WO2010059981A2 - Banque de présentation mammalienne de haute complexité et procédés de criblage - Google Patents

Banque de présentation mammalienne de haute complexité et procédés de criblage Download PDF

Info

Publication number
WO2010059981A2
WO2010059981A2 PCT/US2009/065393 US2009065393W WO2010059981A2 WO 2010059981 A2 WO2010059981 A2 WO 2010059981A2 US 2009065393 W US2009065393 W US 2009065393W WO 2010059981 A2 WO2010059981 A2 WO 2010059981A2
Authority
WO
WIPO (PCT)
Prior art keywords
mammalian cells
polynucleotides
antibody
cells
library
Prior art date
Application number
PCT/US2009/065393
Other languages
English (en)
Other versions
WO2010059981A3 (fr
Inventor
Chen Zhou
Original Assignee
Dgen Biotech Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dgen Biotech Limited filed Critical Dgen Biotech Limited
Priority to CN2009801545883A priority Critical patent/CN102282266A/zh
Priority to US13/130,561 priority patent/US20120101000A1/en
Publication of WO2010059981A2 publication Critical patent/WO2010059981A2/fr
Publication of WO2010059981A3 publication Critical patent/WO2010059981A3/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6845—Methods of identifying protein-protein interactions in protein mixtures
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display

