is diagnosed as having the cancer to be treated, in step c).
  • such a method may include the steps of: a) determining the expression level of GPC3 in cancer cells or tissue(s) obtained from a subject who is suspected to have the cancer to be treated; b) comparing the expression level of GPC3 with a cancerous control level; c) diagnosing the subject as having the cancer to be treated, if the expression level of GPC3 is similar or equivalent to the cancerous control level; and d) selecting the subject for cancer treatment, if the subject is diagnosed as having the cancer to be treated, in step c).
  • the present invention also provides a kit for determining a subject suffering from cancer that can be treated with the double-stranded molecule of the present invention or vector encoding thereof, which may also be useful in assessing and/or monitoring the efficacy of a cancer treatment.
  • the cancer includes, but is not limited to, esophageal cancer, gastric cancer, hepatic cancer, osteosarcoma, soft tissue cancer or endometriosis.
  • the kit may preferably include at least one reagent for detecting the expression of the GPC3 gene in a subject-derived cancer cells or tissue sample, which reagent may be selected from the group of:
  • Suitable reagents for detecting mRNA of the GPC3 gene include nucleic acids that specifically bind to or identify the GPC3 mRNA, such as oligonucleotides which have a complementary sequence to a portion of the GPC3 mRNA. These kinds of oligonucleotides are exemplified by primers and probes that are specific to the GPC3 mRNA. These kinds of oligonucleotides may be prepared based on methods well known in the art. If needed, the reagent for detecting the GPC3 mRNA may be immobilized on a solid matrix. Moreover, more than one reagent for detecting the GPC3 mRNA may be included in the kit.
  • suitable reagents for detecting the GPC3 protein include antibodies to the GPC3 protein.
  • the antibody may be monoclonal or polyclonal.
  • any fragment or modification (e.g., chimeric antibody, scFv, Fab, F(ab') 2 , Fv, etc.) of the antibody may be used as the reagent, so long as the fragment or modified antibody retains the binding ability to the GPC3 protein.
  • Methods to prepare these kinds of antibodies for the detection of proteins are well known in the art, and any method may be employed in the present invention to prepare such antibodies and equivalents thereof.
  • the antibody may be labeled with signal generating molecules via direct linkage or an indirect labeling technique.
  • kits and methods for labeling antibodies and detecting the binding of the antibodies to their targets are well known in the art, and any labels and methods may be employed for the present invention.
  • more than one reagent for detecting the GPC3 protein may be included in the kit.
  • the kit may contain more than one of the aforementioned reagents.
  • tissue samples obtained from subjects without cancer or suffering from cancer may serve as useful control reagents.
  • a kit of the present invention may further include other materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts (e.g., written, tape, CD-ROM, etc.) with instructions for use.
  • These reagents and such may be retained in a container with a label.
  • Suitable containers include bottles, vials, and test tubes.
  • the containers may be formed from a variety of materials, such as glass or plastic.
  • the reagent when the reagent is a probe against the GPC3 mRNA, the reagent may be immobilized on a solid matrix, such as a porous strip, to form at least one detection site.
  • the measurement or detection region of the porous strip may include a plurality of sites, each containing a nucleic acid (probe).
  • a test strip may also contain sites for negative and/or positive controls. Alternatively, control sites may be located on a strip separated from the test strip.
  • the different detection sites may contain different amounts of immobilized nucleic acids, i.e., a higher amount in the first detection site and lesser amounts in subsequent sites.
  • the number of sites displaying a detectable signal provides a quantitative indication of the amount of GPC3 mRNA present in the sample.
  • the detection sites may be configured in any suitably detectable shape and are typically in the shape of a bar or dot spanning the width of a test strip.
  • the kit of the present invention may further include a positive control sample or GPC3 standard sample.
  • the positive control sample of the present invention may be prepared by collecting GPC3 positive samples and then assaying their GPC3 levels.
  • a purified GPC3 protein or polynucleotide may be added to cells that do not express GPC3 or buffers to form the positive sample or the GPC3 standard sample.
  • purified GPC3 may be a recombinant protein.
