WO2009144480A1

WO2009144480A1 - Treatment and diagnosis of behavioural disorders

Info

Publication number: WO2009144480A1
Application number: PCT/GB2009/001367
Authority: WO
Inventors: Zosia Miedzybrodzka; David St Clair; Berndt Muller; Milu Neves-Pereira; Doreen Massie
Original assignee: University Court Of The University Of Aberdeen; Grampiant Health Board
Priority date: 2008-05-30
Filing date: 2009-05-29
Publication date: 2009-12-03
Also published as: GB2473575A; GB201021794D0; GB2473575B; GB0809821D0

Abstract

The present invention concerns the identification of a novel drug target for use in the treatment of behavioural disorder, hi particular, the invention provides compounds capable of modulating the expression, function and/or activity of eIF4E, for use in treating a behavioural disorder as well as methods of identifying the same.

Description

TREATMENT AND DIAGNOSIS OF BEHAVIOURAL DISORDERS FIELD OF THE INVENTION

The present invention concerns the identification of a novel drag target for use in the treatment of behavioural disorders such as, for example, autism and schizophrenia, diagnostic assays and associated methods. BACKGROUND TO THE INVENTION

Autistic disorder (AD) is a common form of childhood neurodevelopmental disorder, characterised by severe and sustained impairment of social interaction and social communicative abilities, as well as a markedly restricted repertoire of activities and interests (American Psychiatric Assocation, 1994). It is a form of Pervasive Developmental Disorder (PDD). Other forms of PDD include Asperger's syndrome which differs from AD by being associated with normal development of language, and 'PDD not otherwise specified' where severe impairment still exists but not all criteria are met. The term 'Autistic Spectrum Disorder' (ASD) is also widely used as an umbrella term for these conditions, reflecting the view that a common, genetically- based aetiology, may be variably expressed to manifest in a broad range of phenotypic variation. ASD is increasingly being recognised as a significant health problem affecting around 1 in 200 individuals (Scott FJ et al, 2002; Fombonne, 2003; PHIS, 2002), and leading to variously disabling consequences for the individual throughout their lifespan. Current treatments are palliative and have little effect on the natural history of the disorder.

Little is known about the aetiology of autistic disorder, but evidence suggests that it is multifactorial with a strong genetic basis (Folstein et al., 2001). Environmental components clearly play a role, but there is no definite evidence for any specific agent. It is also unclear whether these are primary or whether they precipitate disease in a genetically predisposed individual. The most controversial environmental agent is mercury (Fitzpatrick M, 2003). Evidence for a major genetic component in Autistic disorder and more broadly defined PDD comes from both twin and family studies. Bailey et al, (1995) found that in Autistic disorder, 60% of monozygotic (MZ) twins were concordant. When a broader spectrum of related cognitive or social abnormality was considered, 92% of MZ twins were concordant compared with 10% of DZ twins. Sibs of cases have a 2.9% risk of being similarly affected, compared with 0% of controls for both autistic disorder and PDD (Bolton et al, 1994). When more subtle communication and social impairments are considered, 12 to 20% of siblings exhibit this lesser variant. Polygenic inheritance is likely but estimates on the number of genes vary from two to 10 (Pickles et al, 1995; Folstein et al, 2001).

Both locus and allelic heterogeneity may be present. As a result, some cases of autistic disorder may be due to mutations in genes of major effect while in others several genes of modest effect are responsible. Although mapping genes of major effect using recombination in families should be relatively straightforward, in practice most families with autistic disorder rarely have more than two affected members available for study. Furthermore, reduced fecundity ensures that affected cases are rarely found in more than two generations. Consequently linkage approaches need to rely on cumulative lod scores. This can lead to failure to demonstrate linkage in the presence of locus heterogeneity. For example, the recently identified Bardet-Biedel syndrome gene TTC8 was on chromosome 14q, a region not highlighted by linkage studies in families (Ansley SJ et al, 2003).

In autistic disorder, genome wide linkage studies and follow up analyses have yielded suggestive linkage to several autosomal regions as well as sites on the X- chromosome (OMIM, 2004). The largest scan to date, using 345 families from the Autism Genetic Resource Exchange (AGRE) collection, has found strongest linkage to chromosomes 17q,5p,llp and 4q (Yonan et al 2003). The most promising findings to date are mutations in neuroligins NLGN3 and NLGN4 on the X chromosome (Jamain S et al, 2003). However, the relevance of these findings may be reduced as mental retardation is combined with autistic features. Similarly, a large number of association studies examining candidate genes within and out with the above mentioned hot-spot regions, have so far failed to provide unequivocal evidence of involvement of a particular gene in autistic disorder. The vast majority of the genetic contribution to autism remains unexplained.

In a group of 525 subjects with autism who were karyotyped and had no recognised underlying medical condition, Castermans et al. (2003) identified four cases with a de novo chromosomal aberration and no family history of autistic disorder. Molecular analysis of the first of these (46,XY,t(5;13)(ql2.1;ql3.2)) led to identification of the gene neurobeachin on chromosome 13q as a candidate gene for autism.

Where an apparently balanced reciprocal translocation is associated with a disease phenotype, the translocation is more likely to be causative where either (1) an isolated case carries the translocation de novo (i.e. it is not present in either parent), or (2) where the disease phenotype segregates with the translocation in the family. There is a strong scientific case for analysis of the breakpoint regions in these circumstances and there are several ways in which the translocation may be implicated in the disease under investigation. Only by analysis of the breakpoint regions can one assess if one of the following possibilities is applicable: (a) there is direct disruption of the responsible gene in the translocation carrier(s) (b) there is disruption of a control element of a responsible gene in the translocation carrier(s)- this control element need not be at the site of the gene e.g. in translocations causing aniridia, control elements of the Pax 6 gene located more than 100kilobases(kb) downstream of the gene (c) Even if a gene or its control elements are not directly disrupted, whole gene rearrangement may cause the phenotype. Where a gene is thus implicated in the translocation carrier(s) it may also be directly involved in idiopathic cases of the disease. If so, one might expect to find mutations in at least a few non-translocation / idiopathic cases. Alternatively no mutations may be found, but the candidate gene may harbour a functional variant enriched in idiopathic cases. If neither mutations, nor functional variants are found in idiopathic cases, the translocation associated gene may still be important in elucidating our understanding of the disease as a whole, as it may implicate a hitherto unsuspected molecular homologue or biochemical pathway that is relevant to the more common disorder. The association between a translocation and a phenotype may alternatively arise by chance. To date, insufficient disease-associated translocation breakpoints have been analysed to estimate what proportion of overall cases this latter group comprise. However, the more rare the phenotype, the more likely the association has not arisen by chance.

Autism (OMEVI 209850) is a common childhood onset neurodevelopmental disorder, characterized by severe and sustained impairment of social interaction and social communicative abilities, as well as a markedly restricted repertoire of activities and interests. Although multifactorial in origin, autism has a strong genetic basis with monozygotic twin concordance approaching 90%^!. It is clinically heterogeneous with up to 10% of cases associated with well defined neurological disorders such as tuberous sclerosis and fragile X syndrome¹. Genome wide linkage studies yielded linkage peaks on chromosomes 17q, 5p,llp and 4q ^" , and rare mutations have found at several loci including the neuroligin, neurexin and SHANK3 genes^5"7. Microscopic chromosomal rearrangements are seen in 3-6% of autism , submicroscopic copy number variations (CNVs) in at least 10% of sporadic, but fewer, <2%, in familial cases⁹'¹⁰. Here we implicate the eukaryotic translation initiation factor 4E gene {EIF4E) in autism.

SUMMARY OF THE INVENTION

The present invention results from the observation that levels of eIF4E activity and/or expression are involved in the development of behavioural disorders such as autism and/or schizophrenia in humans. More specifically, genetic variation, mutations and/or alterations in the eIF4E promoter or other regulatory elements within, outside (i.e. upstream or downstream therefrom) or associated with the eIF4E gene (referred to hereinafter as "associated regulatory elements"), may modulate the level of eIF4E activity and/or expression which in turn may lead to the development of a behavioural disorder. The level of eIF4E activity/expression may also be modulated by other cellular components which interact, either directly (for example by binding to) or indirectly (for example, via some other component) with eIF4E.

Accordingly, the present invention concerns the use of compounds which modulate the expression, function and/or activity of eIF4E in methods and medicaments for treating a behavioural disorder. Furthermore, the invention also provides methods for the identification, screening and or testing of agents which may be useful in the treatment of a behavioural disorder.

Thus in a first aspect, the present invention provides a compound capable of modulating the expression, function and/or activity of eIF4E, for use in treating a behavioural disorder. In a second aspect, the present invention provides the use of a compound capable of modulating the expression, function and/or activity of eIF4E, in the manufacture of a medicament, for the treatment of a behavioural disorder.

It should be understood that the term "behavioural disorder" includes disorders such as autism and/or schizophrenia. Furthermore, the methods, uses and compositions and diagnostic, testing and screening assays provided by this invention concern autism and schizophrenia.

Hereinafter it is to be understood that references to "eIF4E" relate not only to the complete eIF4E gene and its protein product but fragments/portions of either. Moreover, the term "eEF4E" may encompass associated nucleic acid and/or protein/peptide sequences (including any fragment or fragments derived therefrom). Furthermore, the term "eIF4E" includes altered or mutated forms of any of the above and one of skill in the art will appreciate that a nucleic acid and/or amino acid sequence may be considered "mutated" and/or "altered" if the (primary) sequence, structure and/or organisation of that sequence differs from that of a reference nucleic acid or amino acid sequence.