Definitions

  • This application pertains to the construction and screening of mammalian polypeptide display libraries, particularly mammalian display libraries of full length antibodies.
  • High throughput screening for antibodies that bind specifically to a target antigen was made possible by cell surface display technologies, including phage display, ribosomal/mRNA display, and yeast display. Hoogenboom et al., Nature Biotechnology (2005), 23(9): 1105- 1116). While each of these screening platforms has its specific advantages, they are all based on expression of antibodies in an environment that is different from that of mammalian cells. Protein folding, glycosylation, disulfide bond formation, and/or modification are likely different from proteins produced in those systems versus in mammalian cells.
  • WO05/063817 discloses a method of screening a small library of full length antibodies. After homologous integration of a single-gene copy in each cell, the population was sorted by flow cytometry to obtain cells expressing antibodies with high binding affinity. See also US2005/0059082 and WO08/070367. Most of the currently available mammalian display technologies are infeasible for screening a high complex library of polynucleotides encoding a large number of different antibodies.
  • the present invention provides methods of screening mammalian display libraries, including methods of screening for polynucleotides encoding a polypeptide having a desired property, methods of enriching polynucleotides encoding a polypeptide having a desired property, methods of isolating a mammalian cell containing a polynucleotide encoding a polypeptide having a desired property, methods of screening for mammalian cells containing a polynucleotide encoding a polypeptide having a desired property, methods of identifying a polypeptide having a desired property, and methods of obtaining a polypeptide having a desired property.
  • the method comprises: a) screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying a polypeptide having the desired property and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides; c) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying a polypeptide having the desired property and recovering a second subpopulation of mammalian cells.
  • steps b) and c) are repeated more than once.
  • the method comprises: a) reverse transcribing mRNA extracted from a subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides, wherein the subpopulation of cells is obtained by screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying a polypeptide having the desired property; b) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying a polypeptide having the desired property and recovering a second subpopulation of mammalian cells.
  • the method comprises screening a population of mammalian cells transfected with a sublibrary of polynucleotides for cells displaying a polypeptide having the desired property and recovering a subpopulation of mammalian cells, wherein the sublibrary is generated by reverse transcribing mRNA extracted from an intermediate population of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides, wherein the intermediate population of cells is obtained by screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying a polypeptide having the desired property.
  • the polypeptide is a heteromeric protein.
  • the polypeptide is an antibody.
  • a method of isolating a polynucleotide encoding a polypeptide having a desired property comprising: a) screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying a polypeptide having the desired property and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides; c) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying a polypeptide having the desired property and recovering a second subpopulation of mammalian cells; and d) isolating from said second subpopulation of mammalian cells a polyn
  • the polynucleotides in the primary library encode at least 10 9 (including for example about any of 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , and 10 16 ) different polypeptides.
  • the initial population of mammalian cells is transiently transfected with the primary library under a condition where an individual mammalian cell in the population can take up more than about 100, such as more than about any of 10 3 , 10 4 , 10 5 , or 10 6 copies of different polynucleotides.
  • the screening condition in step c) is more stringent than that of step a).
  • a method of isolating a polynucleotide that encode a heteromeric protein with a desired property comprising: a) screening an initial population of mammalian cells for cells displaying a heteromeric protein having a desired property and recovering a subpopulation of mammalian cells, wherein the initial population of mammalian cells are transfected (such as transiently transfected) with a primary library of polynucleotides encoding a first polypeptide and a second polypeptide and wherein the first polypeptide and the second polypeptide form a heteromeric protein on the cell surface; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides; c) screening a subsequent population of mammalian cells for cells displaying a heteromeric protein with a desired property and recovering a second subpopulation of mamm
  • a method of isolating a polynucleotide encoding an antibody specifically recognizing an antigen comprising: a) screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides encoding antibodies for cells displaying an antibody specifically recognizing the antigen and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides; c) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying an antibody specifically recognizing the antigen and recovering a second subpopulation of mammalian cells; and d) isolating from said second subpopulation of mammalian cells a polynucleotide encoding an antibody specifically recognizing
  • step a) comprises: (i) contacting the initial population of mammalian cells with the antigen under a suitable binding condition; and (ii) recovering a subpopulation of mammalian cells that bind to the antigen.
  • step c) comprises: (i) contacting the enriched mammalian display library with the antigen under a suitable binding condition; and (ii) recovering a subpopulation of mammalian cells that bind to the antigen.
  • step d) comprises: i) isolating mRNA from the subpopulation of cells, ii) amplifying the mRNA into cDNA; iii) cloning the cDNA into a cloning vector; and iv) determining the sequence of the DNA.
  • a method of isolating a polynucleotide encoding an antibody specifically recognizing a specific antigen comprising: a) screening an initial population of mammalian cells transiently transfected with a first primary library of polynucleotides encoding light chain and a second primary library encoding heavy chain and displaying antibodies encoded by the polynucleotides on the cell surface to obtain a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides; c) screening a population of mammalian cells transfected with the sublibrary of polynucleotides and displaying antibodies encoded by the polynucleotides on the cell surface to obtain a second subpopulation of mammalian cells; and d) isolating from said second subpopulation of
  • steps b) and c) are repeated at least once prior to step d). In some embodiments, steps b) and c) are repeated no more than about three times prior to step d). In some embodiments, the polynucleotides in the primary libraries encode at least 10 9 different antibodies. In some embodiments, step a) comprises: (i) contacting the initial population of mammalian cells with the antigen under a suitable binding condition; and (ii) recovering a subpopulation of mammalian cells that bind to the antigen.
  • step c) comprises: (i) contacting the enriched mammalian display library with the antigen under a suitable binding condition; and (ii) recovering a subpopulation of mammalian cells that bind to the antigen.
  • step d) comprises: i) isolating mRNA from the subpopulation of cells, ii) amplifying the mRNA into cDNA; iii) cloning the cDNA into a cloning vector; and iv) determining the sequence of the DNA.
  • the initial population of mammalian cells is transiently transfected with the primary libraries under a condition where individual mammalian cells in the population can take up more than about 100, such as more than about any of 10 3 , 10 4 , 10 5 , or 10 6 copies of different polynucleotides.
  • the method further comprises transiently transfecting the primary libraries of polynucleotides into the initial population of mammalian cells.
  • a method of isolating a polynucleotide that encodes an antibody specifically recognizing an antigen comprising: a) screening an initial population of mammalian cells transfected with a first primary library of polynucleotides encoding a light chain and second primary library of polynucleotides encoding a heavy chain for cells displaying an antibody specifically recognizing the antigen and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a first sublibrary of polynucleotides encoding the light chain and a second sublibrary of polynucleotides encoding the heavy chain; c) screening a population of mammalian cells transfected with the first sublibrary of polynucleotides and the second sublibrary of the polynucleotides for cells displaying an antibody specifically recognizing
  • libraries and kits for carrying out the methods described herein Further provided are sublibraries generated during the screening process and polynucleotides/polypeptides obtained from methods described herein.
  • Figure 1 provides a schematic diagram showing an exemplary method of screening as described herein.
  • FIG. 2 provides a schematic diagram showing an exemplary single cassette expression vector.
  • Enzymes 1-3 refer to restriction enzymes cleavage sites recognizable by a different restriction enzyme (such as restriction enzymes that recognize a non-palendromic sequence), wherein the ends of each fragment resulting from the cleavage with said restriction enzyme do not self-ligate.
  • FIG. 3 provides a schematic illustration of the procedure to construct the single cassette expression vector pDGB-HC-TM.
  • the HC-TM fragment was generated by
  • Figure 4 shows the results of restriction enzyme digestion of vector pDGBHC-
  • TM The vector was digested by 5 restriction enzymes in four ways and analyzed by electrophoresis in 1% agarose gel.
  • M 1 kb plus DNA ladder (Invitrogen); A: Nhel+Xhol; B:
  • Figure 5A provides a schematic illustration of the procedure to construct the dual cassette expression vector. Four fragments were PCR-amplified and ligated together by
  • Figure 5B shows the results of restriction enzyme digestion analysis of vector pDGB4.
  • Purified plasmid DNA of pDGB4 clone #16 was digested by 3 restriction enzymes in 5 ways and electrophoresis analyzed in 1% agarose-TBE gel.
  • M DNA ladder; 1: Sfil I; 2:
  • the present invention provides a high efficiency method of screening mammalian display library for polypeptides with a desired property.
  • the method is based on the fact that, although each mammalian cell transfected with foreign DNA plasmids can contain up to 10 6 copies of plasmids, only a small portion of (for example about 10 2 -10 3 copies of) plasmids are transcribed into mRNA and expressed into polypeptides. Accordingly, the mRNA from positive cells obtained from a mammalian display library screen would be significantly less complex (for example at least 1000 times less complex) than that of the DNA in those cells.
  • the method of the present invention takes advantage of this reduction in complexity.
  • mRNA from the enriched subpopulation of mammalian cells is isolated and amplified by methods such as RT-PCR (reverse transcriptase PCR) to create a pool of polynucleotides (a sublibrary).
  • RT-PCR reverse transcriptase PCR
  • This pool of polynucleotides is in turn introduced into mammalian cells and subject to another round of library screening.
  • the second round of screening process can be repeated, for example, once, twice, or more times.
  • the method described herein allows high efficiency screening of mammalian display library, making it possible to screen mammalian display libraries with a diversity of at least 10 9 .
  • the methods provided herein are particularly suitable for screening heteromeric proteins.
  • methods of screening antibodies are provided.
  • a primary library of antibody light chain and a primary library of antibody heavy chain are co-transfected into mammalian cells, allowing display of antibodies on the cell surface.
  • FIG. 1 further provides a schematic diagram showing an exemplary method of screening antibody display libraries.
  • the invention in one aspect provides a method of screening a mammalian display library or method of isolating a polynucleotide encoding a polypeptide (such as an antibody) with a desired property by way of mammalian display library screening.
  • polypeptides such as antibodies
  • a method of generating a library of polynucleotides for mammalian display screening wherein the polynucleotides collectively encode at least 10 9 different recombinant polypeptides (such as antibodies).
  • kits for carry out the methods described herein Also provided are polynucleotides isolated by methods described herein and polypeptides encoded by the polynucleotides.
  • Display or “mammalian display” refers to presentation of different recombinant polypeptides on the surface of mammalian host cells.
  • Library used herein refers to a diverse collection or mixture of polynucleotides comprising polynucleotides encoding different recombinant polypeptides.
  • a library of polynucleotides may comprise at least 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , or more different polynucleotides within a given collection of polynucleotides.
  • the different polynucleotides in the library are related through, for example, their origin from a single animal species (for example, human, mouse, rabbit, goat, horse), tissue type, organ, or cell type.
  • a "library” may comprise polynucleotides of a common genus.
  • the genus can be polynucleotides encoding an immunoglobulin subunit polypeptide of a certain type and class e.g., a library might encode an antibody ⁇ , ⁇ l, ⁇ 2, ⁇ 3, ⁇ 4, a 1, a2, e, or d heavy chain, or an antibody K or ⁇ light chain.
  • each member of any one library described herein may encode the same heavy or light chain constant region
  • the library may collectively comprise at least 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 different variable regions i.e., a "plurality" of variable regions associated with the common constant region.
  • Micromalian display library refers to a library comprising polynucleotides encoding different recombinant polypeptides that can be displayed on mammalian cells. In some contexts, the term is also used generally to include mammalian cells transfected with the library of polynucleotides.
  • “Screening” used herein refers to the method in which a pool comprising the desired species is subject to an assay in which the desired species can be detected, and subsequently an aliquot of the pool in which the desired species is detected and optionally enriched is recovered or obtained.
  • "Recovering” is used herein to mean a crude separation of a desired species from the rest of the pool which are not desired.
  • Stringency of a screening condition refers to the assay condition for the screening method.
  • stringency of the screening condition refers to the stringency of the condition for the binding assay.
  • a population of mammalian cells is meant a group of mammalian cells into which a library of polynucleotides can be introduced and displayed. Although it is preferred that a population of cells be a monoculture, i.e., wherein each cell in the population is of the same cell type, mixed cultures of cells are also contemplated. Cells may be adherent, i.e., cells which grow attached to a solid substrate, or, alternatively, the cells may be in suspension.
  • the mammalian cells may be cells derived from primary tumors, cells derived from metastatic tumors, primary cells, cells which have lost contact inhibition, transformed primary cells, immortalized primary cells, cells which may undergo apoptosis, and cell lines derived there from.
  • an “antibody” is an immunoglobulin molecule capable of specific binding to a target, such as a carbohydrate, polynucleotide, lipid, polypeptide, etc., through at least one antigen recognition site, located in the variable region of the immunoglobulin molecule.
  • the term encompasses not only intact polyclonal or monoclonal antibodies, but also fragments thereof (such as Fab, Fab', F(ab')2, Fv), single chain (ScFv), mutants thereof, naturally occurring variants, fusion proteins comprising an antibody portion with an antigen recognition site of the required specificity, humanized antibodies, chimeric antibodies, and any other modified configuration of the immunoglobulin molecule that comprises an antigen recognition site of the required specificity.
  • Humanized antibodies refer to a molecule having an antigen- binding site that is substantially derived from an immunoglobulin from a non-human species and the remaining immunoglobulin structure of the molecule based upon the structure and /or sequence of a human immunoglobulin.
  • the antigen-binding site may comprise either complete variable domains fused onto constant domains or only the complementarity determining regions (CDRs) grafted onto appropriate framework regions in the variable domains.
  • Antigen binding sites may be wild type or modified by one or more amino acid substitutions, e.g., modified to resemble human immunoglobulin more closely.
  • Some forms of humanized antibodies preserve all CDR sequences (for example, a humanized mouse antibody which contains all six CDRs from the mouse antibodies).
  • Other forms of humanized antibodies have one or more CDRs (one, two, three, four, five, six) which are altered with respect to the original antibody, which are also termed one or more CDRs "derived from" one or more CDRs.
  • Chimeric antibodies refers to those antibodies wherein one portion of each of the amino acid sequences of heavy and light chains is homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular class, while the remaining segment of the chains is homologous to corresponding sequences in another.
  • the variable region of both light and heavy chains mimics the variable regions of antibodies derived from one species of mammals, while the constant portions are homologous to the sequences in antibodies derived from another.
  • the variable regions can conveniently be derived from presently known sources using readily available hybridomas or B cells from non human host organisms in combination with constant regions derived from, for example, human cell preparations.
  • variable region has the advantage of ease of preparation, and the specificity is not affected by its source, the constant region being human, is less likely to elicit an immune response from a human subject when the antibodies are injected than would the constant region from a non-human source.
  • the definition is not limited to this particular example.
  • variable region of an antibody refers to the variable region of the antibody light chain or the variable region of the antibody heavy chain, either alone or in combination.
  • the variable regions of the heavy and light chain each consist of four framework regions (FR) connected by three complementarity determining regions (CDRs) also known as hypervariable regions.
  • the CDRs in each chain are held together in close proximity by the FRs and, with the CDRs from the other chain, contribute to the formation of the antigen- binding site of antibodies.
  • CDRs complementarity determining regions
  • a CDR may refer to CDRs defined by either approach or by a combination of both approaches.
  • a "constant region" of an antibody refers to the constant region of the antibody light chain or the constant region of the antibody heavy chain, either alone or in combination.
  • An antibody or a polypeptide "specifically binds” or “preferentially binds” to an antigen or a target if it binds with greater affinity, avidity, more readily, and/or with greater duration than it binds to other substances. It is understood by reading this definition that, for example, an antibody or a polypeptide that specifically or preferentially binds to a first target may or may not specifically or preferentially bind to a second target. As such, “specific binding” or “preferential binding” does not necessarily require (although it can include) exclusive binding. Generally, but not necessarily, reference to binding means preferential binding.
  • full length antibody “intact antibody,” and “whole antibody” are used herein interchangeably, to refer to an antibody in its substantially intact form, not antibody fragments.
  • the term particularly refers to an antibody with heavy chains that contains the Fc region.
  • a full length antibody can be a native sequence antibody or an antibody variant.
  • Antibody fragments comprise only a portion of an intact antibody, generally including an antigen binding site of the intact antibody and thus retaining the ability to bind antigen.
  • Examples of antibody fragments encompassed by the present definition include: (i) the Fab fragment, having VL, CL, VH and CHl domains; (ii) the Fab' fragment, which is a Fab fragment having one or more cysteine residues at the C-terminus of the CHl domain; (iii) the Fd fragment having VH and CHl domains; (iv) the Fd' fragment having VH and CHl domains and one or more cysteine residues at the C-terminus of the CHl domain; (v) the Fv fragment having the VL and VH domains of a single antibody; (vi) the dAb fragment which consists of a VH domain; (vii) isolated CDR regions; (viii) F(ab').sub.2 fragments, a bivalent fragment including two Fab' fragments linked by a disulf
  • the term "heavy chain” as used herein refers to the larger immunoglobulin subunit which associates, through its amino terminal region, with the immunoglobulin light chain.
  • the heavy chain comprises a variable domain and a constant domain.
  • the constant domain further comprises the CHl, hinge, CH2, and CH3 domains.
  • the heavy chain comprises a CH4 domain but does not have a hinge domain.
  • immunoglobulin heavy chain constant domain refers to the CHl, hinge, CH2, CH3, CH4 domains or any combination thereof.
  • the term "light chain” as used herein refers to the smaller immunoglobulin subunit which associates with the amino terminal region of a heavy chain. As with a heavy chain, a light chain comprises a variable region and a constant region. There are two different kinds of light chains, kappa and lambda, referred to herein as "immunoglobulin light chain constant domains.” A pair of these can associate with a pair of any of the various heavy chains to form an immunoglobulin molecule.
  • V-lambda a lambda variable region linked to a kappa constant region linked to a kappa constant region linked to a lambda constant region
  • antibody variant refers to an antibody with single or multiple mutations in the heavy chains and/or light chains.
  • the mutations exist in the variable region. In some embodiments, the mutations exist in the constant region.
  • Nucleic acid or "polynucleotide” or grammatical equivalents as used herein means at least two nucleotides covalently linked together. Nucleic acids and polynucleotides are polymers of any length, including, e.g., 200, 300, 500, 1000, 2000, 3000, 5000, 7000, 10,000, etc. A nucleic acid described herein generally contains phosphodiester bonds, although in some cases, nucleic acid analogs are included that may have at least one different linkage, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O- methylphophoroamidite linkages, and peptide nucleic acid backbones and linkages. Mixtures of naturally occurring nucleic acids and analogs can be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made.
  • polypeptide used herein refers to polymers of amino acid residues.
  • polypeptide used herein encompasses protein, peptides, and heteromeric proteins.
  • polypeptide also applies to amino acid polymers in which one or more amino acid residues is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers, those containing modified residues, and non-naturally occurring amino acid polymers.
  • polypeptide encompasses a heteromeric protein, such as an antibody (for example a full length antibody).
  • Heteromeric protein used herein refers to a protein having at least two polypeptide chains, at least two of which are different from each other.
  • the heteromeric protein can be an antibody having a light chain and a heavy chain.
  • the heteromeric protein is a T cell receptor.
  • the heteromeric protein is an antibody-like peptibody as described herein.
  • Peptibody used herein refers to a chimeric molecule in which a polypeptide is fused to the N-terminus of a constant region of the heavy chain or light chain of an antibody.
  • the polypeptide can be fused to the Fc region of an antibody heavy chain.
  • polypeptide can be fused to a full length constant region of the heavy chain.
  • polypeptide can also be fused to the CL region of the antibody light chain.
  • recombinant polynucleotide herein is meant a polynucleotide not normally found in its natural environment.
  • recombinant polypeptide is a polypeptide made using recombinant techniques, e.g., through the expression of a recombinant nucleic acid as depicted above.
  • heterogenous when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not normally found in the same relationship to each other.
  • the nucleic acid is typically recombinantly produced, having two or more sequences, e.g., from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source.
  • a heterogenous protein will often refer to two or more subsequences that are not found in the same relationship to each other, e.g., a fusion protein.
  • a "promoter” is typically an array of nucleic acid control sequences that direct transcription of a nucleic acid.
  • a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element.
  • a promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription.
  • a “constitutive” promoter is a promoter that is active under most environmental and developmental conditions.
  • operably linked refers to a juxtaposition of two or more components, wherein the components so described are in a relationship permitting them to function in their intended manner.
  • a promoter and/or enhancer is operably linked to a coding sequence if it acts in cis to control or modulate the transcription of the linked sequence.
  • the DNA sequences that are "operably linked” are contiguous and, where necessary to join two protein coding regions or in the case of a secretory leader, contiguous and in reading frame.
  • an operably linked promoter is generally located upstream of the coding sequence, it is not necessarily contiguous with it.
  • a polyadenylation site is operably linked to a coding sequence if it is located at the downstream end of the coding sequence such that transcription proceeds through the coding sequence into the polyadenylation sequence.
  • Linking is accomplished by recombinant methods known in the art, e.g., using PCR methodology, by annealing, or by ligation at convenient restriction sites. If convenient restriction sites do not exist, then synthetic oligonucleotide adaptors or linkers are used in accord with conventional practice.
  • transfected or transformed or transformed” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell.
  • a transformed cell includes the primary subject cell and its progeny.
  • the host cell can be bacteria, yeast, mammalian cell, and plant cells.
  • GPI glycosidylphosphatidylinositol
  • expression vector refers to a self-replicating polynucleotide and, in the present invention, comprises an expression construct. The expression vector will comprise at least one replication origin (also referred to as "origin of replication").
  • the replication origin confers the ability to replicate in a host and may be viral, eukaryotic, or prokaryotic.
  • the expression vector may be used to stably or transiently transfect a eukaryotic cell line or may be used in transformation of a prokaryotic cell.
  • the expression vector may exist extra-chromosomally in a transient transfectant. In a stable transfectant, the expression vector may be propagated as an episomal vector or may be integrated into the host cell chromosome.
  • the expression vector of the present invention may further comprise at least one selectable marker gene to facilitate recognition of either prokaryotic or eukaryotic transfectants.
  • An expression vector, as used herein, may contain both a eukaryotic and a prokaryotic origin of replication.
  • signal peptide refers to a hydrophobic sequence that mediates insertion of the protein through the membrane bounding the ER.
  • Type I transmembrane proteins also comprise signal sequences.
  • Signal sequences are amino-terminal hydrophobic sequences which are usually enzymatically removed following the insertion of part or all of the protein through the ER membrane into the lumen of the ER.
  • a signal precursor form of a sequence can be present as part of a precursor form of a protein, but will generally be absent from the mature form of the protein.
  • signal peptides or sequences that are functional in mammalian cells include the following: the signal sequence for interleukin-7 (IL-7) described in U.S. Pat. No. 4,965,195; the signal sequence for interleukin-2 receptor described in Cosman et al. ((1984), Nature 312:768); the interleukin-4 receptor signal peptide described in EP Patent No. 0 367 566; the type I interleukin-1 receptor signal sequence described in U.S. Pat. No.
  • the signal peptide may be the naturally occurring signal peptide for a protein of interest or it may be a heterogenous signal peptide.
  • binding partner is used herein in the broadest sense and refers to two or more polypeptide sequences that are able to bind to each other under in vitro/in vivo conditions.
  • binding partners include, without limitation, antibody and antigen, ligand and receptor, enzyme and substrate.
  • the present invention provides methods of screening mammalian display libraries, including methods of screening for polynucleotides encoding a polypeptide having a desired property, methods of enriching polynucleotides encoding a polypeptide having a desired property, method of isolating a mammalian cell containing a polynucleotide encoding a polypeptide having a desired property, method of screening for mammalian cells containing a polynucleotide encoding a polypeptide having a desired property, methods of identifying a polypeptide having a desired property, and method of obtaining a polypeptide having a desired property.
  • the methods generally entails reverse transcribing mRNA extracted from a subpopulation of mammalian cells recovered from a previous library screening into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides. This step can be repeated one or more times.
  • the invention provides a method that comprises: a) screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying a polypeptide having the desired property and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides; c) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying a polypeptide having the desired property and recovering a second subpopulation of mammalian cells.
  • steps b) and c) are repeated more than once.
  • the method comprises: a) reverse transcribing mRNA extracted from a subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides, wherein the subpopulation of cells is obtained by screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying a polypeptide having the desired property; b) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying a polypeptide having the desired property and recovering a second subpopulation of mammalian cells.
  • the method comprises screening a population of mammalian cells transfected with a sublibrary of polynucleotides for cells displaying a polypeptide having the desired property and recovering a subpopulation of mammalian cells, wherein the sublibrary is generated by reverse transcribing mRNA extracted from an intermediate population of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides, wherein the intermediate population of cells is obtained by screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying a polypeptide having the desired property.
  • the polypeptide is a heteromeric protein.
  • the polypeptide is an antibody.
  • the invention provides a method of isolating a polynucleotide encoding a polypeptide having a desired property, comprising: a) screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying a polypeptide having the desired property and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides; c) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying a polypeptide having the desired property and recovering a second subpopulation of mammalian cells; and d) isolating from said second subpopulation of mammalian cells a polyn
  • the polynucleotides in the primary library encode at least 10 9 different polypeptides.
  • the initial population of mammalian cells are transiently transfected with the primary library under a condition where an individual mammalian cell in the population can take up more than about 100, such as more than about any of 10 3 , 10 4 , 10 5 , or 10 6 copies of different polynucleotides.
  • the screening condition in step c) is more stringent than that of step a). [0069]
  • steps b) and c) are repeated at least once prior to step d). In some embodiments, step b) and c) are repeated no more than about three times prior to step d).
  • the method further comprises transfecting (such as transiently transfecting) a primary library of polynucleotides into the initial population of mammalian cells.
  • step b) further comprises transfecting (such as transiently transfecting) said sublibrary of polynucleotides into mammalian cells.
  • the amplification of the cDNA in step b) is carried out by PCR.
  • the cDNAs are PCR amplified by using a single set of primers.
  • the assay condition in later steps can be more stringent than those in the earlier steps.
  • a high stringency screening condition in later steps of the methods allows further enrichment in later mammalian cell subpopulations and facilitates isolation of polynucleotide.
  • a method of isolating a polynucleotide encoding a polypeptide having a desired property comprising: a) reverse transcribing mRNA extracted from a subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides, wherein the subpopulation of cells is obtained by screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying a polypeptide having the desired property; b) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying a polypeptide having the desired property and recovering a second subpopulation of mammalian cells; and c) isolating from said second subpopulation of mammalian cells a polynucleotide encoding a polypeptide having the desired property
  • a method of isolating a polynucleotide encoding a polypeptide having a desired property comprising: a) screening a population of mammalian cells transfected with a sublibrary of polynucleotides for cells displaying a polypeptide having the desired property and recovering a subpopulation of mammalian cells, wherein the sublibrary is generated by reverse transcribing mRNA extracted from an intermediate population of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides, wherein the intermediate population of cells is obtained by screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying a polypeptide having the desired property, and b) isolating from said subpopulation of mammalian cells a polynucleotide encoding a polypeptide having the desired property
  • a method of screening a mammalian display library comprising a) screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying a polypeptide having the desired property and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides; c) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying a polypeptide having the desired property and recovering a second subpopulation of mammalian cells.
  • a method of screening a mammalian display library comprising: a) reverse transcribing mRNA extracted from a subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides, wherein the subpopulation of cells is obtained by screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying a polypeptide having the desired property; b) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying a polypeptide having the desired property and recovering a second subpopulation of mammalian cells.
  • a method of screening a mammalian display library comprising screening a population of mammalian cells transfected with a sublibrary of polynucleotides for cells displaying a polypeptide having the desired property and recovering a subpopulation of mammalian cells, wherein the sublibrary is generated by reverse transcribing mRNA extracted from an intermediate population of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides, wherein the intermediate population of cells is obtained by screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying a polypeptide having the desired property.
  • the desired property is a specific binding to a binding partner.
  • a method of isolating a polynucleotide encoding a polypeptide that recognizes a binding partner comprising: a) screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying a polypeptide that recognizes the binding partner and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides; c) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying a polypeptide that recognizes the binding partner and recovering a second subpopulation of mammalian cells; and d) isolating from
  • step a) comprises: i) contacting the initial population of mammalian cells with a binding partner and ii) recovering a subpopulation of mammalian cells that bind to the binding partner.
  • step c) comprising: i) contacting the population of mammalian cells with the binding partner, and ii) recovering a subpopulation of mammalian cells that bind to the binding partner.
  • the condition for binding in step c) is more stringent than that of step a). In some embodiments when steps b) and c) are repeated at least once, the condition for binding in later steps can be more stringent than those in the earlier steps.
  • the method is used to isolate polynucleotide(s) that encode a heteromeric protein.
  • a method of isolating a polynucleotide that encode a heteromeric protein with a desired property comprising: a) screening an initial population of mammalian cells for cells displaying a heteromeric protein having a desired property and recovering a subpopulation of mammalian cells, wherein the initial population of mammalian cells are transfected (such as transiently transfected) with a primary library of polynucleotides encoding a first polypeptide and a second polypeptide and wherein the first polypeptide and the second polypeptide form a heteromeric protein on the cell surface; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides; c) screening a subsequent population
  • step a) in the method described above comprises screening an initial population of mammalian cells transfected with a first primary library of polynucleotides encoding a first polypeptide and a second primary library encoding a second polypeptide.
  • the method further comprises transfecting into the initial population of mammalian cells with a first primary library encoding a first polypeptide and a second primary library encoding a second polypeptide, wherein the first polypeptide and the second polypeptide form a heteromeric protein on the cell surface.
  • the first primary library and the second primary library together encode at least 10 9 different heteromeric proteins.
  • step b) in the method described above comprises amplifying said cDNA to generate a first sublibrary of polynucleotides encoding the first polypeptide and a second sublibrary of polynucleotides encoding the second polypeptide.
  • step b) further comprises transfecting the two sublibraries of polynucleotides into a population of mammalian cells.
  • both step a) and step c) involve mammalian cells transfected with two (or more) different libraries of polynucleotides.
  • two different primer sets can be used to amplify polynucleotides encoding the first polypeptide and polynucleotides encoding the second polypeptide separately, thus allowing the cloning of these polynucleotides into different vectors.
  • the use of different libraries of polynucleotides at different levels of the screening cycles increases the diversity of the heteromeric proteins displayed on the mammalian cells. For example, by using a first primary library with a diversity of 10 4 and a second primary library with a diversity of 10 5 , the total number of different heteromeric proteins that can be presented on the surface of the mammalian cells would be at least 10 9 . The diversity can be even bigger if the heteromeric protein can have more than two different polypeptide chains.
  • use of a first sublibrary and a second sublibrary allows shuffling to occur. For example, by combining the first sublibrary with the second sublibrary, new combinations of polypeptides in the heteromeric protein may be created.
  • steps b) and c) are repeated at least once, one round of RT-PCR can generate two or more sublibraries of polynucleotides while another round of RT-PCR can generate a single sublibrary of polynucleotides.
  • steps b) and c) are repeated at least once, one round of RT-PCR can generate two or more sublibraries of polynucleotides while another round of RT-PCR can generate a single sublibrary of polynucleotides.
  • steps b) and c) are repeated at least once, one round of RT-PCR can generate two or more sublibraries of polynucleotides while another round of RT-PCR can generate a single sublibrary of polynucleotides.
  • a single vector encoding both the first polypeptide and the second polypeptide be used at the later round(s) of the screening so that the polynucleotide that is ultimately isolated would encode both of the two desired polypeptides.
  • a method of isolating a polynucleotide that encode a heteromeric protein with a desired property comprising: a) screening an initial population of mammalian cells for cells displaying a heteromeric protein with a desired property and obtaining a subpopulation of mammalian cells, wherein the initial population of mammalian cells are transfected (such as transiently transfected) with a primary library of polynucleotides encoding a first polypeptide and a second polypeptide and wherein the first polypeptide and the second polypeptide form a heteromeric protein on the cell surface; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a first sublibrary of polynucleotides encoding a first polypeptide and a second sublibrary of polynucleotides encoding a second polypeptide; c) screening a subsequent
  • the polypeptides displayed on the surface of the mammalian cells in some embodiments can be partially or completely released from the mammalian cells. This allows further analysis of the polypeptide in functional studies.
  • the methods described herein are applicable for the screening of any kind of polypeptides, and are particularly suitable for screening heteromeric proteins. The methods are particularly suitable, for example, for the production of protein complexes such as antibodies, T-cell receptors, class I and class II MHC molecules, integrins, CD8, CD28, and factor VIII molecules.
  • fusion protein comprising a heterogenous polypeptide fused to a dimerization domain.
  • the fusion protein further comprises a membrane tethering domain.
  • the dimerization domain can be an antibody constant region.
  • an antibody-like peptibody i.e., a multimeric peptibody comprising a polypeptide fused to a light chain constant region and a polypeptide fused to a heavy chain constant region, wherein the heavy chain and light chain constant regions dimerize to produce an antibody-like molecule.
  • an antibody-like peptibody contains two polypeptides fused to the light chain constant region and two polypeptides fused to the heavy chain constant region.
  • the polypeptides in the antibody-like peptibody can be different or the same.
  • polypeptide such as an antibody
  • desired properties include, for example, specific binding to a partner, higher binding affinity to a binding partner, antibody-dependent cellular cytotoxicity (ADCC), complement-dependent cytotoxicity (CDC), agonist or antagonist functions, induction or inhibition of apoptosis, angiogenesis, proliferation, activation of inhibition of signaling pathway. Multiple properties may be screened simultaneously or individually. Assay methods for these desired properties are known in the art.
  • the methods include, but are not limited to, methods of screening for polynucleotides encoding an antibody having a desired property (such as specific binding to an antigen), methods of enriching polynucleotides encoding an antibody having a desired property (such as specific binding to an antigen), methods of isolating a mammalian cell containing a polynucleotide encoding an antibody having a desired property (such as specific binding to an antigen), methods of screening for mammalian cells containing a polynucleotide encoding an antibody having a desired property (such as specific binding to an antigen), methods of identifying an antibody having a desired property (such as specific binding to an antigen), and methods of obtaining an antibody having a desired property (such as specific binding to an antigen).
  • a desired property such as specific binding to an antigen
  • methods of enriching polynucleotides encoding an antibody having a desired property such as specific binding to an antigen
  • the method comprises: a) screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of antibodies for cells displaying an antibody having a desired property (such as specific binding to an antigen) and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of antibodies; c) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying an antibody having a desired property (such as specific binding to an antigen) and recovering a second subpopulation of mammalian cells.
  • steps b) and c) are repeated more than once.
  • the method comprises: a) reverse transcribing mRNA extracted from a subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of antibodies, wherein the subpopulation of cells is obtained by screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying an antibody having a desired property (such as specific binding to an antigen); b) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying an antibody having a desired property (such as specific binding to an antigen) and recovering a second subpopulation of mammalian cells.
  • the method comprises screening a population of mammalian cells transfected with a sublibrary of polynucleotides for cells displaying an antibody having a desired property (such as specific binding to an antigen) and recovering a subpopulation of mammalian cells, wherein the sublibrary is generated by reverse transcribing mRNA extracted from an intermediate population of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides, wherein the intermediate population of cells is obtained by screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying an antibody having a desired property (such as specific binding to an antigen).
  • the polypeptide is a full length antibody.
  • a method of isolating a polynucleotide encoding an antibody specifically recognizing an antigen comprising: a) screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides encoding antibodies for cells displaying an antibody specifically recognizing the antigen and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides; c) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying an antibody specifically recognizing the antigen and recovering a second subpopulation of mammalian cells; and d) isolating from said second subpopulation of mammalian cells a polynucleotide encoding an antibody specifically recognizing
  • steps b) and c) are repeated at least once prior to step d). In some embodiments, step b) and c) are repeated no more than about three times prior to step d). In some embodiments, the method further comprises transfecting a primary library of polynucleotides into the initial population of mammalian cells. In some embodiments, step b) further comprises transfecting said sublibrary of polynucleotides into mammalian cells. [0088] In some embodiments, step a) comprises: i) contacting the initial population of mammalian cells with an antigen and ii) recovering a subpopulation of mammalian cells that bind to the antigen.
  • step c) comprises: i) contacting the population of mammalian cells with the antigen, and ii) recovering a subpopulation of mammalian cells that bind to the antigen.
  • the condition for antigen binding in step c) is more stringent than that of step a). In some embodiments when steps b) and c) are repeated at least once, the condition for binding in later steps can be more stringent than those in the earlier steps.
  • a method of isolating an antibody specifically recognizing an antigen comprising: a) reverse transcribing mRNA extracted from a subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides, wherein the subpopulation of cells is obtained by screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying an antibody specifically recognizing the antigen; b) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying an antibody that specifically recognize the antigen and recovering a second subpopulation of mammalian cells; and c) isolating from said second subpopulation of mammalian cells a polynucleotide encoding an antibody specifically recognizing the antigen.
  • a method of isolating a polynucleotide encoding an antibody specifically recognizing an antigen comprising: a) screening a population of mammalian cells transfected with a sublibrary of polynucleotides for cells displaying an antibody specifically recognizing the antigen and recovering a subpopulation of mammalian cells, wherein the sublibrary is generated by reverse transcribing mRNA extracted from an intermediate population of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides, wherein the intermediate population of cells is obtained by screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying an antibody specifically recognizing the antigen, and b) isolating from said subpopulation of mammalian cells a polynucleotide encoding an antibody specifically recognizing the antigen.
  • a method of screening a mammalian display library comprising a) screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of antibodies for cells displaying an antibody specifically recognizing the antigen and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides; c) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying an antibody specifically recognizing the antigen and recovering a second subpopulation of mammalian cells.
  • a method of screening a mammalian display library comprising: a) reverse transcribing mRNA extracted from a subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides, wherein the subpopulation of cells is obtained by screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying an antibody specifically recognizing the antigen; b) screening a population of mammalian cells transfected with the sublibrary of polynucleotides for cells displaying an antibody specifically recognizing the antigen and recovering a second subpopulation of mammalian cells.
  • a method of screening a mammalian display library comprising screening a population of mammalian cells transfected with a sublibrary of polynucleotides for cells displaying an antibody specifically recognizing the antigen and recovering a subpopulation of mammalian cells, wherein the sublibrary is generated by reverse transcribing mRNA extracted from an intermediate population of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides, wherein the intermediate population of cells is obtained by screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides for cells displaying an antibody specifically recognizing the antigen.
  • a method of isolating a polynucleotide that encodes an antibody specifically recognizing an antigen comprising: a) screening an initial population of mammalian cells transfected (such as transiently transfected) with a primary library of polynucleotides encoding a light chain and a heavy chain for cells displaying an antibody specifically recognizing the antigen and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides; c) screening a population of mammalian cells transfected with the sublibrary of polynucleotides encoding a light chain and a heavy chain for cells displaying an antibody specifically recognizing the antigen and recovering a second subpopulation of mammalian cells; and d) isolating from said second subpopulation of mamm
  • a method of isolating a polynucleotide that encodes an antibody specifically recognizing an antigen comprising: a) screening an initial population of mammalian cells transfected (such as transiently transfected) with a first primary library of polynucleotides encoding a light chain and second primary library of polynucleotides encoding a heavy chain for cells displaying an antibody specifically recognizing the antigen and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a sublibrary of polynucleotides; c) screening a population of mammalian cells transfected with the sublibrary of polynucleotides encoding a light chain and a heavy chain for cells displaying an antibody that specifically recognizing the antigen and recovering a second subpopulation of mammalian cells; and
  • a method of isolating a polynucleotide that encodes an antibody specifically recognizing an antigen comprising: a) screening an initial population of mammalian cells transfected with a first primary library of polynucleotides encoding a light chain and second primary library of polynucleotides encoding a heavy chain for cells displaying an antibody specifically recognizing the antigen and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a first sublibrary of polynucleotides encoding the light chain and a second sublibrary of polynucleotides encoding the heavy chain; c) screening a population of mammalian cells transfected with the first sublibrary of polynucleotides and the second sublibrary of the polynucleotides for cells displaying an antibody specifically recognizing
  • a method of isolating a polynucleotide that encodes an antibody specifically recognizing an antigen comprising: a) screening an initial population of mammalian cells transfected (such as transiently transfected) with a first primary library of polynucleotides encoding a light chain and second primary library of polynucleotides encoding a heavy chain for cells displaying an antibody specifically recognizing the antigen and recovering a subpopulation of mammalian cells; b) reverse transcribing mRNA extracted from said subpopulation of mammalian cells into cDNA and amplifying said cDNA to generate a first sublibrary of polynucleotides encoding the light chain and a second sublibrary of polynucleotides encoding the heavy chain; c) screening a population of mammalian cells transfected (such as transiently transfected) with the first sublibrary of polynucleotides and the second
  • the primary library (particularly the high complexity primary library) can be constructed with methods described herein.
  • the primary library is a na ⁇ ve antibody library.
  • the primary library is an antibody library generated from individual(s) who is immunized with the antigen.
  • the primary library is a human antibody library.
  • the primary library is a library of polynucleotides encoding humanized antibodies.
  • the primary library is a chimeric antibody library.
  • the primary library is an antibody library from other mammalian species, including, but not limited to, mouse, rabbit, goat, and horse.
  • the primary library is produced from any of the immune tissues, including, for example, bone marrow, spleen, lymph nodes, lymphocytes. In some embodiments, the primary library is synthesized. [0097] In some embodiments, the primary library comprises a first primary library of polynucleotides encoding antibody light chains and a second primary library of polynucleotides encoding antibody heavy chains. In some embodiments, the 3' end of the heavy chain encoded by the polynucleotide is fused to a cell surface tether domain.
  • the cell surface tether domain can be any transmembrane domain or a membrane linking sequence.
  • Suitable cell surface tether domains include, but is not limited to, PDGFR transmembrane domain, B7-1 transmembrane domain, asialoglycoprotein receptor (ASGPR) transmembrane domain.
  • the cell surface tether domain is a GPI signal sequence which directs anchoring of the immunoglobulin to the cell- surface via a GPI linker.
  • the GPI signal sequence is from human DAF.
  • myristylation sequences can serve as the cell surface tether domain.
  • the methods of the present invention makes it possible to screen mammalian display libraries with a diversity that is equal or higher than 10 9 , thus providing a reason to make mammalian display libraries with such high diversity. Accordingly, the present invention also provides a method of constructing a library of polynucleotides encoding antibodies, wherein the polynucleotides collectively encode at least about 10 9 , including for example at least about 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 different recombinant antibodies. Each polynucleotide in the library could encode both a light chain and a heavy chain.
  • a first library of polynucleotide encoding a light chain can be combined with a second library of polynucleotide encoding a heavy chain.
  • the heavy chain and the light chain can be paired inside the cell, thus creating a high diversity of different antibodies.
  • a method of constructing a library of polynucleotides encoding antibodies comprising combining a library of light chain with a library of heavy chain such that the polynucleotides collectively encode at least about 10 9 different recombinant antibodies.
  • the primary library is derived from a single individual.
  • a method of constructing a library of polynucleotides encoding antibodies from a single individual wherein the polynucleotides collectively encode at least about 10 9 , including for example at least about 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 different recombinant antibodies.
  • a method of constructing a library of polynucleotides encoding antibodies from a single individual comprising combining a library of light chain of the individual with a library of heavy chain of the individual such that the polynucleotides collectively encode at least about 10 9 different recombinant antibodies.
  • the polynucleotides are present in plasmid vectors.
  • a population of mammalian cells displaying at least about 10 9 , including for example at least about 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 different recombinant antibodies on the surface.
  • Also provided in the present invention are methods of constructing a library of polynucleotides encoding antibody-like peptibodies, wherein the polynucleotides collectively encode at least about 10 9 , including for example at least about 10 10 , 10 11 , 10 12 , 10 13 , 10 14 or 10 15 different recombinant peptibodies.
  • a population of mammalian cells displaying at least about 10 9 , including for example at least about 10 10 ,
  • the discussion herein focuses primarily on antibodies, the description, whenever applicable, would apply to antibody-like peptibodies as well.
  • the present application also encompasses methods of screening a library of antibody-like peptibodies as described herein.
  • techniques that may be used to efficiently generate libraries of immunoglobulins, including those described or referenced in Molecular Cloning;A Laboratory Manual, 3rd Ed. (Maniatis, Cold Spring Harbor Laboratory Press, New York, 2001), Current Protocols in Molecular Biology (John Wiley & Sons), U.S. Pat. No. 6.403,312, U.S. Ser. No. 09/782,004, U.S. Ser. No. 09/927,790, U.S. Ser. No. 10/218,102, PCT WO 01/40091, and PCT WO 02/25588, each of which is incorporated by reference in its entirety.
  • Such methods include but are not limited to gene assembly methods, PCR- based method and methods which use variations of PCR, ligase chain reaction-based methods, pooled oligo methods such as those used in synthetic shuffling, error-prone amplification methods and methods which use oligos with random mutations, classical site- directed mutagenesis methods, cassette mutagenesis, and other amplification and gene synthesis methods.
  • gene assembly methods PCR- based method and methods which use variations of PCR, ligase chain reaction-based methods, pooled oligo methods such as those used in synthetic shuffling, error-prone amplification methods and methods which use oligos with random mutations, classical site- directed mutagenesis methods, cassette mutagenesis, and other amplification and gene synthesis methods.
  • a variety of commercially available kits and methods for gene assembly, mutagenesis, vector subcloning, and the like, are available for generating nucleic acids that encode immunoglobulin amino acid sequences.
  • Vectors for expressing antibodies (particularly full length antibodies) on the surface of mammalian cells can be prepared according to methods known in the art.
  • the polynucleotide encoding an immunoglobulin heavy chain constant region is fused as its 3' end to a polynucleotide encoding the cell surface tether domain, allowing display of the expressed immunoglobulins on the surface of the mammalian cells.
  • there is an enzymatic cleavage site between the heavy chain constant region and the membrane tether domain the cleavage of which allows the immunoglobulin be removed enzymatically, thus enabling conversion of the expressed immunoglobulin from a membrane-bound form to a soluble form.
  • the cleaved antibody can be used directly for further functional analysis, thus obviating the step of converting a membrane anchored form into a soluble form.
  • Furin is a protease which resides in the trans-Golgi network of eukaryotic cells. Its function is to cleave proteins at a step just prior to their delivery to their final cellular destination. Furin recognizes a consensus amino acid sequence, RXRR (SEQ ID NO:1), RXRK (SEQ ID NO:2), or KXKR (SEQ ID NO: 3)(where X is any amino acid) and cuts proteins which contain these sequences when they reach the transgolgi network. See U.S. Pat. No. 7,223,390; Poole et al., /.
  • the expressed protein containing the furin cleavage site typically goes through its normal process of folding and assembly to attain its native configuration. After export from the endoplasmic reticulum, the protein travels along the secretory pathway to reach the cell surface. When the protein reaches the trans-Golgi network, it is cleaved by the furin protease. Because Furin cleavage is partially complete, a portion of the antibodies will be released into the medium while the other portion of the antibodies will remain attached to the cell membrane. This configuration allows functional assays of the cleaved antibody while maintaining the link between the antibody and the cell expressing the antibody.
  • Suitable promoters for expression of the recombinant polypeptides in the mammalian cells include, but are not limited to, SV40 promoter, mouse mammary tumor virus promoter, human HIV long terminal repeat promoter, moloney virus promoter, avian leukemia virus promoter, Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, human actin promoter, human hemoglobin promoter, CMV promoter, human EF-I alpha promoter, or human muscle creatine promoter.
  • the vector comprises a first promoter operatively linked to the first polynucleotide encoding an immunoglobulin heavy chain and a second promoter operatively linked to the second polynucleotide encoding an immunoglobulin light chain.
  • the immunoglobulin light chain and heavy chain are present in two separate vectors, each having a different promoters operably linked to the immunoglobulin light chain and heavy chains.
  • the mammalian cells for the library screening can be derived from any eukaryotic species, including but not limited to cells from rat, mouse, bovine, porcine, sheep, goat, and human.
  • the cells can be maintained according to standard methods well known to those of skill in the art.
  • suitable mammalian cells include HeLa cells (HeLa S3 cells,
  • ATCC CCL2.2 Jurkat cells, Raji cells, Daudi cells, human embryonic kidney cells (293- HEK; ATCC 293cl8, ATCC CRL 1573), African green monkey kidney cells (CV-I; Vero; ATCC CRL 1587), SV40-transformed monkey kidney cells (COS-I ; ATCC CRL 1650), canine kidney cells (MDCK; ATCC CCL 34), baby hamster kidney cells (BHK- 21, BHK- 570; ATCC CRL 8544, ATCC CRL 10314), Chinese hamster ovary cells (CHO-Kl; ATCC CCL61; CHO DG44 (Chasin et al, 1986, Som Cell Molec Genet, 12, 555)), and other rodent cell lines such as NSO, SP2/0, GHl (ATCC CCL82), H-4-II-E (ATCC CRL 1548), NIH-3T3 (ATCC CRL 1658).
  • NSO NSO
  • SP2/0 GHl
  • the mammalian cell is selected from the group consisting of 293-HEK, HeIa, Jurkat, Raji, Daudi, COS, or CV-I cells.
  • the mammalian cells are derivatives of the cells described above.
  • Mammalian cells can be transformed with polynucleotides using suitable means and cultured in conventional nutrient media modified as is appropriate for inducing promoters. Representative examples of such methods include transfection using calcium phosphate precipitation, lipid mediated transfection, direct microinjection of polynucleotides into intact target cells, and electroporation.
  • the mammalian cells are transiently transfected.
  • Suitable culture conditions for cells are well known.
  • the mammalian cells used in different steps of the methods described herein can be the same or different. It should be noted that, while in traditional methods of screening it is desirable (and sometimes critical) to control the copies of vectors taken up by a cells, during the initial steps of the methods in the present invention it is preferable that each mammalian cell can take up as many vector copies as possible.
  • the transfection condition may be optimized in such a way that each mammalian cell takes up at least about 20, such as at least about any of 50, 100, 200, 300, 400, 500, 1000, or more plasmids up to 10 6 , 10 7 per cell.
  • the transfection conditions can be optimized by adjusting parameters such as cell density, concentration of vector DNA, ratio of the different primary libraries (when applicable), transfection reagents, and transfection procedure.
  • the present invention in one aspect provides a population of mammalian cells, at least some (for example 50%, 60%, 70%, 80%, 90%, 99%) of which comprise least about 20, such as at least about any of 50, 100, 200, 300, 400, 500, 1000, or more different polynucleotides up to 10 6 or 10 7 per cell.
  • the mammalian cells are transiently transfected.
  • the antibodies are allowed to be displayed on the cell surface of the mammalian cells.
  • allowing display is meant allowing the vectors which have been introduced into the cells to undergo transcription and translation of the polypeptides and transporting the antibodies to the membrane surface. The conditions, and time required to allow expression will vary depending on the choice of the host cell and the choice of vectors, as is well known by one of ordinary skill in the art.
  • cells expressing antibodies on their surface are subsequently contacted with an antigen by a method which will allow the antigen to bind to the desired antibody, thereby allowing the cells expressing the antibody to be distinguished from those cells which do not bind the antigen.
  • the initial screening step allows a first subpopulation of mammalian cells be recovered.
  • Recovery is meant separation of a desired component from those components which are not desired. It should be understood by a person in the ordinary skill in the art that, although the subpopulation of mammalian cells are enriched with cells displaying an antibody specifically recognizing an antigen, most cells in the subpopulation are likely to be non-specific binders. In some embodiments, the initial screening is carried out in a low stringency condition to maximize the possibility of capturing cells displaying an antibody that specifically recognize the antigen.
  • the initial screening can be carried out using any one of the following methods: fluorescence-activated cell sorting (FACS), bead-based sorting such as magnetic bead-based sorting (MACS), a combination thereof, or other solid-phase panning techniques.
  • FACS fluorescence-activated cell sorting
  • MCS magnetic bead-based sorting
  • Other techniques that can be used are also known in the art. For example, if the cells are in suspension, and the antigen is attached to a solid substrate, cells which specifically bind to the antigen will be trapped on the solid substrate, allowing those cells which do not bind the antigen to be washed away, and the bound cells can subsequently be recovered. Alternatively, if the cells are attached to a solid substrate, and by specific binding to the antigen are caused to be released from the substrate, they can be recovered from the cell supernatant.
  • the antigen can be attached to the solid substrate (such as magnetic beads) either directly or indirectly.
  • the solid substrate can be coated by a streptavidin, which allows antigens linked to a biotin be attached to the solid substrate via the interaction of streptavidin and the biotin.
  • streptavidin a streptavidin
  • the antigen can be expressed and presented at the surface of a cell.
  • the interaction between the antigen presenting cell and the cells that bind to the antigen allows separation of the cells binding to the antigen (for example, cells expressing the desired antibody).
  • the cell complexes can be isolated by ways of FACS.
  • the interaction between the antigen presenting cells and the cells that bind to the antigen could induce a detectable signal (either within the antigen presenting cells or the cells that bind to the antigen) that allows separation of the cells binding to the antigen.
  • the cells are incubated with an antigen that has been labeled directly or indirectly with a fluorescent label (such as fluorescein-5-isothiocyanate (FITC)).
  • a fluorescent label such as fluorescein-5-isothiocyanate (FITC)
  • FACS fluorescence activated cell sorting
  • one or more of the above-techniques can be combined.
  • solid phase panning can be combined with the use of FACS or vice versa.
  • FACS fluorescence Activated Cell Sorting
  • ELISA assays can be used to determine the binding affinity of an isolated immunoglobulin toward a target antigen.
  • the antibody can be partially or completely cleaved from the fused tether domain and can be used to further assay and/or confirm the desired properties.
  • the methods described herein encompass methods of generating and screening sublibraries as described herein. After recovery of the initial subpopulation of mammalian cells, total mRNA is extracted from the cells. The mRNA is transcribed into cDNA, and the antibody genes or parts the antibody genes (such as the VH and VL regions of the antibody genes) are amplified (for example by PCR).
  • primers used for polynucleotides in the sublibrary can be based on vector sequence of the primary library.
  • primers can be designed based on sequences in the vectors to amplify both the light chain and the heavy chain sequences.
  • the VH and VL regions of the antibody sequence is cloned into the backbone vectors containing CH and CL regions respectively to construct two sub-libraries, heavy and light chain sub-libraries.
  • the two sublibraries are subsequently transfected into mammalian cells. This step allows shuffling of the heavy and light chain in cells, which may increase the chance to isolate an antibody with higher expression as well as higher affinity.
  • at least one primer for amplifying the light chain is different from the one used for amplifying the heavy chain so that the light chain and heavy chain can be separately cloned into different vectors, and divided into different sublibraries.
  • the amplified antibody sequences can be cloned back into the same vectors used in the primary library or into a different vector.
  • the primary library comprises a primary light chain library and a different second primary heavy chain library, with the light chain and heavy chains on different vectors (such as plasmid vectors).
  • the amplified light chain and heavy chain sequences are then cloned into a dual cassette single vector.
  • the vector is similar to the vector used in Higuchi et al., J. Immun. Methods (1997) 202:193-204.
  • separate libraries were used for several rounds of screening before cloning the light and heavy chains into a single dual expression vector.
  • Cloning dual expression vector at the final stage of the screening allows simultaneous identification of the pair of antibody light chain and heavy chains for an antibody with the desired property (such as specific binding to an antigen).
  • the mammalian cells used in the subsequent screening steps may be of the same type used in the first round of screening, or may be different cells, as long as they are capable of expressing the polypeptide on the cell surface.
  • the screening can be carried out using any of the above methods described for the initial screening.
  • the RT-PCR and screening steps described herein can be repeated at least one, two, three, four, five, six, or seven times. In some embodiments, the steps are repeated no more than about three times.
  • the stringency for the different cycles of screening can be the same or different to facilitate the isolation of the polynucleotide.
  • a higher stringency condition is used towards the end of the screening cycle to decrease the diversity of the polynucleotides obtained from the enriched subpolulations.
  • the diversity of the sublibraries can be evaluated during the various steps of the method. A diversity of less than about 1000 to 10000 signals that an isolation step can be carried out as described below.
  • Isolation of polynucleotide encoding an antibody specifically recognizing the antigen [0130] To isolate the antibody sequence, the total mRNA is isolated from the final sub-cell pool. The relevant regions are RT-PCR amplified, restriction enzyme digested and cloned into a stable expression vector. The DNA is then stably transfected into mammalian cells under conditions that most mammalian cells have only one expression vector in each cell. For example, a titration step can be used to dilute the concentration of plasmid used for cellular transfection to reduce the likelihood of expression in the same cell of multiple vectors encoding different immunoglobulins.
  • a flip-in system e.g., FLP-inTM System (Invitrogen, Inc.) can be used.
  • Cells expressing the desired antibody can be isolated, for example, by methods described above.
  • the polynucleotide encoding the desired antibody can be isolated and sequenced.
  • the present invention also provides specific expression vectors for use in methods described herein. These expression vectors provide high cloning efficiency, and are particularly useful for constructions of high complexity protein libraries such as high complexity antibody libraries described herein, as well as for use in methods of screening libraries, such as methods described herein.
  • the vectors provided herein can be used for rapid construction of any antibody libraries, heavy chain, light chain, chimerical and even fusion proteins, and for high expression of these antibody proteins on the mammalian cell surface for efficient screening and selecting (for example, when coupled with FACS).
  • Two or more unique endonuclease recognizing sequences can be incorporated into the vector for the pop-in and pop-out of genes of interest.
  • a library with a size of at least 10 6 complexity can be readily constructed.
  • CMV promoter a commonly used promoter for high expression of proteins in variety of mammalian cells, can be used to drive the expression of inserted genes (such as antibody genes).
  • a transmembrane domain from PDGFR can be fused in frame to the C-terminal of heavy chain consistent region.
  • dual cassette expression vectors can contain dual mammalian expression cassettes for the one-step insertion of both heavy chain and light chain genes to display full-length bivalent antibodies on mammalian cell surfaces. This can be achieved by fusing a transmembrane domain from PDGFR to the C-terminus of the heavy chain constant region. We can also incorporate a furin cleavage site between the constant region and PDGFR transmembrane domain to obtain secreted antibodies. As a result, antibodies can be expressed simultaneously on the cell surface in a membrane- anchored version for screening and selecting through FACS analysis as well as in condition medium in a secreted version for function analysis.
  • an expression vector comprising an open reading frame flanked by a pair of cleavage sites recognizable by a restriction enzyme (for example a restriction enzyme that recognizes a non-palendromic sequence), wherein the ends of each fragment resulting from the cleavage with said restriction enzyme do not self-ligate.
  • a restriction enzyme for example a restriction enzyme that recognizes a non-palendromic sequence
  • the open reading frame encodes an antibody heavy chain.
  • the antibody heavy chain is fused to a transmembrane domain.
  • the vector further comprises a second pair of cleavage sites recognizable by a different restriction enzyme (such as restriction enzymes that recognizes a non-palendromic sequence), wherein the ends of each fragment resulting from the cleavage with said second restriction enzyme do not self-ligate.
  • the second pair of cleavage sites flank the open reading frame.
  • one of the second pair of cleavage sites flanks the open reading frame wherein the other one of the second pair of cleavage sites is located within the open reading frame.
  • the open reading frame comprises an antibody heavy chain, and one of the second pair of cleavage sites is located between the variable region and the constant region.
  • Such vector may be suitable, for example, for cloning an antibody variable region.
  • the open reading frame comprises an antibody light chain, and one of the second pair of cleavage sites is located between the variable region and the constant region.
  • Such vector may be suitable, for example, for cloning an antibody variable region.
  • the restriction enzyme is selected from the group consisting of Sfil, BstXI, and BsmBl. It is to be understood that other enzymes with similar properties can be used as well.
  • the vector further comprises a promoter that is operably linked to said open reading frame.
  • the vector has a restriction map as depicted in Figure 2.
  • the vector has a restriction map as depicted in Figure 3.
  • the expression vector comprises a second open reading frame.
  • a dual-expression cassette vector comprising: 1) a first open reading frame flanked by first pair of cleavage sites recognizable by a restriction enzyme (such as a restriction enzyme that recognizes a non- palendromic sequence), wherein the ends of each fragment resulting from the cleavage with said restriction enzyme do not self-ligate; and 2) a second open reading frame flanked by a second pair of cleavage sites recognizable by a restriction enzyme (such as a restriction enzyme that recognizes a non-palendromic sequence), wherein the ends of each fragment resulting from the cleavage with said second restriction enzyme do not self-ligate.
  • a restriction enzyme such as a restriction enzyme that recognizes a non-palendromic sequence
  • one of the open reading frames encodes an antibody heavy chain.
  • the antibody heavy chain is fused to a transmembrane domain.
  • one of the open reading frames encodes an antibody light chain.
  • a dual-expression cassette vector comprising: 1) a first open reading frame encoding an antibody heavy chain, flanked by first pair of cleavage sites recognizable by a restriction enzyme (such as a restriction enzyme that recognizes a non- palendromic sequence), wherein the ends of each fragment resulting from the cleavage with said restriction enzyme do not self-ligate; and 2) a second open reading frame expressing an antibody light chain, flanked by a second pair of cleavage sites recognizable by a restriction enzyme (such as a restriction enzyme that recognizes a non-palendromic sequence), wherein the ends of each fragment resulting from the cleavage with said second restriction enzyme do not self-ligate.
  • a restriction enzyme such as a restriction enzyme that recognizes a non-palendromic sequence
  • the dual-cassette expression vector further comprises a third pair of restriction enzyme cleavage sites recognizable by a third restriction enzyme (such as a third restriction enzyme that recognizes a non-palendromic sequence), wherein the ends of each fragment resulting from the cleavage with said third restriction enzyme do not self-ligate.
  • a third restriction enzyme such as a third restriction enzyme that recognizes a non-palendromic sequence
  • one of the third pair of cleavage sites flanks the one of the open reading frames on the vector, and wherein the other one of the third pair of cleavage sites is located within the same open reading frame.
  • one of the open reading frames comprises an antibody heavy chain, and one of the third pair of cleavage sites is located between the variable region and the constant region.
  • one of the open reading frames comprises an antibody light chain, and one of the third pair of cleavage sites is located between the variable region and the constant region.
  • the dual-cassette expression vector further comprises a fourth pair of restriction enzyme cleavage sites recognizable by a third restriction enzyme (such as a third restriction enzyme that recognizes a non-palendromic sequence), wherein the ends of each fragment resulting from the cleavage with said third restriction enzyme do not self-ligate.
  • a third restriction enzyme such as a third restriction enzyme that recognizes a non-palendromic sequence
  • one of the fourth pair of cleavage sites flanks the one of the open reading frames on the vector, and wherein the other one of the fourth pair of cleavage sites is located within the same open reading frame. It is contemplated that the third pair of cleavage site and the fourth pair of cleavage site can each flank (and locate within) a different open reading frame in the dual cassette expression vector.
  • one of the open reading frame comprises an antibody heavy chain, and one of the third pair of cleavage sites is located between the variable region and the constant region; whereas one of the open reading frame comprises an antibody light chain, and one of the fourth pair of cleavage sites is located between the variable region and the constant region.
  • the restriction enzyme is selected from the group consisting of Sfil, BstXI, and BsmBl.
  • the vector further comprises a first promoter operably linked to said first open reading frame and a second promoter operably linked to said second open reading frame.
  • the vector has a restriction map as depicted in Figure 5A.
  • libraries and kits for carrying out the methods described herein are also provided. Further provided are sublibraries generated during the screening process and polynucleotides/polypeptides obtained from methods described herein. [0143] In some embodiments, there is provided a library of polynucleotides encoding an antibody light chain and a library of polynucleotides encoding an antibody heavy chain, wherein the two libraries allow expression of at least 10 9 , including for example at least any of 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , or more different antibodies.
  • the antibody light chain comprises: (i) a light chain constant region, (ii) an immunoglobulin light chain variable region, and (iii) a signal peptide.
  • the antibody heavy chain comprises: (i) at least one antibody heavy chain constant region, (ii) an immunoglobulin heavy chain variable region, and (iii) a signal peptide.
  • the antibody heavy chain further comprises a cell surface tethering domain at the C-terminal end of the heavy chain constant region.
  • the antibody heavy chain further comprises a furin cleavage site between the heavy chain constant region and the cell surface tethering domain.
  • the two libraries are provided in a kit, either in separate containers or in the same container.
  • the kit further comprises primers, reagents, cells, and instructions for carrying out methods described herein.
  • a kit comprising 1) a first plasmid library of polynucleotides encoding a plurality of immunoglobulin heavy chains, 2) a second plasmid library of polynucleotide encoding a plurality of immunoglobulin light chains.
  • the kit further comprises a population of cells capable of expressing immunoglobulin molecules.
  • the kit further comprises enzymes and primers for RT-PCR.
  • the first and the second plasmid libraries are contained in separate containers.
  • the kit further provides an instruction for carrying out the one or more methods describe herein.
  • a kit comprising 1) a set of primers for the generation of primary libraries (such as primary libraries of antibodies), 2) a set of vectors for transient and/or stable transfection of mammalian cells; and 3) a set of primers for the generation of sublibraries (such as sublibraries of antibodies).
  • the kit further provides an instruction for carrying out the methods describe herein.
  • polynucleotides obtained for methods described herein and polypeptides encoded by such polynucleotides can be useful, for example, as research reagents, diagnostic reagents and therapeutics for treatment of diseases.
  • kits comprising expression vectors, such as the single cassette and dual cassette expression vectors described herein.
  • the kit can either comprise the entire vector, or linear fragments of the vector which can directly be used for ligation (such as four- way ligation).
  • This example shows construction of a vector which can express antibody in mammalian cell in both surface anchored version and secreted version simultaneously.
  • a specific expression vector which can: [0152] 1. express antibody in mammalian cells at a level high enough for detection and analysis;
  • the vector pcDNA 3.1 from Invitrogen is used as the starting material.
  • the vector size is 5.4 kb, containing most necessary components for expression of proteins in mammalian cells.
  • the 1.8 kb Neo gene expression cassette is deleted to reduce the vector size.
  • the MCS multiple-cloning-site
  • the suitable version of vector has a site of about 3.2 kb.
  • This 3.2 kb vector is used as backbone vector for construction of antibody expression library. When the gene of interest is inserted into this vector in MCS, the gene is expressed when the vector is delivered into mammalian cells.
  • FCS Furin cleavage site
  • This example describes the construction of a vector for stable express of antibody in mammalian cell in both surface anchored version and secreted version simultaneously.
  • dual expression vector For expression of both heavy and light chain from single vector, dual expression vector is constructed. One more expression cassette is inserted into vector pcDNA3.1. The Ch and Cl gene sequences are inserted into this vector at separate cassettes.
  • Promoterl Ch or Cl- PoIyA-- Promoter2— Cl or Ch- PolyA— -Selection marker
  • the vector is further modified by insertion of PDGFR coding sequence at the 3'-end of heavy chain constant region.
  • FCS Furin cleavage site
  • This example describes construction of full-length human antibody mammalian display library.
  • This example shows the building of a full-length human antibody mammalian display library with a diversity of 10 9 or larger.
  • the vector constructed in example 1 is used as the backbone for construction of the library.
  • Vh and Vl are amplified by PCR from ready-to-use cDNA of human immune tissue (bone marrow, spleen and peripheral blood lymphocytes) (BioChain, South San Francisco, CA USA), using primers as described in book Phage Display (Carles et al, Cold Spring Harbor Laboratory Pr.).
  • the PCR conditions are optimized to ensure the efficient and accurate amplification of Vh and Vl.
  • the PCR products are digested with suitable restriction enzymes matched with cloning vector. After digestion the products are purified using PCR purification kit (Qiagen).
  • the heavy chain constant region (Ch) of IgGl the heavy chain constant region (Ch) of IgGl
  • FCS and PDGFR sequence are cloned into the vector from example 1 in MCS. Then the Vh mixture is inserted into the vector in frame before Ch region using T4 ligase. After transformation of ligation mixture, the transformation efficiency and library size are calculated by measuring the transformant number to make sure the library size is 10e5 or larger. The diversity of library is analyzed and calculated more accurately by sequence analysis of more than 100 individual clones.
  • the FCS region may not be included in the vector if the antibody is only need to be expressed on cell surface.
  • the kappa (or lambda) chain constant region (Cl) is cloned into the vector from example 1 in MCS. Then the Vl mixture is inserted into the vector in frame before Cl region using T4 ligase. After transformation of ligation mixture, the transformation efficiency and library size are calculated by measuring the transformant number to make sure the library size is 10e4 or larger. The diversity of library will be analyzed and calculated more accurately by sequence analysis of more than 100 individual clones.
  • Both heavy chain and light chain library vectors can be easily amplified in bacteria and stored in -20C with safe.
  • the antibodies expressed from this library can be anchored on mammalian cell surface for affinity and function screening and selecting directly.
  • part of the antibodies are expressed as soluble molecules into condition medium, which can be used directly for further function analysis and characteristic analysis of antibodies without the conversion of antibodies from membrane anchored format to soluble format, speeding up the screening and selecting.
  • Example 3 describes the expression and screening of mammalian cell surface displayed antibody library and selecting antibody candidates [0175]
  • the libraries constructed from Example 3 are vector DNA and can be amplified. To amplify the vector library, the vector DNAs are transformed into bacteria competent cells. Antibiotic-resistant colonies are collected and vector DNAs are purified from bacteria using max-prep kit (Qiagen).
  • transfection conditions are optimized in terms of cell density, vector DNA dose, the ratio of heavy and light chain libraries, transfection reagent and transfection procedure using transfection optimization kit (Biocompare, S. San Francisco, CA).
  • the 293 cells are splited as need and seeded into T225 flasks coated with 1% poly-lysine.
  • the DNA library mixture is transfected into 293 cells in T225 flasks. 48-72 hours post-transfection, the cells are dissociated using dissociate buffer (Invitrogen) and suspended in staining buffer (PBS with 2% FBS) in a density of Ie6- Ie7/ml. The cells are double- stained with PE-labeled mouse anti-human IgGl heavy chain and FITC-labeled anti-human kappa chain constant region antibodies (1 ug / ml). Then the expression of antibodies on the cell surface is analyzed by FACS. Usually more than 90% of the cells are stained positively compared to negative control. This is the primary cell library.
  • the selected antigen (for specificity, see other examples) is labeled with biotin, then used to staining the antibody positive cell population as conformed as described above.
  • the streptavidin-conjugated magnetic beads (Dynal/Invitrogen) are mixed with antigen-stained cell population.
  • the specific antibody positive cells are captured by magnetic beads and collected by magnetic field as described in product manual.
  • the cells are stained with FITC- conjugated anti-light chain antibody or PE-conjugated specific antigen or both.
  • the primary cell pool and sub-cell pools are FACS analyzed to calculate enrichment efficiency.
  • the total mRNA is extracted from the final sub- cell pool.
  • the Vh and Vl regions are RT-PCR amplified, restriction enzyme digested and purified.
  • Obtained Ch and Cl are inserted into stable expression vector from example 2 in frame with its constant partner to form a full-length heavy chain gene and full-length light chain gene to build a stable expression sub-library.
  • this vector the pair of heavy and light chain is fixed and only one type of antibody is expressed if only one vector is integrated in the genome.
  • the stable expression sub-library is transfected into CHO cells.
  • the transfection conditions are optimized in multiple parameters including DNA dose, mixing with different amount of non-expression vector, and transfection procedure.
  • the expression level and specific binding affinity of the antibodies are analyzed by FACS.
  • the single cells which exhibit high expression and high affinity are isolated by single cell FACS sorting.
  • the specific antibody genes are cloned by RT-PCR from these single cell populations and sequence confirmed that they are single clones.
  • the selected antibody gene can be expressed in large scale for further analysis.
  • Vh and Vl are amplified by PCR from ready-to-use cDNA of mouse immune tissue (bone marrow, spleen and peripheral blood lymphocytes) (BioChain, South San Francisco, CA USA), using primers as described in book Phage Display (Carles et al, Cold Spring Harbor Laboratory Pr.).
  • the PCR conditions are optimized to ensure the efficient and accurate amplification of Vh and Vl.
  • the PCR products are digested with suitable restriction enzymes matched with cloning vector. After digestion the products are purified using PCR purification kit (Qiagen).
  • the human heavy chain constant region (Ch) of IgGl, FCS and PDGFR sequence are cloned into the vector from example 1 in MCS. Then the mouse Vh mixture is inserted into the vector in frame before Ch region using T4 ligase. After transformation of ligation mixture, the transformation efficiency and library size are calculated by measuring the transformant number to make sure the library size is 10e5 or larger. The diversity of library is analyzed and calculated more accurately by sequence analysis of more than 100 individual clones.
  • the FCS region may not be included in the vector if the antibody is only need to be expressed on cell surface.
  • the human kappa (or lambda) chain constant region (Cl) is cloned into the vector from example 1 in MCS. Then the mouse Vl mixture is inserted into the vector in frame before Cl region using T4 ligase. After transformation of ligation mixture, the transformation efficiency and library size are calculated by measuring the transformant number to make sure the library size is 10e4 or larger. The diversity of library will be analyzed and calculated more accurately by sequence analysis of more than 100 individual clones.
  • Both heavy chain and light chain library vectors can be easily amplified in bacteria and stored in -20C with safe.
  • the antibodies expressed from this library can be anchored on mammalian cell surface for affinity and function screening and selecting directly.
  • part of the antibodies are expressed as soluble molecules into condition medium, which can be used directly for further function analysis and characteristic analysis of antibodies without the conversion of antibodies from membrane anchored format to soluble format, speeding up the screening and selecting.
  • mouse constant regions of heavy and light chains are used to replace the human counterparts in the vector.
  • This example describes construction of antibody-like bivalent peptibody mammalian display library
  • an antibody-like, bivalent, mammalian displayable peptibody library is constructed.
  • a polypeptide gene library is in vitro synthesized.
  • the DNA sequence of the library has a size of 36-72 nucleotides franked at both ends with restriction enzyme recognizing sequences for cloning the library into expression vector.
  • This example shows the construction of a single expression cassette vector for rapid construction of antibody libraries and expression of antibody proteins on mammalian cell surface.
  • the vector constructed contains full length human heavy chain fused at the 3' end with trans-membrane domain (TM) of platelet derived growth factor receptor (PDGFR), To reduce the size, the vector we designed contains no selection gene expression cassette, which usually would be used for the selection in mammalian cells.
  • TM trans-membrane domain
  • PDGFR-TM platelet derived growth factor receptor
  • 9 primers have been designed (Table 1). HC-TM was obtained by 5 PCRs. Using total RNA isolated from human PBMC as a template, variable domain of heavy chain has been first RT-PCR amplified by primer Pl and P2 (PCR-I).
  • PCR-2 was performed using primers P3 and P4 and the products from PCR- 1 as template to introduce Nhel/BstxI/Sfil/BsmBI enzyme recognizing sequences before the start codon and the second BsmBI recognizing sequence in frame at the 3' end of the variable domain.
  • Human IgG- 1 constant region was RT-PCR amplified from total RNA isolated from human PBMC by P5 and P6 (PCR-3) to introducing second BsmBI recognizing sequence at 5' end and BamHI recognizing sequence at the 3' end.
  • the 4 th RT-PCR was performed using P7 and P8 to amplify PDGFR-TM. At the 5' end of TM, a BamHI cutting site was incorporated.
  • the final PCR (PCR-5) used fragments from PCR 2, 3, and 4 as templates and primers P3 and P9 to introduce Sfil/BstXI/XhoI recognizing sequence at the 3' end of this fusion protein.
  • the final PCR product (fragment 5) contains full length human heavy chain and PDGFR-TM. After digestion with Nhel and Xhol, the fragment was inserted into the vector pcDNA 5/FRT between Nhel and Xhol at multiple cloning site to form the interim vector. [0215] To reduce the total size of the vector, the hygromycin B selection gene expression cassette was deleted from the interim vector.
  • primers P201 (5'- ctaactgacacacattccacagaagcttcaccctaatcaagttttttgggg-3') and P202 (5'- tgtatcttatcatgtctgtataccgaagcttcctctagctagagcttggcg-3') were designed to contain HindIII recognizing sequence and complimentary to the interim vector.
  • results show that using competent cells with an efficiency of 3 ⁇ 10 7 , the ligation- transformation efficiency of lug of DNA can reach up to 3.2 x 10 6 (Table 2).
  • the transformation efficiency of group 1 where the vector was digested by Nhel and Xhol, has an efficiency of 0.94 ⁇ 10 6 , lower than the other three groups.
  • the vector fragment from Nhel and Xhol digestion can be self-ligated without insert fragment.
  • the vector fragments from other three groups show no self-ligation. It is reasonable to say that this vector self-ligation reduces the effective ligation between vector fragment and insert fragment in real ligation, decreasing the transformation efficiency and increasing the background (8.6%, Table 2- A).
  • 4 colonies were randomly picked from each group for analysis and all 16 clones (4 for each ligation) show right sized fragments. [0217] Table 2
  • the vector pDGB-HC-TM contains only HC-TM fusion protein but full length antibodies need simultaneous expression of heavy chain and light chain in single cells.
  • primer P 182 (5 '-
  • the vectors pDGB-HC- TM and pDGB-huKappa were co-transfected into 293-T Cells.
  • the transient expression of antibodies on cell surface was analyzed by FACS 60-hours post transfection.
  • Parental 293-T cells show no antibody expression on cell surface when staining with PE-conjugated mouse anti-human kappa chain antibodies and FITC-conjugated mouse anti-human IgG antibodies.
  • the cells transfected by pDGB-HC-TM show heavy chain expression on the cell surface but no detection of kappa chain expression.
  • Cells transfected by pDGB-huKappa, neither heavy chain nor light chain were detected on cell surface.
  • the heavy chain and light chain can be separately and simultaneously detected. These results suggest that if the light chain can be detected on the cell surface, the cell will contain heavy chain too. Only heavy chain and light chain co-expressed in the cells, the full length antibodies can be detected on the cell surface.
  • Antibody libraries were constructed by insertion of antibody genes into a proper vector to form a recombinant plasmid DNA. After introduced into a proper host cell, the antibody will be expressed for screening and selection.
  • One of the key steps in construction of antibody libraries is effective ligation of vector fragment and insert fragment. Commonly used restriction enzymes form palendromic ends after digestion, allowing self- ligation occur and reducing the ligation efficiency.
  • the vector pDGB-HC-TM contains IgGl heavy chain constant region and transmembrane domain.
  • BsmBI cutting sites a Vh library can be easily inserted into the vector.
  • BstXI or Sfil the HC-TM can be replaced.
  • BamHI cutting site between CH and TM and downstream Xhol site the TM can be easily deleted to express soluble antibodies.
  • Example 7 has shown successful construction of a universal single expression cassette vector utilizing restriction enzymes BstXI, BsmBI and Sfil, which recognize and cleavage unique sequences to prevent self ligation, and demonstrates high insertion efficiency of HC or LC.
  • restriction enzymes BstXI, BsmBI and Sfil which recognize and cleavage unique sequences to prevent self ligation, and demonstrates high insertion efficiency of HC or LC.
  • the ligation and transformation efficiency of this single expression cassette vector can easily reach 10 7 clones per ⁇ g of ligated DNA.
  • this vector is only capable of single heavy chain or light chain insertion.
  • PCR- amplified human kappa chain library and human heavy chain variable domain library were used in the four-way ligation to replace the gene fragments obtained from digestion of clone 16.
  • the ligation and transformation efficiency is IxIO 5 per ⁇ g of ligated DNA.
  • FCS Fluorescence Cleavage Site
  • FCS furin cleavage site
  • Ch heavy chain constant domain
  • TM PDGFR trans-membrane domain
  • Flip-In system comprises of vector pcDNATM 5/FRT, vector pOG44, Flip-in Chinese hamster ovary (FCHO) cell line, and related cell maintenance medium.
  • FCHO Flip-in Chinese hamster ovary
  • FIp-In system only a single copy of transfected vector will be integrated into one cell genome in a designated location through recombinase-mediated DNA recombination. In that way, the expression of same antibody from different vectors will only be dependent on that vector's characteristics, and we would not have to consider underlying variables such as copy numbers of the integrated vector, or the location of integration.
  • FCS FCS-binding protein
  • our display system can generate both membrane-bound antibodies for screening and soluble antibodies for function assay.
  • the human antibody on cell surface can be detected by very low concentration of PE-conjugated anti-human kappa chain antibody (one seventh of manufacture's suggested dose) and the concentration of human antibody in conditioned medium was estimated at 1-2 ug per ml. Therefore, the insertion of FCS into vector pDGB4 allows for the selection of high affinity antibodies through FACS and direct use of culture medium from the cells for function assays.
  • the use of cleavage activity of inherent furin in combination with anchoring ability of transmembrane domain to express secreted and membrane-bound antibodies simultaneously has not been reported before.
  • any other genes can also be inserted as long as they have the correct ends.
  • future applications of our vector platform may easily exceed antibody expression and become pivotal in any protein expression experiments.
  • it can be used to clone other pairs of genes such as receptor and ligand or both subunits of T-cell receptors. Co-expression of these molecules through single vector could even help in quantitatively analyzing the relationship between the molecules.
  • This example shows the construction of a full-length human antibody mammalian display library with combinatory diversity more than 10 11 .
  • 10 9 of peripheral blood mononuclear cells (PBMC) were isolated from more than eighty donors.
  • Total RNA was isolated from PBMC using RNA Easy kit (Qiagen).
  • the genes of variable domain of human IgGl heavy chain (Vh) and kappa light chain (LC) were amplified by two-step RT-PCR.
  • the PCR products were digested with suitable restriction enzymes matched with cloning vector. After digestion, the products were purified by gel extraction kit (Axygen, Union City, CA).
  • Vh library was inserted into the vector of example 1 in frame before human immunoglobulin constant region (Ch) using T4 DNA ligase. After transformation of ligation mixture, the transformation efficiency and library size were calculated by counting the number of transformants and the size of human IgGl heavy chain library was 1.32 x 10 6 . Vh regions of 10 colonies were sequence analyzed. 8 out of 10 had right coding sequences. [0248] Full-length kappa chain library was cloned into the vector of example 1. The library size was 6.21 x 10 5 . Kappa genes of 10 colonies were sequence analyzed. 8 out of 10 had right coding sequences.
  • the plasmid DNA of ten heavy chain clones were co-transfected with single kappa chain clone which had been tested to express kappa chain in high level and the plasmid DNA of ten kappa chain clones were co-transfected with single heavy chain clone which had also been tested to express heavy chain in high level.
  • the expression of antibody on transfected cell surface was FACS analyzed. 6 out of 10 heavy chain clones and 5 out of 10 kappa chain clones were expressed in different levels.
  • This library was a primary, universal full-length human antibody
  • immunoglobulin Gl/Kappa immunoglobulin Gl/Kappa library.
  • the antibodies expressed from this library were anchored on mammalian cell surface for affinity and function screening and selecting directly.
  • the libraries included human HBV specific, human renal cancer specific library, human self-immune disease specific libraries, and personal specific libraries.
  • RNA isolated from spleen cells of Kuanming mice immunized with human tumor cells (Liver cancer 7721, lung cancer A549 and Colon cancer DLD-I).
  • the library had a combinatory diversity of 1.11 x 10 10 theoretically and 1.78 x 10 9 in DNA level.
  • the peptide libraries were constructed using assembling PCR with mouse signal peptide in frame at 5 '-end of the genes and proper restriction enzyme cutting sequences franked at both ends.
  • the DNA sequence of the peptide library had a size of 36 nucleotides, coding for a peptide of 12 amino acids.
  • PepG library human IgGl constant region
  • PepK library fused to constant region of human kappa chain
  • PepG and PepK libraries had sizes of 3.96 x 10 5 and 1.19 x 10 6 respectively.
  • 10 pepG clones and 9 pepK clone were sequence analyzed. 7 out of 10 pepG gave sequence results and 4 out of 7 had right coding sequences. 6 out of 10 pepK clones had right coding sequences.
  • FACS analysis was carried out using FITC-conjugated TNF, HBsAg and proteins from human colon tumor DLD-I cells and binding of these antigens to the ALBP library-transfected 293-T cells was demonstrated.
  • This example shows the construction of HIV- specific human antibody library and isolation of HIV gpl20 specific antibodies from the library
  • PBMC was isolated from HIV-infected long survivor donor and total RNA was isolated from PBMC using RNA Easy kit (Qiagen).
  • the genes of variable domain of human immunoglobulin heavy chain (Vh) were amplified by two-step RT-PCR. The amplification of human kappa chain was not successful.
  • PCR products of Vh were digested with suitable restriction enzymes matched with cloning vector. After digestion the products were purified by gel extraction kit (Axygen, Union City, CA).
  • Vh library was inserted into the vector of example 1 in frame before IgGl constant region (Ch) using T4 DNA ligase and the size of heavy chain library was 1.16 x 10 5 (HIV-Vh-Lib).
  • the HIV Vh library was also inserted into the vector of example 2 by 4-way ligation. In the construction, the single kappa chain gene CZRl was used instead of kappa chain library. The library size was 7.8 x 10 4 (HIV-CZR-Lib).
  • the HIV-CZR-Lib was transfected into FCHO cells and selected under hygromycin (500 ug/ml). The stable selected cell pool was stained by FITC-conjugated HIV envelope protein gpl20 (FITC-gpl20) and analyzed by FACS. About 3% of the cells were shown the specific antigen binding, indicating the presence of gpl20-pecific antibody on cell surface. This portion of the cells was isolated by FACS and the Vh genes coding for the specific antibodies were PCR amplified and analyzed by standard molecular biology techniques. One of the clones showed specific binding to FITC-gpl20.
  • This example shows the composition of human antibody library construction kit and the rapid construction of a personalized human antibody library by this kit.
  • the core kit contained: 1) single expression cassette vector; 2) dual expression cassette vector; 3) human heavy chain primer set 1, 2 and 3 (HGPl, HGP2 and KGP3) and 4) human kappa chain primer set 1, 2 and 3 (HKPl, HKP2 and HKP3).
  • the amplified antibody genes were purified, digested by proper restriction enzymes and inserted into the single expression cassette vector.
  • the sizes of heavy chain and kappa chain libraries were 9.4 x 10 4 and 8.4 x 10 4 respectively.
  • the size of combinatory library was 7.9 x 10 9 .

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Urology & Nephrology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Virology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Food Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

La présente invention concerne des procédés d’isolement d’un polynucléotide codant pour un polypeptide tel qu’un anticorps ayant une propriété souhaitée au moyen du criblage d’une banque de présentation mammalienne et des procédés de génération d’une banque de polynucléotides codant pour des polypeptides tels que des anticorps, où les polynucléotides codent collectivement pour au moins 109 polypeptides différents. La présente invention concerne en outre des kits pour mettre en œuvre les procédés présentement décrits, des polynucléotides isolés par les procédés présentement décrits, des banques codant pour le réservoir d’anticorps de différentes espèces comprenant les humains, la souris, le lapin, et des polypeptides codés par les polynucléotides.
PCT/US2009/065393 2008-11-21 2009-11-20 Banque de présentation mammalienne de haute complexité et procédés de criblage WO2010059981A2 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN2009801545883A CN102282266A (zh) 2008-11-21 2009-11-20 高复杂度哺乳动物展示文库及其筛选方法
US13/130,561 US20120101000A1 (en) 2008-11-21 2009-11-20 High complexity mammalian display library and methods of screening

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US11702808P 2008-11-21 2008-11-21
US61/117,028 2008-11-21
US27695609P 2009-09-18 2009-09-18
US61/276,956 2009-09-18

Publications (2)

Publication Number Publication Date
WO2010059981A2 true WO2010059981A2 (fr) 2010-05-27
WO2010059981A3 WO2010059981A3 (fr) 2010-08-12

Family

ID=42198831

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/065393 WO2010059981A2 (fr) 2008-11-21 2009-11-20 Banque de présentation mammalienne de haute complexité et procédés de criblage

Country Status (3)

Country Link
US (1) US20120101000A1 (fr)
CN (1) CN102282266A (fr)
WO (1) WO2010059981A2 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015120058A2 (fr) 2014-02-05 2015-08-13 Molecular Templates, Inc. Procédés de criblage, de sélection et d'identification de polypeptides de recombinaison cytotoxiques fondés sur une diminution provisoire de la ribotoxicité
EP2991679A4 (fr) * 2013-04-29 2016-12-07 Adimab Llc Réactifs multispécificité, procédés de préparation et d'utilisation associés
US11286477B2 (en) 2014-05-02 2022-03-29 Iontas Limited Preparation of libraries of protein variants expressed in eukaryotic cells and use for selecting binding molecules
EP4130260A4 (fr) * 2020-03-27 2024-05-15 Ddbio Co Ltd Shang Hai Procédé de construction et application d'un vecteur d'affichage de gène de polypeptide de liaison spécifique d'un antigène

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100069614A1 (en) 2008-06-27 2010-03-18 Merus B.V. Antibody producing non-human mammals
CA2791109C (fr) 2011-09-26 2021-02-16 Merus B.V. Generation de molecules de liaison
AU2014321251B2 (en) * 2013-09-23 2020-04-16 X-Body, Inc. Methods and compositions for generation of binding agents against cell surface antigens
GB201704115D0 (en) * 2017-03-15 2017-04-26 Oxford Genetics Ltd Method of selecting for antibodies
GB201903233D0 (en) 2019-03-08 2019-04-24 Oxford Genetics Ltd Method of selecting for antibodies
US20220154174A1 (en) 2019-03-08 2022-05-19 Oxford Genetics Limited Method of Selecting for Antibodies
MX2022012005A (es) * 2020-03-27 2022-10-21 Ddbio Co Ltd Shang Hai Metodo para el despliegue de anticuerpo biespecifico en la superficie de celula de mamifero y vector.
CN112538499A (zh) * 2020-12-22 2021-03-23 北京鼎成肽源生物技术有限公司 一种重组质粒载体、抗体展示细胞系及其应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050282181A1 (en) * 2003-12-22 2005-12-22 Wei Yan Methods for identifying functional antibodies
US20060078561A1 (en) * 1994-01-31 2006-04-13 The Trustees Of Boston University Polyclonal antibody libraries
WO2008070367A2 (fr) * 2006-11-01 2008-06-12 Facet Biotech Corporation Banques d'affichage d'immunoglobine à base de cellule de mammifère

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT1298207E (pt) * 2001-10-01 2010-11-08 Deutsches Krebsforsch Processo para a produção de bibliotecas de proteínas e para a selecção de proteínas a partir da mesma

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060078561A1 (en) * 1994-01-31 2006-04-13 The Trustees Of Boston University Polyclonal antibody libraries
US20050282181A1 (en) * 2003-12-22 2005-12-22 Wei Yan Methods for identifying functional antibodies
WO2008070367A2 (fr) * 2006-11-01 2008-06-12 Facet Biotech Corporation Banques d'affichage d'immunoglobine à base de cellule de mammifère

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2991679A4 (fr) * 2013-04-29 2016-12-07 Adimab Llc Réactifs multispécificité, procédés de préparation et d'utilisation associés
US10156574B2 (en) 2013-04-29 2018-12-18 Adimab, Llc Polyspecificity reagents, methods for their preparation and use
US10883997B2 (en) 2013-04-29 2021-01-05 Adimab, Llc Polyspecificity reagents, methods for their preparation and use
WO2015120058A2 (fr) 2014-02-05 2015-08-13 Molecular Templates, Inc. Procédés de criblage, de sélection et d'identification de polypeptides de recombinaison cytotoxiques fondés sur une diminution provisoire de la ribotoxicité
US11286477B2 (en) 2014-05-02 2022-03-29 Iontas Limited Preparation of libraries of protein variants expressed in eukaryotic cells and use for selecting binding molecules
US11912984B2 (en) 2014-05-02 2024-02-27 Iontas Limited Preparation of libraries of protein variants expressed in eukaryotic cells and use for selecting binding molecules
US11926818B2 (en) 2014-05-02 2024-03-12 Iontas Limited Preparation of libraries of protein variants expressed in eukaryotic cells and use for selecting binding molecules
EP4130260A4 (fr) * 2020-03-27 2024-05-15 Ddbio Co Ltd Shang Hai Procédé de construction et application d'un vecteur d'affichage de gène de polypeptide de liaison spécifique d'un antigène

Also Published As

Publication number Publication date
US20120101000A1 (en) 2012-04-26
CN102282266A (zh) 2011-12-14
WO2010059981A3 (fr) 2010-08-12

Similar Documents

Publication Publication Date Title
US20120101000A1 (en) High complexity mammalian display library and methods of screening
JP6043431B2 (ja) 特異的な結合タンパク質または機能性タンパク質の遺伝子転位を利用した同定
US20220090053A1 (en) Integrated system for library construction, affinity binder screening and expression thereof
US7968313B2 (en) Selection of cells expressing heteromeric polypeptides
WO1995015393A1 (fr) Nouveau vecteur de detection d'expression
JP6019540B2 (ja) 抗原特異的又はリガンド特異的結合タンパク質の同定
CN109810188A (zh) 用于克隆和表达关联抗体可变区基因区段的快速方法
EP2401295A1 (fr) Procédé de production d'anticorps
JP2023081910A (ja) ポリペプチド発現系
US20130143238A1 (en) Procedure for the generation of a high producer cell line for the expression of a recombinant anti-cd34 antibody
US20190031752A1 (en) Method for Producing Antibodies
AU2007200686B2 (en) Selection of cells expressing heteromeric polypeptides
AU2002331883A1 (en) Selection of cells expressing heteromeric polypeptides

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200980154588.3

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09828314

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 13130561

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 09828314

Country of ref document: EP

Kind code of ref document: A2