  • the GPC3 level of the positive control sample is, for example, more than the cut off value.
  • cDNA microarray slides Fabrication of the cDNA microarray slides has been described elsewhere (Zembutsu H et al., Cancer Res 2002 Jan 15, 62(2): 518-2.; Nishidate T et al., Int J Oncol 2004 Oct, 25(4): 797-819).
  • the present inventors prepared duplicate sets of slides containing 23,040 (colon cancer, soft tissue sarcoma, and testicular seminoma, prostate cancer) or 27,648 (breast cancer and bladder cancer) or 36,864 (pancreas cancer, NSCLC, SCLC, and esophagus cancer) cDNA spots, to reduce experimental fluctuation.
  • RNAs were extracted from patients with tumors and from corresponding normal tissues. T7-based RNA amplification was carried out to obtain adequate quantities of RNA for microarray experiments. Aliquots of amplified RNA were labeled by reverse transcription with adequate amounts of Cy5-dCTP or Cy3-dCTP (Amersham Biosciences, Buckinghamshire, United Kingdom). Hybridization, washing, and detection were carried out as described previously (Zembutsu H et al., Cancer Res 2002 Jan 15, 62(2): 518-27; Nishidate T et al., Int J Oncol 2004 Oct, 25(4): 797-819). [0115] Cell line and cell culture
  • GPC3 GPC3 gene expression level was evaluated in breast cancer and esophagus cancer cell lines using semi-quantitative RT-PCR experiments. Specifically, a 3-microgram aliquot of mRNA from each cell lines transfected with siRNA was reverse-transcribed for single- stranded cDNAs using oligo d(T)16 primer (Roche) and Superscript II (Invitrogen). Expression of beta-actin (ACTB) served as an internal control. The number of cycles in PCR reaction was optimized to ensure product intensity within the linear phase of amplification. Each cDNA mixture was diluted for subsequent PCR amplification with primer sets as follows:
  • GPC3 forward primer: 5'- GCTTGGTCTCTTTTCAACAATCC -3' (SEQ ID NO: 3); reverse primer: 5'- GCAAAAGGACAATCTATATGCTACC -3' (SEQ ID NO: 4);
  • siRNAs against the GPC3 gene were synthesized in BEX Co Ltd. 10 pmol/well dsRNA oligo against the GPC3 gene were transfected into TE8 cells (expressing the GPC3 gene) and TE7 cells (not detectable the expression of GPC3) on 96-well mi- crotiter plate (Becton Dickinson) using Lipofectamine2000TM (Invitrogen).
  • the siRNA against Luciferase siLuc: target sequence; CTT ACGCTGAGT ACTTCGA
  • SiTox (Dharmacon) was used as positive control. After transfection of each siRNA to cancer cells, the cell proliferation was examined. The knock down ability of siRNA was determined by RT-PCR.
  • the concentration of living cells visualized with calcein was evaluated using IN Cell Analyzer 1000 (GE Healthcare Bio-Science KK) after 96h from transfection of siRNA.
  • Example 2 Expression analysis of GPC3 in cancer cells by cDNA microarray and RT-PCR cDNA microarray analyses were carried out as described previously (Zembutsu H et al., Cancer Res 2002 Jan 15, 62(2): 518-27; Nishidate T et al., Int J Oncol 2004 Oct, 25(4): 797-819). Expression of GPC3 in cancer tissues was compared with that of corresponding normal epithelia, and up-regulation of GPC3 was confirmed in the tissue of gastric cancer, hepatic cancer, osteosarcoma, soft tissue cancer and endometriosis (Table 1).
  • siRNA design tool available on Ambion, Inc. website
  • G/C content was the range of 30%-60%.
  • the GPC3 gene was over-expressed in esophagus cancer cells including clinical sample (Table 1 and Figure IA).
  • growth suppression assay was performed in GPC3-expressing esophagus cancer cell line (TE8) transfected with each siRNA.
  • no effect was observed in TE7 cells transfected with GPC3-si#4 and GPC3-si#8 ( Figure 2B).
  • undesired non-specific cell death by transfection of GPC3-si#4 and GPC3-si#8 was not appeared.
  • GPC3 should be applicable to cancer therapy for a wide variety of cancers including gastric cancer, hepatic cancer, osteosarcoma, soft tissue cancer, esophagus cancer and endometriosis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne une molécule bicaténaire isolée inhibant la croissance d'une cellule exprimant GPC3. L'invention concerne également une méthode de traitement d'une maladie associée à GPC3, notamment un cancer oesophagique, un cancer gastrique, un cancer hépatique, un ostéosarcome, un cancer des tissus mous ou une endométriose, par administration de la molécule bicaténaire contre un gène de GPC3. En outre, l'invention concerne des produits, en particulier des molécules bicaténaires et des vecteurs les codant, ainsi que des compositions contenant les molécules ou les vecteurs, utiles dans les méthodes de l'invention.
PCT/JP2010/002379 2009-04-02 2010-03-31 Molécule bicaténaire inhibant l'expression de gpc3 WO2010113507A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US21179709P 2009-04-02 2009-04-02
US61/211,797 2009-04-02

Publications (1)

Publication Number Publication Date
WO2010113507A1 true WO2010113507A1 (fr) 2010-10-07

Family

ID=42827815

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2010/002379 WO2010113507A1 (fr) 2009-04-02 2010-03-31 Molécule bicaténaire inhibant l'expression de gpc3

Country Status (1)

Country Link
WO (1) WO2010113507A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107805636A (zh) * 2017-10-16 2018-03-16 山东大学 一种双功能5′‑tri‑phosphate siGPC‑3及制备方法与应用
EP4048791A4 (fr) * 2019-10-22 2024-03-06 Aim Immunotech Inc Procédés et compositions pour le traitement de l'endométriose

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HAUPT LM ET AL.: "The heparan sulfate proteoglycan (HSPG) glypican-3 mediates commitment of MC3T3-E1 cells toward osteogenesis", J CELL PHYSIOL, vol. 220, no. 3, September 2009 (2009-09-01), pages 780 - 791 *
ISHIGURO T ET AL.: "Anti-glypican 3 antibody as a potential antitumor agent for human liver cancer", CANCER RES., vol. 68, no. 23, 2008, pages 9832 - 9838 *
KOZU T: "Genome RNA technology and leukemia", EXPERIMENTAL MEDICINE, vol. 22, no. 17, 2004, pages 173 - 178 *
NAKATSURA T ET AL.: "Glypican-3, overexpressed specifically in human hepatocellular carcinoma, is a novel tumor marker", BIOCHEM BIOPHYS RES COMMUN, vol. 306, no. 1, 2003, pages 16 - 25 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107805636A (zh) * 2017-10-16 2018-03-16 山东大学 一种双功能5′‑tri‑phosphate siGPC‑3及制备方法与应用
EP4048791A4 (fr) * 2019-10-22 2024-03-06 Aim Immunotech Inc Procédés et compositions pour le traitement de l'endométriose

Similar Documents

Publication Publication Date Title
US8420329B2 (en) Methods for diagnosing or treating prostate cancer
US8512944B2 (en) PRMT1 for target genes of cancer therapy and diagnosis
US20100273855A1 (en) Compositions and methods of treating cancer
EP1730534A2 (fr) Compositions et procedes servant a traiter un cancer des poumons
US20160024597A1 (en) miRNAs AS THERAPEUTIC TARGETS IN CANCER
WO2008102906A1 (fr) Gènes de transition hspc-hrpc
WO2012023285A1 (fr) Ehmt2 comme gène cible pour le traitement et le diagnostic du cancer
WO2010023856A1 (fr) Gène ttll4 associé au cancer du pancréas
WO2010113507A1 (fr) Molécule bicaténaire inhibant l'expression de gpc3
WO2010023855A1 (fr) Gène c12orf48 servant de gène cible dans le traitement et le diagnostic du cancer
JP2007530519A (ja) 癌を治療するための材料および方法
KR20110063494A (ko) 암 치료 및 진단을 위한 표적 유전자인 ｏｉｐ５
WO2012157239A1 (fr) Gène chodl comme marqueur tumoral et cible thérapeutique pour le cancer
CN110964832A (zh) 肺癌诊断和治疗的靶基因
KR20230127007A (ko) Ednra 억제제를 유효성분으로 포함하는 대장암의 예방 또는 치료용 약학적 조성물
WO2012023287A1 (fr) Suv420h1 et suv420h2 comme gènes cibles pour le traitement et le diagnostic du cancer
JP2019165706A (ja) がんの治療又は予防用医薬および癌のバイオマーカー
WO2012023286A1 (fr) Lrrc42 comme gène cible pour le traitement et le diagnostic du cancer
WO2011018898A1 (fr) Cdc45l comme marqueur tumoral et cible thérapeutique pour le cancer
EP2470652A1 (fr) Ercc6l comme gènes cibles pour le diagnostic et la thérapie du cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10758286

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10758286

Country of ref document: EP

Kind code of ref document: A1