In addition to compounds which directly affect the eIF4E gene and/or the protein product thereof, the term "compound capable of modulating the expression, function and/or activity of eIF4E" may include compounds which modulate the expression, function and/or activity of components associated, either directly, or indirectly, with eIF4E. For example, the compounds provided by the present invention may exert their effects (i.e. the modulation of eIF4E expression, function and/or activity) by modulating the expression, function and/or activity of an eIF4E associated nucleic acid and/or protein. The term "eIF4E associated nucleic acid" includes nucleic acid sequences, whether ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), which are either directly or indirectly associated with eIF4E. For example, a directly associated nucleic acid sequence may be taken to be the eIF4E promoter region, an associated (possibly downstream) regulatory element or any messenger RNA derived therefrom. Indirectly associated nucleic acid sequences may be those sequences which, for example, modulate the activity of eIF4E or provide transcription factors or other elements (for example components of pathways) which regulate the expression of eIF4E or interact with eIF4E to regulate gene expression and translation.

Similarly, the term "eIF4E associated proteins" may be taken to relate to protein or peptide sequences which are either directly or indirectly associated with eIF4E. Directly and/or indirectly associated proteins/peptides may be encoded by the abovementioned associated nucleic acids. Consequently, a directly associated protein may interact with eIF4E to modulate its function and/or level of expression. An indirectly associated protein may interact with other cellular components (for example those involved in cellular pathways) which in turn modulate the activity and/or level of expression of eIF4E.

In certain embodiments, the present invention provides compounds capable of modulating compounds involved in pathways directly or indirectly associated with eIF4E. by way of example a pathway directly associated with eIF4E may comprise a step which requires eIF4E. In directly associated pathways may yield one or more products which interact with e!F4e. For example, the present invention may provide medicaments and/or methods which use compounds capable of modulating mammalian target of rapamycin (mTOR) signalling and/or pathways associated with mTOR signalling. By way of example, the terms "associated nucleic acid" and "associated protein" may include cellular components which interact with eIF4E such as, for example, the eukaryotic elongation factors (elF) 4A (an RNA helicase) and 4G (a scaffold protein) which interact with eIF4E to form a complex known as eIF4F. Additionally, the terms may include eIF4B, which stimulates the activity of the eIF4A helicase, or eukaryotic initiation factor (elF) 3. Furthermore, eukaryotic initiation factor 4E binding proteins (eIF4E-BP: for example the specific proteins 4EBP 1, 4EBP2, or 4EBP3), which compete with eIF4G for eIF4E binding, may also be regarded as "eIF4E associated proteins". Other cellular components known to interact (either directly or indirectly) with eIF4E include mascin and cytoplasmic polyadenylation element binding protein (CPEB) (Richter and Lorenz, 2002) . For the avoidance of doubt, in addition to each of the eIF/eIF binding proteins mentioned above, the present invention contemplates medicaments, uses and methods which may involve the use of the nucleic acids encoding the same.

A "reference" nucleic acid and/or amino acid sequence may be, for example, a naturally occurring mammalian eIF4E gene, eIF4E protein, eIF4E associated nucleic acid or eIF4E protein sequence derived from, for example a rodent or human (Homo sapiens sapiens). Exemplary reference sequences are provided at the National Center for Biotechnology Information (NCBI) identified using accession number M15353.

The term "modulation" may be taken to mean either an increase or decrease in the activity or expression of eIF4E relative to the activity or expression of eIF4E in a healthy (or non-Autistic) individual. In one embodiment, the compounds provided by the present invention and which modulate the expression, function and/or activity of eIF4E increase the expression, function and/or activity thereof. The present inventors have determined that in certain cases, the level of eEF4E promoter activity in a person suffering from or predisposed to a behavioural disorder, is greater than level of promoter activity in a non-Autistic individual. As such, one of skill in the art will appreciate that a compound which is capable of decreasing the level of eIF4E gene and or protein expression, function and/or activity may be useful in the treatment of a behavioural disorder. hi a third aspect, the present invention provides a method of treating a patient suffering from a behavioural disorder, said method comprising the step of administering a therapeutically effective amount of a compound capable of modulating the expression, function and/or activity of eIF4E.

The present invention also provides an eIF4E gene sequence or fragment thereof, which gene sequence or fragment thereof, is capable of expressing one or more copies of the eIF4E protein, for use in treating a behavioural disorder and/or in methods of treatment or the manufacture of medicaments, for treating a behavioural disorder.

It will be appreciated that the present invention also extends to methods of treating a behavioural disorder by administering to a patient suffering or predisposed to developing a behavioural disorder a DNA construct comprising an eIF4E gene sequence or fragment thereof, which gene sequence or fragment thereof is capable of expressing one or more copies of the eIF4E protein, whereby expression of said one or more copies of the eIF4E protein treats or ameliorates said disease(s).

Typically, the eIF4E sequence or fragment thereof will be administered to a subject in the form of a recombinant molecule comprising said eIF4E sequence or fragment under appropriate transcriptional/translational controls to allow expression of said eIF4E protein when administered to a subject. It will be appreciated that the eIF4E sequence or fragment may be under control of a suitable promoter, such as a constitutive and/or controllable promoter. Convenient promoters include the native eIF4E promoter and other types of promoters including, for example, constitutive promoters such as the Simian Virus 40 promoter, chemically inducible promoters such as the tetracycline promoter or physically-regulated promoters such as the heat shock and tissue-specific promoters.

The present invention also provides a recombinant molecule comprising an eIF4E sequence or fragment thereof for use in therapy. The recombinant molecule may be in the form of a plasmid, phagemid or viral vector.

Many different viral and non- viral vectors and methods of their delivery, for use in gene therapy are known to those skilled in the art and these include, for example, adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, lentiviral vectors, herpes virus vectors, liposomes, DNA vaccination and the like.

It will be appreciated that while each of the compounds described herein may be administered to an individual alone, it is possible to combine the compounds such that an individual is treated with one or more of the compounds either alone or in combination. For example, it may be possible to use a compound capable of inhibiting the expression, function and/or activity of eIF4E to ablate or reduce the aberrant eIF4E expression which results in a behavioural disorder and to administer a further compound, such as a DNA construct to restore eIF4E expression, function and/or activity.

In addition to the above, the present invention further provides a method for screening, identifying and/or testing agents which may be useful in the treatment of a behavioural disorder, said method comprising the steps of; (a) contacting a test agent or agents with the eukaryotic initiation factor 4E (eIF4E) gene, its protein product or an eIF4E associated nucleic acid or protein; and

(b) detecting any interaction between the test agent or agents and the eEF4E gene, its protein product or the eIF4E associated nucleic acid or protein.

In one embodiment, the method according to the fourth aspect of the invention may involve contacting one or more test agent(s) with one or more of the eukaryotic initiation factor 4E (eIF4E) gene, its protein product, an eBF4E associated nucleic acid and/or protein.

The term "interaction" should be taken to encompass both direct and indirect interactions between a test agent(s) and eEF4E. For example, a test agent which interacts with eIF4E may bind to eIF4E or to an associated nucleic acid or protein. In instances where a test agent binds eIF4E , it is assumed that a "test agent(s)/eIF4E complex" results.

The occurrence of an interaction between a test agent or agents and eDF4E, may be detected or determined by a number of assays familiar to one of skill in the art. For example, immunological techniques such as enzyme linked immunosorbant assays (ELISA), immunoblotting, immunofluorescence, immunohistochemical staining and co-immunoprecitation are all potentially useful.

Advantageously, test agents may be labelled so as to permit detection of test agent(s)/eIF4E complexes. Useful labels may include, for example, enzymatic, fluorescent, chemiluminescent, bioluminescent and/or radioactive labels. Suitable labels may, for example, include horseradish peroxidise (HRP), alkaline phosphatase (ALP) and the like. Suitable test agents may include, for example, small compounds such as small organic molecules, antibodies, antibody fragments (such as, for example Fab, Fab(2) and nanobody fragments), the eIF4E gene, eEF4E regulatory elements (such as promoters, associated regulatory elements or the like) protein products and/or fragments of any of these. Furthermore, suitable test agents may include nucleic acids (either DNA or RNA) or proteins thought to interact with the eIF4E gene or its protein product. Other suitable test agents may include nucleic acids (either DNA or RNA) or peptides/proteins associated with eIF4E or fragments thereof. Additionally, or alternatively, oligonucleotide sequences such as antisense oligonucleotides or small interfering (si) RNA may also be suitable for use as test agents. A person of skill in the art, knowing the gene sequences of the eIF4E would be able to prepare and test appropriate antisense oligonucleotides and siRNA molecules. Furthermore, the artificial intelligence algorithm BIOPREDsi is capable of predicting 21 nucleotide siRNA sequences that have an optimal effect for a given gene.

In a further embodiment, the method of screening, identifying or testing an agent or agents potentially useful in the treatment of a behavioural disorder, may further comprise the step of, after contacting the test agent or agents with eIF4E, removing any unbound test agent. Removal of unbound test agent may be achieved by, for example, washing with a buffer or other solution prior to determining or detecting any binding between the test agent(s) and eIF4E.

Advantageously, a known eIF4E binding agent ("eIF4E binding agent") may be used to determine whether or not a particular test agent or agents bind to eIF4E. A method or assay of this sort may be known to the skilled man as a "displacement" or "competition" assay. For example, the method of screening, identifying or testing an agent potentially useful in the treatment of a behavioural disorder may comprise the step of contacting an eIF4E binding agent with eIF4E and/or any eDF4E/test agent complexes that have formed. Preferably, the eIF4E binding agent may be contacted with eIF4E and/or any test agent/eEF4E complexes after the optional wash step described above. Alternatively, the eIF4E binding agent may be contacted with eDF4E at the same time as the test agent or agents is/are contacted with eIF4E. Preferably, in order to facilitate the detection of binding between an eIF4E binding agent and eIF4E and/or eIF4E/test agent complexes, the eIF4E binding agent may be labelled as described above.

Advantageously, once the eIF4E binding agent has been contacted with eIF4E and/or any test agent(s)/eIF4E complexes, unbound eIF4E binding agent may be removed by washing with a buffer or other suitable solution.

By determining the amount of eIF4E binding agent bound to eIF4E, it may be possible to determine whether or not the test agent(s) binds/bind eIF4E. The level of eIF4E binding agent binding to eIF4E may easily be determined by comparison with an assay in which no test agent is contacted with eIF4E i.e. a control assay. Any reduction in the amount of eIF4E binding agent bound to eIF4E as compared with a control assay, would indicate that some binding has occurred between the test agent(s) and eIF4E. No observed reduction or any increase in binding between the eIF4E binding agent and eIF4E would suggest that no binding has occurred between the test agent(s) and eEF4E.

Other techniques for determining or detecting binding between a test agent or agents and e!F4E, such as band shift assays and immunological detection techniques such as ELISA or immunoblot, may comprise the additional step of, after contacting a test agent or agents with eIF4E, subjecting the eIF4E/test agent(s) mixture to electrophoresis. A technique such as electrophoresis may be used to resolve or separate the components of a test agent(s)/eIF4E mixture. Advantageously, the test agent(s)/eIF4E mixture may be subjected to electrophoresis on an agarose gel or other suitable substrate which may be stained to reveal any resolved or separated eIF4E, test agent(s) and/or any eIF4E/test agent(s) complexes. Alternatively, the resolved or separated components may be transferred to a solid substrate such as nitrocellulose and further probed to detect either the test agent(s) and/or eIF4E (or a complex between the two). By way of example, the solid substrate may be probed with a test agent binding agent and/or an eIF4E binding agent. Examples of suitable binding agents may include oligonucleotide probes, antibodies and/or other molecules known to bind eIF4E or the test agent(s).

The assays described above may be performed in any suitable device or on any suitable substrate, such as, for example, plates, tubes, dishes etc. The assays may, for example, be performed in multi-well plates.

Advantageously, eIF4E may be bound or otherwise immobilised on any of the abovementioned suitable devices or substrates. Immobilisation may be achieved by using an alkali buffer such as a bi-carbonate buffer and dissolving or suspending eIF4E therein. Volumes of the buffered solution containing eIF4E may then be added to the device or substrate under conditions suitable to result in the development of non-covalent bonds.

Binding between a test agent and eIF4E may be taken as indicative of the ability of the test agent to modulate the activity or expression of eIF4E and/or a pathway that leads to a behavioural disorder.

Thus, in one embodiment, the method according to the fourth aspect of the invention comprises the step of detecting any modulation of the activity and/or expression of eIF4E by the test agent or agents. As stated above, the term "modulation" may be taken to mean either an increase or decrease in the activity or expression of eIF4E relative to the activity or expression of eIF4E in a normal or control assay. The terms "normal assay" or "control assay" refer to an assay in which eIF4E has not been contacted with a test agent. The results obtained from a normal or control assay may be compared with those obtained from an assay in which eIF4E is contacted with a test agent, so as to determine whether or not the test agent is capable of modulating (i.e. increasing or decreasing) the activity and/or expression of eIF4E.

Accordingly, a test agent or agents identified by the method according to the fourth aspect of the invention may be further tested for an ability to modulate the activity and/or expression of eEF4E.

As stated, the development of a behavioural disorder may be linked to genetic variation, mutations and/or alterations within the eIF4E promoter region and/or other regulatory elements within the eIF4E gene or associated with the eIF4E gene, which modulate the activity and/or expression of eIF4E. Additionally, or alternatively, a behavioural disorder may be associated with other cellular components which interact, either directly or indirectly, with eIF4E to modulate its activity and/or expression. As such, test agents identified as useful in the treatment of a behavioural disorder by the methods described herein, may function to counteract, reduce or enhance the effect of the aforementioned genetic variations, mutation/alteration and/or interactions. Particularly useful are agents found to decrease the levels of eIF4E expression, function and/or activity.

Advantageously, in order to determine whether a test agent or agents is/are capable of modulating the activity and/or expression of eIF4E, the test agent(s) may be contacted with eIF4E in a cell based or cell free system. An exemplary cell free system is provided by WO2006054556 which discloses a mammalian cell liquid extract composition for protein synthesis, comprising a eukaryotic translation initiation factor and/or a translation regulator and a template messenger RNA, wherein the initiation factor may be eIF4E.

Alternatively, the method may comprise the step of contacting a test agent with a cell expressing eIF4E. The "cell" may, for example, be a recombinant cell engineered to express eIF4E. Cells suitable for use in the above method include, for example, mammalian cells such as human or rodent cells, insect and/or bacterial cells.

Modulation of eIF4E may occur as a result of a direct interaction between eIF4E and the test agent or agents. Additionally or alternatively, eEF4E modulation may occur as a result of an interaction between the test agent and a gene, nucleic acid sequence (either DNA or RNA) and/or protein associated with eIF4E. Such an interaction may otherwise be known as an "indirect interaction".

The cell free or cell based systems may be probed using a variety of techniques, all familiar to one of skill in the art, to determine whether the test agent or agents modulated the activity or expression of eIF4E.

Modulation of eIF4E activity and/or expression may manifest as an increase or decrease in protein synthesis relative to a control assay. In one embodiment, a template mRNA may be added to the cell free or cell based assay. Modulation of eIF4E activity and/or expression may be detected as a decrease or increase in the amount of translated template mRNA produced.

Additionally, or alternatively, by measuring eIF4E messenger RNA (mRNA) levels by, for example, Northern blot and comparing the results with the levels of mRNA obtained from a control assay, it may be possible to determine whether the test agent or agents modulate the activity or expression of eIF4E. One of skill in the art would understand that Northern blot assays are frequently conducted with reference to the level of some other mRNA, for example a "house keeping" gene such as β-actin or the like.

Other methods of detecting eIF4E modulation may include PCR and quantitative PCR techniques such as real-time PCR. hi a further embodiment, the cell free or cell-based assay may further comprise a reporter construct, said reporter construct comprising a reporter gene the expression of which is under the control of the eIF4E gene promoter or another regulatory element, hi this way it may be possible to determine the ability of a test agent or agents to modulate the activity and/or expression of the eIF4E gene by monitoring the activity and/or expression of the reporter gene. Test agents which increase or stimulate the activity of the reporter gene may be taken to be agents potentially useful in the treatment of a behavioural disorder. The human eIF4E promoter sequence is disclosed by Jones et al, 1996 and Kelly et al, 1998.

The identification of test agents which interact with or modulate eIF4E opens up the possibility of treating a behavioural disorder. For example, antisense oligonucleotides and/or siRNA molecules screened, tested or identified by the methods described herein, may be used to treat a behavioural disorder. Additionally or alternatively, small molecules such as fragments of antibodies, proteins and/or nucleic acid sequences, such as, for example, fragments of eIF4E or nucleic acids or proteins associated with eIF4E, may be used to treat a behavioural disorder. hi an fifth aspect, there is provided an agent detected by the methods described herein for use in treating a behavioural disorder.

A sixth aspect provides a use for agents detected by the methods described herein in the manufacture of a medicament for the treatment of a behavioural disorder. In a seventh aspect there is provided a method of treating a subject suffering from or predisposed to developing a behavioural disorder, said method comprising the step of administering an effective amount of an agent screened, identified or tested by the methods described herein.

In an eighth aspect, the present invention provides a method of diagnosing a genetic predisposition to a behavioural disorder in a subject, said method comprising the steps of;

(a) providing a sample of nucleic acid from a subject

(a) detecting the presence of a mutation in the eIF4E gene, its protein product and/or associated protein and/or nucleic acid sequences.

The method described in the eighth aspect of this invention may be useful in the diagnosis of a behavioural disorder as genetic variation, mutations and/or alterations in the eIF4E gene, its protein product and/or associated proteins and/or nucleic acid sequences may modulate the activity and/or expression of the eIF4E gene or its protein product. For example, a mutation or alteration may result in an increase or decrease in the expression of the eIF4E gene or its protein product or a partial or total loss of eEF4E function or activity. By way of example, genetic variation and/or mutations in the eIF4E promoter region may modulate the activity and/or level of expression of the eIF4E gene. Examples of genetic variations, mutations and/or alterations which may result in modulation of eIF4E activity and/or expression, include single or multiple base pair insertions, substitutions and/or deletions. Accordingly, such variations, mutations and/or alterations may be associated with the development of a behavioural disorder. It is to be understood that "associated nucleic acid sequences" may include, for example, the eIF4E promoter region, transcription factors, or other associated regulatory elements involved (either directly or indirectly) with eIF4E expression.

In addition, it should be understood that the term "associated protein sequences" may include, for example, proteins which directly or indirectly bind or associate with eIF4E. For example, associated protein sequences may include the eIF4E binding proteins, 4EBP1, 4EPB2 and/or 4EPB3.

Accordingly, the detection of a mutation or alteration in the eIF4E gene, its protein product, an associated protein sequence (or nucleic acid encoding the same), an eEF4E transcription factor and/or the promoter region, may indicate that a subject has or is predisposed to developing a behavioural disorder.

Specifically, for example, the insertion of an additional "cytosine" into the eIF4E promoter leads to an out of frame shift which may modulate the activity and/or expression of eIF4E. Additionally, a balanced translocation of chromosomes 4 and 5 ((46,XY,t(4:5)(q22;q31.3) may result in modulation of the activity and/or expression of the eIF4E gene or its protein product. The inventors have determined that these mutations/variations may be associated with the behavioural disorders or a susceptibility or predisposition thereto.

In addition, a single base insertion in the EDF4E promoter region (CCCCC/GCC: on the critical C7-4EBE) may also be associated with the development of a behavioural disorder or a susceptibility or predisposition thereto.

The inventors have identified a number of other mutations/variations in eIF4E associated sequences which may also be associated with the development of a behavioural disorder or a predisposition/susceptibility thereto. These variations (either alone (in isolation) or in combination with one or more other variations disclosed herein) may form the basis of a method of diagnosing a genetic predisposition to a behavioural disorder, such as, for example autism and/or sachizophrenia, in a subject. Variations (or mutations) potentially useful in such methods are presented in Table 1 belowi

Table 1: Mutation analysis in schizophrenia:

*Change in predicted protein sequence:

VPPGPNGHIRHVARS//(W)PIRFESHFFPLTPPSGAVVRSD

RSKMATVEP

As such, assays capable of detecting mutations, such as insertions, substitutions and/or deletions in the promoter (or other associated regulatory elements) and/or assays capable of detecting any of the abovementioned mutations/variations (such as for example the chromosomal translocation or insertions/substitutions detailed above), may permit the diagnosis of a behavioural disorder or detection of those likely to develop or predisposed to develop the disease. Additionally, or alternatively, mutations or alterations (such as single or multiple base substitutions, deletions and/or insertions) in the eIF4E gene, its protein product, the promoter region or other associated regulatory elements, may result in modulation of eIF4E expression. Accordingly, an assay designed to detect mutations and/or alterations in the eIF4E gene, its protein product or promoter region may assist in the diagnosis of a behavioural disorder and/or the identification of those likely or predisposed to develop a behavioural disorder.

By "sample" it is meant any component of the subject from which nucleic acid may be obtained. Body fluids such as blood, are a potential source of nucleic acid for use in the present method. Additionally, or alternatively, a sample of tissue may be used to provide cells from which nucleic acid may be extracted. For example, a swab of the buccal cavity can provide buccal cells which may be used in the present method.

Hereinafter, all references to "mutations" are to be understood to refer to any mutation or alteration, for example a balance chromosomal translocation or single or multiple nucleotide substitution, addition or deletion in the eIF4E gene, its protein product, a fragment or fragments derived from either and/or the eIF4E promoter region or other associated regulatory elements.

A sample may include other bodily fluids such as amniotic fluid. As such, and in one embodiment of the present invention, the method of detecting a behavioural disorder may be applied during pregnancy so as to determine whether or not a developing embryo/foetus possesses a mutation associated with a behavioural disorder. In view of the above, and in one embodiment, the present invention provides a method of diagnosing a behavioural disorder in a subject, said method comprising the steps of;

(a) providing a sample of nucleic acid from a subject; and

(b) detecting the presence of a balanced translocation of chromosomes 4 and 5 ((46,XY,t(4:5)(q22;q31.3).

A person of skill in the art would be familiar with the techniques required to detect a mutation in a nucleic acid and/or amino acid sequence. For example, nucleic acid and amino acid sequences can be sequenced and compared with a reference sequence, for example the corresponding naturally occurring sequences, in order to determine whether or not a mutation is present.

Additionally, or alternatively, the polymerase chain reaction (PCR) may be used to amplify specific nucleic acid sequences for the purposes of detecting a mutation. For example, following amplification by PCR, the amplified nucleic acid fragments may be sequenced and compared with a reference.

Other means by which a mutation may be detected include immunological techniques such as ELISA, Western blot, immunoblot, co-immunoprecipitation, restriction fragment length polymorphism (RFLP) analysis, Northern and Southern blots, dHPLC (denaturing high performance liquid chromatography) or other technique such as hrMELT.

By way of example, eIF4E binding agents may be used to detect mutations and/or alterations which affect the structure and hence activity and/or expression of the eIF4E protein product. For example, failure of an eIF4E binding agent to bind eIF4E may suggest the presence of a mutation. Alternatively, oligonucleotide probes may be used to detect mutations in the eIF4E gene, a fragment or fragments derived therefrom, the eEF4E promoter or any regulatory sequence associated therewith. For example a probe may be designed to recognise a specific sequence in a reference eIF4E sequence or an eIF4E promoter sequence. Failure of that probe to bind the eIF4E or eIF4E promoter sequence obtained from the nucleic acid sample, may indicate the presence of a mutation.

Identification of mutations in the eIF4E gene or its associated nucleic acids which result in the aberrant expression, activity or functioning of the eIF4E protein opens up the possibility of treating a behavioural disorder by gene therapy. As such, a correct non-mutant copy or copies of the eIF4E gene may be used to complement for a mutant version of the eIF4E gene present in a subject. Furthermore, a correct or non-mutated/altered copy or copies of a regulatory element or elements (such as a promoter) responsible for, or involved with, controlling the expression of eIF4E, may be used to correct an abnormal regulatory sequence.

In a ninth aspect, the present invention provides a non-human transgenic animal for use in studying a behavioural disorder and/or screening test agents potentially useful in the treatment of a behavioural disorder, wherein said non-human transgenic animal comprises a chromosomally incorporated or extra-chromosomal altered or mutated eIF4E gene or eIF4E associated gene.

Additionally or alternatively, the transgenic animal may comprise a chromosomally incorporated or extra-chromosomal altered or mutated eIF4E associated nucleic acid. Alternatively, a transgenic animal useful in the study of a behavioural disorder and/or detection of agents potentially useful in the treatment of a behavioural disorder, may result from haploinsufficiency, where one or more copies of the eIF4E gene or an eIF4E associated gene, are rendered inactive by a mutation or the like and the remaining copy (or copies) of the gene are insufficient to confer a wild-type phenotype.

Alternatively, a gene or genes of interest may be "knocked out" using, for example, site directed mutagenesis techniques known to one of skill in the art.

Transgenic animals carry a gene or "transgene" which has been introduced into the germ line of the animal (or an ancestor of the animal), at an early (for example one-cell) developmental stage. Accordingly, the term "transgenic animal" as used herein, relates to non-human animals, having a non-endogenous (heterologous) nucleic acid sequence present either as an extra-chromosomal element or stably integrated into its germ line DNA (i.e. stably integrated into the genomic DNA of most or all of its cells.

More particularly, the term "transgene" relates to any piece of DNA which can be inserted into a cell, and preferably becomes part of the genome (either stably integrated or as a stable extra-chromosomal element) of the resulting organism. Such "transgenes" include genes which are partly or entirely heterologous (i.e. foreign) as well as genes homologous to endogenous genes of the organism.

Preferably, the altered or mutated eIF4E gene or eIF4E associated gene is chromosomally incorporated.

Advantageously, the non-human transgenic animal is a mammal, preferably a rodent such as a rabbit, guinea pig, rat or mouse.

A heterologous nucleic acid sequence may be introduced into the germ line DNA of a non-human animal by genetic manipulation of, for example, embryos or embryonic stem cells of the host animal. Accordingly, a "transgenic" animal is any animal containing cells that bear genetic information received, directly or indirectly, by deliberate genetic manipulation at the sub-cellular level. Said transgenic non-human animal, by virtue of the presence of a heterologous altered or mutated eIF4E gene or eIF4E associated gene, may provide a model for studying a behavioural disorder. Furthermore, it may be possible to use the above- described model to determine or evaluate the efficacy of a particular test agent for use in treating a behavioural disorder.

Additionally, or alternatively, it may be possible to introduce a mutated or altered regulatory element, such as a promoter or other associated regulatory element, into the germ line of an animal. In this way, in addition to providing a means for studying the effect of modulated eIF4E expression, the resulting animal model may be used to identify or test agents potentially useful in the treatment of a behavioural disorder.

Thus, in a further aspect, there is provided a method of testing or evaluating the efficacy of a test agent for use in treating a behavioural disorder, said method comprising the steps of: a) administering a test agent or agents to a transgenic animal in accordance with the ninth aspect of the present invention; and b) comparing the effect of said test agent on the behaviour of said transgenic animal with the behaviour of a control animal not administered the test agent, wherein a change in behaviour of the transgenic animal of step (a) as compared to the control animal, identifies said test agent as potentially useful in the treatment of a behavioural disorder.

The chromosomal integration of an altered or mutated eIF4E gene or associated gene, may result in an animal exhibiting symptoms similar to those present in an autistic human. For example, the mouse may show an increased level of anxiety or altered home-cage and social behaviour, hi the non-human transgenic animal of the present invention, altered social behaviour may manifest as a decrease in the time the animal spends investigating or interacting with another animal of the same species. Additionally, or alternatively, the transgenic animals of the present invention may be hyperactive and/or exhibit learning or memory deficits.

A test agent found to be useful in treating a behavioural disorder may eliminate or reduce one or more symptoms of the disease. Such changes in the symptoms may, in an animal model, manifest themselves as changes in behaviour. Various animal behavioural tests are known and are useful in facilitating the identification of those test agents which reduce or eliminate one or more of the symptoms of a behavioural disorder. For example, learning and memory function may easily be assessed with maze tests while social behaviour may be observed by allowing a number of animals to interact and comparing any observations as to the nature of the interaction with those of interacting control animals which have not been administered the test agent.

DETAILED DESCRIPTION OF THE INVENTION

The present invention will now be described in detail with reference to the following figures which shows:

Figure 1: A chromosomal translocation in a case of classical autism, (a) Schematical representation of the breakpoint regions of chromosomes 4 and 5, and derivative chromosomes der (4) and der (5). The breakpoints are indicated with arrows. Representation was prepared using the UCSC genome browser. Not all forms of the reference genes are shown, nor all exons. Chromosome coordinates are based on the human genome build 36.2. (b) Breakpoint sequences. Shown are the sequences spanning the breakpoint on chromosomes 4 and 5 (in small and capital letters, respectively), and the joining sequences on der (4) and der (5) determined by direct sequencing. Underlined residues are not derived from either chromosome 4 or chromosome 5.

Figure 2: Expression of exon 12. Northern blots with poly(A) mRNA from different human brain tissues were probed with a radiolabeled exon 12 probe, detected using a phosphoimager. The position of the 1.6 kb RNA is indicated.

Figure 3: An inherited C insertion in the EIF4E promoter in children with autism increases promoter activity. (a) EIF4E promoter region showing transcription initiation sites (capital letter), the start of the EIF4E coding sequence (boxed) and the 4EBE promoter element (4EBE, underlined) with a stretch of 7 nucleotides (C₇-4EBE)¹³. The major transcription initiation site is indicated with +1²⁷. (b) Insertions of a C in the EIF4E-4EBE promoter element were detected by sequencing in two independent families of the AGRE cohort (C₈-4EBE). Pedigree and sequencing traces are shown for one family only as the inheritance pattern and sequence are the same in both families, (c) Effect of the C insertion on binding of nuclear factors. ³²P-end-labelled double-stranded oligonucleotides encompassing either the wild type C₇-4EBE element or the Cs-4EBE element were incubated with or without HeLa cell nuclear- extract. Protein-DNA complexes were detected by native gel electrophoresis (EMSA). Where indicated a 200-fold or 500-fold excess of cold competitor DNA was included in the binding reaction. The histogram summarises the proportion of -P labelled DNA in complexes. The proportion of complexed DNA in reaction without competitor was defined as 100 %. Shown are data from 2 independent experiments (in black and white, respectively), (d) C insertion increases EIF4E promoter activity in HeLa cells. Dual luciferase assays were done with pGL3 basic (no promoter) or pGL3 containing the 0.4 kb EIF4E promoter fragment encompassing the C₇-4EBE or C₈-4EBE element, and two Myc binding sites. Shown are relative firefly lucif erase units, standardized with respect to Renilla lucif erase expression.

Figure 4: Cytogenetic analysis of translocation case (a) GTG banding of chromosomes 4 and 5 and der4 and der5. (b) FISH analysis of breakpoint. RPIl- 91 INlO maps to base pairs 99887465-100079064 on chromosome 4, RP11-359H9 and RP11-659D8 maps to base pairs 146356329-14651515 and 142011154- 142179956 on chromosome 5, respectively. RPl 1-91 INlO labels both derivative chromosomes and thus spans the breakpoint. RP11-359H9 and RP11-659D8 (indicated by an arrow and a diamond) flank the chromosome 5 breakpoint. Figure 5: Quantitative expression analysis of EIF4E by real-time RT-PCR Relative expression of EIF4E mRNA was quantified by real-time PCR using cDNA generated from lymphoblast cultures on a LightCycler 480 (Roche). Expression was normalised to GAPDH and expressed as fold change from a control culture (Cont 01). Cultures were generated from controls (Cont 01 [n=6], Cont 02 [n=6]), autistic AGRE patients (AU 01 [n=3], AU 02 [n=3]) and the patient with the translocation (Transl [n=5]). Results are mean ± S.E.M., replicate cultures as indicated above. Figure 6: Western analysis of EIF4E expression Immortalised lymphoblasts were grown in RPMI supplemented with 10 % FCS and 100 units/ml penicillin/ 100 μg/ml streptomycin. Cells were grown in asynchronous culture to a density of 5 x 10⁵ cells/ml and then lysed as

Protein concentration was determined by Bradford assay using bovine serum albumine as standard. 15 μg and 30 μg protein of each cell extract were analysed by 10 % SDS-P AGE/Western blotting. Rabbit Anti- EIF4E antibodies were from Cell Signalling (#9742) and goat anti-actin antibodies (Santa Cruz Biotechnology Inc; sc-1616). Antibodies were detected by chemiluminescence using appropriate HRP-coupled secondary antibodies. Note that EIF4E and tubulin levels vary to the same degree between control cell lines, the cell line derived from the translocation case and lymphoblast cell lines derived from subjects AU 01 and AU 02 (AGRE).

Case description

Apparently normal development up until two years of age, was followed by a period of severe regression characterized by loss of speech, social interaction and communication skills, and the development of stereotyped and repetitive patterns of behavior. At the age of 6.5 years his speech consisted of little other than stereotyped vocalizations.

METHODS

Subjects Blood samples were obtained from the translocation carrier and his parents with informed consent. Clinical assessment was performed by a clinical geneticist and a Child Psychiatrist with a research interest in autism administered the Autism Diagnostic Observation Schedule- Generic (Module I)¹¹ and Autism Diagnostic Interview Revised (2000)¹². One hundred and twenty familial autism samples were obtained from AGRE; families were selected on the basis of availability of both parents and multiple offspring with a definite diagnosis of autism. The study protocol was approved by the Grampian Local Research Ethics Committee.

Cell lines An Epstein-Barr-virus-transformed lymphoblast cell line was established by the European Cell and Culture Collection (ECACC), who also supplied control cell lines (AQ0006 and BB0016) used in expression work. Transformed lymphoblast cell lines derived from subjects AU Ol and AU 02 were obtained from AGRE. Cell lines were cultured at 37°C / 5%CO₂ in RPMI 1640 supplemented with 10% fetal bovine serum, 1000 units/ml penicillin, lOOμg/ml streptomycin and 0.25 mg/ml amphotericin B (Invitrogen).

Cytogenetic analysis Conventional cytogenetic analysis was performed, on GTG banded metaphase nuclei at the 550 band level. Nuclei were obtained from a lithium- heparinised peripheral blood sample following standard cytogenetic culture and harvest protocols²². Fluorescent in-situ hybridization (FISH) was performed with commercial unique sequence telomere-specific probes (Vysis), bacterial artificial chromosomes (BACs), and Fosmid clones from the regions flanking the cytogenetic breakpoints. The BACs and fosmids were selected using the University of California at Santa Cruz Genome Bioinformatics Browser (http://genome.ucsc.edu/) and obtained from BACPAC Resources (Children's Hospital Oakland Research Institute). Genomic DNA was labelled by direct incorporation of fluorochromes by Nick translation (Vysis Nick translation kit). BACs were hybridized for 24 hours, followed by 2 min washes in 0.4XSSC/0.1% IPEGAL at 72°C visualized at 10Ox magnification (Zeiss Neofluar objective) using an epifluorescence microscope (Zeiss Axiscop) and an Applied Imaging analysis system using the MacProbe version 4.3 software.

Chromosome flow-sorting Flow sorting and generation of chromosome-specific paint probes followed previously described methods ' . DNA from der (4) and der (5) was amplified using the GenomePlex^® Single Cell Whole Genome Amplification Kit (WGA4) from Sigma- Aldrich. Detailed analysis of the breakpoint regions PCR primer pairs from across the region of interest were used to amplify DNA from derivative chromosomes. Primer pairs were thus selected to amplify across both breakpoints to characterize the translocation by direct sequencing. Copy-number variation analysis on the Affymetrix human Gene-Chip 1OK array was used to exclude other cryptic rearrangements.

Sequencing for mutation analysis Direct sequencing was used to examine the coding regions and the promoter of the EIF4E gene. PCR products were purified by a Y-100 column (Fisher Scientific) and direct sequencing was performed using the Big Dye Terminator v. 3.1 Cycle Sequencing Kit, ABI. Sequencing reactions were analysed using an ABI 3100 Genetic Analyzer and results were analyzed using the programs SEQUENCHER 3.1.1. Putative mutations were validated by sequencing DNA from the affected sibling (and both parents) showing a variation, and 56 controls. Variants found in affected sibs but not controls were additionally screened for in 1050 anonymous control samples using denaturing high performance liquid chromatography (dHPLC) on a Transgenomic WAVE apparatus.

Real-time qPCR Quantitation of expression of EIF4E, NR3C1, METAPl, ARHGAP26, HMHBl, is detailed in methods. Analysis was as per the method of Pfaffl²⁵. RNA was extracted from growing cultures with TRI REAGENT T 9424 (Sigma). We prepared cDNA using SUPERSCRIPT π kit (Amersham). Real-Time PCR was performed on the cDNA from the individual with the translocation, the two subjects with the promoter variant, and two normal control cell lines. All samples were checked for the absence of genomic DNA. Quantitative PCR (qPCR) reactions were performed on a Roche LightCycler 480 qPCR system with a 96-well block and 20 μl/well reaction volumes. Each reaction consisted of 10 μl LightCycler 480 Probe Master Mix (Roche Cat no.04707494001) andl μl FAM-labelled Custom TaqMan assay and/or 1 μl VIC-labelled Human GAPD (GAPDH) Endogenous Control. Reaction volume was adjusted to 20 μl / well with cDNA template and sterile dH20.

Thermal cycle conditions were 10 min enzyme activation at 95⁰C, followed by 40 cycles, each consisting of a denaturing (95^°C for 10 s), annealing and elongation (6O⁰C for 30 s) step. Fluorescence was read at the end of every elongation during each cycle. Samples were quantified using a serially diluted standard curve of unknown target concentration to confirm all comparisons were made during the linear range of the PCR reaction and to correct for the efficiency of each assay, as per the method of Pfaffl²⁵. Each gene of interest signal was normalized to GAPDH for each sample.

Table 2: Details of assays used in Real-time qPCR studies All assays were from

Applied Biosystems, except for the TSPAN5 assay.

TSPAN5 expression was measured using primers ATGCAAGTCGAGAGCGATGT and CTGGCATCATAGCCACACTG and the Roche Universal probe library 18 probe for qPCR.

Table 3: Sequencing oligonucleotides used in mutation analysis oiEIF4E.

Exon numbers refer to exons in reference sequence/alternative transcript. Intron indicates intronic sequences in either transcript.

Binding reactions and EMSA Binding reactions with ~ 80 fmol ³²P 5' end-labelled double-stranded oligonucleotides were performed in 16 mM Hepes-KOH (pH 8), 16 % glycerol, 80 mM KCl, 0.16 mM EDTA, 0.8 mM DTT and 10 mg/ml HeLa cell nuclear extract (Abeam). After 30 min incubation on ice, reactions were analysed by 5 % polyacrylamide gel electrophoresis, and visualised using autoradiography or a Fuji Phosphoimager with AIDA software for quantitation. Double-stranded DNA molecules used were the wild type genomic sequence 5'- TTTCCTCTTACCCCCCCTTCTGGAGCGGTT (C₇-4EBE) and the derivative C₈- 4EBEAb with an additional C added to the C₇ stretch element. Where indicated, 200- fold or 500-fold excess of cold double-stranded competitor DNA was added.

Luciferase assays A 410 base pair EIF4E promoter fragment spanning the region from a Pstl site up to the major transcrition initiation site (Position +1 in Fig. 3a) was amplified using the Roche Expand High Fidelity PCR kit, with oligonucleotides to create a C₇-4EBE and a Q-4EBE version. PCR fragments were inserted into pGEM- T easy (Promega) and verified by sequencing. The primers contained Kpnl and Hindiπ restriction sites that were used to insert the promoter fragments into the firefly luciferase reporter vector pGL3 basic (Promega). Near confluent HeLa cells grown in 24 well plates were transfected with 0.7 μg pGL3 based reporter, and with 100 ng pRL-Tk (Promega) expressing Renilla luciferase. Cells were lysed 24 h - 48 h after transfection and luciferase activities were determined using a dual luciferase assay (Promega). Firefly luciferase activity was standardised with respect to Renilla luciferase. Transfections were done in triplicates and each transfection was measured three times. Shown are the average and standard deviation calculated from the three parallel transfections.

Northern analysis Pre-prepared multi-tissue Northern blot membranes (MTN 2 and MTN 5) were purchased from Clontech. Exon 12 probe was PCR amplified from genomic DNA and the sequence was confirmed by DNA sequencing. Preparation of radiolabeled exon 12 probe, hybridisation and analysis by phosphoimager was done as described previously²⁶. RESULTS

A de novo apparently balanced reciprocal translocation between the long arms of chromosomes 4 and 5 (46,XY,t(4:5)(q23;q31.3)) was identified in a child with classic AD. There was no family history suggestive of autistic traits. He had no dysmorphic features, other than a double hair whorl on the crown, and no malformations. Both Autism Diagnostic Observation Schedule- Generic (Module I)¹ and Autism Diagnostic Interview Revised(2000)² demonstrated a typical and severe autistic phenotype and on all measures, DSMIV criteria for the diagnosis of Autistic disorder were fulfilled. Apparently normal development up until the age of two, was followed by a period of severe regression characterized by loss of speech, social interaction and communication skills, and the development of stereotyped and repetitive patterns of behaviour. At the age of 6.5 yrs his speech consisted of little other than stereotyped vocalizations.

FISH analysis with BAC and cosmid clones narrowed down the sites of the breakpoints on chromosomes 4 and 5. BAC clone RPl 1-91 INlO spans the breakpoint on chromsome 4, the chromosme 5 breakpoint was mapped using cosmids to a 47.6 kb interval (142,854,992-142,902,586). Fine-mapping of the breakpoint was performed using PCR on DNA amplified from flow sorted derivative chromosomes. The breakpoint was then characterised using direct sequencing (Figure 1). Rearrangement of chromosomal material distal to this breakpoint was excluded using copy-number variation analysis on the Affymetrix human Gene-Chip 1OK array (data not shown).

The breakpoint on chromosome four is located in a region linked to autism (Yonan, Schellenberg, Trikalinos, Szatmari). The breakpoint on chromosome five is not in a linked region, the nearest gene being NR3C1. Families with heterozygous mutation of NR3C1 are reported with hypertension, hypokalemia and female masculinisation, but not autistic features (14). Our subject by contrast is normotensive with a normal urinary screen for catecholamines. The breakpoint on chromosome 4 maps downstream of the EIF4E reference sequence, a strong candidate gene for autism. Expression of all genes surrounding the breakpoint in EBV-transformed lymphocytes from the translocation case was similar to those in controls when measured using realtime PCR assays for reference genes and Western analysis did not^' reveal any difference in expression of EIF4E in these lymphocytes. Using Affymetrix Human Exon 1.0 ST arrays (http://genome.ucsc.edu^*), we noted a region downstream of the chromosome 4 breakpoint showing increased expression in cerebellum. Furthermore, the Genescan algorithm suggests that transcripts of EIF4E are not restricted to the reference EIF4E coding sequence and promoter. An alternative transcript of 12 exons, NT_016354.401, spans the breakpoint and is disrupted by the translocation. All 12 exons are expressed in GenBank mRNA and / or seen on Affymetrix arrays. The translocation breakpoint is flanked by exons 10 and 11. We have now examined other brain tissues by Northern analysis and have found widespread expression of exon 12 of NT_016354.401 (Fig. 2). The protein derived from NT_016354.401 has a central core of 212 amino acids shared with EIF4E, and unique N- and C-termini (145 and 198 amino acids, respectively), with the C-terminus being largely encoded by exons 10, 11 and 12.

Direct sequencing was used to examine the EIF4E reference sequence and the Genscan NT_016354.401 sequence in 120 multi-case families from the Autism Genetic Research Exchange collection (AGRE; www.agre.org). We identified a single base C insertion in affected sibs and a parent from two different families located in a region previously identified as an EIF4E promoter (MOLECULAR AND CELLULAR BIOLOGY Aug,.6436-6453; 2005) (Fig. 3). This sequence variant was not identified in 1000 controls. Using electrophoretic mobility shift assays (EMSA) we demonstrated that this DNA sequence variant has an increased affinity for a nuclear factor, presumably hn-RNPK (Fig 4a). In addition, a promoter activity assay using a luciferase reporter demonstrated a commensurate increase in EIF4E promoter activity in the presence of the single base insertion (fig. 5). Western analysis did not identify a difference in levels of EIF4E compared to beta actin in transformed lymphocyte cell lines from the cases with the promoter variant. hi the framework of the model gene NT_016354.401, this C insertion introduces a premature termination codon 30 nucleotides (10 amino acids) downstream of the insertion, producing a putative open reading frame lacking EIF4E sequence. Usually, such mutations result in the mRNA being subject to nonsense- mediated decay.

EIF4E activity is the rate-limiting component of eukaryotic translation initiation, which directs ribosomes to mRNA 5' cap structure for initiation of protein synthesis. EIF4E is fundamental to the process by which long-lasting alterations in synaptic strength, termed synaptic plasticity or long-term potentiation (LTP), lead to learning and memory (Neuroscience 5, 931-942,2004., Nature 433, 477-80; 2005). The EIF4E region has been implicated in three independent linkage studies of the AGRE cohort (Yonan et al (2003), (Ylisaukko-oja et al, 2006, Trikalinos). For the first time we provide direct evidence for a role of the EIF4E region in autism, and implicate germline mutations in this region in human disease.

Expression of EIF4E and other translation initiation factors is widespread in body tissues, but levels of expression vary. EIF4E is expressed throughout the brain, but with variable levels in different structures. The association of a classic severe autistic phenotype with translocation of EEF4E-linked exons which exhibit brain- specific expression points to the likely importance of these exons in the learning and memory processes underlying autism. The insertion mutation may act through alteration of promoter activity. Alternatively, the insertion would be predicted to cause haploinsufficiency of NT_016354.401 as transcripts are likely subject to nonsense-mediated mRNA decay. Expression levels of EEF4E were not demonstrably altered in transformed lymphocytes cells. However we expect these effects to be brain specific and need further investigation in an appropriate model system.

EIF4E activity is regulated by a number of signaling mechanisms, of which the best studied is the highly conserved PTEN-TS C-mammalian Target of Rapamycin (mTOR) pathway. Mutation in several genes within this pathway is associated with autism. In tuberous sclerosis, where 25 -50% have autistic features, mutation in TSCl and TS C2, removes inhibition of mTOR, an upstream regulator of EEF4E. Similarly, germline mutation in PTEN reduces Akt mediated repression of the TSC1/TSC2 complex, and is associated with autistic features. (Journal of Medical Genetics 42, 318-321; 2005). Knockout of the intracellular receptor mediator of rapamycin activity, FKBP12 causes mice to display a preference for familiar rather than novel objects, and these mice exhibit perseverance, a proposed murine equivalent of repetitive and other behavioral features found in autism (Neuroscience 5, 931-942). Similarly, in Fragile X, a learning disability with autistic features, inactivation of FMRP causes upregulation of synaptic translation (J. Neurosci 26(27), 7147-7150; 2006). Thus Autistic symptoms can occur as a result of increased synaptic translation.

Regulation of synaptic plasticity by EIF4E is highly complex and probably governed by as yet unknown additional EIF4E binding proteins (Neuroscience 5, 931- 942). In oncogenesis, increased EIF4E activity, results in specific upregulation of translation of particular mRNAs that are normally inefficiently translated (Nature 433, (7025):477-80;2005).

The promoter variant we identified in two multiplex autistic families alters activity of an EIF4E promoter, or alternatively may cause the destabilisation of transcripts from the EIF4E-linked gene NT_016354.401.

Ensuing subtle variation in synaptic EIF4E levels or haploinsufficiency of NT_016354.401 is likely to have a significant impact on delicate processes such as synaptic consolidation, through modification of translation of selected few but important mRNAs. Phenotypic expression of such variants will depend upon genetic background and environmental factors, possibly at specific stages in development. This could account for finding reportedly asymptomatic carriers of the mutation among parents of affected cases.

The observation of haploinsufficiency of downstream exons of NT_016354.401 in this translocation case suggests that both down- and up-regulation of mRNA translation may have equally dramatic effects on synaptic plasticity and risk of autism. Down regulation may reduce protein availability and in turn the supply of plasticity factors. Reduction of protein synthesis through competition for substrate increases and strengthens existing synapses at the expense of establishing new ones (NEUROLOGY 46, 707-719; 1996.) Normal social cognitive memory depends upon the frequent establishment of new memory, whereas strengthening of existing synapses reinforces repetitive behaviors and old memories, as seen in autism.

Mutation in another sub-unit of translation initiation, EIF2B, causes vanishing white matter disease (Nat. Genet. 29, 1061-4036; 2001). We previously reported decreased white matter and increased grey matter in autism, (Neuroimage 24, 455-61; 2005). Thus variation in EIF4E or interacting proteins is consistent with the white matter variation observed in autism.

It is interesting to note that in contrast to findings at other autism loci none of the affected cases with mutations in this study had either associated mental retardation or epilepsy. Larger studies are now required to determine the prevalence and penetrance of EIF4E mutations. Finally, EIF4E is the endpoint of a number of pathways implicated in autism. Our findings raise the interesting possibility that pharmacological manipulation of mTOR signalling, or of expression of brain specific isoforms of EIF4E, may be of therapeutic benefit where autism is associated with abnormalities in these convergent pathways. Discussion

We have mapped the breakpoints of a de novo balanced translocation 46,XY,t(4;5)(q23;q31.3) identified in a child with classic autism. The breakpoint on chromosome 4 maps downstream of the reference sequence of EIF4E, a strong candidate gene for autism, and disrupts sequences coding for alternative transcripts that are highly expressed in brain tissues. Mutation screening of 120 multiplex autism families identified a further two unrelated families, where both affected children and one parent harbored the same single nucleotide insertion at position -25, in the basal element of the EIF4E promoter. This variant, not present in 2040 control chromosomes, enhances promoter activity. It also causes a truncating mutation in alternative transcripts. Our findings suggest that germline variation in EIF4E, which has a key role in control of synaptic plasticity and memory, is implicated in the pathogenesis of autism.

Autism (OMIM 209850) is a common childhood onset neurodevelopmental disorder, characterized by severe and sustained impairment of social interaction and social communicative abilities, as well as a markedly restricted repertoire of activities and interests. Although multifactorial in origin, autism has a strong genetic basis with monozygotic twin concordance approaching 90% ^l. It is clinically heterogeneous with up to 10% of cases associated with well defined neurological disorders such as tuberous sclerosis and fragile X syndrome¹. Genome wide linkage studies yielded linkage peaks on chromosomes 17q, 5p,llp and 4q^2"5, and rare mutations have been found at several loci including the neuroligin, neurexin and SHANK3 genes^5"7. o

Microscopic chromosomal rearrangements are seen in 3-6% of autism , submicroscopic copy number variations (CNVs) in at least 10% of sporadic, but fewer, <2%, in familial cases⁹'¹⁰. Here we demonstrate a role for the eukaryotic translation initiation factor 4E gene (EIF4E) in autism.

Routine clinical cytogenetic screening identified a de novo balanced 46,XY,t(4;5)(q23;q31.3) translocation in a child with classic autism. There was no family history suggestive of autistic traits. He had no dysmorphic features, other than a double hair whorl on the crown, and no malformations. Both Autism Diagnostic Observation Schedule- Generic (Module)¹¹ and Autism Diagnostic Interview Revised (2000)¹² demonstrated a typical and severe autistic phenotype and on all measures, DSMIV criteria for the diagnosis of Autistic disorder were fulfilled. FISH analysis with BAC and cosmid clones localized the sites of the breakpoints. BAC clone RPl 1-91 INlO spanned the breakpoint on chromosome 4, and cosmids mapped the breakpoint on chromosome five to a 47.6 kb interval (142,854,992- 142,902,586) (Fig. 4). Fine mapping was performed using PCR on DNA amplified from flow sorted derivative chromosomes identified as the derivatives by chromosome painting. The breakpoint boundaries were then defined using direct sequencing (Fig. 1). The breakpoint on chromosome four is located in a region linked to autism^2"5. It maps 56kB downstream of the EIF4E reference sequence, a strong candidate gene for autism. The breakpoint on chromosome five is not in a linked region, the nearest gene being NR3C1 (29kB). Families with heterozygous mutation of NR3C1 are reported with hypertension, hypokalemia and female masculinisation, but not autistic features¹³. Our subject by contrast is normotensive with a normal urinary screen for catecholamines.

We found no difference from controls in real-time RT-PCR expression analysis of all genes, including EIF4E, surrounding the breakpoints in EBV- transformed lymphocytes from the translocation case, and Western analysis of EEF4E in lymphocytes from the carrier was also normal (Figs. 5 and 6). Using Affymetrix Human Exon 1.0 ST array data (http://genome.ucsc.edu), we noted a region downstream of the chromosome 4 breakpoint showing increased expression in cerebellum. Furthermore, the Genescan algorithm suggests that transcripts of EIF4E are not restricted to the reference EIF4E coding sequence and promoter. An alternative transcript of 12 exons, NT_016354.401, spans the breakpoint and is disrupted by the translocation. All 12 exons are expressed in GenBank mRNA and / or seen on Affymetrix arrays. The translocation breakpoint is flanked by exons 10 and 11. We have now examined other brain tissues by Northern analysis and have found widespread expression of exon 12 of NT_016354.401 (Fig. 2). The protein derived from NT_016354.401 has a central core of 212 amino acids shared with EIF4E, and unique N- and C-termini (145 and 198 amino acids, respectively), with the C-terminus being largely encoded by exons 10, 11 and 12.

We used direct sequencing to examine the EIF4E reference sequence and alternative transcript NT_016354.401 for mutations in 120 multi-case families from the Autism Genetic Research Exchange collection (AGRE; www.agre.org). We identified a single base C insertion in both affected siblings and one parent from two independent families. This sequence variant, which is not present in 2040 control chromosomes, is located in a region previously identified as an EIF4E basal promoter element that binds hnRNPK¹⁴ (Fig. 3). Western analysis showed no difference in EIF4E expression in EBV-transformed lymphoblasts (Fig. 6). However electrophoretic mobility shift assays (EMSA) showed that this DNA sequence variant has an increased affinity for an abundant nuclear factor, probably hn-RNPK¹⁴ (Fig. 3c). Using a promoter activity assay with a luciferase reporter we found a commensurate increase in EIF4E promoter activity in the presence of the single base insertion (Fig. 3d). This C insertion also affects NT_016354.401 - it introduces a premature termination codon 30 nucleotides downstream. A number of rare base changes were also present in the autism families (see Table 1). Table 1: Sequence variations identified by direct sequencing in autism families.

* EIF4E mRNA reference sequence

EIF4E activity is the rate-limiting component of eukaryotic translation initiation, which directs ribosomes to the mRNA 5' cap structure for initiation of protein synthesis. In brain, EIF4E activity is fundamental to the regulation of lasting alterations in synaptic strength or plasticity, and of long-term potentiation (LTP): these are important in learning and memory¹ '* . Increased activity in these systems can lead to repetitive, perseverative behaviour patterns¹⁵. EIF4E is highly conserved across species and no germline mutations in the reference transcript have been reported to date.

A number of independent lines of evidence point to EIF4E as a strong candidate gene for autism. It is located in a linkage hot spot implicated through four linkage studies^2"5. EIF4E activity is regulated by the highly conserved PTEN/P13K and Tuberous Sclerosis (TS) pathways. These pathways converge on mammalian Target of Rapamycin (mTOR), an upstream regulator of EIF4E. In tuberous sclerosis, where 25 - 50% have autistic features, mutations in TSCl and TSC2, remove inhibition of mTOR and increase EIF4E activity¹. Similarly, in Cowden and other sydromes with germline mutations in PTEN, there are often associated autistic features¹⁷. Also mice with knockouts of the intracellular receptor mediator of rapamycin activity, Fkbpl2, display repetitive and other behavioral features like those found in autism¹⁵. Dysregulation of these signaling pathways can result in abnormalities of brain growth and synaptic plasticity in a manner analogous to Fragile X syndrome, a learning disability disorder with prominent autistic features, where inactivation of FMRP causes upregulation of synaptic translation¹⁸. Dysregulation of glutamate signaling is also seen in both Fragile X and TS. Cap-dependent translation is active during mGluR-LTD, and both MEK-ERK and P13K-mTOR signaling pathways regulate EIF4E activity¹⁹. Finally mutation in another sub-unit of the translation initiation complex, EIF2B, causes the pediatric neurological disorder, vanishing white matter disease . We previously reported decreased white matter and increased grey matter in autism²¹ Thus variation in EIF4E or interacting proteins is consistent with the white matter variation observed in autism.

Our finding of mutations in three families implicates the EIF4E gene in the pathogenesis of autism, and provides a strong case for further study of EBF4E and related pathways and their relationship to autism. A limitation is that we cannot access brain tissue from the translocation carrier and see if the translocation alters EIF4E function in brain. Full characterization of expression of the alternative isoforms in brain tissue from other individuals is also required. What is clear is that exons 10, 11 and 12 of the alternative transcript are highly expressed in brain, and all nine other exons are also expressed. It is also clear that the breakpoint is located between exons 10 and 11, and so would disrupt any transcripts containing these sequences. Downstream brain specific regulatory elements may also be disrupted by the translocation. Similarly, the mutation in the basal promoter element of the EIF4E reference sequence alters EIF4E promoter binding affinity and promoter activity, but could only be examined for changes in EEF4E expression in peripheral tissue from affected members of the two families. The mutation also introduces a premature termination codon 30 nucleotides downstream of the insertion site of the NT_016354.401 transcript, and so produces an open reading frame lacking EIF4E sequence. Haplo-insufficiency may result from nonsense-mediated mRNA decay. Regulation of synaptic plasticity by EIF4E is highly complex and probably governed by as yet unknown additional EIF4E binding proteins¹⁵. In oncogenesis, increased EEF4E activity results in specific upregulation of translation of particular rnRNAs that are normally inefficiently translated¹⁶. Subtle dysregulation, either up or down, of synaptic EIF4E through modification of translation of specific brain transcripts may significantly impact on delicate processes such as synaptic consolidation. The penetrance and expressivity of such variants will depend upon genetic background and environmental factors, possibly at specific stages in development. This could account for our finding of reportedly asymptomatic carriers of the insertion mutation among the parents of the affected cases. It is interesting to note that in contrast to findings at other autism loci, none of the affected cases with mutations in this study had either associated mental retardation or epilepsy. Larger studies are now required to determine the prevalence and penetrance of EDF4E mutations. Finally, EIF4E is the endpoint of a number of pathways implicated in autism. Our findings raise the interesting possibility that, in cases where these pathways are affected, pharmacological manipulation of mTOR signalling or other pathways controlling EIF4E expression may be of therapeutic benefit. References

1 Abrahams, BS, Geschwind, DH. Advances in autism genetics: on the threshold of a new neurobiology. Nature Reviews Genetics 9, 341-355 (2008).

2 Yonan, AL, et al.. A genomewide screen of 345 families for autism- susceptibility loci. Am. J. Hum. Genet.73, 886-97 (2003).

3 Trikalinos TA, et al.. A heterogeneity-based genome search meta-analysis for autism spectrum disorders. MoI. Psychiatry 11, 29-36 (2006).

4 Schellenberg, GD, et al.. Evidence for multiple loci from a genome scan of autism kindreds. MoI. Psychiatry 11, 1049-60 (2006).

5 Szatmari, P, Jones, MB, Tuff, L, Bartolucci, G, Fisman, S, and Mahoney, W. Lack of cognitive impairment in first-degree relatives of children with pervasive developmental disorders. /. Am. Acad. Child. Adolesc. Psychiatry 32, 1264-1273 (1993).

6 Jamain, S, et al.. Mutations of the X-linked neuroligins NLGN3 and NLGN4 are associated with autism. Nat. Genet. 34, 27-29 (2003).

7 Durand, CM, et al.. Mutations of the synaptic scaffolding protein SHANK3 are associated with autism spectrum disorders. Nat. Genet. 39, 25-7 (2006). 8 Vorstman, JA, et al. Identification of novel autism candidate regions through analysis of reported cytogenetic abnormalities associated with autism. MoI. Psychiatry 11, 18 - 28 (2006).

9 Sebat, J, et al. Strong association of de novo copy number mutations with autism. Science 316, 445-9 (2007).

10 Weiss, LA, et al. Association between microdeletion and microduplication at 16pll.2 and autism. N.E.J.M. 358, 667-675 (2008).

11 Lord, C, et al. The autism diagnostic observation schedule-generic: a standard measure of social and communication deficits associated with the spectrum of autism. J. Autism Dev. Disord. 30, 205-223 (2000).

12 Lord, C, Rutter, M, Lecouteur, A. Autism Diagnostic Interview-Revised - A Revised Version of A Diagnostic Interview for Caregivers of Individuals with Possible Pervasive Developmental Disorders. /. Autism Dev. Disord. 24, 659-685 (1994).

13 Karl, M, et al.. Familial glucocorticoid resistance caused by a splice site deletion in the human glucocorticoid receptor gene. /. Clin. Endocrin. Met 76, 683 - 689 (1993).

14 Lynch, M, et al. hnRNP K binds a core polypyrimidine element in the Eukaryotic Translation Initiation Factor 4E (eIF4E) promoter, and its regulation of eIF4E Contributes to neoplastic transformation. MoI. Cell. Biol. 25, 6436-6453 (2005).

15 Klann, E, Dever, TE. Biochemical mechanisms for translation in synaptic plasticity. Nature Reviews Neuroscience 5, 931-942 (2004).

16 Richter, JD, Sonenberg N. Regulation of cap-dependent translation by eIF4E inhibitory proteins. Nature 433, 477-80 (2005). 17 Butler, MG, et al. Subset of individuals with autism spectrum disorders and extreme macrocephaly associated with germline PTEN tumour suppressor gene mutations. J Med Genet. 42, 318-321 (2005).

18 Pfeiffer, BE, Huber, KM. Current Advances in Local Protein Synthesis and Synaptic Plasticity. J. Neurosci. 26, 7147-7150 (2006).

19 Banko, JL, Poulin, F, Hou, L, DeMaria, CT, Sonenberg, N and Klann, E. The translation repressor 4E-BP2 is critical for eIF4F complex formation, synaptic plasticity, and memory in the hippocampus. J. Neurosci. 25, 9581-9590 (2005).

20 Leegwater, P, et al. Subunits of the translation initiation factor eIF2B are mutant in leukoencephalopathy with vanishing white matter. Nat. Genet. 29, 383-8 (2001).

21 Waiter, GD, et al. Structural white matter deficits in high-functioning individuals with autistic spectrum disorder: a voxel-based investigation. Neuroimage 24, 455-61 (2005).

22 DE Rooney. Human Cytogenetics: constitutional analysis. A practical approach. Third Edition 2001, Oxford University Press, Oxford.

23 Telenius, H, et al. Cytogenetics analysis by chromosome painting using DOP- PCR amplified flow-sorted chromosomes. Genes Chromosomes Cancer 4, 257-263 (1992).

24 Yang, F, Carter, NP, Shi, L, Ferguson-Smith, MA. A comparative study of karyotypes of muntjacs by chromosome painting. Chromosoma 103, 642-52 (1995).

25 Pfaffl, MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, 2002-7 (2001). 26 Mϋller, B, Blackburn, J, Feijoo, C, Zhao, X, Smythe, C. DNA-activated protein kinase functions in a newly observed S phase checkpoint that links histone mRNA abundance with DNA replication J. