WO2010080007A2 - Ｔｏｌｌ 유사수용체２ 리간드로서 기능하는 그람양성균 유래의 리포단백질 - Google Patents

Ｔｏｌｌ 유사수용체２ 리간드로서 기능하는 그람양성균 유래의 리포단백질 Download PDF

Info

Publication number
WO2010080007A2
WO2010080007A2 PCT/KR2010/000164 KR2010000164W WO2010080007A2 WO 2010080007 A2 WO2010080007 A2 WO 2010080007A2 KR 2010000164 W KR2010000164 W KR 2010000164W WO 2010080007 A2 WO2010080007 A2 WO 2010080007A2
Authority
WO
WIPO (PCT)
Prior art keywords
lipoprotein
gram
positive bacteria
staphylococcus aureus
lipoproteins
Prior art date
Application number
PCT/KR2010/000164
Other languages
English (en)
French (fr)
Other versions
WO2010080007A3 (ko
Inventor
이복률
쿠로카와켄지
나카야마히로시
아사누마미와코
Original Assignee
부산대학교 산학협력단
리까가쿠 켄큐쇼
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 부산대학교 산학협력단, 리까가쿠 켄큐쇼 filed Critical 부산대학교 산학협력단
Publication of WO2010080007A2 publication Critical patent/WO2010080007A2/ko
Publication of WO2010080007A3 publication Critical patent/WO2010080007A3/ko

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/92—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving lipids, e.g. cholesterol, lipoproteins, or their receptors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria

Definitions

  • the present invention seeks to provide lipoproteins derived from Gram-positive bacteria that function as ligands of TRL2.
  • the immune system is divided into innate and adaptive immune systems, each with a different function and role.
  • TLRs Toll-like receptors
  • the innate immune system which includes antimicrobial peptides, phagocytic cells, complement systems, and Toll like receptors (TLRs)
  • TLRs Toll like receptors
  • LRR leucine-rich repeat
  • TLRs specifically recognize pathogen-associated molecular patterns (PAMPs) or microorganism-associated molecular patterns (MAMPs) derived from various microorganisms, including bacteria, viruses, protozoa and fungi, through the extracellular domain. Recognition of microbial invasion by TLRs triggers the activation of evolutionarily conserved signaling cascades in Drosophila and mammals.
  • PAMPs pathogen-associated molecular patterns
  • MAMPs microorganism-associated molecular patterns
  • the TLRs When the TLRs bind to the TLRs ligand, the TLRs mobilize MyD88, an essential signaling adapter for most TLRs, resulting in a signaling cascade that (i) activates the NF- ⁇ B pathway ( ii) activates MAPKs, including Jun N-terminal kinase (JNK).
  • Activated NF-kB induces secretion of various inflammatory cytokines -TNF-a, IL-4, IL-5, IL-6, etc., and these cytokines are inflamed through a complex immune network
  • Cells such as T lymphocytes, macrophages, NK cells, and dendritic cells are activated or induced at the site of inflammation.
  • TLRs TLR ligands that bind to TLRs
  • PAMPs are TLR ligands that bind to TLRs
  • PAMPs are generally (a) expressed by microorganisms rather than mammalian hosts, and (b) preservation of structure across a wide range of pathogens. And (c) the ability to stimulate innate immunity.
  • TLR1 and TLR2 recognize bacterial mycobacterial lipoproteins and triacylated lipopeptides, while TLR2 contains lipoproteins, peptidoglucan (PGN), lipoteichoic acid (LTA, gram-positive bacteria) (mycobacteria), glycosyl phophatidylinositol anchor (T. cruzi), phenol soluble modulin (S. epidermis), zymosan (fungi), and. It is involved in the recognition of structures of various pathogens such as glycolipids (Treponema maltophilum).
  • PPN peptidoglucan
  • LTA lipoteichoic acid
  • S. epidermis glycosyl phophatidylinositol anchor
  • zymosan zymosan
  • LPS of Leptospira interrogans or Porphyromonas gingivalis are recognized by TLR2. They differ from the typical Grams-negative LPS in biochemical and physical properties. TLR2 requires cooperation with TLR1 or TLR6 to recognize them, and TLR2 causes signaling in the form of heterodimerization with TLR1 or TLR6. TLR1 and TLR2 act as heterodimers to distinguish triacyl lipopeptides, and TLR2 and TLR6 act as heterodimers to distinguish the structural differences of microlipopeptides such as diacyl lipopeptides. It is involved in differentiation, and inhibiting any one of them blocks the effector cell response.
  • TLR3 is known to recognize double-stranded RNA and polyinosinic-polycytidylic acid (polyI: C), an alogue of dsRNA, which occurs during the propagation of RNA virus.
  • TLR4 recognizes lipopolysaccharide (LPS) expressed in the cell membrane of gram-negative bacteria and is the best studied among TLRs as a receptor for gram-negative bacteria LPS.
  • TLR5 recognizes the flagellin protein of Listeria monocytogens.
  • TLR7, 8 recognizes Imiquimod, Loxoribine and Single-Stranded RNAs
  • TLR9 recognizes CpG-containing sequences or synthetic oligonucleotides (ODNs) in bacterial DNA
  • TLR11 recognizes profilin-like proteins (He H , Genovese KJ, Nisbet DJ, Kogut MH.Profile of Toll-like receptor expressions and induction of nitric oxide synthesis by Toll-like receptor agonists in chicken monocytes.Mol Immunol. 2005 Aug 9).
  • Gram positive bacteria include staphylococci, streptococci, pneumococci, leprosy, diphtheria, tetanus, anthrax and actinomycetes, which are the main causes of most serious infectious diseases such as diphtheria, tuberculosis and pneumonia.
  • Staphylococcus aureus is a major pathogen, including food poisoning, impetigo, cellulitis, scalded skin syndrome, mastitis, and bacteremia.
  • Toxic shock syndrome causes a variety of diseases, Staphylococcus aureus is not only adaptable, but also strong resistance to antibiotics and resistance to multiple drugs.
  • a new lipoprotein derived from Gram-positive bacteria acting on Toll-like receptor2 is used for the prevention and treatment of diseases caused by Gram-positive bacteria with multiple drug resistance causing serious diseases.
  • the present invention provides an immunogenic composition for preventing or treating Gram-positive bacteria, an immunostimulant for preventing or treating Gram-positive bacteria, and an antigen for diagnosing Gram-positive bacteria.
  • the present invention provides a lipoprotein derived from Gram-positive bacteria, which functions as a ligand for Toll-like receptor 2.
  • the present invention provides an immunogenic composition and immunostimulating agent for preventing or treating Gram-positive bacteria, comprising a lipoprotein derived from Gram-positive bacteria, which functions as a ligand for Toll-like receptor 2.
  • the present invention provides a diagnostic kit comprising the gram-positive bacteria-derived lipoprotein as a diagnostic antigen.
  • lipoproteins derived from gram-positive bacteria Acts as a ligand of Toll-like receptor 2 and stimulates the immune response in vivo, confirming that it can be utilized as an excellent immunogen, immunostimulant or diagnostic antigen in preventing or treating diseases caused by Gram-positive bacteria. Completed.
  • innate immune response refers to any type of immune response to certain pathogen binding molecular patterns (PAMPs).
  • Innate immunity also known in the art as natural or native immunity, mainly includes neutrophils, granulocytes, monocyte phagocytes, dendritic cells, NKT cells and NK cells.
  • Innate immune responses include, but are not limited to, type I interferon production (eg IFN- ⁇ ), neutrophil activity, macrophage activity, phagocytosis, opsonization, complement activity, and any combination thereof It doesn't work.
  • TLR refers to at least 11 highly conserved proteins that recognize pathogen binding molecular patterns (PAMPs) and act as key signaling elements in innate immunity.
  • PAMPs pathogen binding molecular patterns
  • TLR1-TLR11 mammalian pattern recognition receptor protein
  • TLR polypeptides can share certain structures, including extracellular (extracellular) domains with leucine-rich repeats, transmembrane domains and intracellular (cytoplasmic) domains involved in TLR signaling.
  • TLRs include but are not limited to human TLRs.
  • TLR ligand is one that binds to and activates the receptor.
  • native lipoproteins derived from Gram-positive bacteria functioning as TLR2 ligands have not yet been purified or characterized.
  • the present invention provides a lipoprotein derived from Gram-positive bacteria, which functions as a ligand for Toll-like receptor 2.
  • Species-specific TLRs comprising Toll like receptor 2 (TLR2) in the present invention are not limited to mammalian TLRs and may include TLRs derived from human or non-human sources.
  • Non-human sources include, but are not limited to, mammals such as mice, cows, dogs, cats, sheep, pigs, and horses.
  • Gram-positive bacteria to produce lipoprotein, Toll-like receptor 2 ligand in the present invention is not particularly limited in kind, but preferably Staphylococcus aureus, Bacillus substilis, Micro Micrococcus luteus, Streptococcus pneumoniae, Enterococcus faecalis, Streptococcus mutans, Streptococcus pyogenes, Streptococcus pyogenes agalactic (Streptococcus agalactiae), S.
  • Lipoproteins derived from Gram-positive bacteria of the present invention may be lipoproteins naturally produced in Gram-positive bacteria, and may also be synthesized by using conventional techniques of molecular biology, microbiology, recombinant DNA and immunology within the skill of the art. Or recombinantly produced lipoproteins. Such techniques are described in, eg, Sambrook Molecular Cloning: A Laboratory Manual, Second Edition (1989); DNA Cloning, Volumes I and II (D.N. Glovere, ed., 1985); Oligonucleotide Synthesis (M. J. Gait, ed., 1986); Nucleic Acid Hybridization (B.D. Hames & S. J.
  • the lipoprotein derived from the Gram-positive bacteria of the present invention is a lipoprotein synthesized by adding a modification, which is structurally and functionally identical to the lipoprotein derived from the native Gram-positive bacteria, or generally made in the art by a chemical preparation method, and is chemically selective. It can be prepared by chemoselective ligation or chemical conjugation or oxim chemistry. Such methods are well known in the art and individual peptide constructs can be prepared in a suitable configuration, configuration or order by chemical or recombinant means followed by their chemically selective binding (eg See, for example, Nardin et al., Vaccine 16, 590 (1998); Nardin et al., J. Immunol.
  • Lipidation can be accomplished by the methods known in the art on the peptide construct prepared above. Lipids can be added to the polypeptide through standard condensation, addition, substitution or oxidation.
  • ATP-binding cluster (ABC) transporter substrate- as a lipoprotein derived from Gram-positive bacteria, which functions as a ligand for Toll-like receptor 2. It provides lipoprotein, characterized in that belonging to the group of binding proteins).
  • the ATP binding cluster (ABC) transporter substrate-binding proteins function as TLR2 ligands and the N-terminus.
  • Lipobox N-terminal lipobox is characterized by the presence of a cysteine residue (cysteine residue) having a specific amino acid sequence and the lipid binding to the end thereof.
  • the lipoprotein is characterized in that it belongs to the group of ATP binding cluster (ABC) transporter substrate-binding proteins derived from Gram-positive bacteria. It may be a lipoprotein, preferably ATP binding cluster (ABC) transporter substrate binding protein from Bacillus substilis, Micrococcus luteus or Staphylococcus aureus (ATP binding cluster (ABC) transporter substrate-binding proteins) lipoproteins, characterized in that belonging to the group, more preferably, Bacillus substilis (Bacillus substilis) YfmC (NP_388633) is a lipoprotein, micrococcus Staphylococcus aureus, a lipoprotein encoded by Lucose (Micrococcus luteus) GluE (ZP_02945718) lococcus aureus) SitC (YP_499195), SAOUHSC_02699 (YP_501161), SAOUHSC_00844 (Y
  • the present invention provides a lipoprotein having a triacylated N-terminus as a lipoprotein derived from Gram-positive bacteria, which functions as a ligand to Toll-like receptor 2.
  • the ligand that stimulates Toll-like receptor 2 may be a lipoprotein having a triacylated N-terminus derived from Gram-positive bacteria, preferably Staphylococcus aureus.
  • the Staphylococcus aureus is not particularly limited in its kind, but is preferably S. aureus RN4220, S. aureus SA113, S. aureus MW2, or S. aureus It may be MSSA4776.
  • the lipoprotein of the present invention may include all of the triacylated N-terminus lipoproteins derived from Staphylococcus aureus, preferably SitC (YP_499195), SAOUHSC_02699 (YP_501161), SAOUHSC_00844 (YP_499398), SAOUHSC_02650 (YP_501112), SAOUHSC_02549 (hypothetical molybdate-binding ABC-transporter, YP_501011) or SAOUHSC_00808 (YP_499364).
  • Bacterial lipoproteins are structurally divided into two groups: diacylated lipoproteins and triacylated lipoproteins. These two groups can be distinguished by the presence or absence of three enzymes involved in the maturation of bacterial lipoproteins. During maturation, this first enzyme, lipoprotein diacylglycerol transferase (Lgt), catalyzes the transfer of diacylglycerol to the sulfhydryl moiety of cysteine residues conserved in the signal peptide of lipoprotein precursors. The second enzyme, lipoprotein signal peptidase (Lsp), then cleaves this product.
  • diacylated lipoproteins catalyzes the transfer of diacylglycerol to the sulfhydryl moiety of cysteine residues conserved in the signal peptide of lipoprotein precursors.
  • Lsp lipoprotein signal peptidase
  • N-acyltransferase an enzyme that exists only in Gram-negative bacteria that does not exist in Gram-positive bacteria, transfers one acyl group to the amino group of S-diacylated cysteine residues as a third enzyme. It is known to produce acylated-S-diacylated lipoproteins.
  • Gram-positive bacteria produce diacylated lipoproteins because N-acyltransferase (Lnt) has not yet been demonstrated in Gram-positive bacteria, and Gram-negative bacteria are triacylated lipoproteins. triacylated lipoproteins).
  • the protein derived from Staphylococcus aureus belonging to Gram-positive bacteria was triacylated through mass analysis as demonstrated in the following experimental example.
  • the structure of the triacylated lipoprotein found as an example of the present invention is represented by the formula (1).
  • Formula 1 is only one example of triacylated lipoprotein of Gram-positive bacteria Staphylococcus aureus, but the scope of the present invention is not limited thereto.
  • a lipoprotein derived from Staphylococcus aureus has a triacylated N-terminus and may be a fatty acid saturated in an N-terminal cysteine, preferably N. C5 to C50 saturated in terminal cysteine, more preferably C15 to C20 fatty acid saturated in N-terminal cysteine residue. Since the infectivity and pathogenicity of bacteria will be considered by the carbon number of the fatty acid, the carbon number may have an important meaning in the future application of the present invention.
  • the N-terminus of the bacterium may be triacylated by modifying three fatty acids having a carbon number in the range of C5 to C50, preferably C15 to 20.
  • the present invention is to provide an immunogenic composition for preventing or treating Gram-positive bacteria as an active ingredient, a lipoprotein derived from Gram-positive bacteria, which functions as a ligand for Toll-like receptor 2.
  • the lipoprotein may be derived from Gram-positive bacteria, preferably Staphylococcus aureus, Bacillus substilis, Micrococcus luteus, Streptococcus pneumoniae ( Streptococcus pneumoniae, Enterococcus faecalis, Streptococcus mutans, Streptococcus pyogenes, Streptococcus agalactiae, S. e.
  • Gram-positive bacteria preferably Staphylococcus aureus, Bacillus substilis, Micrococcus luteus, Streptococcus pneumoniae ( Streptococcus pneumoniae, Enterococcus faecalis, Streptococcus mutans, Streptococcus pyogenes, Streptococcus agalactiae, S. e.
  • Streptococcus gordonii Streptococcus mitis
  • Streptococcus oralis Streptococcus oralis
  • Streptococcus equi Bacillus anthracis
  • Bacillus anthracis Preferably, Staphylococcus aureus oil Raw protein.
  • a lipoprotein derived from Staphylococcus aureus which has a triacylated N-terminus
  • the carbon number of the fatty acid to be modified plays an important role in the infectivity and pathogenicity of the bacteria, because it is possible to determine which bacterial lipoproteins to produce as infectious and pathogenic high or low immunogens depending on the carbon number
  • the carbon number of may have an important meaning in the present invention.
  • lipoproteins that act as immunogens of the invention may comprise at least an immunogenic portion of a gram-positive lipoprotein that interacts with Toll-like receptor 2, a portion thereof, or a variant thereof.
  • the immunogenic moiety includes a binding moiety recognizable by Toll-like receptor 2, and preferred fragments include fragments that exhibit immunogenicity when provided alone or when contained in an immunogenic composition of the present invention.
  • immunogenic composition refers to the ability of the composition to elicit an immune response in a mammal against a particular pathogen.
  • immunogenic compositions include lipoproteins of the invention for vaccines, vaccine conjugates. It may include a case used for such.
  • the lipoprotein of the present invention When the lipoprotein of the present invention is used as an immunogen, only a lipoprotein functioning as an immunogen can be produced using molecular biological techniques commonly used in the art such as recombination or by a method such as chemical synthesis. The risk can be excluded by not using the Gram-positive bacteria that cause disease during in vivo administration as direct antigens.
  • the antigenicity is very similar to that of the original Gram-positive bacteria, which is suitable for use as an immunogen for prophylaxis and treatment. In situations, laboratories will be able to easily and quickly mass-produce prophylactic and therapeutic immunogens.
  • each can be administered independently or in combination with other ingredients.
  • These vaccine compositions may comprise an adjuvant together with one or more pharmaceutically acceptable carriers and / or diluents acceptable in the art, which carriers may themselves include any carrier which does not cause a harmful reaction to the individual to which the composition is administered. Include. Suitable carriers are usually large and slow metabolized macromolecules such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids, amino acid copolymers, lipid aggregates (eg oil droplets or liposomes) or inert virus particles. It may include. Such carriers are well known to those skilled in the art.
  • Surfactants and particulates such as nonionic block polymer surfactants (eg cholesterol), virosomes, saponins (eg Quil A, QS-21 and GPI-0100), proteosomes, immune stimulation Complexes, cocleates, quaternary amines (dimethyl dioctadecyl ammonium bromide (DDA)), abridine, vitamin A, vitamin E; Bacterial products, such as the RIBI adjuvant system (Ribi Inc.), Mycobacterum phlei cell wall skeleton (Detox®), Muramil dipeptide (MDP) and tripeptide (MTP), monoforce Poryl lipid A, Bacillus Calmete-Guerin, heat-labile E.
  • coli enterotoxin cholera toxin, trehalose dimicholate, CpG oligodeoxynucleotides
  • Cytokines and hormones such as interleukin (IL-1, IL-2, IL-6, IL-12, IL-15, IL-18), granulocyte colony stimulating factor, dehydroepiandrosterone, 1,25-dihydrate Roxy Vitamin D3
  • Polyanions such as dextran; Polyacrylics (eg, polymethylmethacrylate, Carbopol 934P); Carriers such as tetanus toxide, dipteria toxide, cholera toxin B subunit, mutant heat-labile enterotoxin (rmLT) of enterooxygenic Escherichia coli, heat shock protein; Oil-in-water emulsions such as AMPHIGEN® (Hydronics, USA); And water-in-oil emulsions, such as Freund's complete and incomplete adjuvant.
  • the subject of the immunogenic composition of the present invention includes human or non-human, preferably human, cattle, pigs, goats, dogs, sheep and the like, but is not limited to these examples.
  • an effective amount of any of the vaccines, vaccine conjugates, immunogens or adjuvants described herein can be administered to a host.
  • An effective amount means an amount required to alleviate or eliminate a symptom to be treated or prevented without inducing severe toxicity to a host, and those skilled in the art can appropriately select it. This amount can be measured by observing the host's immune response after a certain amount of a particular agent (eg, an immunized polypeptide).
  • the effective dose of the immunogenic composition of the present invention is 10 5 pfu (plaque forming unit) to 10 12 pfu / kg body weight, preferably 10 8 to 10 11 pfu / weight kg, but is not limited thereto.
  • the dosage of the immunogenic composition may be determined by the route of administration, the method of administration, the tissue to which the vaccine is administered (eg, muscle, respiratory system), the desired antibody titer, the specific treatment requirements of the subject to be immunized, the severity of the symptoms, the sex, age and weight of the individual, etc. Can be selected appropriately.
  • compositions described herein can be administered to any part of the host body, including but not limited to joints, blood flow, lungs, guts, muscle tissue, skin and peritoneal cavity. Therefore, the immunogenic composition may be administered by intravenous, intraperitoneal, intramuscular, subcutaneous, intradermal, and intradermal infusion, oral administration, inhalation, or sequential administration over time.
  • aerosol formulations containing an immunogen can be administered to a host by inhalation.
  • duration of vaccination with any of the materials described herein can be as short as 1 day and as long as lifetime (eg, years).
  • an immunogen can be administered once a year over a decade.
  • the number of treatments can also vary. For example, the immunogen can be administered daily, weekly, monthly or once a year (or twice, three times, etc.).
  • Formulations for administration may include sterile aqueous or nonaqueous solutions, suspensions and emulsions.
  • non-aqueous solvents include, but are not limited to, propylene glycol, polyethylene glycol, vegetable oils, and injectable organic esters.
  • Aqueous carriers include, but are not limited to, water and alcohols, saline and buffer solutions.
  • preservatives, flavoring agents and other additives such as, for example, antimicrobials, antioxidants, chelating agents, inert gases, and the like may also be included.
  • Formulations of such immunogenic compositions preferably use those suitable agents known in the art as disclosed in Remington's Pharmaceutical Science (latest version), Mack Publishing Company, Easton PA.
  • Any method can be used to determine whether a specific immune response is induced.
  • antibody responses to specific antigens can be determined using immunological assays (eg, ELISA).
  • medical methods to assess the extent of a particular disease state can also be used to determine whether a target immune response is induced.
  • the present invention provides an immunostimulant for preventing or treating Gram-positive bacteria, which comprises lipoprotein derived from Gram-positive bacteria, which functions as a ligand for Toll-like receptor 2.
  • Lipoprotein of the present invention is derived from Gram-positive bacteria, but the type thereof is not particularly limited, but is preferably Staphylococcus aureus, Bacillus substilis, Micrococcus luteus , Streptococcus pneumoniae, Enterococcus faecalis, Streptococcus mutans, Streptococcus pyogenes, Streptococcus agalactia, Stgaltococcus, S.epidermidis, Streptococcus gordonii, Streptococcus mitis, Streptococcus oralis, Streptococcus equis, Streptococcus equisis (Bacillus ansis) anthracis), more preferably Staphylococcus It can be a thunder-house (Staphylococcus aureus).
  • the lipoprotein of the present invention acts as a ligand of TRL to enhance the response of TRL.
  • the lipoprotein may act directly or indirectly to stimulate an immune response to cause an enhanced immune response.
  • the present invention is to provide a diagnostic kit comprising a lipoprotein derived from Gram-positive bacteria as a diagnostic antigen, which functions as a ligand for Toll-like receptor 2.
  • the diagnostic subject of the present invention is a Gram-positive bacterium, but the type thereof is not particularly limited, but is preferably Staphylococcus aureus, Bacillus substilis, Micrococcus luteus, Streptococcus Streptococcus pneumoniae, Enterococcus faecalis, Streptococcus mutans, Streptococcus pyogenes, Streptococcus agalactia, Streptococcus agal.
  • Streptococcus gordonii Streptococcus mitis
  • Streptococcus oralis Streptococcus equi
  • Bacillus anthracis It may be, more preferably, Staphylococcus aur eus), Bacillus substilis, Micrococcus luteus
  • the diagnostic antigen is Bacillus substilis YfmC (NP_388633), Micrococcus luteus GluE (ZP_02945718), Staphylococcus aureus, which functions as a ligand to Toll-like receptor 2.
  • SitC ((YP_499195), SAOUHSC_02699 (YP_501161), SAOUHSC_00844 (YP_499398), SAOUHSC_02650 (YP_501112), SAOUHSC_02549 (hypothetical molybdate-binding ABC-transporter) of Staphylococcus aureus, or 808_6410C93_00, or 808_C9_6464 Lipoprotein may be, but the scope of the present invention is not limited thereto.
  • the present invention provides a diagnostic kit comprising a gram-positive bacteria-derived lipoprotein as a diagnostic antigen.
  • a diagnostic kit comprising a gram-positive bacteria-derived lipoprotein as a diagnostic antigen.
  • the antigen for diagnosis of gram-positive bacteria according to the present invention can be provided in all diagnostic methods for diagnosing a disease using diagnostic antigens in the art and in a diagnostic method for confirming the detection of gram-positive bacteria, such as agar gel. It can be used for sedimentation (AGID), enzyme-linked immunoassay (ELISA). That is, the present invention can be provided in a diagnostic kit for detecting an antigen-antibody reaction by reacting a biological antibody sample collected from a subject and a Gram-positive bacterium diagnostic antigen according to the present invention.
  • the lipoprotein derived from the Gram-positive bacteria of the present invention which functions as a ligand of Gram-positive bacteria-derived Toll-like receptor 2, can be utilized as a good immunogen or immunostimulant in the prevention or treatment of diseases caused by Gram-positive bacteria. Since it will be able to be used as a diagnostic antigen in the diagnosis of positive bacteria, the industrial value of the present invention will be large.
  • FIG. 1A to 1H show whether a cell wall molecule functions as a native TLR2 ligand and stimulates the CHO / hCD14 / hTLR2 reporter cell line with the hCD25 gene induced by NF- ⁇ B.
  • the surface expression level of CD25 was measured by flow cytometry.
  • FIG. 1I confirms that TX-114 phase fragment showing TLR2 stimulatory activity was separated by SDS-PAGE to obtain one 33 kDa protein band.
  • Figure 2 shows the sequencing of Staphylococcus aureus SitC lipoprotein (boxes show signaling peptides, asterisks show lipid binding cysteines, and underlined Edman cleavage sequences). Shows the amino acid sequence determined by the dashed line, and the dotted line indicates the amino acid sequence determined by LC-MS / MS, and the double underline indicates the amino acid determined by MALDI TOFMS.)
  • FIG. 3 shows SitC protein fragments digested by lysylendopeptidase in SDS-PAGE gel slices by MALDI TOFMS.
  • FIG. 4 shows the MALDI-TOF MS spectra of the organic phase of the in-gel tryptic digest of SitC (FIG. 4A), LPL digests (FIG. 4B) cultured for 5 hours, and LPL digests (FIG. 4C) cultured for 17 hours.
  • the MALDI-TOF MS spectra is shown.
  • Figure 6 shows the chemical structure of N-octadecanoly-S-glyceryl-cysteinyl-GTGGK.
  • Figure 7 shows the SDS-PAGE analysis with cell lysate and TX114 fraction of S. aureus RN4220, the following arrows represent SitC and SAOUHSC_02699.
  • FIG. 8 shows the MALDI-TOF mass spectrum of the 33-kDa protein in FIG. 7, which detects triacylated lipopeptides of cell lysate of S. aureus.
  • Figure 9 shows the MALDI-TOF mass spectrum of triacylated lipoproteins of SitC of S. aureus SA113 strain.
  • Figure 11 is a MALDI mass spectrum of lipid modified peptides of S. aureus SA113 strain, which shows the triacylated lipoproteins of SitC and SAOUHSC_02699 in the MALDI mass spectrum.
  • FIG. 12 surface expression of NF- ⁇ B-driven hCD25 in CHO / hCD14 / hTLR2 cells (FIG. 12A) or CHO / hCD14 / hTLR4 (FIG. 12B) cells stimulated by S. aureus SitC protein was analyzed by flow cytometry. It is shown.
  • Figure 13 shows TLR2 stimulation by purified SitC and SitC mutant bacteria
  • Figures 13A and 13B show maternal C57BL / 6 (bar1), TLR1-/-(bar2), TLR2-/-(bar3), TLR6 Peritoneal macrophages prepared from ⁇ / ⁇ (bar4), and MyD88 ⁇ / ⁇ (bar5) were stimulated with LPS, synthetic Pam3CSK4, MALP-2, or purified SitC protein and TNF- ⁇ in culture supernatant (FIG. 13A ) And IL-6 (FIG. 13B) are measured using ELISA. N.D means that nothing was detected.
  • FIG. 13C SDS-PAGE analysis of the aqueous phases (lane1 and lane3) and TX-114-detergent phases (lane2 and lane4) of the solubilized PGN.
  • FIG 14 shows that ABC transporter substrate binding lipoproteins of two different Gram-positive bacteria activate TLR2.
  • 14A shows SDS-PAGE analysis of purified S. aureus SitC (laneSitC), B.subtilisYfmC (lane1), and M.luteusGluB (lane2) lipoproteins.
  • CHO / hCD14 / hTLR2 Figures 14B and 14D
  • CHO / hCD14 / hTLR4 Figures 14C and 14E cells show B.subtilis YfmC lipoproteins ( Figures 14B and 14C) or M. Stimulation is shown with or without luteus GluB lipoproteins (FIGS. 14D and 14E) (black lines with gray areas).
  • Figure 15 shows the amino acid sequence of TLR2 stimulating lipoproteins B. subtilis YfmC (NP_388633, A) and M. luteus GluE (ZP_02945718, B) (box below shows signal sequence peptide, asterisk is lipid binding Cysteine and underlined letters indicate amino acids determined by LC-MS / MS analysis of trypsin-treated fragments).
  • S. aureus and E. coli strains were obtained at 12.5 ⁇ g / ml chloramphenicol (Cm), 20 ⁇ g / ml pheleomycin (phleomycin, Phleo), 100 ⁇ g / ml ampicillin (Amp) at 30 ° C. or 37 ° C. Tryptic soy broth (Difco) or Luria Bertani medium containing 50 ⁇ g / ml kanamycin (Km), or 10 ⁇ g / ml erythromycin (Erm) (1% tryptone, 0.5% yeast extract and 1 % NaCl). While B. subtilis strain 168 was cultivated in Luria Bertani medium containing 0.5% NaCl, M.
  • luteus ATCC 4698 which was distributed from the Korean Culture Center of Microorganisms, was cultured in Tryptic soy broth.
  • S. aureus SA113 is also available from Dr. Kagoshima University. Received from Hashimoto. Methicillin -resistant S. aureus (MRSA) MW2 and methicillin-sensitive S. aureus (MSSA) 4776 were obtained from the Korean Culture Center of Microorganisms.
  • S. aureus RN4220, SA113, MW2, and MSSA4776 were grown in the aforementioned Luria Bertani (LB) or Brain Heart Infusion (BHI) medium.
  • S. aureus strains and plasmids used in this study are listed in Table 1 below.
  • E. coli strain XL1-Blue (recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F'proAB lacIq lacZ ⁇ M15 Tn10 (Tetr)], Stratagene) was used in the subcloning procedure.
  • DNA fragments located upstream or downstream of about 1.5 kbp from sitC were used with PCR primers SitC-P1KpnI (CGGGGTACCGTTTGTCGGAATTGATTT) and SitC-P2 (TATTGGATCCTTTTCATGTTAAACTTCCTCGTTTC) or SGTTCCCTCAT ) And amplified using SitC-P4EcoRI (GGGATTGATGGAATTCTGAAGGGCTTTTCATCA), and then, secondly, Phleo-P2 + (primer, which has a sequence complementary to SitC-P2 and SitC-P3 and complementary to pUC19-upp-phleo template, respectively Phleo resistance gene was amplified using GGATCCAATAGACCAGTTGCA) and Phleo-P3 + (CGATTGCTGAACAGATTAATAATAGA).
  • the three amplified fragments were then spliced together using joining PCR (Fabret, C., Ehrlich, SD, and noisyrot, P. (2002) Mol Microbiol 46, 25-36), and the resulting sections Insertion into the KpnI and EcoRI positions of pKOR1 (Bae, T., and Schneewind, O. (2006) Plasmid 55, 58-63) produces pKOR1-sitC.
  • the pKOR1-sitC plasmid was introduced into RN4220 cells and the Cm-resistant strain produced by homologous recombination was selected at 43 ° C.
  • Cm-sensitive strains showing Phleo resistance were formed through second site homologous recombination and were screened in the presence of 100 ng / ml anhydrotetracycline at 30 ° C and termed M0573.
  • PCR with the primers SitC-P1 KpnI and SitC-P4 EcoRI was performed to confirm the lack of the chromosome sitC gene in M0573.
  • the lgt gene encoding lipoprotein diacylglycerol transferase was expressed in RN4220 cells by a single cross-over recombination that mediates the integration of plasmid fragments derived from pMUTIN-T3 (Erm resistant). Split.
  • This fragment in particular pMlgt, has an internal lgt open reading frame, which is amplified with primers 5Plgt-HindIII (CCCAAGCTTAGGACCACTGAGTGTACGATGG) and 3Plgt-BamHI (CGCGGATCCAGCGACATCCCAAAT). PCR confirmed insertional deletion of the chromosome lgt gene.
  • pSlgt is a derivative of the pKE515 plasmid with the lgt gene open region frame under the control of the S. aureus hu gene promoter.
  • the lgt gene open reading frame is then amplified using primers pSlgt-5PKpnI (TGAGGAGTAGGTACCATGGGTATTGTA) and pSlgt-3PEcoRI (CGGAATTCACGCCATAAAGGGTTTGTATGA), cut into KpnI and EcoRI and inserted into the KpnI and EcoRI sites of pKE515pHU.
  • pSsitC is a derivative of pKE515 with the sitC gene open region frame under the control of the S. aureus hu gene promoter.
  • the sitC gene open reading frame was amplified using primers pSsitC-5PKpnI (ACGAGGAAGGGTACCATGAAAAAATTA) and pSsitC-3PSalI (GTCGACTGTTGATGTGTGGCCTAAAA) and subcloned into pGEM-T easy vector via TA cloning (Promega, Madison), resulting in pGEM-s Got.
  • This pGEM-sitC was cleaved with KpnI and NotI and inserted into the KpnI and NotI sites of pKE515pHU to obtain pSsitC.
  • the present invention pS sitC pKE515pHU carrying SitC ORF
  • the present invention pS lgt pKE515pHU carrying Lgt ORF
  • the present invention pMUTIN-T3 S. aureus integration vector, Ampr, Ermr (5) d pM lgt pMUTIN-T3 carrying internal lgt coding region
  • the present invention pKOR1 Targeting vector for S. aureus genes, Ampr, Cmr (6) e pKOR1- sitC PKOR1 carrying ⁇ sitC :: phleo
  • the present invention pS sitC pKE515pHU carrying SitC ORF
  • the present invention pS lgt pKE515pHU carrying Lgt ORF
  • the present invention pMUTIN-T3 S. aureus integration vector, Ampr, Ermr (5) d pM lgt pMUTIN-T3 carrying internal l
  • a phleo the pheleomycin resistance gene
  • Cmr chloramphenicol resistance
  • Ampr ampicillin resistance
  • Ermr erythromycin resistance
  • Example 2 Insoluble peptidoglycan from S. aureus cells
  • Insoluble peptidoglycans were prepared (Park, JW, Kim, CH, Kim, JH, Je, BR, Roh, KB, Kim, SJ, Lee, HH, Ryu, JH, Lim, JH, Oh, BH). , Lee, WJ, Ha, NC, and Lee, BL (2007) Proc Natl Acad Sci USA 104, 6602-6607).
  • S. aureus RN4220 cells were obtained from an OD 600 of 1.5 (500 ml culture) and 12 g glass beads (0.1 to 0.11 mm) under 2,000 oscillations per minute for a total of 7 minutes in a solution consisting of 20 ml of 1 M NaCl. Crushed with.
  • the cells were centrifuged at 2,000x g for 10 minutes, and the supernatant was centrifuged at 13,000 xg for 10 minutes. Its fillet (crude peptidoglycan fraction) is resuspended in 0.5% SDS and then incubated at 60 ° C for 30 minutes. Insoluble peptidoglycan fractions are collected by washing with water six times.
  • SitC lipoproteins were isolated from S. aureus insoluble peptidoglycan fractions by Triton X-114 (TX-114) phase partitioning (see Shimizu, T., Kida, Y., and Kuwano). , K. (2005) J Immunol 175, 4641-4646). Briefly, S. aureus insoluble peptidoglycan fragment (100 mg) at 37 ° C. in a 10 ml solution consisting of 20 mM Tris-HCl (pH 8) added TX-114 to a final concentration of 2%. After digestion with ⁇ -lyticase (4 ⁇ g) for 14 hours, the cells were incubated at 4 ° C. for 1 hour.
  • the mixture was then incubated at 37 ° C for 10 minutes to phase separate. After centrifugation at 10,000 xg for 10 minutes, the upper aqueous phase was removed and replaced with an equal volume of TBSE solution (20 mM Tris-HCl, pH 8, 130 mM NaCl and 5 mM EDTA). This process was repeated twice. To precipitate the components of this solution, excess ethanol was added to the final TX-114 phase. During TX-114 phase separation, peptidoglycans that induce phenoloxidase activity in Tenebrio molitor hemolymph were observed in the aqueous phase (see Kan, H., Kim, CH, Kwon, HM, Park, JW, Roh, KB).
  • aureus RN4220 cells crushed with glass beads were centrifuged at 2,000 xg for 10 minutes to fillet the cell debris and centrifuged at 13,000 xg for 20 minutes after removal of their supernatant. Cell lysates were separated and supernatant fractions were collected. After cell lysate is fractionated using TX-114 phase separation, the obtained TX-114 fragment is precipitated with ethanol, loaded onto a gel and analyzed via SDS-PAGE. 33 kDa protein was recovered from the gel and precipitated with ethanol (precipitated).
  • Lipoproteins of B. subtilis 168 or M. luteus ATCC 4698 cells were purified from cell lysate using a method similar to that used to purify S. aureus SitC from cell lysate. It was. 33 kDa protein and 37 kDa protein from TX-114 fragments from B. subtilis or M. luteus cells, respectively, were isolated via SDS-PAGE, recovered from the gel and precipitated with ethanol (precipitated).
  • the purified protein 25 ⁇ g was reduced and reduced.
  • the molecular weight of the full-length protein was determined by matrix-assisted laser desorption ionization mass spectrometry (MALDI TOFMS). Sinapinic acid was used as the matrix. Proteins isolated by SDS-PAGE were digested in gel using lysylendopeptidase or trypsin (in-gel digested), and the digests were analyzed by liquid chromatography-tandem mass spectrometry (MS / MS) or MALDI TOFMS (see; Kodama, K., Fukuzawa, S., Nakayama, H., Kigawa, T., Sakamoto, K., Yabuki, T., Matsuda, N., Shirouzu, M., Takio, K., Tachibana, K., and Yokoyama, S. (2006) Chembiochem 7 , 134-139). The protein was identified using MS / MS data by Mascot database searching software.
  • the protein was isolated by SDS-PAGE in the TX114 phase and stained with Coomassie Brilliant Blue R250 (CBB). Protein bands excised from the gel are destained with 50% (v / v) methanol and dried in a vacuum centrifuge. The dried gel pieces are rehydrated with 10 ng / L trypsin (Promega) and then about 20 mL of 50 mM containing 0.1% (w / v) n-decyl--D-glucopyranoside (SIGMA) Incubate at 37 for 18 h under Tris-HCl (pH 8.5). The resulting digest is analyzed either directly by mass spectrometry or after chloroform / methanol extraction.
  • CBB Coomassie Brilliant Blue R250
  • Lipid-modified peptides were extracted after some modifications (see Ujihara T, Sakurai I, Mizusawa N, Wada H. A method for analyzing lipid-modified proteins with mass spectrometry.Anal Biochem. 2008 Mar 15; 374 ( 2): 429-31.). Briefly, the peptide solution (10-20 L) obtained from in-gel digestion is acidified with 1 mL of 70% formic acid and separated into the lower organic phase and the upper aqueous phase. The mixture is vortexed by mixing with an equal amount of chloroform / methanol (2/1, v / v) solution and centrifuged at 10,000 xg for 10 minutes. The organic phase containing the lipid modified peptides is transferred to a new tube. The acidification step is necessary because methyl ester formation in the C-terminal carboxyl group of the lipopeptides in the presence of tryptic activity is frequently observed in the organic phase.
  • the organic phase containing the lipid modified peptide is dried in vacuo and decomposed by sonication in 10-20 L water for 5 minutes. The solution was heated at 100 for 1.5 hours to inactivate trypsin and Pseudomonas sp. Incubated at 37 ° C with 80 ng / L lipoprotein lipase (LPL) from (SIGMA).
  • LPL lipoprotein lipase
  • MALDI-TOF MS analysis was performed using Ultraflex (Bruker Daltonics) in positive ion mode and reflectron mode.
  • Saturated -cyano-4-hydroxycinnamic acid (CHCA) solution in chloroform / methanol (2: 1, v / v) solvent is used as matrix.
  • a thin layer is prepared with the CHCA matrix and these samples are loaded onto the thin layer of the matrix.
  • MALDI-MS / MS spectra are obtained using a MALDI-iontrap mass spectrometer (MALDI-LTQ; Thermo Fisher Scientific) using CHCA or 2, 5-Dihydroxybenzoic acid as a matrix.
  • the protein was purified by LC-MS / MS.
  • In-gel digests were analyzed by nano-LC (1100 series; Agilent Technologies) combined with a hybrid quadrupole-TOF instrument (Q-Tof2 Waters).
  • the mobile phases of the home-made capillary column filled with Inertsil ODS (GL Science) are solvent A consisting of 0.075% (v / v) formic acid in aqueous solution and in aqueous solution.
  • Solvent B consisting of 0.075% (v / v) formic acid and 80% (v / v) acetonitrile.
  • the resulting MS / MS data is then applied to Mascot (Matrix Science) for protein identification.
  • Reporter CHO cell lines expressing human CD14 and human TLR2 (CHO / CD14 / TLR2) or TLR4 (CHO / CD14 / TLR4) were selected from Dr. D.Golenbock (University of Massachusetts Medical School), 10% heat-inactivated fetal bovine serum (GIBCO), 1 mg / ml G418 (Invitrogen, Carlsbad, Calif.), 400 U / ml Hygromycin (hygromycin, Amresco, San Francisco, Calif.), and 1x penicillin-streptomycin (GIBCO) added to Ham's F-12 medium (GIBCO, Carlsbad, Calif.) .
  • TLR1-/-, TLR2-/-, TLR6-/-, MyD88-/-mice were prepared (see Adachi, O., Kawai, T., Takeda, K., Matsumoto, M., Tsutsui, H.). , Sakagami, M., Nakanishi, K., and Akira, S. (1998) Immunity 9 , 143-150; Takeuchi, O., Hoshino, K., and Akira, S.
  • Peritoneal macrophages were harvested 3 days after ip injection with 2 ml of 4% thioglycollate and then incubated in RPMI 1640 medium with 10% FCS (GIBCO).
  • LPS obtained from Salmonella minesota RE595, synthetic Pam 3 CSK 4 , and MALP-2 was purchased from Sigma.
  • the concentrations of tumor necrosis factor (TNF) - ⁇ and interleukin (IL) -6 from the culture supernatants were measured using ELISA (Genzyme, Minneapolis).
  • Reporter gene vectors expressing firefly luciferase under the control of a promoter activated by pELAM (a gift from Dr. Golenbock at University of Massachusetts Medical School) NF- ⁇ B (see Means, TK, Wang, S., Lien, E., Yoshimura, A., Golenbock, DT, and Fenton, MJ (1999) J Immunol 163, 3920-3927), pRL-TK (Promega Corp.) Control reporter and pDisplay (Invitrogen, Carlsbad, Calif.) (A gift from Dr. Y.
  • HEK293 cells were transfected with calcium / phosphate method overnight with a mixture of plasmid DNA. The cells were further cultured in fresh medium for one day, followed by incubation with S. aureus for 2 hours, and then cell lysates were fired with firefly luciferase and lucifer using the Dual Luciferase Assay kit. The amount of Nilla luciferase was investigated to determine the amount. The degree of NF- ⁇ B activity is determined by the ratio of firefly luciferase to Renilla luciferase.
  • PEC peritoneal macrophage
  • 5 ml PBS 137 mM NaCl, 2.7 mM KCl, 8.1 mM Na 2 HPO 4 , 1.5mMKH 2 PO 4 , pH7.27.4,0.2umfiltered
  • HBSS Hops Balanced Salt
  • step dilution is performed twice with 7 standard and blank (reagent diluent) up to 31.25 pg / ml.
  • Washing buffer with 300ul washing three times and then placed on the back was added 100ul to each plate and then diluted with a diluent reagent by an amount corresponding to the 2 nd antibody in the ELISA kit at least 2 hours at room temperature.
  • HRP streptavidin-horseradish-peroxidase
  • cytokine value is obtained by measuring at wavelength of 450 nm with ELISA measuring instrument.
  • the CHO / hCD14 / hTLR2 reporter cell line with hCD25 gene induced by NF- ⁇ B was stimulated for 16 hours, and the surface expression level of CD25 was measured by flow cytometry.
  • This stimulation is either induced by S.aureus whole cells of the maternal RN4220 (Figs. 1A and 1C), or derived by LTA (lipoteichoic acids) -deficient ⁇ ltaS mutant ( Fig. 1B), lipoprotein-deficient maturation with the empty plasmid Induced by ⁇ lgt mutant (Fig. 1D) or by ⁇ lgt mutant with pSlg tplasmid (Fig. 1E).
  • Figures 1A and 1B bacteria were pre-cultured at 30 ° C, and Figures 1C, 1D and 1E were pre-cultured at 37 ° C. I was.
  • the ratio of CHO cells to bacterial cells is 1:10 and 1: 100 in Figures 1A and 1B, and 1: 5 and 1:50 in Figure 1C, 1D and 1E. to be.
  • the cells were also mock treated (black lines with gray areas) (FIGS. 1A-1H).
  • TLR2 stimulatory activity in the S. aureus ⁇ lgt mutant is due to unidentified lipoproteins in the insoluble PGN fraction, not PGN itself. This suggests that it activates TLR2, and it was found that in S. aureus, LTA is not the preferred molecule to stimulate TLR2 at least under our reaction conditions.
  • Insoluble peptidoglycan (PGN) fragments were isolated from S.aureus RN4220 cells according to Example 2, solubilizing the PGN of S.aureus with an Achromobacter ⁇ -lytic protease.
  • a TX-114 detergent fraction (FIG. 1G) and an aqueous fraction (FIG. 1H) were prepared by performing a Triton X-114 (TX-114) detergent-mediated phase partitioning technique as in Example 3. It was.
  • CHO / hCD14 / hTLR2 cells of Experimental Example 1-1 were stimulated with soluble PGN fraction (FIG. 1F), TX-114 detergent fraction (FIG.
  • FIG. 1G aqueous fraction after TX-114 treatment
  • FIG. 1H aqueous fraction after TX-114 treatment
  • the CHO / hCD14 / hTLR2 cells were stimulated with their aqueous fraction to measure TLR2 stimulatory activity.
  • the content of soluble PGN used for cell stimulation was 0.7 ⁇ g / ml or 7 ⁇ g / ml in (FIG. 1F), and the cells were treated with aqueous fractions 1 or 10 times the content of the soluble PGN (FIG. 1H).
  • Cells were treated with TX-114 detergent fraction containing 24 ng or 240 ng (FIG. 1G).
  • the cells were also mock treated (black lines with gray areas) (FIGS. 1A-1H).
  • the soluble PGN fraction can be confirmed that the TLR2 stimulatory activity when incubated with TLR2 expressing CHO cells, it can be assumed that the soluble PGN fraction contains TLR2 stimulatory molecules (FIG. 1F).
  • the water-insoluble TX-114 phase (TX-114 detergent fraction) had TLR2 stimulatory activity, whereas the aqueous phase (aqueous fraction) had no stimulatory activity (FIG. 1H).
  • Soluble PGN fraction 60 ⁇ g dry weight, lane1
  • aqueous phase lane2
  • 10-fold concentrated TX-114 detergent phase lane3
  • TX-114 phase fragments showing TLR2 stimulatory activity were separated by SDS-PAGE to obtain one 33 kDa protein band (lane 3).
  • the arrowheads and arrows in Figure 1 I below show Protein A and 33 kDa protein, respectively.
  • 33 kDa protein of 200 ⁇ g homologous 200 ⁇ g sample was obtained from 100 mg dry weight sample of insoluble PGN by using TX-114 phase partitioning and electro-elution from SDS-PAGE gel.
  • LC-MS / MS liquid chromatography-tandem mass spectrometry
  • gas-phase automated amino acid sequencer Internal amino acid sequences were determined. N-terminal peptide structure was determined by Matrix Assisted Laser Desorption / Ionization Time of Flight Mass Spectrometry.
  • a box shows a signal peptide and an asterisk shows a lipid binding cysteine
  • an underlined part shows an amino acid sequence determined by Edman-degradation sequencing, and is dotted with a dotted line.
  • the part shows the amino acid sequence determined by LC-MS / MS
  • the underlined part shows the amino acid determined by MALDI TOFMS.
  • the 33kDa protein is encoded by the sitC gene.
  • the amino acid sequence of the internal peptide fragment obtained by lysylendopeptidase was exactly identical to what is known as the S.aureus SitC protein sequence.
  • the N-acylated mode of SitC it was confirmed that the N-terminal amino acid sequence of the purified 33kDa protein was blocked during Edman degradation sequencing.
  • SitC protein fragments from S.aureus RN4220 cells obtained by lysylendopeptidase digestion on SDS-PAGE gel slices were measured using MALDI-TOF MS according to Example 6-1.
  • SitC is a triacylated lipoprotein and obtained from insoluble PGN.
  • SitC is one of the major lipoproteins in S. aureus and is known as an iron-regulated ATP binding cluster (ABC) transporter substrate-binding protein (see Cockayne, A., Hill, PJ, Powell, NB, Bishop, K., Sims, C., and Williams, P. (1998) Infect Immun 66,3767-3774; Lee, SJ, Bohm, A., Krug, M., and Boos, W. (2007) Trends Microbiol 15,389-397).
  • ABSC iron-regulated ATP binding cluster
  • FIGS. 4A, 4B and 4C are mass signals corresponding to triacylated, diacylated, and monoacylated CGTGGK.
  • 4A and 2 show the MALDI-TOF MS spectra of the organic phase (A) of in-gel tryptic digest of SitC.
  • a series of 14-Da interval peaks between m / z 1296 and 1410 were detected, which peaked at the N-terminus modified with glycerides through thioether linkages between the sulfydryl group of cysteine and three dehydrated fatty acids.
  • Figure 4B shows a new series of 14 Da interval peaks between m / z 1044 and 1115 newly detected after five hours digestion with LPL, and the mass values of these ions were derived from (original) triacylated peptides. Corresponds to the mass values of diacylglyceryl-cysteinyl-GTGGK (Table 2) produced by the release of esterified fatty acids.
  • Figure 5 shows the MALDI-MS / MS spectrum of the peak at m / z 862.5 corresponding to octadecanoylglyceryl-cysteinyl-GTGGK
  • Figure 6 is the arrangement of the fragment ions observed in Figure 5 is N-octadecanoly-S-glyceryl
  • the clear structure of -cysteinyl-GTGGK is shown.
  • the y-series ions on m / z 419.3 (y5), 401.3 (y5-H2O), 362.2 (y4), and 261.2 (y3) in the MS / MS spectra confirmed the amino acid sequence of GTGGK, and this modification confirmed the N-terminal cysteine. Represents a residue.
  • the ions at m / z 444.1, 584.1, 641.2, and 698.3 can be designated as b-series ions (bl, b3-H2O, b4-H2O, and b5-H2O, respectively).
  • the characterized fragment ions for S-glyceryl-cysteinyl peptides produced by the neutral loss of thioglycerol can be observed at m / z 754.4, in which octadecanoyl groups are cysteine by amide bonds. It is connected to the a-amino group of.
  • the triacylated lipopeptides of sitC were examined from the cell lysate.
  • S. aureus RN4220 cell extract and TX-114 partitioning fraction were applied to SDS-PAGE and protein was stained with CBB R250.
  • a band corresponding to 33-kDa was separated from the gel and in-gel-digested, and the resulting peptide was analyzed by LC-MS / MS.
  • SitC was identified as a main component of the band.
  • the arrows below represent SitC and SAOUHSC_02699.
  • this is the triacylation at the N-terminus of SitC is the major form in S. aureus RN4220 strain, while triacylated lipopeptides of SitC were detected, while no diacylated peptide was detected. .
  • Most lipoproteins in cells were found to be triacylated with various fatty acids.
  • peaks may be of triacylated fatty acids modified with unsaturated fatty acids and are also observed for the RN4220 strain cultured with BHI broth.
  • the components of the fatty acids of MRSA MW2 and MSSA 4776 are similar to those of RN4220.
  • the length and / or structure of fatty acids varied according to the culture conditions due to changes in the strain or possibly the membrane lipids, triacylated lipopeptides were found in all strains.
  • Lipoproteins obtained from the TX114 phase using cytolysates of S. aureus RN4220 were examined. Proteins separated by SDS-PAGE according to Example 6-2 were analyzed by LC-MS / MS, and lipopeptides extracted from digest by chloroform / methanol were analyzed by MALDI-TOF MS. .
  • Experimental Example 5 Function as a natural ligand of TLR2 of S. aureus SitC protein.
  • CHO / hCD14 / hTLR2 cells FIG. 12A
  • CHO / hCD14 in the presence or absence of 2 ng / ml or 20 ng / ml of purified S. aureus SitC protein / hTLR4 FIG. 12B
  • Surface expression of NF- ⁇ B-driven hCD25 was analyzed by flow cytometry.
  • the purified SitC protein was able to stimulate TLR2 at a concentration of 20 ng / ml (0.6 nM), but not TLR4. This concentration corresponds to the concentration of LPS that can induce cytokine production in mouse macrophages.
  • TLR2 concentration of 20 ng / ml (0.6 nM)
  • This concentration corresponds to the concentration of LPS that can induce cytokine production in mouse macrophages.
  • triacylated SitC protein released from insoluble S.aureus PGN by treatment with Achromobacter ⁇ -lytic protease functions as a natural ligand of TLR2.
  • Peritoneal macrophages (1 ⁇ ) prepared from maternal C57BL / 6 (bar1), TLR1-/-(bar2), TLR2-/-(bar3), TLR6-/-(bar4), and MyD88-/-(bar5) 10 5 cells) were stimulated with 1 ⁇ g / ml LPS, 10 ng / ml synthetic Pam 3 CSK 4 , 100 ng / ml MALP-2, or 100 ng / ml or 1 ⁇ g / ml of purified SitC protein for 24 hours.
  • Concentrations of TNF-a (FIG. 13A) and IL-6 (FIG. 13B) in the culture supernatant were measured using ELISA and its data expressed as mean + SD using at least two independent mice. ND means not detected.
  • tumor necrosis factor (TNF) -a and interleukin (IL) were expressed from macrophage cells of wild-type mice at a concentration of 100 ng / ml (3 nM). It was confirmed that it induces -6 release. SitC also did not induce the release of TNF-a and IL-6 from macrophages in mice with TLR2-/-and MyD88-/-.
  • TLR2 is a SitC- It is suggested that it is essential for the mediated cytokine production.
  • Viable S.aureus ⁇ sitC deficient mutants were produced in Luria-Bertani medium and tryptic soy broth. SDS-PAGE analysis of aqueous phases (lanes 1 and 3) and TX-114-detergent phases (lanes 2 and 4) of solublized PGN was performed.
  • Lanes 1 and 2 in FIG. 13C analyzed fragments obtained from S. aureus ⁇ sitC mutants with empty plasmid pKE515, and lanes 3 and 4 analyzed fragments obtained from plasmids containing sitC gene, sitC mutants with pSsitC. It is. In other words, the SitC 33kDa protein band was not detected in the ⁇ sitC mutant and the 33kDa protein band was reappeared by inserting the plasmid with the sitC gene into ⁇ sitC (lanes2 and 4 in FIG. 13C), which is a 33kDa protein in the PGN. It was confirmed that this is a true SitC protein.
  • TX-114-enriched proteins were purified from Bacillus substilis (33kDa) and Micrococcus luteus (37kDa), respectively (lanes 1 and 2 of Figure 14A).
  • the two proteins had TLR2 stimulatory activity in TLR2-expressed CHO cells at 20 ng / ml, and there was no TLR4 stimulatory activity as shown in FIGS. 14C and 14D.
  • TLR2 stimulatory activity in TLR2-expressed CHO cells at 20 ng / ml
  • TLR4 stimulatory activity as shown in FIGS. 14C and 14D.
  • Sections obtained by treatment with Bacillus substilis and Micrococcus luteus with trypsin were analyzed by LC-MS / MS.
  • LC-MS / MS analysis of the sections obtained by trypsin treatment showed that 33 kDa and 37 kDa proteins (NP_388633 and ZP_02945718 in B.substilis and M.luteus, respectively) were used as tentative ABC transporter substrate-binding lipoproteins. It has been shown that it can function.
  • B.subtilis lipoprotein (33kDa) encoded by the theyfmC gene, produces a 315 amino acid precursor with putative lipid binding cysteine at the 19 amino acid position, which is a ferrichrome binding of ABC transporter. Similar to protein.
  • the following box shows a signal peptide
  • an asterisk shows a lipid binding cysteine
  • an underlined part shows an amino acid determined by LC-MS / MS analysis of a trypsinized fragment.
  • the M.luteus protein (37kDa) is then encoded by a gene that produces a 297 amino acid precursor with putative lipid binding cysteine at the 22 amino acid position, which is the glutamate binding protein (GluB) in the ABC transporter system. Similar to These results clearly confirmed that the ABC transporter substrate binding lipoprotein from Gram-positive bacteria was a natural ligand of TLR2.
  • the lipoprotein derived from the Gram-positive bacteria of the present invention which functions as a ligand of Gram-positive bacteria-derived Toll-like receptor 2, can be utilized as a good immunogen or immunostimulant in the prevention or treatment of diseases caused by Gram-positive bacteria. Since the diagnostic antigen may be used for diagnosis, the industrial value of the present invention will be great.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Public Health (AREA)
  • Food Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Endocrinology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

본 발명에서는 Toll 유사 수용체2 에 리간드로서 기능하는 것을 특징으로 하는 그람양성균 (Gram-positive bacteria) 유래의 리포단백질을 제공하고자 한다. 상기 그람양성균 (Gram-positive bacteria) 유래의 리포단백질은 Toll like 수용체2 와 결합하는 리간드로서 작용하는 것으로 그람양성균으로 야기되는 질병을 예방 또는 치료하는 데 있어 좋은 면역원 또는 면역자극제로서 제공될 수 있으며, 그람양성균을 진단하는데 있어 진단용 항원으로 제공될 수 있다.

Description

Ｔｏｌｌ 유사수용체２ 리간드로서 기능하는 그람양성균 유래의 리포단백질
본 발명은 TRL2의 리간드로서 기능하는 그람양성균 유래의 리포단백질을 제공하고자 한다.
면역계는 각각 기능과 역할이 다른 선천성(innate)과 적응성(adaptive) 면역계로 나누어진다.
최근 들어, 많은 연구결과들은 선천성 면역에 있어서 Toll 유사수용체(Toll-like Receptors, TLRs)의 중요성을 설명하고 있다. 항 미생물 펩티드, 탐식세포, 보체계, 및 Toll 유사수용체(Toll like receptors, TLRs)를 포함하는 선천성 면역계는 감염 후 즉각적으로 활성화되어 감염 미생물의 증식을 재빨리 조절할 수 있으므로 림프구가 감염을 담당할 때까지의 감염 초기단계의 방어를 담당한다. 현재까지 TLR의 경우 인간에서 약 11종이, 쥐에서 약13종이 보고되었다. 이러한 TLR family에 속하는 분자는 일반적으로 extracellular region에 leucine-rich repeat(LRR) motif가 있고 IL-1 수용체와 비슷한 cytoplasmic domain이 존재하는 타입I의 막단백질로서 호모(homo)- 또는 헤테로다이머(heterodiamer)로 작용한다. TLR은 박테리아, 바이러스, 원생동물 및 진균류를 포함한 다양한 미생물로부터 유도된 병원체 관계된 분자패턴 (pathogen-associated molecular patterns, PAMPs)이나 microorganism-associated molecular patterns (MAMPs)를 extracellular domain을 통해서 특이적으로 인식하는데, TLR에 의한 미생물 침입의 인식은 초파리 (Drosophila) 및 포유동물에서 진화상 보존된 신호전달 케스케이드의 활성화를 촉발시킨다.
TLRs가 TLRs리간드에 결합하면 TLRs은 MyD88, 대부분의 TLRs의 필수적인 신호전달 어댑터 (signaling adaptor)를 동원하여 신호전달 캐스캐이드 (cascade)를 일으키고, 이를 통해 (i) NF-κB 경로를 활성화시키고 (ii) Jun N-말단 카이네이즈 (JNK)를 포함한 MAPKs을 활성화시킨다. 활성화된 NF-kB는 다양한 염증 사이토카인 (cytokine)들 -TNF-a, IL-4, IL-5, IL-6 등의 분비를 유도하고, 이러한 사이토카인 (cytokine)들은 복잡한 면역 네트워크를 통하여 염증세포 예를 들면, T 림프구, 대식세포, NK 세포, dendritic 세포들을 활성화 또는 염증부위로 유도한다.
한편, TLR이 밝혀진 이래로 TLR에 결합하는 TLR 리간드인, PAMPs를 찾는 노력이 계속되어왔으며, PAMP는 일반적으로 (a) 포유동물 숙주가 아닌 미생물에 의한 발현, (b) 광범위한 병원체에 걸친 구조의 보존 및 (c) 선천성 면역성을 자극하는 능력을 포함하는 특정 기준을 충족시킨다.
지금까지 TLR10, TLR12, TLR13 을 제외하고 각각 하나 이상의 리간드(ligand)가 밝혀졌다. TLR1과 TLR2는 박테리아의 mycobacterial lipoprotein과 트리아실화된 리포단백질(triacylated lipopeptide)를 인지하며, TLR2는 리포단백질(lipoproteins), 펩티도글리칸(peptidoglucan, PGN), lipoteichoic acid (LTA, 그람양성균), lipoarabinomannan (mycobacteria), glycosyl phophatidylinositol anchor (T. cruzi), 페놀용해성 modulin (S. epidermis), zymosan (fungi), 및. glycolipids (Treponema maltophilum) 등 다양한 병원균의 구조물을 인식하는데 관여한다. 또한, Leptospira interrogans나 Porphyromonas gingivalis의 일부 구조적 변종 (variants) LPS가 TLR2에 의해 인식된다. 이들은 생화학적, 물리적 성질에서 전형적인 그람음성균의 LPS와 차이를 보인다. TLR2는 이들을 인식하기 위해 TLR1이나 TLR6와의 협동이 필요하며, TLR2는 TLR1나 TLR6과의 헤테로다이머(heterodimerization)형태로 신호전달을 야기시킨다. TLR1과 TLR2가 헤테로다이머로 작용하여 트리아실리포펩티드 (triacyl lipopeptides)를, TLR2과 TLR6가 헤테로다이머로 작용하여 다이아실리포펩티드 (diacyl lipopeptides)를 구별하는 등 미세한 리포펩티드(lipopeptides)의 구조적 차이를 구별하는데 관여하며, 이들 중 어느 하나를 억제하면 효과세포반응이 차단된다. 그러나, 아직까지 TLR2 에 의해 인지되는 그람양성균 유래의 천연 lipoprotein이 정제되거나 특정화되지 않았다. TLR3은 RNA virus의 증식 중에 생기는 double-stranded RNA와 dsRNA의analogue인 polyinosinic-polycytidylic acid (polyI:C)를 인지하는 것으로 알려져 있다. TLR4는 gram-negative bacteria의 세포막에 발현되는 lipopolysaccharide (LPS)를 인지하며, 그람음성균의 LPS에 대한 수용체로서 TLR과 중에서 가장 연구가 잘 되어있다. TLR5는 Listeria monocytogens의 flagellin protein을 인지한다. TLR7, 8은 Imiquimod, Loxoribine와 Single-Stranded RNAs을 인지하고, TLR9는 박테리아 DNA안의 CpG를 포함한 시퀀스 (sequence) 또는 synthetic oligonucleotides (ODNs)를 인지하고, TLR11은 profilin-like protein을 인지한다 (He H, Genovese KJ, Nisbet DJ, Kogut MH. Profile of Toll-like receptor expressions and induction of nitric oxide synthesis by Toll-like receptor agonists in chicken monocytes.Mol Immunol. 2005 Aug 9).
한편, 그람양성균 (Gram positive bacteria)에는 포도상구균, 연쇄상구균, 폐렴균, 나병균, 디프테리아균, 파상풍균, 탄저균, 방선균 등이 포함되어 디프테리아나 결핵, 폐렴 등 대부분의 심각한 전염병들을 야기시키는 주원인이 된다. 그람양성균의 일례로, 스타필로코커스 아우레우스(Staphylococcus aureus)는 주요 병원균으로 식중독, 농가진 (impetigo), 봉소염 (cellulitis), 열상피부증후군 (scalded skin syndrome), 유방염 (mastitis), 균혈증 (bacteremia), 패혈증 (sepsis), 포도상구균성폐염 (Staphylococcal pneumonia), 심내막증 (endocarditis), 심부전증 (心不全症-heart failure), 골수염 (osteomylitis), 포도상구균성패혈증 (Staphylococci sepsis), 피의 순환허탈 (circulatory collapse), 독소쇼크증후군 (Toxic shock syndrome) 등을 다양한 질병을 유발하는데, 스타필로코커스 아우레우스은 적응력이 강할 뿐만 아니라 항생제 대한 내성이 강하며 다중 약제에 대한 내성을 가지고 있다.
이에 본 발명에서는, 심각한 질병을 야기하는 다중 약제 내성을 지닌 그람양성균에 대해, 우수한 예방 및 치료효과를 나타낼 수 있는 종래와는 다른 작용 기능을 이용한 면역원을 찾아냄으로 신규한 치료제를 개발하고자 하였다.
본 발명에서는 심각한 질병을 야기하는 다중 약제 내성을 지닌 그람양성균으로 야기되는 질병의 예방 및 치료를 위해, Toll 유사 수용체2 (toll-like receptor2)에 작용하는 그람양성균 유래의 새로운 리포단백질 (lipoprotein)을 제공하고자 하며, 이를 이용한 그람양성균 예방 또는 치료용 면역원성 조성물, 그람양성균 예방 또는 치료용 면역자극제 및 그람양성균 진단용 항원을 제공하고자 한다.
본 발명에서는 Toll 유사 수용체2에 리간드로서 기능하는 것을 특징으로 하는 그람양성균 (Gram-positive bacteria) 유래의 리포단백질을 제공한다.
또한 본 발명에서는 Toll 유사 수용체2에 리간드로서 기능하는 것을 특징으로 하는 그람양성균 (Gram-positive bacteria) 유래의 리포단백질 (lipoprotein)을 유효성분으로 하는 그람양성균 예방 또는 치료용 면역원성 조성물 및 면역자극제 그리고 상기 그람양성균 유래의 리포단백질을 진단용 항원으로 하는 진단용 키트를 제공하고자 한다.
본 발명에서는, 심각한 질병을 야기하는 다중 약제 내성을 지닌 그람양성균에 대해, 우수한 예방 및 치료효과를 나타낼 수 있는 종래와는 다르게 기능하는 면역원을 찾아내고자 노력하던 중, 그람양성균 유래의 리포단백질 (lipoprotein)이 Toll 유사 수용체2의 리간드로서 작용하여 생체내 면역반응을 자극함으로 그람양성균으로 야기되는 질병을 예방 또는 치료하는 데 있어 뛰어난 면역원, 면역자극제 또는 진단용 항원으로 활용될 수 있음을 확인하고 본 발명을 완성하였다.
이하, 본 발명을 상세히 설명하도록 하겠다.
본 명세서에 사용된 "선천적인 면역 반응"이라는 용어는 특정 병원체 결합 분자 패턴 (PAMPs)에 대한 면역 반응의 임의의 유형을 말한다. 자연적 또는 네이티브 면역으로도 당업계에 알려진 선천적인 면역은 주로 호중구, 과립구, 단핵 식균세포, 수지상 세포, NKT 세포 및 NK 세포를 포함한다. 선천적인 면역 반응은 I형 인터페론 생산 (예를 들면, IFN-α), 호중구 활성, 대식세포 활성, 식균작용, 옵소닌작용 (opsonization), 보체 활성 및 이들의 임의의 조합을 포함하나, 이에 한정되지 않는다.
본 발명에서 "Toll 유사 수용체 (Toll like receptor)"와 동등하게, "TLR"라는 용어는 병원체 결합 분자 패턴 (PAMPs)을 인식하고 선천적인 면역에서 핵심 신호전달 요소로서 활동하는 적어도 11개의 높게 보존된 포유동물 패턴 인식수용체 단백질 (TLR1-TLR11) 군의 임의의 일원을 말한다. TLR 폴피펩타이드는 류신-리치 반복, 막횡단 도메인 및 TLR 신호전달에 관여하는 세포내 (세포질) 도메인을 가지는 세포외 (세포질외) 도메인을 포함하는 특정 구조를 공유할 수 있다. TLRs은 인간 TLRs을 포함하나 이에 한정되지 않는다.
본 발명에서 "Toll-유사 수용체 리간드" (TLR 리간드)는 TLR에 결합하고 상기 수용체를 활성화시키는 것이다. 선행기술 중에서 TLR2 리간드로서 기능하는 그람양성균 유래의 천연 리포단백질(native lipoprotein)이 아직까지 정제되거나 특정화된 경우가 없었다.
본 발명에서는 Toll 유사 수용체2에 리간드로서 기능하는 것을 특징으로 하는 그람양성균 (Gram-positive bacteria) 유래의 리포단백질을 제공한다.
본 발명에서의 Toll 유사 수용체2 (TLR2)를 포함하는 종-특이적 TLR은 포유류 TLR에 한정되지는 것은 아니며, 인간 또는 비-인간원으로부터 유도된 TLR을 포함할 수 있다. 비-인간원은 포유류 예를 들어, 쥐, 소, 개, 고양이, 양, 돼지 및 말을 포함하지만, 이에 한정되지는 않는다.
본 발명에서 Toll 유사 수용체2 리간드인 리포단백질을 생산하는 그람양성균은 그 종류가 특별히 한정되는 것은 아니나, 바람직하게는 스타필로코커스 아우레우스 (Staphylococcus aureus), 바실러스 서브틸리스 (Bacillus substilis), 마이크로코커스 루터스 (Micrococcus luteus), 스트렙토코커스 뉴모니아 (Streptococcus pneumoniae), 엔테로코커스 패칼리스 (Enterococcus faecalis), 스트렙토코커스 뮤탄스 (Streptococcus mutans), 스트렙토코커스 피오게네스 (Streptococcus pyogenes), 스트렙토코커스 아갈락티아 (Streptococcus agalactiae), S. 에피더미디스(S.epidermidis), 스트렙토코커스 고르도니 (Streptococcus gordonii), 스트렙토코커스 미티스 (Streptococcus mitis), 스트렙토코커스 오랄리스 (Streptococcus oralis), 스트렙토코커스 에퀴 (Streptococcus equi), 바실러스 안트라시스 (Bacillus anthracis) 등일 수는 있지만 이에 한정되는 것은 아니다.
본 발명의 그람양성균 유래의 리포단백질은 반드시 그람양성균에서 자연 그대로 생산된 리포단백질일 수 있으며, 또한 당업계의 기술 내에 있는 분자생물학, 미생물학, 재조합 DNA 및 면역학의 통상적인 기법을 이용하여 합성에 의해 또는 재조합에 의해 생산된 리포단백질일 수 있다. 이러한 기법은 문헌 [예, Sambrook Molecular Cloning: A Laboratory Manual, Second Edition(1989); DNA Cloning, Volumes I and II(D.N. Glovere, ed., 1985); Oligonucleotide Synthesis(M.J. Gait, ed., 1986); Nucleic Acid Hybridization(B.D. Hames & S.J. Higgins, eds., 1984); Transcription and Translation(B.D. Hames & S.J. Higgins, eds., 1984); Animal Cell Culture(R.I. Freshney, ed., 1986); Immobilized Cells and Enzymes(IRL Press, 1986); B. Perbal, A Practical Guide to Molecular Cloning(1984); the Methods in Enzymology series(Academic Press, Inc.), especially volumes 154 and 155; Gene Transfer Vectors for Mammalian Cells(J.H. Miller and M.P. Calos, eds., 1987, Cold Spring Harbor Laboratory); Mayer and Walker, eds.,(1987), Immunochemical Methods in Cell and Molecular Biology(Academic Press, London); Scopes, (1987), Protein Purificaiton: Principles and Practice, Second Edition(Springer-Verlag, N.Y.), and Handbook of Experimental Immunology, Volumes I-IV(D.M. Weir and C.C. Blackwell, eds., 1986)]을 참조할 수 있다.
또한, 본 발명의 그람양성균 유래의 리포단백질은, 화학적 제조방법에 의해 천연의 그람양성균 유래의 리포단백질과 구조적, 기능적으로 동일 또는 당업계에서 일반적으로 이루어지는 변형을 가하여 합성된 리포단백질로, 화학 선택적 결합 (chemoselective ligation) 또는 화학적 접합 (conjugation) 또는 옥심화학 (oxim chemistry)에 의하여 제조될 수 있다. 그러한 방법은 당해 기술 분야에 잘 알려져 있으며 화학적 수단 또는 재조합 수단 및 이어서 그들의 화학 선택적 결합에 의해 적합한 형태(configuration), 배위 (conformation) 또는 순서 (order)로 개개의 펩티드 구조체가 제조될 수 있다 (예를 들면, 참조 Nardin et al., Vaccine 16, 590 (1998); Nardin et al., J. Immunol. 166, 481 (2001); Rose et al., Mol. Immunol. 32, 1031 (1995); Rose et al., Bioconjug. Chem 7, 552 (1996); and Zeng et al., Vaccine 18, 1031 (2000)). 상기 제조된 펩티드 구조체에 당해 기술 분야에서 공지된 방법에 의하여 지질화가 이루어질 수 있다. 표준 축합, 첨가, 치환 또는 산화반응을 통해, 지질이 폴리펩티드에 첨가될 수 있다.
본 발명에서는 Toll 유사 수용체2에 리간드로서 기능하는 것을 특징으로 하는 그람양성균 (Gram-positive bacteria) 유래의 리포단백질로서 ATP 결합 무리(ABC)트랜스포터 기질 결합 단백질 (ATP binding cluster(ABC) transporter substrate-binding proteins)군에 속하는 것을 특징으로 하는 리포단백질(lipoprotein)을 제공한다.
본발명의 그람양성균 (Gram-positive bacteria) 유래의 리포단백질로서 ATP 결합 무리(ABC)트랜스포터 기질 결합 단백질 (ATP binding cluster(ABC) transporter substrate-binding proteins)은 TLR2 리간드로서 기능하며, N-말단 리포박스 (N-terminal lipobox)란 특정 아미노산서열을 가지고 그 말단에 lipid 가 결합하는 시스테인 잔기(cysteine residue) 가 존재하는 것을 특징으로 한다.
본 발명의 일례로, 상기 리포단백질로서는 그람양성균 (Gram-positive bacteria) 유래의 ATP 결합 무리(ABC)트랜스포터 기질 결합 단백질 (ATP binding cluster(ABC) transporter substrate-binding proteins)군에 속하는 것을 특징으로 하는 리포단백질일 수 있으며, 바람직하게는 바실러스 서브틸리스 (Bacillus substilis), 마이크로코커스 루터스 (Micrococcus luteus) 또는 스타필로코커스 아우레우스 (Staphylococcus aureus) 유래의 ATP 결합 무리 (ABC)트랜스포터 기질 결합 단백질 (ATP binding cluster(ABC) transporter substrate-binding proteins)군에 속하는 것을 특징으로 하는 리포단백질일 수 있으며, 더욱 바람직하게는 바실러스 서브틸리스(Bacillus substilis) YfmC(NP_388633)로 암호화되는 리포단백질, 마이크로코커스 루터스(Micrococcus luteus) GluE (ZP_02945718)로 암호화되는 리포단백질, 스타필로코커스 아우레우스(Staphylococcus aureus)의 SitC(YP_499195), SAOUHSC_02699(YP_501161), SAOUHSC_00844 (YP_499398), SAOUHSC_02650 (YP_501112), SAOUHSC_02549 (hypothetical molybdate-binding ABC-transporter, YP_501011) 또는 SAOUHSC_00808 (YP_499364)로 암호화되는 리포단백질일 수 있다.
또한, 본 발명에서는 Toll 유사수용체2에 리간드로서 기능하는 것을 특징으로 하는 그람양성균 (Gram-positive bacteria) 유래의 리포단백질로서 triacylated N-말단을 지닌 것을 특징으로 하는 리포단백질을 제공한다.
본 발명의 바람직한 일례로, Toll 유사 수용체2를 자극하는 리간드로서 그람양성균, 바람직하게는 스타필로코커스 아우레우스 (Staphylococcus aureus)유래의 triacylated N-말단을 지닌 리포단백질일 수 있다.
본 발명의 일례로, 상기 스타필로코커스 아우레우스 (Staphylococcus aureus)는 그 종류에 있어 특별히 한정되지는 않으나, 바람직하게는 S. aureus RN4220, S. aureus SA113, S. aureus MW2, 또는 S. aureus MSSA4776일 수 있다.
본 발명의 일례로, 본 발명의 리포단백질로는 상기 스타필로코커스 아우레우스 (Staphylococcus aureus)유래의 triacylated N-말단을 지닌 리포단백질을 모두 포함할 수 있으며, 바람직하게는 SitC (YP_499195), SAOUHSC_02699 (YP_501161), SAOUHSC_00844 (YP_499398), SAOUHSC_02650 (YP_501112), SAOUHSC_02549 (hypothetical molybdate-binding ABC-transporter, YP_501011) 또는 SAOUHSC_00808 (YP_499364)로 암호화되는 리포단백질일 수 있다.
박테리아 리포단백질은 구조적으로 두가지 그룹, 즉 디아실화된 리포단백질 (diacylated lipoproteins)과 트리아실화된 리포단백질 (triacylated lipoproteins)로 나뉘어진다. 이러한 두가지 그룹은 박테리아 리포단백질의 성숙에 관여하는 3가지 효소의 존재 또는 부재에 의해 구별될 수 있다. 성숙과정동안, 이 첫 번째 효소인 리포단백질 디아실글리세롤 트렌스퍼라아제 (lipoprotein diacylglycerol transferase, Lgt)는 리포단백질 전구체의 신호펩티드에 보존된 시스테인 잔기의 sulfhydryl 부분에 디아실글리세롤의 전달을 촉매하는데 반해, 두 번째 효소인 , 리포단백질 신호 펩티다아제 (lipoprotein signal peptidase, Lsp)는 이어서 이 산물 (product)를 절단한다. 흥미롭게도, 그람양성균에는 존재하지 않는 그람 음성균에만 존재하는 효소인 N-acyltransferase (Lnt)가 세 번째 효소로 하나의 아실 그룹을 S-diacylated된 시스테인 잔기의 아미노 그룹에 전달하여, 트리아실화된 N-acylated-S-diacylated 리포단백질을 생산한다고 알려져 있다. 즉, 종래에 그람양성균에서는 N-acyltransferase (Lnt)가 아직까지 그 단백질의 존재가 증명되지 않았기 때문에 그람양성균은 디아실화된 리포단백질 (diacylated lipoproteins)을 생산하며, 그람음성균은 트리아실화된 리포단백질 (triacylated lipoproteins)을 생산한다고 알려져 있었다.
그러나 본 발명에서는 그람양성균에 속하는 스타필로코커스 아우레우스 (Staphylococcus aureus)유래의 단백질이, 하기 실험예에서 입증한 바와 같이 mass 분석을 통해 트리아실화되어 있음을 밝혔다. 본 발명의 일례로 밝혀진 트리아실화된 리포단백질의 구조는 화학식1과 같다. 하기 화학식1은 그람양성균인 스타필로코커스 아우레우스 (Staphylococcus aureus)의 트리아실화된 리포단백질을 나타내는 일례일 뿐, 이에 본 발명의 범위가 제한되는 것은 아니다.
<화학식1>
Figure PCTKR2010000164-appb-I000001
본 발명의 리포단백질의 일례로, 스타필로코커스 아우레우스 (Staphylococcus aureus) 유래의 리포단백질로서 triacylated N-말단을 지닌 것으로 N-말단 시스테인에 포화된 지방산이 수식된 것일 수 있으며, 바람직하게는 N-말단 시스테인에 포화된 C5 내지 C50, 더욱 바람직하게는 N-말단 시스테인 잔기에 포화된 C15 내지 C20의 지방산으로 수식되어져 있을 수 있다. 상기 지방산의 탄소수에 의해 박테리아의 감염성과 병원성 여부가 고려될 것이기 때문에 앞으로 본 발명의 활용에 있어서 상기 탄소수는 중요한 의미를 가질 수 있다. 본 발명의 일례로, 상기 박테리아의 N-말단은 C5 내지 C50, 바람직하게는 C15 내지 20 범위의 탄소수를 가진 지방산이 3개 수식되어져 트리아실화된 것일 수 있다.
본 발명에서는 Toll 유사 수용체2에 리간드로서 기능하는 것을 특징으로 하는 그람양성균 (Gram-positive bacteria) 유래의 리포단백질을 유효성분으로 하는 그람양성균 예방 또는 치료용 면역원성 조성물을 제공하고자 한다.
상기 리포단백질은 그람양성균에서 유래되는 것일 수 있으며, 바람직하게는 스타필로코커스 아우레우스 (Staphylococcus aureus), 바실러스 서브틸리스 (Bacillus substilis), 마이크로코커스 루터스 (Micrococcus luteus), 스트렙토코커스 뉴모니아 (Streptococcus pneumoniae), 엔테로코커스 패칼리스 (Enterococcus faecalis), 스트렙토코커스 뮤탄스(Streptococcus mutans), 스트렙토코커스 피오게네스 (Streptococcus pyogenes), 스트렙토코커스 아갈락티아 (Streptococcus agalactiae), S. 에피더미디스 (S.epidermidis), 스트렙토코커스 고르도니 (Streptococcus gordonii), 스트렙토코커스 미티스 (Streptococcus mitis), 스트렙토코커스 오랄리스 (Streptococcus oralis), 스트렙토코커스 에퀴 (Streptococcus equi), 바실러스 안트라시스 (Bacillus anthracis)일 수 있으며, 더욱 바람직하게는 스타필로코커스 아우레우스 (Staphylococcus aureus)유래의 단백질일 수 있다.
또한, 본 발명의 리포단백질의 일례로, 스타필로코커스 아우레우스 (Staphylococcus aureus) 유래의 리포단백질로서 triacylated N-말단을 지닌 것으로 N-말단 시스테인에 포화된 지방산이 수식된 것일 수 있으며, 바람직하게는 N-말단 시스테인에 포화된 C5 내지 C50, 더욱 바람직하게는 N-말단 시스테인 잔기에 포화된 C15 내지 C20의 지방산으로 수식되어져 있을 수 있다. 상기 수식되어지는 지방산의 탄소수는 박테리아의 감염성과 병원성 여부에 있어 중요한 역할을 하는 것으로, 탄소수에 따라 어떤 박테리아리포단백질을 이용하여 감염성과 병원성이 높거나 낮은 면역원으로 생성할지 여부를 결정할 수 있기 때문에 상기의 탄소수는 본 발명에서 중요한 의미를 가질 수 있다.
또한 본 발명의 면역원으로 작용하는 리포단백질은 Toll 유사 수용체2와 작용하는 그람양성균의 리포단백질의 적어도 면역원성 부분, 이의 일부분 또는 이의 변형체를 포함할 수 있다. 상기 면역원성 부분은 Toll 유사 수용체2에 의해 인식 가능한 결합부분을 포함하는 것으로, 바람직한 단편은 단독으로 제공될 때 또는 본 발명의 면역원성 조성물 내 함유될 때 면역원성을 나타내는 단편들을 포함한다.
상기 면역원성 조성물에서의 "면역원성"이라는 것은 특정 병원체에 대해 포유동물에서 면역 반응을 유발시키는 조성물의 능력을 의미하는 것으로, 이러한 면역원성 조성물의 예로는, 본 발명의 리포단백질이 백신, 백신 접합체 등으로 쓰이는 경우를 포함할 수 있다.
본 발명의 리포단백질을 면역원으로 사용할 경우, 면역원으로 기능하는 리포단백질만을 재조합 등 당업계에서 일반적으로 사용하는 분자생물학적 기법을 이용하여 생산하거나 화학합성 등의 방법을 통해 생산할 수 있으므로, 그 제조과정 및 생체 내 투여과정에서 질병을 야기하는 그람양성균을 직접 항원으로 사용하지 않아 위험성이 배제될 수 있으며, 항원성이 본래의 그람양성균의 것과 매우 흡사하여 예방 및 치료용 면역원으로 사용하기에 적합하고, 긴급한 상황에 실험실에서 손쉽게 예방 및 치료용 면역원을 안전하고 신속하게 대량생산이 가능할 수 있을 것이다.
본 발명에서 기술된 리포단백질이 면역원으로 사용될 경우 각각 독립적으로 투여될 수 있거나 또는 다른 성분들과 조합하여 투여될 수 있다. 이들 백신 조성물은 당해 분야에서 허용되는 하나 이상의 약학적 허용 담체 및/또는 희석제와 함께 아주반트를 포함할 수 있는데, 이러한 담체는 그 자체로 조성물을 투여 받는 개체에 유해한 반응을 일으키지 않는 임의의 담체를 포함한다. 적합한 담체는 통상적으로 크고 느리게 대사화되는 거대분자, 예를 들어 단백질, 다당류, 폴리락트산, 폴리글리콜산, 중합체 아미노산, 아미노산 공중합체, 지질 응집체(예를 들어, 오일 소적 또는 리포좀) 또는 불활성 바이러스 입자를 포함할 수 있다. 이러한 담체는 당업자에게 잘 알려져 있다. 또한, 이들 담체는 면역원성 복합체 자체의 면역보강제 효과이외에 면역자극제 또는 면역보강제로서 작용할 수 있다. 상기 아주반트는 항원의 면역원성을 증진시키기 위하여 사용되는 물질이며, 본 발명에 사용하기에 적합한 아주반트로는, 몇몇 아주반트 부류, 예컨대 미네랄 염, 예컨대 Alum, 알루미늄 히드록시드, 알루미늄 포스페이트 및 칼슘 포스페이트; 계면활성제 및 미립자, 예컨대, 비이온성 블록 중합체 계면활성제 (예컨대, 콜레스테롤), 비로솜 (virosome), 사포닌 (saponin) (예컨대, Quil A, QS-21 및 GPI-0100), 프로테오솜, 면역 자극 착체, 코클레에이트, 4차 아민(디메틸 디옥타데실 암모늄 브로마이드(DDA)), 아브리딘, 비타민 A, 비타민 E; 박테리아생성물, 예컨대 RIBI 아주반트 시스템(Ribi Inc.), 미코박테리룸 플레이(Mycobacterum phlei)의 세포벽 골격(Detox(등록상표)), 무라밀 디펩티드(MDP) 및 트리펩티드(MTP), 모노포스포릴 지질 A, 바실러스 칼메테-구에린(Bacillus Calmete-Guerin), 열-불안정한 대장균 엔테로톡신(enterotoxin), 콜레라 독소, 트레할로스 디미콜레이트, CpG 올리고데옥시뉴클레오티드; 시토카인 및 호르몬, 예컨대, 인터류킨(IL-1, IL-2, IL-6, IL-12, IL-15, IL-18), 과립구집락자극인자, 데히드로에피안드로스테론, 1,25-디히드록시 비타민 D3; 폴리아니온, 예컨대 덱스트란; 폴리아크릴릭(예컨대, 폴리메틸메타크릴레이트, Carbopol 934P); 담체, 예컨대 테타누스 톡시드, 딥테리아 톡시드, 콜레라 독소 B 서브유닛, 엔테로톡시제닉 대장균의 돌연변이체 열-불안정한 엔테로톡신(rmLT), 열 쇼크 단백질; 수중유적형 유화액, 예컨대 AMPHIGEN(등록상표)(Hydronics, 미국); 및 유중수적형 유화액, 예컨대 프로인트(Freund)의 완전 및 불완전 아주반트가 포함될 수 있지만, 이에 제한되지 않는다.
본 발명의 면역원성 조성물의 적용대상은 인간 또는 비인간을 포함하며, 바람직하게는 인간, 소, 돼지, 염소, 개, 양 등일 수 있으나, 이들 일례에 한정되는 것은 아니다.
포유 동물을 백신화시키기 위하여, 유효량만큼의 본원에 기술된 임의의 백신, 백신 접합체, 면역원 또는 면역증강제가 숙주에 투여될 수 있다. 유효량이란, 숙주에 심각한 독성을 유도하지 않으면서 치료 또는 예방하고자 하는 증상을 완화 또는 제거하는데 요구되는 양을 의미하며, 당업자라면 적절하게 선택할 수 있다. 이러한 양은 특정 물질(예를 들어, 면역화 폴리펩타이드)을 일정량 투여한 이후에 숙주의 면역 반응을 관찰하여 측정될 수 있다. 본 발명의 면역원성 조성물의 유효용량은 105pfu(plaque forming unit) 내지 1012pfu/체중 kg이고, 바람직하게는 108내지 1011pfu/체중kg일 수 있으나, 이에 한정되는 것은 아니다. 면역원성 조성물의 투여량은 투여 경로, 투여 방법, 백신이 투여되는 조직(예, 근육, 호흡기), 목적하는 항체 역가, 면역화 대상자의 특정한 치료 요건, 증상의 경중, 개체의 성별, 나이 및 체중 등을 고려하여 적절하게 선택할 수 있다.
더욱이, 만일 독성이 존재하는 경우, 독성의 수준은 특정 물질을 일정량 투여하기 이전 또는 그 이후에 숙주의 임상적 증상을 평가함으로써 측정될 수 있다. 숙주에 투여된 특정 물질의 유효량은 목적 결과 및 숙주의 반응 그리고 독성의 수준에 따라서 조절할 수 있다는 사실에 주목해야 한다. 심각한 독성은 각각의 특정 숙주에 따라서 다양할 수 있으며, 숙주의 질병 상태, 나이 및 고통에 대한 내성을 포함하는 다수의 인자들(이에 한정되는 것은 아님)에 따라서 달라질 수 있다.
뿐만 아니라, 본원에 기술된 조성물은, 관절, 혈류, 허파, 내장, 근육 조직, 피부 및 복막강을 포함하는(이에 한정되는 것은 아님) 숙주 신체 중 임의의 부분에 투여될 수 있다. 그러므로, 상기 면역원성 조성물은 정맥내, 복막내, 근육내, 피하, 초내, 그리고 피내 주입법, 구강 투여법, 흡입법, 또는 경시적 순차 투여법에 의하여 투여될 수 있다. 예를 들어, 면역원을 함유하는 애어로졸 제제는 흡입법에 의하여 숙주에 투여될 수 있다. 본원에 기술된 물질 중 임의의 것에 의한 백신화의 지속 시간은 짧게는 1일에서부터 길게는 평생 동안(예를 들어, 수 년)일 수 있다는 사실에 주목해야 할 것이다. 예를 들어, 면역원은 10년에 걸쳐서 해마다 1회씩 투여될 수 있다. 또한 치료 횟수는 다양할 수 있다. 예를 들어, 면역원은 매일, 매주, 매달 또는 매년 1회(또는 2회, 3회 등) 투여될 수 있다.
투여용 제제에는 멸균 수용액 또는 비수용액, 현탁액 및 유액을 포함할 수 있다. 상기 비수성 용매의 예로서는 프로필렌글리콜, 폴리에틸렌글리콜, 식물성 오일 및 주사 가능한 유기 에스테르를 포함하나, 이에 한정되는 것은 아니다. 수성담체들로서는 물과 알코올, 염수 및 완충 용액을 포함하나, 이에 한정되는 것은 아니다. 뿐만 아니라, 보존제, 향미제 및 예를 들어, 항균제, 항산화제, 킬레이트제, 비활성기체 등과 같은 기타 첨가제도 포함될 수 있다. 상기 면역원성 조성물의 제형화는 당해 기술 분야에 알려진 적합한 제제는 문헌(Remington's Pharmaceutical Science (최신판), Mack Publishing Company, Easton PA)에 개시되어 있는 것을 사용하는 것이 바람직하다.
특정 면역 반응이 유도되었는지 여부를 결정하는 데에 임의의 방법이 사용될 수 있다. 예를 들어, 특정 항원에 대한 항체반응은 면역학적 검정법(예를 들어, ELISA)를 사용하여 결정될 수 있다. 더욱이, 특정 질병 상태의 정도를 평가할 수 있는 의학적인 방법도 목적 면역 반응이 유도되었는지 여부를 측정하는 데 사용될 수 있다.
또한, 본 발명에서는 Toll 유사 수용체2에 리간드로서 기능하는 것을 특징으로 하는 그람양성균 (Gram-positive bacteria) 유래의 리포단백질을 유효성분으로 하는 그람양성균 예방 또는 치료용 면역자극제를 제공한다.
본 발명의 리포단백질은 그람양성균에서 유래되는 것으로 그 종류는 특별히 한정되지 않으나, 바람직하게는 스타필로코커스 아우레우스 (Staphylococcus aureus), 바실러스 서브틸리스 (Bacillus substilis), 마이크로코커스 루터스 (Micrococcus luteus), 스트렙토코커스 뉴모니아 (Streptococcus pneumoniae), 엔테로코커스 패칼리스 (Enterococcus faecalis), 스트렙토코커스 뮤탄스 (Streptococcus mutans), 스트렙토코커스 피오게네스 (Streptococcus pyogenes), 스트렙토코커스 아갈락티아(Streptococcus agalactiae), S. 에피더미디스 (S.epidermidis), 스트렙토코커스 고르도니 (Streptococcus gordonii), 스트렙토코커스 미티스(Streptococcus mitis), 스트렙토코커스 오랄리스 (Streptococcus oralis), 스트렙토코커스 에퀴 (Streptococcus equi), 바실러스 안트라시스 (Bacillus anthracis)일 수 있으며, 더욱 바람직하게는 스타필로코커스 아우레우스 (Staphylococcus aureus)일 수 있다.
본 발명의 리포단백질은 TRL의 리간드로서 작용하여 TRL의 반응을 증진시키는 등 면역자극제로서, 직접적 또는 간접적으로 작용하여 면역반응을 자극하여 증진된 면역반응을 일으킬 수 있다.
또한 본 발명에서는 Toll 유사 수용체2에 리간드로서 기능하는 것을 특징으로 하는 그람양성균 (Gram-positive bacteria) 유래의 리포단백질을 진단용 항원으로 하는 것을 특징으로 하는 진단용 키트를 제공하고자 한다.
본 발명의 진단대상은 그람양성균으로 그 종류가 특별히 한정되는 것은 아니나, 바람직하게는 스타필로코커스 아우레우스(Staphylococcus aureus), 바실러스 서브틸리스(Bacillus substilis), 마이크로코커스 루터스(Micrococcus luteus), 스트렙토코커스 뉴모니아(Streptococcus pneumoniae), 엔테로코커스 패칼리스(Enterococcus faecalis), 스트렙토코커스 뮤탄스(Streptococcus mutans), 스트렙토코커스 피오게네스 (Streptococcus pyogenes), 스트렙토코커스 아갈락티아(Streptococcus agalactiae), S. 에피더미디스(S.epidermidis), 스트렙토코커스 고르도니(Streptococcus gordonii), 스트렙토코커스 미티스(Streptococcus mitis), 스트렙토코커스 오랄리스(Streptococcus oralis), 스트렙토코커스 에퀴(Streptococcus equi), 바실러스 안트라시스(Bacillus anthracis)일 수 있으며, 더욱 바람직하게는 타필로코커스 아우레우스(Staphylococcus aureus), 바실러스 서브틸리스(Bacillus substilis), 마이크로코커스 루터스(Micrococcus luteus)일 수 있다
본 발명의 바람직한 일례로, 진단용 항원은 Toll 유사 수용체2에 리간드로서 기능하는 바실러스 서브틸리스(Bacillus substilis) YfmC(NP_388633), 마이크로코커스 루터스(Micrococcus luteus) GluE(ZP_02945718), 스타필로코커스 아우레우스(Staphylococcus aureus)의 SitC((YP_499195), SAOUHSC_02699(YP_501161), SAOUHSC_00844 (YP_499398), SAOUHSC_02650 (YP_501112), SAOUHSC_02549 (hypothetical molybdate-binding ABC-transporter, YP_501011) 또는 SAOUHSC_00808 (YP_499364)로 암호화되는 것을 특징으로 하는 리포단백질일 수 있으나 이에 본 발명의 범위가 한정되는 것은 아니다.
본 발명에서는 그람양성균 유래의 리포단백질을 진단용 항원으로 하는 진단용 키트를 제공하는 것으로 그람양성균에 의해 발병되는 질병을 진단할 경우, 직접 질병을 야기하는 그람양성균을 조작하지 않고 재조합이나 화학 합성된 리포단백질만을 항원으로 사용할 수 있기 때문에 조작 및 진단시 안정성이 높다는 장점이 있다.
또한 본 발명에 따른 그람양성균의 진단용 항원은, 당업계에서 일반적으로 진단항원을 사용하여 질병을 진단하는 모든 진단방법 및 그람양성균의 검출을 확인하는 진단방법에 제공될 수 있으며, 이러한 일례로 한천겔침강법(AGID), 효소결합면역측정법(ELISA)에 사용될 수 있다. 즉, 본 발명은 피검체로부터 채취한 생물학적 항체시료와 본 발명에 따른 그람양성균 진단용 항원을 반응시켜 항원-항체 반응을 검출하는 진단키트에 제공될 수 있다.
종래의 연구결과에 따르면 그람양성균은 디아실화된 리포단백질을 가지고 그람음성균은 트리아실화된 리포단백질을 가진다고 알려져 있으며, 이러한 그람양성균 유래의 리포단백질 중에서 Toll 유사 수용체2의 리간드로서 기능 것은 정제되거나 특정화되지 않았다. 그러나, 본 발명에서는 ATP 결합 무리(ABC)트랜스포터 기질 결합 단백질(ATP binding cluster(ABC) transporter substrate-binding proteins)군에 속하는 그람양성균 유래의 천연 리포단백질이 Toll 유사 수용체2의 리간드로서 작용함을 밝히었고 또한 그람양성균은 디아실화된 리포단백질만을 가진다는 종래의 연구 결과와는 달리 그람양성균에서 triacylated N-말단을 가진 리포단백질의 존재를 밝혀내었으며, 이러한 트리아실화된 리포단백질이 TLR2수용체에 대해 리간드로서 작용함을 입증하였다. 이와 같이 그람양성균 유래의 Toll 유사 수용체2의 리간드로서 기능하는 본 발명의 그람양성균 유래의 리포단백질을 그람양성균으로 야기되는 질병의 예방 또는 치료하는 데 있어 좋은 면역원 또는 면역자극제로 활용할 수 있으며, 또한 그람양성균을 진단하는데 있어 진단용 항원으로 활용할 수 있을 것이므로, 본 발명의 산업적 활용가치는 클 것이다.
도1에서 도1A 내지 도1H는 어떤 세포벽 분자가 native TLR2 리간드로서 기능하는지 여부를 확인하기 위한 것으로, NF-κB로 유발되는 hCD25 유전자를 지닌 CHO/hCD14/hTLR2 리포터 세포주(reporter cell line)를 자극하여 그 결과 CD25의 표면 발현정도를 flow cytometry로 측정한 것이다. 도1I는 TLR2 자극활성을 나타내는 TX-114 phase 단편을 SDS-PAGE로 분리하여 한 개의 33 kDa 단백질 밴드를 얻은 것을 확인한 것이다.
도2는 스타필로코커스 아우레우스 (Staphylococcus aureus) SitC 리포단백질의 염기서열을 나타낸 것이다.(박스는 신호전달 펩티드를 나타낸 것이고, 별표는 지질 결합 시스테인을 나타낸 것이고, 밑줄친 부분은 에드만 분해서열에 의해 결정된 아미노산 서열을 나타낸 것이고, 점선으로 윗줄친 부분은 LC-MS/MS에 의해 결정된 아미노산서열을 나타낸 것이고, 이중으로 밑줄친 부분은 MALDI TOFMS에 의해 결정된 아미노산을 나타낸 것이다.)
도3은 SDS-PAGE 겔 슬라이스에서 lysylendopeptidase에 의해 분해된 SitC 단백질 절편을 MALDI TOFMS로 측정한 것이다.
도4에서는 SitC의 in-gel tryptic digest의 유기상(organic phase)(도4A)의 MALDI-TOF MS spectra와, 5시간 배양한 LPL digests(도4B)과 17시간 배양한 LPL digests(도4C)의 MALDI-TOF MS spectra을 나타낸 것이다.
도5는 octadecanoylglyceryl-cysteinyl-GTGGK에 상응하는 m/z 862.5에서의 피크의 MALDI-MS/MS spectrum을 나타낸 것이다.
도6은 N-octadecanoly-S-glyceryl-cysteinyl-GTGGK의 화학 구조를 나타낸 것이다.
도7은 S. aureus RN4220의 세포용해물(cell lysate)과 TX114 fraction을 가지고 SDS-PAGE 분석을 한것이고, 하기 화살표는 SitC와 SAOUHSC_02699를 나타낸다.
도8은 도7에서의 33-kDa 단백질의 MALDI-TOF mass spectrum을 나타낸 것으로, S. aureus의 세포용해물 (cell lysate)의 트리아실화된 리포단백질(triacylated lipopeptides)을 검출한 것이다.
도9는 S. aureus SA113 strain의 SitC의 트리아실화된 리포단백질의 MALDI-TOF mass spectrum을 나타낸 것이다.
도10은 S. aureus SA113 로부터의 SAOUHSC_02699 단백질의 트리아실화된 리포단백질의 MALDI-TOF mass spectrum을 나타낸 것이다. 별표는 포화된 지방산으로 변형된 트리아실화된 리보펩티드의 계산된 분자 매스값(mass values)보다 2 Da만큼 더 작은 피크를 나타낸 것이다.
도11은 S. aureus SA113 균주의 지질 변형된 펩티드의 MALDI mass spectrum으로, 이는 SitC 및 SAOUHSC_02699의 트리아실화된 리포단백질을 MALDI mass spectrum에서 나타낸 것이다.
도12에서는, S. aureus SitC 단백질에 의해 자극되어진 CHO/hCD14/hTLR2세포 (도12A) 또는 CHO/hCD14/hTLR4(도12B)세포에서의 NF-κB-driven hCD25의 표면 발현을 flow cytometry로 분석하여 나타낸 것이다.
도13은 정제된 SitC 와 SitC 돌연변이체 박테리아에 의한 TLR2 자극을 나타낸 것으로, 도13A와 도13B는 모계 C57BL/6 (bar1), TLR1-/-(bar2), TLR2-/-(bar3), TLR6-/-(bar4),및 MyD88-/-(bar5)로부터 제조된 복막의 대식세포를 LPS, 합성Pam3CSK4, MALP-2, 또는 정제된 SitC단백질로 자극하고 배양 상층액상의 TNF-α (도13A) 및 IL-6(도13B)의 농도를 ELISA를 사용하여 측정한 것을 나타낸 것이다. N.D은 검출된 것이 없음을 의미한다. 도13C에서는,가용화된 PGN의 aqueous phase (lane1 및 lane3) 및 TX-114-detergent phase (lane2 및 lane4)의 SDS-PAGE 분석을 나타낸다.
도14는 두 가지 다른 그람양성균의 ABC 트랜스포터 기질 결합 리포단백질이 TLR2를 활성화시키는 것을 나타낸 것이다. 도14A는 정제된 S. aureus SitC (laneSitC), B.subtilisYfmC (lane1), 및 M.luteusGluB (lane2) 리포단백질을 SDS-PAGE 분석한 것이다. 도14B 내지 도14E에서는, CHO/hCD14/hTLR2 (도14B 및 도14D) 또는 CHO/hCD14/hTLR4 (도14C 및 도14E) 세포가 B.subtilis YfmC 리포단백질 (도14B 및 도14C) 또는 M.luteus GluB 리포단백질 (도14D 및 도14E)의 존재 또는 부재 (회색지역을 지닌 검은선)하에 자극됨을 나타낸 것이다.
도15는 TLR2를 자극하는 리포단백질인 B. subtilis YfmC (NP_388633, A) 및 M. luteus GluE (ZP_02945718, B) 의 아미노산 서열이 나타낸 것이다(하기 박스는 신호서열 펩티드를 나타낸 것이고, 별표는 지질 결합 시스테인을 나타낸 것이며, 밑줄친 글씨는 트립신으로 처리한 절편을 LC-MS/MS 로 분석하여 결정한 아미노산을 나타낸 것이다).
본 발명은 이하 실시예 및 실험예로써 상세히 설명하지만, 본 발명의 기술적 범위가 이들 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예 및 실험예에 의해 한정되는 것은 아니다.
<실시예>
실시예 1 : 박테리아 균주, 플라스미드 그리고 배양 조건.
S. aureus 및 E. coli 균주를, 30 ℃ 또는 37 ℃에서 12.5 μg/ml 클로람페니콜 (chloramphenicol, Cm), 20 μg/ml 필레오마이신 (phleomycin, Phleo), 100 μg/ml 암피실린 (ampicillin, Amp), 50 μg/ml 카나마이신 (kanamycin, Km), 또는 10 μg/ml 에리쓰로마이신 (erythromycin, Erm)를 함유하는 Tryptic soy broth (Difco) 또는 Luria Bertani 배지 (1% tryptone, 0.5% yeast extract 및 1% NaCl)에서 배양하였다. 0.5% NaCl를 함유하는 Luria Bertani 배지에서 B. subtilis 균주 168를 배양한 데 반해, 한국미생물배양센터(Korean Culture Center of Microorganisms)로부터 분양된 M. luteus ATCC 4698를 Tryptic soy broth에서 배양하였다. 또한, S. aureus SA113는 가고시마 (Kagoshima)대학의 Dr. Hashimoto로부터 받았다. 메치실린-저항성 S. aureus (MRSA) MW2 및 메치실린-민감성 S. aureus (MSSA) 4776는 한국미생물배양센터 (Korean Culture Center of Microorganisms)로부터 얻었다. S. aureus RN4220, SA113, MW2, 및 MSSA4776는 앞선 언급된 Luria Bertani (LB) 또는 Brain Heart Infusion (BHI) 배지에서 성장시켰다.
이 연구에서 사용된 S. aureus 균주와 플라스미드는 하기 표1에 나열되어 있다. E. coli 균주 XL1-Blue (recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F’proAB lacIq lacZΔM15 Tn10 (Tetr)], Stratagene)는 서브클로닝 절차에 사용되었다. 전기천공 (electroporation), 유전자의 삽입적 결실 (insertional deletion) 그리고 파이지 형질도입 (phage transduction)을 포함하는 S. aureus 세포의 유전자조작이 수행되었다 ( 참조: Kaito, C., Kurokawa, K., Matsumoto, Y., Terao, Y., Kawabata, S., Hamada, S., and Sekimizu, K. (2005) Mol Microbiol 56, 934-944 ; Murai, N., Kurokawa, K., Ichihashi, N., Matsuo, M., and Sekimizu, K. (2006) FEMS Microbiol Lett 254, 19-26 ; Kaito, C., and Sekimizu, K. (2007) J Bacteriol 189, 2553-2557). 염색체 sitC 유전자는 약간의 변형과정을 거치며 Phleo 저항 유전자 (resistance gene)로 대체되어진다 (참조: Fabret, C., Ehrlich, S. D., and Noirot, P. (2002) Mol Microbiol 46, 25-36 ). 일차적으로, sitC 로부터 약 1.5 kbp의 업스트림 (upstream) 또는 다운스트림 (downstream)에 위치한 DNA절편을 각각 PCR 프라이머인 SitC-P1KpnI (CGGGGTACCGTTTGTCGGAATTGATTT) 및 SitC-P2 (TATTGGATCCTTTTCATGTTAAACTTCCTCGTTTC)를 사용하거나 또는 SitC-P3 (GTTCAGCAATCGGTCCCATATCGTGCGTTAAA) 및 SitC-P4EcoRI (GGGATTGATGGAATTCTGAAGGGCTTTTCATCA)를 사용하여 증폭한 후, 이차적으로, 각각 SitC-P2 및 SitC-P3에 각각 상보적이고 pUC19-upp-phleo 주형서열에 대해 상보적인 서열을 지닌 프라이머인 Phleo-P2+ (GGATCCAATAGACCAGTTGCA) 및 Phleo-P3+ (CGATTGCTGAACAGATTAATAATAGA)를 사용하여 Phleo 저항성 유전자 (resistance gene)를 증폭하였다. 다음, 증폭된 세가지 절편을 joining PCR을 사용하여 함께 겹쳐 연결(splice)하고(Fabret, C., Ehrlich, S. D., and Noirot, P. (2002) Mol Microbiol 46, 25-36), 그 결과물 절편을 pKOR1의 KpnI 및 EcoRI 위치내로 삽입하여(Bae, T., and Schneewind, O. (2006) Plasmid 55, 58-63), pKOR1-sitC를 만들어낸다. 상기 pKOR1-sitC 플라스미드를 RN4220 세포내로 도입하고 첫 번째 자리 상동재조합(homologous recombination)에 의해 생성된 Cm-저항균주(resistant strain)를 43 °C에서 선별하였다. 이들 세포로부터, Phleo 저항성을 나타내는 Cm 민감성 균주는 두 번째 자리 상동재조합을 통해 형성되어지며, 30 °C에서 100 ng/ml 안하이드로테트라사이클린 (anhydrotetracycline)의 존재하에서 선별되어지고 이를 M0573라 하였다. 프라이머 SitC-P1 KpnI 및 SitC-P4 EcoRI 을 사용한 PCR을 수행함으로, M0573에서 염색체 sitC 유전자의 결핍을 확인하였다. T013에서, 리포단백질 디아실글리세롤 트랜스퍼라아제 (lipoprotein diacylglycerol transferase)를 암호하는 lgt 유전자는, pMUTIN-T3 (Erm 저항성)에서 유래한 플라스미드 단편의 통합을 매개하는 single cross-over recombination에 의해 RN4220 세포에서 분열된다. 이러한 단편, 특별히 pMlgt는 내부 lgt open reading frame을 지니는데, 이는 프라이머 5Plgt-HindIII (CCCAAGCTTAGGACCACTGAGTGTACGATGG) 및 3Plgt-BamHI (CGCGGATCCAGCGACATCCCAAAT)로 증폭되어 진다. PCR에 의해 염색체 lgt유전자의 삽입적 결실 (insertional deletion)을 확인하였다. 게다가, pSlgt는 S. aureus hu 유전자 프로모터의 조절하에 lgt 유전자 open region frame을 지닌 pKE515 플라스미드의 한 파생물(derivative)이다.
pSlgt를 만들기 위해, S. aureus hu 유전자 프로모터와 번역 개시자리를 프라이머 5PpHU-BamHI (CACGGATCCGGCTAATAATTACGTAAAATGAAT) 및 3PpHU-KpnINcoI (TTGTCCATGGTACCTTCACCTCCTGAGGTTTG)를 사용하여 증폭시키고 그 결과 얻어진 단편을 BamHI 및 NcoI으로 분해시켜서 pKE515의 BamHI 및 NcoI 자리로 삽입시킨 후, pKE515pHU를 얻었다.
이어서, lgt 유전자 open reading frame을 프라이머 pSlgt-5PKpnI (TGAGGAGTAGGTACCATGGGTATTGTA) 및 pSlgt-3PEcoRI (CGGAATTCACGCCATAAAGGGTTTGTATGA)를 사용하여 증폭시키고, KpnI 및 EcoRI 로 잘라서 pKE515pHU의 KpnI 및 EcoRI 자리에 삽입시킨다. pSsitC는 S. aureus hu 유전자 프로모터의 조절하에 sitC 유전자 open region frame을 지닌 pKE515의 한 파생물(derivative)이다.
sitC 유전자 open reading frame을 프라이머 pSsitC-5PKpnI (ACGAGGAAGGGTACCATGAAAAAATTA) 및 pSsitC-3PSalI (GTCGACTGTTGATGTGTGGCCTAAAA)를 사용하여 증폭시키고, TA 클로닝(Promega, Madison)을 거쳐 pGEM-T easy 벡터 내로 서브 클로닝하여서, 그 결과 pGEM-sitC를 얻었다. 이러한 pGEM-sitC를 KpnI 및 NotI로 절단하고 pKE515pHU의 KpnI 및 NotI 자리에 삽입하여서 pSsitC를 얻었다.
표 1
균주(Strains) 기술(Description)a Source or Reference
S. aureus
RN4220 Restriction minus wild-type (1)b
M0674/pM101 RN4220 △ltaS::phleo / pM101 (2)
T013 RN4220 △lgt::pMlgt 본 발명
M0573 RN4220 △sitC::phleo 본 발명
B. subtilis 168 (3)c
M. luteus ATCC 4698
Plasmids
pKE515 S. aureus-E. coli shuttle vector, Cmr, Ampr (4)
pKE515pHU pKE515 carrying the S. aureus hu prompter region 본 발명
pSsitC pKE515pHU carrying SitC ORF 본 발명
pSlgt pKE515pHU carrying Lgt ORF 본 발명
pMUTIN-T3 S. aureus integration vector, Ampr, Ermr (5)d
pMlgt pMUTIN-T3 carrying internal lgt coding region 본 발명
pKOR1 Targeting vector for S. aureus genes, Ampr, Cmr (6)e
pKOR1-sitC pKOR1 carrying △sitC::phleo 본 발명
(1) Novick, R. P., Ross, H. F., Projan, S. J., Kornblum, J., Kreiswirth, B., and Moghazeh, S.(1993) EMBO J 12(10), 3967-3975
(2) Oku, Y., Kurokawa, K., Matsuo, M., Yamada, S., Lee, B. L., and Sekimizu, K. (2009) J Bacteriol 191(1), 141-151
(3) Kunst, F., Ogasawara, N., Moszer, I., Albertini, A. M., Alloni, G., Azevedo, V., Bertero, M.G., Bessieres, P., Bolotin, A., Borchert, S., Borriss, R., Boursier, L., Brans, A., Braun, M.,Brignell, S. C., Bron, S., Brouillet, S., Bruschi, C. V., Caldwell, B., Capuano, V., Carter, N.M., Choi, S. K., Codani, J. J., Connerton, I. F., Danchin, A., and et al. (1997) Nature 390(6657), 249-256
(4) Li, Y., Kurokawa, K., Matsuo, M., Fukuhara, N., Murakami, K., and Sekimizu, K. (2004)Mol Genet Genomics 271(4), 447-457
(5) Vagner, V., Dervyn, E., and Ehrlich, S. D. (1998) Microbiology 144 ( Pt 11), 3097-3104
(6) Bae, T., and Schneewind, O. (2006) Plasmid 55(1), 58-63
aphleo, the pheleomycin resistance gene; Cmr, chloramphenicol resistance; Ampr, ampicillin resistance; Ermr, erythromycin resistance.
b Kindly provided by Hiramatsu K. (Juntendo University, Tokyo, Japan).
c Kindly provided by Yoshikawa H. (Tokyo University of Agriculture, Tokyo, Japan).
d Kindly provided by Ogasawara N. (Nara Institute of Science and Technology, Nara, Japan).
e Kindly provided by Bae T. (University of Chicago, Chicago, IL).
실시예 2: S. aureus cells 로부터의 불용성 펩티도글리칸 (Insoluble peptidoglycan)
불용성 펩티도그리칸을 준비하였다(참조: Park, J. W., Kim, C. H., Kim, J. H., Je, B. R., Roh, K. B., Kim, S. J., Lee, H. H., Ryu, J. H., Lim, J. H., Oh, B. H., Lee, W. J., Ha, N. C., and Lee, B. L. (2007) Proc Natl Acad Sci U S A 104, 6602-6607). S. aureus RN4220 세포를 1.5(500 ml culture)의 OD600에서 얻어서, 20 ml의 1M NaCl로 구성된 용액에서 전체 7분 동안 분당 2,000 진동(oscillations)하에 12g 글라스비드(glass beads, 0.1 to 0.11 mm)로 파쇄하였다.
상기 파쇄된 세포에서 그라스비드(glass beads)와 파쇄되지 않은 세포를 제거하기 위하여 10분간 2,000x g 에서 원심분리하였고, 상기 상층액을 10분간 13,000 xg에서 원심분리하였다. 이의 필렛(정제되지 않은 펩티도글리칸 단편(crude peptidoglycan fraction))을 0.5% SDS에서 재부유시키고(resuspended), 이어서 30분간 60 °C에서 배양시킨다. 불용성의 펩티도글리칸 단편(insoluble peptidoglycan fraction)을 6번 물로 washing하여 수거한다.
실시예 3: Triton X-114 phase partitioning에 의한 SitC 단백질 정제
Triton X-114 (TX-114) phase partitioning법을 통해 S. aureus 불용성 펩티도글리칸 단편(insoluble peptidoglycan fraction)으로부터 SitC 리포단백질을 분리하였다(참조: Shimizu, T., Kida, Y., and Kuwano, K. (2005) J Immunol 175, 4641-4646). 간단하게 S. aureus 불용성 펩티도글리칸 단편(100 mg)을, TX-114를 첨가하여 2%의 최종농도가 되게 한 20 mM Tris-HCl (pH 8)로 구성된 10 ml의 용액에서 37 ℃에서 14시간 동안 β-lytic효소(4 μg)로 분해한 후, 1시간 동안 4 ℃에서 배양하였다. 이어서, 상기 혼합물을 phase separation시키기 위해 37 °C에서 10분간 배양하였다. 10분간 10,000 x g에서 원심분리 후에, 상위 수용성상(aqueous phase)을 제거하고 같은 부피의 TBSE 용액(20 mM Tris-HCl, pH 8, 130 mM NaCl 및 5 mM EDTA)으로 대체하였다. 이러한 과정을 두 번 반복하였다. 이 용액의 성분들을 침전(precipitate)하기 위해 , 최종 TX-114 phase에 과량의 에탄올을 첨가하였다. TX-114 phase separation 동안, Tenebrio molitor hemolymph 내에서 phenoloxidase 활성을 유도하는 펩티도글리칸이 수용액 부분에서 관찰되었다(참조; Kan, H., Kim, C. H., Kwon, H. M., Park, J. W., Roh, K. B., Lee, H., Park, B. J., Zhang,R., Zhang, J., Soderhall, K., Ha, N. C., and Lee, B. L. (2008) J Biol Chem 283, 25316-25323). TX-114 부분의 에탄올 침전물(precipitates)이 12% SDS-PAGE에 로드되고(loaded), 33 kDa 단백질 밴드를 잘라서 이 겔로부터 전기용출하였다 (electro-eluted). SDS를 제거하기 위해 과량의 에탄올로 상기 정제된 단백질을 침전하였다. SitC 단백질은 또한 세포 용해물 (cell lysate)로부터 정제되었다. 간단하게 말하면, 언급한 바와 같이 글라스비드 (glass beads)로 파쇄시킨 S. aureus RN4220 세포를 세포잔해를 필렛으로 만들기 위해 10분간 2,000 xg에서 원심분리하고 이의 상층액을 제거한 후 20분간 13,000 xg에서 원심분리하여 세포 용해물 (cell lysate)을 수거하였다 (supernatant fraction). 이 세포 용해물 (cell lysate)을 TX-114 phase separation을 사용하여 분획한 후, 얻어진 TX-114단편을 에탄올로 침전하여 겔 상에 로드하고 SDS-PAGE를 통해 분석한다. 33 kDa 단백질을 겔로부터 회수하고 에탄올로 침전하였다(precipitated).
실시예4 : B. subtilis 또는 M. luteus 로부터의 리포단백질(lipoprotein)
B. subtilis 168 또는 M. luteus ATCC 4698 세포의 리포단백질을, 세포 용해물(cell lysate)로부터 S. aureus SitC를 정제하기 위해 사용했던 것과 유사한 방법을 사용하여, 세포 용해물(cell lysate)로부터 정제하였다. 각각 B. subtilis 또는 M. luteus 세포로부터의 TX-114 단편에서 33 kDa 단백질과 37 kDa 단백질을 SDS-PAGE를 통해 분리하였고, 겔로부터 회수한 후 에탄올로 침전하였다(precipitated).
실시예5 : 아미노산 서열분석기(Amino acids sequencing)
SDS-PAGE 겔로부터 전기용출된(electroeluted ) 33 kDa 단백질의 내부 아미노산 서열을 결정하기 위하여, 정제된 단백질 (25 μg)을 환원시키고(reduced)
알킬화한 후 37℃에서 12시간 동안 2 μg lysylendopeptidase (WAKO)로 분해시킨다. 이렇게 얻어진 펩티드들을 reverse phase C18 column (Waters)상에서 HPLC를 통해 분리하고 Applied Biosystems Procise Automated Gas Phase Sequencer에 적용하였다(참조; Kim, C. H., Kim, S. J., Kan, H., Kwon, H. M., Roh, K. B., Jiang, R., Yang, Y., Park, J.W., Lee, H. H., Ha, N. C., Kang, H. J., Nonaka, M., Soderhall, K., and Lee, B. L. (2008) J Biol Chem 283, 7599-7607). 아미노말단 서열은 직접적으로 정제된 단백질 (3 μg)에 단백질 서열기(protein sequencer)를 사용함으로 결정 되었다.
실시예6 : 리포단백질 구조를 결정하기 위한 Mass 분석
실시예 6-1
전체 길이의 단백질의 분자량이 matrix-assisted laser desorption ionization mass spectrometry (MALDI TOFMS)에 의해 측정되었다. 시나핀산(Sinapinic acid)이 매트릭스로 사용되었다. SDS-PAGE에 의해 분리된 단백질이 lysylendopeptidase 또는 trypsin을 사용하여 겔내에서 분해되었고 (in-gel digested), 그 분해물이 liquid chromatography- tandem mass spectrometry (MS/MS)나 MALDI TOFMS에 의해 분석되었다 (참조; Kodama, K., Fukuzawa, S., Nakayama, H., Kigawa, T., Sakamoto, K., Yabuki, T.,Matsuda, N., Shirouzu, M., Takio, K., Tachibana, K., and Yokoyama, S. (2006) Chembiochem 7, 134-139). 상기 단백질을 Mascot database searching software에 의한 MS/MS 데이터를 이용하여 동정하였다.
실시예6-2
1) 겔내 분해(In-gel digestion)
상기 TX114 phase에서 단백질은 SDS-PAGE에 의해 분리되었고 Coomassie Brilliant Blue R250 (CBB)로 염색되었다. 이겔로부터 절제된 단백질 밴드를 50% (v/v) 메탄올로 탈색(destain)하고 진공원심분리기에서 건조시킨다. 건조된 겔 조각을 10 ng/L의 트립신 (Promega)을 가지고 재수화 (rehydrate)시키고 그런후 0.1% (w/v) n-decyl--D-glucopyranoside (SIGMA)을 함유하는 약20mL의 50 mM Tris-HCl (pH 8.5)하에서 18시간동안 37에서 배양시킨다. 그 결과 얻어진 분해물을 직접적으로 mass spectrometry로 분석하거나 클로로폼/메탄올 추출 후에 분석한다.
2) 클로로포름/메탄올 추출에 의한 지질 변형된 펩티드의 정제
지질-변형된 펩티드는 약간의 변형을 가한 다음 추출하였다 (참조 ; Ujihara T, Sakurai I, Mizusawa N, Wada H. A method for analyzing lipid-modified proteins with mass spectrometry. Anal Biochem. 2008 Mar 15;374(2):429-31.). 간단히, in-gel digestion로부터 얻어진 펩티드 용액 (10-20 L)을 1mL의 70% 포름산 (formic acid)으로 산성화시키고, 하층의 유기상(organic phase)과 상층의 수용성 상(aqueous phas e)으로 분리하기 위해 같은 양의 클로로포름/메탄올 (chloroform/methanol, (2/1, v/v) )용액과 혼합시켜서 볼텍싱 (vortexing)하고 10분간 10,000 xg에서 원심분리한다. 지질 변형된 펩티드를 함유한 유기상 (organic phase)을 새로운 튜브로 옮겨둔다. tryptic 활성의 존재하에서 리포펩티드의 C-말단 카르복실기 그룹에서 메틸에스터 형성이 빈번히 유기상 (organic phase)에서 관찰되기 때문에 산성화단계가 필수적이다.
3) 리보단백질 리파아제로 지질 변형된 펩티드를 처리
지질 변형된 펩티드를 함유하는 유기상(Organic phase)은 진공상태에서 건조되고 5분간 10-20 L물속에서 초음파처리에 의해 분해되어진다. 이 용액은 트립신을 불활성화시키기 위해 1.5시간동안 100에서 가열되고 Pseudomonas sp. (SIGMA)로부터의 80 ng/L 리포단백질 리파이제(LPL) 와 함께 37℃에서 배양되었다.
4) MALDI-TOF MS 분석
MALDI-TOF MS 분석은 양성 이온 모드와 reflectron 모드에서 Ultraflex (Bruker Daltonics)을 사용하여 수행되어진다. 클로로포름/메탄올 (chloroform/methanol (2:1, v/v)) solvent 내의 포화된 -cyano-4-hydroxycinnamic acid (CHCA) solution이 매트릭스로서 사용되어진다. CHCA 매트릭스를 가지고 얇은층이 준비되고 이러한 샘플이 매트릭스의 얇은층 위에 적충되어진다. MALDI-MS/MS 스펙트라는 매트릭스로서 CHCA 또는 2, 5-Dihydroxybenzoic acid를 사용하는 MALDI-iontrap mass spectrometer (MALDI-LTQ; Thermo Fisher Scientific) 를 이용하여 얻어진다.
5) LC-MS/MS 분석
LC-MS/MS에 의해 단백질을 정제하였다. in-gel digests은 hybrid quadrupole-TOF instrument (Q-Tof2 Waters)와 결합된 nano-LC (1100 series; Agilent Technologies)에 의해 분석되었다. Inertsil ODS (GL Science)로 충진된 직접 제작한 모세관 컬럼 (home-made capillary column)의 이동상 (mobile phases)은 수용액내 0.075% (v/v) 포름산 (formic acid) 으로 이루어진 solvent A와, 수용액내 0.075% (v/v) 포름산 (formic acid)과 80% (v/v) 아세토니트릴 (acetonitrile)로 이루어진 solvent B이다. 그 결과 얻어진 MS/MS 데이터는 단백질 동정을 위해 Mascot (Matrix Science)에 적용되어진다.
실시예7 : Flow Cytometry
인간 CD14 및 인간 TLR2 (CHO/CD14/TLR2) 또는 TLR4 (CHO/CD14/TLR4)를 발현하는 reporter CHO 세포주(cell lines)를 Dr. D.Golenbock (University of Massachusetts Medical School)로부터 제공받아서, 10% 열에 의해 불활성화된 태아 소혈청(heat-inactivated fetal bovine serum, GIBCO), 1 mg/ml G418 (Invitrogen, Carlsbad, CA), 400 U/ml 하이그로마이신 (hygromycin, Amresco, San Francisco, CA), 및 1x 페니실린-스트렙토마이신 (penicillin- streptomycin, GIBCO)이 첨가된 Ham's F-12 배지 (GIBCO, Carlsbad, CA)에서 배양하였다 (maintained).
이러한 세포주들은 TLR2- 또는 TLR4-로 매개된 (mediated) NF-κB 전좌 (translocation)의 결과로서, 표면 CD25단백질을 발현시키도록 하였다 (참조; Medvedev, A. E., Henneke, P., Schromm, A., Lien, E., Ingalls, R., Fenton, M. J.,Golenbock, D. T., and Vogel, S. N. (2001) J Immunol 167, 2257-2267). 이러한 CHO 세포들은 24-well plate에서 한 웰당 2 x 105 세포로 플레이트 되었다. 밤새 배양한 후, 16시간 동안 S. aureus 세포들, 리포단백질 단편 (lipoprotein fractions), Pam3CSK4 (Invivogen), 또는 LPS (Invivogen)로 이 세포들을 자극하였다. FITC-접합된 mouse anti-human CD25 mAb 클론 2A3 (FITC-conjugated mouse anti-human CD25 mAb clone 2A3)(BD Biosciences, San Diego, CA)로 이 세포들을 착색시킨 후, FACSCalibur (BD Biosciences)로 분석하였다.
실시예 8: 쥐 복막 대식세포(Mice Peritoneal Macrophages)
TLR1-/-, TLR2-/-, TLR6-/-, MyD88 -/- 쥐를 준비하였다 (참조; Adachi, O., Kawai, T., Takeda, K., Matsumoto, M., Tsutsui, H., Sakagami, M.,Nakanishi, K., and Akira, S. (1998) Immunity 9, 143-150 ; Takeuchi, O., Hoshino, K., and Akira, S. (2000) J Immunol 165, 5392-5396 ; Takeuchi, O., Kawai, T., Muhlradt, P. F., Morr, M., Radolf, J. D., Zychlinsky, A., Takeda, K., and Akira, S. (2001) Int Immunol 13, 933-940 ; Takeuchi, O., Sato, S., Horiuchi, T., Hoshino, K., Takeda, K., Dong, Z., Modlin, R. L.,and Akira, S. (2002) J Immunol 169, 10-14). 2 ml 의 4% 티오글리콜레이트 (thioglycollate)를 i.p.주입후 3일에 복막 대식세포를 수거하였고, 이어서 10% FCS (GIBCO)가 첨가된 RPMI 1640 배지에서 배양되었다. Salmonella minesota RE595, 합성Pam3CSK4, 그리고 MALP-2 로부터 얻어진 LPS는 시그마사 (Sigma)로부터 구입하였다. 상기 배양 상층액으로부터의 암괴사인자 (tumor necrosis factor , TNF)-α 및 인터루킨 (interleukin, IL)-6의 농도를 ELISA (Genzyme, Minneapolis)를 사용하여 측정하였다.
실시예9 : NF-κB 활성화(NF-B activation)를 위한 분석
pELAM (a gift from Dr. D. Golenbock at University of Massachusetts Medical School)인 NF-κB에 의해 활성화된 프로모터의 조절하에 개똥벌레 루시퍼라아제 (firefly luciferase)를 발현하는 레포터 유전자 벡터 (참조; Means, T. K., Wang, S., Lien, E., Yoshimura, A., Golenbock, D. T., and Fenton, M. J.(1999) J Immunol 163, 3920-3927), pRL-TK (Promega Corp.)인 트랜스펙션 효율성을 표준화하기 위해 사용하는 레니아 루시퍼라아제 (Renilla luciferase)를 구성적으로 발현하는 컨트롤 레포터 (control reporter)와 pDisplay (Invitrogen, Carlsbad, CA) (a gift from Dr. Y. Adachi at Tokyo University of Pharmacy and Life Science)의 쥐 TLR2 cDNA (참조; Ikeda, Y., Adachi, Y., Ishibashi, K., Miura, N., and Ohno, N. (2005) Immunopharmacol Immunotoxicol 27, 285-298)를 포함하는 플라스미드 DNA의 혼합물을 가지고 밤새 calcium/phosphate법을 사용하여 HEK293 세포들을 트랜스펙트 (transfect)하였다. 이 세포들을 하루 동안 신선한 배지에서 더욱 배양하고, 이어서 2시간동안 S. aureus와 함께 배양한 후 세포 용해물 (cell lysates)을 Dual Luciferase Assay kit를 이용하여 개통벌레 루시퍼라아제 (firefly luciferase)와 루닐라 루시퍼라아제 (Renilla luciferase)의 양을 알기 위해 조사하였다. NF-κB 활성 정도는 개통벌레 루시퍼라아제 (firefly luciferase)와 루닐라 루시퍼라아제 (Renilla luciferase)의 비율에 의해 결정된다.
실시예10 : TLR-2 및 TLR-4 KO mouse macrophage 채취법 및 Sit-C 자극에 의한cytokine 정량법
멸균시킨 4% 티오글리콜레이트(thioglycollate) 2ml을 PEC (Peritoneal macrophage)의 유도를 위해 쥐의 복부에 주사한다. 주사한 날을 1일로 생각하여 주사한지 4일 후 5ml PBS (137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4,1.5mMKH2PO4,pH7.27.4,0.2umfiltered)혹은 HBSS (Hanks Balanced Salt Solution)을 쥐의 복부에 주사한 뒤 다시 회수함으로 PEC를 얻는다. 주사기에 든 PEC를 15ml tube에 옮겨 담는다. Tube를 1,100rpm, 5분간 원심분리 시킨다. PBS 혹은 HBSS를 aspirator로 제거한다. RPMI (10% FBS, 1% antibiotics(Penicillin/streptomycin) + 2 mercaptoethanol) 배지에 suspension시킨다. Cell counting 기계를 이용해 cell 수를 센 뒤 Cell을 5 x 104cells/100ul이 되도록 RPMI를 이용해 희석한다. 희석된 Cell을 cell seeding용 96 well plate에 100ul씩 seeding한다. sitC lipoprotein을 처리할 농도의 2배로 희석시킨 뒤 PEC이 seeding된 plate에 100ul 처리한다. 24시간 동안 37℃에서 incubation 시킨 뒤 새 96 well plate에 옮긴다. Cytokine level 측정을 위해 ELISA plate를 준비한다. 우선, ELISA(R&D) protocol에 따라 PBS에 1stantibody를 희석시킨 후 100ul씩 ELISA용 96 well plate에 seeding 후 하룻밤 실온에 둔다. Washing buffer(0.05% Tween20 in PBS) 300ul로 3번 washing 후 blocking buffer (1% BSA + 5% sucrose in PBS) 300ul를 첨가한 후 실온에 1시간 이상 둔다. 다시 washing buffer(0.05% Tween20 in PBS) 300ul로 3번 washing 후 측정하고자 하는 sample을 reagent diluent (1% BSA in PBS)로 희석한 후 (IL-6, TNF-α의 경우 2.5~10배 희석) washing된 plate에 100ul씩 처리하고 실온에 2시간 이상 둔다. Sample 처리시 값 비교를 위한 standard를 두는데 2000pg/ml을 가장 높은 값으로 하여 2배씩 step dilution하여 31.25pg/ml까지 7개의 standard와 blank (reagent diluent) 100ul씩 함께 처리한다. Washing buffer 300ul로 3회 washing 후 ELISA kit의 2ndantibody를 해당하는 양만큼 reagent diluent로 희석 후 plate에 100ul씩 첨가한 뒤 2시간이상 실온에 둔다. 다시 washing buffer 300ul로 3회 washing 후 HRP (streptavidin-horseradish-peroxidase)를 protocol에 따라 reagent diluent로 희석해서 100ul 처리한 뒤 20분 동안 실온에 둔다. 마지막으로 washing buffer 300ul로 3회 plate washing 후 substrate solution 100ul을 plate에 첨가 후 standard 색 변화를 관찰하면서 적당한 시점 (약 5분~20분)에 Stop solution (1:15=D.W:phosphoricacid)50ul를 더하여 반응을 종료시킨다. ELISA 측정기계로 파장 450 nm에서 측정하여 cytokine 값을 얻는다.
< 실험예 >
실험예1 : S.aureus 33kDa TLR2를 자극시키는 단백질의 동정
실험예1-1 : 어떤 세포벽 분자가 native TLR2 리간드로서 기능하는지 여부
NF-κB로 유발되는 hCD25 유전자를 지닌 CHO/hCD14/hTLR2 리포터 세포주(reporter cell line)를 16시간 동안 자극하였고, 그 결과 CD25의 표면 발현정도를 flow cytometry로 측정하였다. 이러한 자극은 모계 RN4220의 S.aureus 전체세포(도1A 및 도1C)에 의해 유도되거나, LTA(lipoteichoic acids)-deficient △ltaS mutant(도1B)에 의해 유도되거나, empty plasmid를 지닌 lipoprotein maturation-deficient △lgt mutant(도1D)에 의해 유도되거나, pSlg tplasmid를 지닌 △lgt mutant에 의해 유도되었다(도1E). 상기 (도1A)와 (도1B)에서 박테리아는 30℃에서 예비배양(pre-culture)시켰고, (도1C), (도1D)와 (도1E)는 37℃에서 예비배양(pre-culture)시켰다. CHO 세포 대 박테리아세포의 비율은 상기 (도1A)와 (도1B)에서 1:10과 1:100이고, (도1C),(도1D) 및(도1E)에서 1:5 및 1:50이다. 또한 상기 세포를 mock 처리하였다(회색지역을 지니는 검은선)(도1A-도1H).
하기 도1A 내지 도1E에서 나타난 바와 같이, △ltaS 돌연변이체의 TLR2 자극 능력은 그 모계 S.aureusRN4220 균주와 유사함을 확인할 수 있었다.(도1A 및 도1B). 이와는 대조적으로, △lgt 돌연변이체는 그 모계균주(도1C)와는 달리, 완전하게 TLR2 활성을 유도할 수 없었는데(도1D), 이는 lgt 유전자를 지닌 플라스미드를 △lgt 돌연변이체 균주에 도입함으로 그 활성이 회복됨을 확인할 수 있었다(도1E).
상기 결과를 종합해 볼 때, 도1D에서 나타난 바와 같이, S.aureus △lgt 돌연변이체에서의 TLR2 자극 활성의 상실은 PGN 자체가 아닌, 불용성의 PGN 조각(insoluble PGN fraction)내의 동정되지 않은 리포단백질이 TLR2을 활성화시킨다는 것을 제시하며, S.aureus에서 LTA 는 적어도 우리의 반응조건하에서 TLR2를 자극시키는 우선적인 분자가 아니라는 것을 확인할 수 있었다.
실험예1-2 : S.aureus 세포벽의 리포단백질이 TLR2 리간드로서 기능하는지 여부
S.aureus RN4220 세포로부터 실시예2에 따라 불용성의 펩티도글리칸(insoluble peptidoglycan(PGN))단편을 분리하여, Achromobacterβ-lytic protease로 S.aureus의 PGN을 가용화시켰다. 상기 soluble PGN fraction을 정제하기 위하여, 실시예3과 같이 Triton X-114 (TX-114) detergent-mediated phase partitioning 기술을 수행하여 TX-114 detergent fraction(도1G)과 aqueous fraction (도1H)을 준비하였다. 실험예1-1의 CHO/hCD14/hTLR2 세포를 soluble PGN fraction(도1F)과 TX-114 detergent fraction(도1G), 그리고 TX-114처리 후의 aqueous fraction (도1H)으로 자극하였다. 상기 soluble PGN fraction이나 TX-114 detergent fraction, TX-114 처리 후 이의 aqueous fraction으로 CHO/hCD14/hTLR2세포를 자극하여 TLR2 자극활성을 측정하였다. 이때 세포자극에 사용되는 soluble PGN의 함량은 (도1F)에서 0.7㎍ /ml 또는 7㎍ /ml이고, 상기 soluble PGN 함량의 1배 또는 10배의 aqueous fractions으로 세포를 처리하였다(도1H). 24 ng 또는 240ng를 함유하는 TX-114 detergent fraction으로 세포를 처리하였다(도1G). 또한 상기 세포를 mock 처리하였다(회색지역을 지니는 검은선)(도1A-도1H).
하기 도1F 내지 도1H에서 나타난 바와 같이, 상기 soluble PGN fraction은 TLR2를 발현하는 CHO 세포와 함께 배양시, TLR2 자극활성이 있음을 확인할 수 있으므로, soluble PGN fraction이 TLR2 자극분자를 함유함을 추측할 수 있다(도1F). 비수용성 TX-114 phase(TX-114 detergent fraction)는 TLR2 자극활성이 있던데 반해(도1G), 수용성 phase(aqueous fraction)는 자극활성이 없음(도1H)을 확인할 수 있었다.
실험예1-3 : SDS-PAGE 분석
empty plasmid pKE515를 지닌 S.aureus RN4220 로부터 얻어진, soluble PGN fraction (60 ㎍ 건조중량, lane1), aqueous phase (lane2) 그리고 10-배로 농축된 TX-114 detergent phase (lane3)를 SDS-PAGE로 분석하였고 Coomassie Brilliant Blue로 염색하였다.
하기 도1I에서 나타난 바와 같이, TLR2 자극활성을 나타내는 TX-114 phase 단편을 SDS-PAGE로 분리하여 한 개의 33 kDa 단백질 밴드를 얻을 수 있었다(lane3). 하기 도1I에서의 화살포 머리와 화살표는 단백질 A 및 33 kDa 단백질을 각각 나타낸 것이다.
실험예2: S.aureus SitC 단백질의 동정.
실시예3에 따라서, SDS-PAGE겔로부터의 TX-114 phase partitioning과 전기용출(electro-elution)를 사용함으로써, insoluble PGN의 100mg건조중량 샘플로부터 동질성을 지닌(homogeneous) 200㎍ 샘플의 33kDa 단백질을 얻을 수 있었다. 실시예5 및 6-1에 따라서, 정제된 33 kDa 단백질의 동정을 하기 위하여, 우리는 liquid chromatography-tandem mass spectrometry (LC-MS/MS)를 실행할 뿐만 아니라, gas-phase 자동 아미노산 서열기를 사용하여 내부 아미노산 서열을 결정하였다. N-말단 펩티드 구조는 Flight Mass Spectrometry의 Matrix Assisted Laser Desorption/Ionization Time에 의해 결정하였다. 하기 도2에서 박스는 신호 펩티드(signal peptide)를 나타낸것이고 별표는 지질 결합 시스테인을 나타낸 것이고, 밑줄친 부분은 에드만분해서열(Edman-degradation sequencing)에 의해 결정된 아미노산 서열을 나타낸 것이고, 점선으로 윗줄친 부분은 LC-MS/MS에 의해 결정된 아미노산서열을 나타낸 것이고, 이중으로 밑줄친 부분은 MALDI TOFMS에 의해 결정된 아미노산을 나타낸 것이다.
하기 도2에서 나타난 바와 같이, 상기 33kDa 단백질은 sitC 유전자에 의해 암호화된 것임을 확인할 수 있었다. lysylendopeptidase에 의해 얻어진 내부 펩티드 절편의 아미노산 서열은 정확히 S.aureus SitC 단백질 서열로 알려진 것과 일치하였다. 또한, SitC의 N-acylated된 방식처럼, 정제된 33kDa 단백질의 N-말단 아미노산 서열은 에드만 분해 시퀀싱이 진행되는 동안 블럭(blocked)되어 있었음을 확인하였다.
실험예3 : sitC 단백질 구조의 동정
실험예3-1 : sitC 단백질의 MALDI TOFMS 분석
SDS-PAGE 겔 슬라이스에서 lysylendopeptidase분해에 의해 얻어진 S.aureus RN4220 세포로부터 SitC 단백질 절편을 실시예6-1에 따라 MALDI-TOF MS를 이용하여 측정하였다.
도3에 나타난 바와 같이, SitC 의 N-acylated-S-(diacyl-propyl)-cysteinyl 펩티드의 이론적 m/z에 상응하는 일런의 8개의 피크를 지닌 14개의 크기차를 보여주었다. 피크1의 얻어진 m/z는 tripalmitic acid (Pam3)-modifiedN-acyl-S-(diacyl-propyl)-cysteinyl- peptide의 이론적인 m/z에 상응하며, 피크 2 내지 8의 얻어진 m/z는 그들의 지방산에 증가하는 수의 메틸렌(CH2) 그룹을 지닌 Pam3-N-terminal 펩타이드의 이론적인 m/z에 상응한 것이다. 즉, SitC가 트리아실화된 리포단백질이고 불용성의 PGN으로부터 얻어진 것임을 확인할 수 있었다. 상기 SitC는 S.aureus에서의 주요 리포단백질의 하나로서, 아연 조절된 ATP 결합 무리 트렌스포터 기질 결합 단백질 (iron-regulated ATP binding cluster (ABC) transporter substrate-binding protein )이라고 알려져 있다 (참조; Cockayne, A., Hill, P. J., Powell, N. B., Bishop, K., Sims, C., and Williams, P. (1998) InfectImmun 66,3767-3774 ; Lee, S. J., Bohm, A., Krug, M., and Boos, W. (2007) TrendsMicrobiol 15,389-397).
실험예 3-2 : SitC의 트리아실화
1) S. aureus RN4220 로부터의 SitC 의 N-말단 구조
SitC의 N-말단 펩티드를 얻기 위해, SDS-PAGE에 의해 분리된 SitC 밴드를 실시예6-2에 따라 in-gel digestion에 적용한 후, 클로로포름/메탄올 추출(chloroform/methanol extraction)을 한 후, MALDI-TOF MS 분석과 LC-MS/MS 분석을 하였다. 이때, 도4A는 SitC의 in-gel tryptic digest의 유기상(organic phase)(도4A)의 MALDI-TOF MS spectra를 분석한 것이며, 도4B 및 도4C는 변형된 지방산을 특정화하기 위해, 리포펩티드를 (디)아실그리세리드 부분으로부터 에스테르화된 지방산의 가수분해를 촉매하는 LPL로 처리한 것으로, 5시간 배양한 LPL digests(도4B)과 17시간 배양한 LPL digests(도4C)의 MALDI-TOF MS spectra를 분석한 것이다. 또한, 도5와 도6는 LPL 저항성 지방산의 변형 위치를 결정하기 위해, octadecanoylglyceryl-cysteinyl-GTGGK에 상응하는 m/z 862.5에서의 피크를 MALDI-MS/MS로 분석한 것이다.
표 2 Theoretical and observed masses of the lipid-modified N-terminal peptides of SitC and those generated by LPL digestion
Modified peptide Theoretical [M+H]+ Observed m/z D (ppm)
triacyl(C47)+CGTGGK 1296.944 1296.953 6.4
triacyl(C48) 1310.96 1310.935 -19.4
triacyl(C49) 1324.976 1324.947 -21.9
triacyl(C50) 1338.992 1338.983 -6.5
triacyl(C51) 1353.007 1352.993 -10.6
triacyl(C52) 1367.023 1367.006 -12.4
triacyl(C53) 1381.039 1381.024 -10.6
triacyl(C54) 1395.054 1395.048 -4.5
triacyl(C55) 1409.07 1409.053 -12
diacyl(C30)+CGTGGK 1044.699 1044.706a 6.3
diacyl(C31) 1058.715 1058.699a -15.2
diacyl(C32) 1072.731 1072.744a 12.4
diacyl(C33) 1086.746 1086.746a -0.3
diacyl(C34) 1100.762 1100.775a 11.8
diacyl(C35) 1114.778 1114.775a -2.4
monoacyl(C16)+CGTGGK 834.501 834.477b -28.04
monoacyl(C17) 848.517 848.508b -10.3
monoacyl(C18) 862.532 862.522b -12
monoacyl(C19) 876.548 876.518b -34.2
monoacyl(C20) 890.563 890.567b 3.8
LPL digestion for a5h andb17h.
하기 도4A, 4B 및 4C를 나타내는 각각의 피크는 triacylated, diacylated, 및 monoacylated CGTGGK에 상응하는 mass signals이다. 도4A 및 표2에는 SitC의 in-gel tryptic digest의 유기상(organic phase)(A)의 MALDI-TOF MS spectra를 나타내었다. m/z 1296 와 1410간의 일련의 14-Da interval peaks가 검출 되어지는데, 이러한 피크는 시스테인의 sulfydryl 그룹과 탈수 (dehydration) 된 세 개의 지방산과의 티오에테르 결합을 통해 글리세리드로 수식된 N-말단의 CGTGGK 펩티드 분자이온에 상응한다.
도4B는 LPL로 다섯시간 분해 후, m/z 1044 와 1115간의 일련의 서로다른 14 Da interval peak들이 새로이 검출되었으며, 이러한 이온의 매스 값(mass values)은 (원래의) 트리아실화된 펩티드로부터의 에스테르화된 지방산의 방출에 의해 생성된 diacylglyceryl-cysteinyl-GTGGK (표 2)의 매스 값(mass values)과 상응한다.
도4C에서는 17시간 배양후에 m/z 834와 891간의 다른 일련의 피크가 검출되었다. 이들 이온의 매스값(mass values)은 트리아실화된 펩티드로부터의 두 개의 에스테르화된 지방산의 방출에 의해 생성된 monoacylglyceryl-cysteinyl-GTGGK의 매스값과 상응한다. 더욱 배양하여도, 부가적인 피크가 검출되지 않았다. 이러한 트리아실화된 펩티드는 두 개의 에스테르화된 지방산과 하나의 LPL 저항성 지방산에 의해 변형되어진 것이다.
하기 도5는 octadecanoylglyceryl-cysteinyl-GTGGK에 상응하는 m/z 862.5에서의 피크의 MALDI-MS/MS spectrum을 나타낸 것이고, 도6는 도5에서 관찰된 절편 이온의 배치는 N-octadecanoly-S-glyceryl-cysteinyl-GTGGK의 분명한 구조를 나타낸 것이다. MS/MS 스펙트럼 에서 m/z 419.3 (y5), 401.3 (y5-H2O), 362.2 (y4) 및 261.2 (y3)상의 y-series 이온은 GTGGK의 아미노산 서열을 확인해 주었는데, 이러한 변형은 N-말단 시스테인 잔기를 나타낸다. m/z 444.1, 584.1, 641.2, 및 698.3에서의 이온들은 b-series 이온들 (각각 b1, b3-H2O, b4-H2O, 및 b5-H2O)임이 지정될 수 있다. 더욱이, 티오글리세롤(thioglycerol)의 neutral loss에 의해 생성된 S-glyceryl-cysteinyl 펩티드에 대한 특성화된 조각 이온은 m/z 754.4에서 관찰되어질 수 있는데, 이는 octadecanoyl 그룹이 아미드 결합(amide bond)에 의해 시스테인의 a-아미노 그룹에 연결되어 있다는 것을 나타낸다.
요약하면, N-말단 펩티드의 LPL digestion과 MS/MS 분석 모두의 결과는, N-아실화를 통해 SitC 의 N-말단 시스테인이 포화된 C15에서 C20의 지방산으로 수식되어져 있을 뿐만 아니라, 두 개의 포화된 지방산으로 S-diacylglycerylation 되어있음을 입증하였다.
2) S. aureus 의 세포 추출물로부터의 SitC의 트리아실화된 펩티드 검출
트리아실화된 형태가 이 세포에서 주요 분자적 species인지를 알아내기 위하여 세포용해물로부터 sitC의 트리아실화된 리포펩티드를 검출하기 위해 조사하였다. S. aureus RN4220의 세포추출물과 TX-114 partitioning fraction을 SDS-PAGE에 적용하였고 단밸질을 CBB R250 로 염색하였다. 실시예6-2에 따라 33-kDa에 상응하는 밴드가 겔로부터 분리되어 in-gel-digested 되었고 그 결과 얻어진 펩티드는 LC-MS/MS에 의해 분석되었다.
도7에서 나타난 33-kDa에 해당하는 밴드의 분석결과, 이러한 밴드의 주요 성분으로서 SitC가 동정되었다. 하기 화살표는 SitC와 SAOUHSC_02699를 나타낸 것이다. 도8에 나타난바와 같이, 이는 SitC의 N-말단에서의 트리아실화가 S. aureus RN4220균주에서의 주요 형태이며, 이러한 SitC의 트리아실화된 리포펩티드가 검출되는 반면, 디아실화된 펩티드는 검출되지 않았다. 세포내의 대부분의 리포단백질은 다양한 지방산으로 트리아실화됨을 확인할 수 있었다.
3 ) S. aureus의 다른 균주에서의 SitC의 N 말단 구조의 특정
SA113, MRSA MW2, 및 MSSA 4776에서의 SitC의 N-말단 구조를 분석하였고, 실시예 6-2에 따라 이들 균주로부터 in-gel digested SitC의 유기상(organic phase)이 MALDI-TOF MS에 의해 분석되었다. 도면에서 별표는 포화된 지방산으로 변형된 트리아실화된 리보펩티드의 계산된 분자 매스값(mass values)보다 2 Da만큼 더 작은 피크를 나타낸 것이다.
표 3 Calculated and observed masses of triacylated N-terminal lipopeptide of SitC in S.aureus SA113strain.
Modified peptide Theoretical [M+H]+ Observed m/z D (ppm)
C46+CGTGGK 1282.93 1282.91 -15.6
C47 1296.94 1296.98 30.8
C48 1310.96 1310.99 22.9
C49 1324.98 1325.02 30.2
C50 1338.99 1339.03 29.9
C51 1353.01 1353.05 29.6
C52 1367.02 1367.05 21.9
C53 1381.04 1381.11 50.7
하기 도9와 상기 표3에서 나타난 바와 같이, SA113균주에서 검출된 m/z 1283 과 1381 사이의 일련의 14-Da interval 피크는 트리아실화된 N-말단 펩티드에 상응하는 것이다. SA113의 리포펩티드의 mass 범위는 RN4220의 것보다 작으며, 이는 RN4220보다 SA113 에서의 SitC의 N-말단에 더 짧은 지방산이 부착되어진다는 것을 나타낸다(도4A 및 도9). 게다가, 포화된 지방산에 의해 변형된 트리아실화된 리포펩티드의 계산된 매스값(mass values)보다 2-Da만큼 더 작은 피크는 SA113에서 관찰되어지는 반면, 매스값(mass values)에서 덜 강화된 신호가 RN4220 균주에서 관찰되었다. 이러한 피크는 불포화 지방산으로 변형된 트리아실화된 지방산의 것일 수 있으며 BHI broth로 배양된 RN4220 균주의 경우에 또한 관찰 되어진다. 다른 한편, MRSA MW2 및 MSSA 4776의 지방산의 구성성분들은 RN4220의 것과 유사하다. 비록 지방산의 길이 및/또는 구조가 균주나 아마 막지질의 성분변화로 인한 배양상태에 따라 다양하더라도, 트리아실화된 리포펩티드는 모든 균주에서 검출되어짐을 확인할 수 있었다.
실험예 4: S. aureus의 다른 리포단백질의 특정
S. aureus RN4220의 세포용해물을 사용한 TX114 phase 로부터 얻어진 리포단백질을 조사하였다. 실시예 6-2에 따라 SDS-PAGE에 의해 분리된 단백질을 LC-MS/MS로 분석하였고, 클로로포름/메탄올(chloroform/methanol)에 의한 digest로부터 추출된 리포펩티드는 MALDI-TOF MS에 의해 분석되었다.
표 4 Calculated and observed masses of the triacylated N-terminal lpeptides of SAOUHSC_02699, SAOUHSC_00844, SAOUHSC_02549, SAOUHSC_02650, and SAOUHSC_00808 in S.aureusRN4220.
Modified peptide Theoretical [M+H]+ Observed m/z D (ppm)
C47+CGNNSSKa 1366.96 1366.95 -8.4
C48 1380.98 1380.98 2.1
C49 1394.99 1394.95 -30.6
C50 1409.01 1408.98 -20.1
C51 1423.02 1422.95 -51.9
C52 1437.04 1436.96 -55.3
C53 1451.06 1450.98 -51.7
C54 1465.07 1464.97 -68.7
C55 1479.09 1478.97 -78.6
C47+CGNGNKb 1366.96 1366.95 -8.4
C48 1380.98 1380.98 2.1
C49 1394.99 1394.95 -30.6
C50 1409.01 1408.98 -20.1
C51 1423.02 1422.95 -51.9
C52 1437.04 1436.96 -55.3
C53 1451.06 1450.98 -51.7
C54 1465.07 1464.97 -68.7
C55 1479.09 1478.97 -78.6
C49+CSNSNDNNESKc 2014.2 2014.15 -25.5
C50 2028.22 2028.16 -28
C51 2042.23 2042.22 -6.1
C52 2056.25 2056.24 -3.9
C53 2070.26 2070.24 -11.4
C54 2084.28 2084.27 -4.5
C55 2098.29 2098.26 -16.6
C45+CGQDSDQQKd 1755.08 1755.11 16.6
C46 1769.1 1769.14 20.8
C47 1783.12 1783.13 8.5
C48 1797.13 1797.16 13.3
C49 1811.15 1811.15 0.5
C50 1825.16 1825.19 12.6
C51 1839.18 1839.17 -3.9
C52 1853.19 1853.18 -5.1
C44+CGHHQDSAKe 1715.08 1715.01 -42.8
C45 1729.1 1729.04 -33.9
C46 1743.11 1743.11 -1.4
C47 1757.13 1757.16 17.2
C48 1771.14 1771.14 1.3
C49 1785.16 1785.15 -5.6
C50 1799.17 1799.17 -1.2
C51 1813.19 1813.17 -11.7
C52 1827.2 1827.17 -19.1
aSAOUHSC_02699, bSAOUHSC_00844,cSAOUHSC_02549,dSAOUHSC_02650,eSAOUHSC_00808
상기 표4에서 나타난 바와 같이, SitC뿐만 아니라 다섯가지 리포단백질인 SAOUHSC_02699, SAOUHSC_00844 (YP_499398), SAOUHSC_02650 (YP_501112), SAOUHSC_02549 (hypothetical molybdate-binding ABC-transporter, YP_501011) 그리고 SAOUHSC_00808 (YP_499364) 이 동정되어졌다. 이러한 펩티드들의 특정 피크는 m/z 14의 거리(interval)에서 발견되어지는데, 이는 이러한 리포펩티드들이 또한 다양한 길이의 지방산으로 변형되어짐을 나타낸다. 이러한 피크의 관찰된 매스값(mass values)은 각각 리포단백질의 트리아실화된 N-말단 펩티드의 계산된 분자적 매스값(mass values)에 상응하였다. 이러한 결과는 S. aureus RN4220의 리포단백질의 N-말단이 일반적으로 트리아실화된 것을 제시하였다.
종래에는 Tawaratsumida등은 SA113 균주에서 SAOUHSC_02699의 N-말단 구조는 디아실화된 것으로 보고하였다. 그러나 도 10와 도 11에서 나타난 바와 같이, 1470 와 1567 사이의 m/z14의 interval에서 특이적 피크가 검출된 반면, 종래에 보고 되었던 구조(S-dipalmytoylglyceryl-cysteinyl-GNNSSK)에 상응하는 m/z 1259.9에서의 중요한 신호(significant signal)가 이 digest 및 digest의 유기상(organic phase)에서 관찰되지 않았다. SAOUHSC_02699의 N-말단 구조에 대한 이러한 차이점은 지질-변형된 펩티드의 준비와 분석 방법이 다르기 때문에 생기는 것이다. Tawaratsumida 등이 행한 공정의 전체 수율은 l-배양(l-culture)당 각 1.6 마이크로그람의 리포단백질로 우리의 것보다 백배이상 낮다. 이러한 수율에서의 차이에 의해, 우리는 S. aureusis 에서의 리포단백질의 주요형태가 트리아실화되었다고 결론할 수 있었다.
실험예 5 : S. aureus SitC 단백질의 TLR2의 천연 리간드로서 기능.
실시예3에 따라, 정제된 S. aureus SitC 단백질의 2 ng/ml 또는 20ng/ml의 존재 또는 부재하(회색지역을 지닌 검은선)에 CHO/hCD14/hTLR2 cells (도12A) 또는 CHO/hCD14/hTLR4(도12B)을 자극하였다. NF-κB-driven hCD25의 표면 발현은 flow cytometry에 의해 분석되어진다.
도12A와 도12B에서 나타난 바와 같이, 정제된 SitC 단백질은 20 ng/ml (0.6 nM)의 농도에 TLR2를 자극할 수 있었으나, TLR4를 자극하지는 못하였다. 이러한 농도는 쥐의 대식세포에서 사이토카인(cytokines)생산을 유도할 수 있는 LPS 의 농도와 상응하는 것이다. 상기의 실험예에서 나타난 바와 같이, Achromobacter β-lytic protease를 처리함으로 불용성 S.aureus PGN로부터 방출된 triacylated SitC 단백질이 TLR2의 천연 리간드로서 기능한다는 것을 확인할 수 있었다.
실험예6 : 정제된 sitC와 sitC 돌연변이체 박테리아에 의한 TLR2 자극.
실험예6-1
모계 C57BL/6 (bar1), TLR1-/-(bar2), TLR2-/-(bar3), TLR6-/-(bar4),및 MyD88-/-(bar5)로부터 제조된 복막의 대식세포(1 x 105cells)를 1 ㎍/ml LPS, 10 ng/ml 합성Pam3CSK4, 100ng/ml MALP-2, 또는 100ng/ml 또는 1㎍/ml의 정제된 SitC단백질로 24시간동안 자극하였다. 배양 상층액상의 TNF-a (도13A) 및 IL-6(도13B)의 농도는 ELISA를 사용하여 측정하였고, 이의 데이터는 적어도 2개의 독립적인 쥐를 사용하여 평균 + SD 로 나타내었다. N.D.는 검출되지 않은 것을 의미한다.
하기 도13A와 도13B에서 나타난 바와 같이, SitC 단백질이 100 ng/ml (3 nM)의 농도에서 야생형 쥐의 대식세포로부터 종양괴사인자 (tumor necrosis factor, TNF)-a 와 인터루킨 (interleukin, IL)-6 방출을 유도한다는 것을 확인할 수 있었다. 또한 SitC는 TLR2-/- 및 MyD88-/- 인 쥐의 대식세포로부터의 TNF-a 및 IL-6의 방출을 유도하지 않았다. 기대와 다르게, TLR1-/- 및 TLR6-/- 인 쥐의 대식세포에서 사이토카인의 생산이 유도되었다는 것은, 비록 TLR1-/- 및 TLR6-/-가 이 과정에서 필수적이진 않더라도, TLR2가 SitC-매개된 사이토카인 생산(SitC-mediated cytokine production)에 필수적이라는 것을 제시하였다.
실험예6-2
Luria-Bertani 배지와 tryptic soy broth에서 생존가능한 S.aureus △sitC결핍 돌연변이체 (sitC)를 생산하였다. solublized PGN의 aqueous phase(lanes1 및 3) 및 TX-114-detergent phase(lanes2 및 4)를 SDS-PAGE 분석을 시행하였다.
도 13C에서의 lanes1 및 2는 empty plasmid pKE515를 지닌 S. aureus △sitC 돌연변이체로부터 얻어진 절편을 분석한 것이고, lanes3 및 4는 sitC gene을 함유하는 플라스미드, pSsitC를 지닌 sitC 돌연변이체로부터 얻어진 절편을 분석한 것이다. 즉, SitC 33kDa 단백질 밴드가 △sitC 돌연변이에서 검출되지 않았고 sitC 유전자를 지닌 플라스미드를 △sitC 에 집어넣음으로 33kDa 단백질 밴드가 다시 나타남을 확인할 수 있었는데(도 13C의 lanes2 및 4), 이는 PGN내의 33kDa 단백질이 진실한 SitC 단백질임을 확인할 수 있었다.
실험예7 : TLR2를 활성화 시키는 그람양성균으로부터의 ABC transporter substrate-binding lipoproteins
실험예7-1
S. aureus SitC (laneSitC), B.subtilisYfmC(lane1), 및 M.luteusGluB(lane2)의 정제된 리포단백질에 대한 SDS-PAGE 분석을 하였다.
하기 도14A에서 나타난 바와 같이, Bacillus substilis (33kDa) 및 Micrococcus luteus (37kDa) 각각으로 부터 두가지 다른 TX-114-농화배양된 단백질을 정제하였다 (도14A의 lanes 1 및 2).
실험예7-2
2ng/ml 또는 20ng/ml의 B.subtilis YfmC 리포단백질(14B와 14C) 또는 2ng/ml 또는 20ng/ml의 M.luteus GluB 리포단백질(14D와 14E)의 존재 또는 부재(회색지역을 지닌 검은선)하에 CHO/hCD14/hTLR2(14B와 14D) 또는 CHO/hCD14/hTLR4 (14C와 14E)세포들을 자극하여, 상기 두 정제된 단백질의 TLR2이 발현된 CHO 세포에서의 TLR2 자극능력 및 TLR4이 발현된 CHO 세포에서의 TLR4 자극능력을 조사하였다. 이 실험은 실험예1에 따라 수행된 것으로, 적어도 2회 이상의 독립된 실험의 대표값으로 데이터를 표기하였다.
하기 도 14B와 14D에서와 같이 상기 두가지 단백질이 20 ng/ml농도에서 TLR2가 발현된 CHO세포에서 TLR2 자극활성을 지님을 확인할 수 있었고, 도 14C와 도14D에서와 같이 TLR4 자극활성이 없음을 확인할 수 있었다.
실험예8: Bacillus substilis 및 Micrococcus luteus로부터 동정된, TLR2를 활성화 시키는 리포단백질
Bacillus substilis 및 Micrococcus luteus을 트립신으로 처리하여 얻어진 절편을 LC-MS/MS로 분석하였다.
도 15에서 나타난 바와 같이 트립신 처리에 의해 얻어진 절편의 LC-MS/MS 분석결과, 33 kDa 및 37 kDa 단백질(B.substilis 및 M.luteus 각각에서 NP_388633 및 ZP_02945718)이 tentative ABC transporter substrate-binding lipoproteins로서 기능할 수 있음을 나타내었다. B.subtilis 리포단백질(33kDa)은 theyfmC 유전자에 의해 암호화되는 것으로 19 아미노산 위치에 추정상의(putative) 지질 결합 시스테인을 지닌 315 아미노산 전구체를 생산하는데, 이러한 전구체는 ABC transporter.의 페리크롬(ferrichrome)결합 단백질과 유사하다. 도15에서 하기 box는 신호펩티드(signal peptide)를, 별표는 지질 결합 시스테인( lipid binding cysteine)을, 밑줄친 부분은 트립신처리된 절편을 LC-MS/MS 분석하여 결정된 아미노산을 나타낸 것이다. 이때, M.luteus 단백질(37kDa)은 22 아미노산 위치에 추정상의(putative) 지질 결합 시스테인을 지닌 297 아미노산 전구체를 생산하는 유전자에 의해 암호화되어지는데, 이는 ABC transporter 시스템에서 글루탐메이트 결합단백질(GluB)과 유사하다. 이러한 결과를 통해 그람양성균으로부터의 ABC transporter 기질 결합 리포단백질이 TLR2의 천연 리간드라는 것을 명확히 확인할 수 있었다.
그람양성균 유래의 Toll 유사 수용체2의 리간드로서 기능하는 본 발명의 그람양성균 유래의 리포단백질을 그람양성균으로 야기되는 질병의 예방 또는 치료하는 데 있어 좋은 면역원 또는 면역자극제로 활용할 수 있으며, 또한 그람양성균을 진단하는데 있어 진단용 항원으로 활용할 수 있을 것이므로, 본 발명의 산업적 활용가치는 클 것이다.

Claims (16)

  1. 톨 유사 수용체2 (toll-like receptor2)에 리간드로서 기능하는 것을 특징으로 하는 그람양성균 (Gram-positive bacteria) 유래의 리포단백질 (lipoprotein).
  2. 제1항에 있어서,
    상기 리포 단백질은 ATP 결합 무리(ABC)트랜스포터 기질 결합 단백질(ATP binding cluster(ABC) transporter substrate-binding proteins)군에 속하는 것을 특징으로 하는 리포단백질.
  3. 제2항에 있어서,
    N-말단 리포박스 (N-terminal lipobox)인 특정 아미노산서열을 가지고 그 말단에 지질 (lipid)이 결합하는 시스테인 잔기 (cysteine residue)가 존재하는 것을 특징으로 하는 리포단백질.
  4. 제2항에 있어서,
    상기 리포단백질은 바실러스 서브틸리스 (Bacillus substilis) YfmC (NP_388633)로 암호화되는 것을 특징으로 하는 리포단백질.
  5. 제2항에 있어서,
    상기 리포단백질은 마이크로코커스 루터스 (Micrococcus luteus) GluE (ZP_02945718)로 암호화되는 것을 특징으로 하는 리포단백질.
  6. 제1항에 있어서,
    트리아실화된 (triacylated) N-말단을 지닌 것을 특징으로 하는 리포단백질.
  7. 제6항에 있어서,
    상기 리포단백질은 스타필로코커스 아우레우스 (Staphylococcus aureus)로부터 유래된 것을 특징으로 하는 리포단백질.
  8. 제7항에 있어서,
    상기 리포단백질은 N-말단 시스테인 잔기에 포화된 C5 내지 C50의 지방산이 수식되어져 있는 것을 특징으로 하는 리포단백질.
  9. 제7항에 있어서,
    스타필로코커스 아우레우스 (Staphylococcus aureus) RN4220, 스타필로코커스 아우레우스 (Staphylococcus aureus) SA113, 스타필로코커스 아우레우스 (Staphylococcus aureus) MW2, 또는 스타필로코커스 아우레우스 (Staphylococcus aureus) MSSA4776로부터 유래된 것을 특징으로 하는 리포단백질.
  10. 제7항에 있어서,
    SitC (YP_499195), SAOUHSC_02699 (YP_501161), SAOUHSC_00844 (YP_499398), SAOUHSC_02650 (YP_501112), SAOUHSC_02549 (hypothetical molybdate-binding ABC-transporter, YP_501011) 또는 SAOUHSC_00808 (YP_499364) 인 것을 특징으로 하는 리포단백질.
  11. 제1항 내지 제10항 중 어느 한 항에 따른 리포단백질을 유효성분으로 하는 그람양성균 예방 또는 치료용 면역원성 조성물.
  12. 제11항에 있어서.
    상기 그람양성균은 스타필로코커스 아우레우스(Staphylococcus aureus)인 것을 특징으로 하는 면역원성 조성물.
  13. 제1항 내지 제10항 중 어느 한 항에 따른 리포단백질을 유효성분으로 하는 그람양성균 예방 또는 치료용 면역자극제.
  14. 제13항에 있어서.
    상기 그람양성균은 스타필로코커스 아우레우스(Staphylococcus aureus)인 것을 특징으로 하는 면역자극제.
  15. 제1항 내지 제10항 중 어느 한 항에 따른 리포단백질을 진단용 항원으로 하는 것을 특징으로 하는 그람양성균 진단용 키트.
  16. 제15항에 있어서,
    상기 그람양성균은 바실러스 서브틸리스(Bacillus substilis), 마이크로코커스 루터스(Micrococcus luteus) 또는 스타필로코커스 아우레우스(Staphylococcus aureus)인 것을 특징으로 하는 진단용 키트.
PCT/KR2010/000164 2009-01-09 2010-01-11 Ｔｏｌｌ 유사수용체２ 리간드로서 기능하는 그람양성균 유래의 리포단백질 WO2010080007A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US14346709P 2009-01-09 2009-01-09
US61/143,467 2009-01-09

Publications (2)

Publication Number Publication Date
WO2010080007A2 true WO2010080007A2 (ko) 2010-07-15
WO2010080007A3 WO2010080007A3 (ko) 2010-11-25

Family

ID=42317019

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2010/000164 WO2010080007A2 (ko) 2009-01-09 2010-01-11 Ｔｏｌｌ 유사수용체２ 리간드로서 기능하는 그람양성균 유래의 리포단백질

Country Status (1)

Country Link
WO (1) WO2010080007A2 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107149671A (zh) * 2016-03-03 2017-09-12 郭文江 一种药物组合物及其应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002085933A1 (en) * 2001-04-20 2002-10-31 The Institute For Systems Biology Toll-like receptor 5 ligands and methods of use
KR20030097854A (ko) * 2001-05-15 2003-12-31 저팬 이뮤너리서치 래버래터리스 컴퍼니 리미티드 고밀도 리포단백질 반응성 펩티드

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002085933A1 (en) * 2001-04-20 2002-10-31 The Institute For Systems Biology Toll-like receptor 5 ligands and methods of use
KR20030097854A (ko) * 2001-05-15 2003-12-31 저팬 이뮤너리서치 래버래터리스 컴퍼니 리미티드 고밀도 리포단백질 반응성 펩티드

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HASHIMOTO ET AL. INT. IMMUNOLOGY vol. 18, no. 2, 22 December 2005, pages 355 - 362 *
HASHIMOTO ET AL. J. IMMUNOLOGY vol. 177, 27 February 2006, pages 3162 - 3169 *
HENNEKE ET AL. J. IMMUNOLOGY vol. 180, 13 February 2008, pages 6149 - 6158 *
STOLL ET AL. INFECTION AND IMMUNITY vol. 73, no. 4, 30 April 2005, pages 2411 - 2433 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107149671A (zh) * 2016-03-03 2017-09-12 郭文江 一种药物组合物及其应用

Also Published As

Publication number Publication date
WO2010080007A3 (ko) 2010-11-25

Similar Documents

Publication Publication Date Title
US7598354B2 (en) Campylobacter glycans and glycopeptides
WO2011025286A2 (ko) 리포테이코익산 유래 당지질 및 이를 포함하는 조성물
WO2016195159A1 (ko) 신규한 tlr4 길항제
HU226869B1 (en) Immunological adjuvant compound and composition containing thereof
KR20110041479A (ko) 면역애쥬번트인 플라겔린 기반의 화합물 및 이의 용도
Hutton et al. A Helicobacter pylori homolog of eukaryotic flotillin is involved in cholesterol accumulation, epithelial cell responses and host colonization
WO2020059895A1 (ko) 스팅 작용자를 포함하는 면역항원보강제 및 백신 조성물
US20180214533A1 (en) Novel targets of acinetobacter baumannii
WO2018080253A1 (ko) 면역반응 조절물질 및 양이온성 리포좀을 포함하는 면역증강용 조성물 및 이의 용도
WO2018080252A1 (ko) 면역반응 조절물질 및 이를 포함하는 백신 조성물
EP2575877B1 (en) Novel immunoadjuvant compounds and uses thereof
Ziaco et al. Development of clickable monophosphoryl lipid A derivatives toward semisynthetic conjugates with tumor-associated carbohydrate antigens
WO2018030878A1 (ko) 재조합 단백질을 포함하는 돼지 마이코플라즈마 감염 예방용 백신 조성물
Felgner et al. The immunogenic potential of bacterial flagella for Salmonella‐mediated tumor therapy
WO2010080007A2 (ko) Ｔｏｌｌ 유사수용체２ 리간드로서 기능하는 그람양성균 유래의 리포단백질
US6368599B1 (en) Caulobacter LPS immunoadjuvants
US9221898B2 (en) N-linked glycan compounds
KR20010088302A (ko) 헬리코박터 감염에 대한 비경구 면역화 방법에 있어서의ｌｔ 및 ｃｔ
WO2017116005A1 (ko) 세포밖 소포 생성 및 숙주 면역반응을 조절하는 small rna 유전자 및 이의 용도
WO2019194393A1 (ko) 페리틴 자가조립체에 항원 펩타이드 및 면역 증강제가 결합된 나노 입자 및 이의 용도
WO2020263011A1 (ko) 미세아교세포 마커로서의 후각수용체 및 그의 용도
Xu et al. Development of antibacterial drugs by targeting toll-like receptors
WO2022035248A1 (ko) 코리스미산 이성화효소를 포함하는 결핵 예방용 백신 조성물
Ciszek-Lenda et al. Immunosuppressive effect of systemic administration of Lactobacillus rhamnosus KL37C-derived exopolysaccharide on the OVA-specific humoral response
US20140314813A1 (en) Clostridium difficile lipoteichoic acid and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10729349

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10729349

Country of ref document: EP

Kind code of ref document: A2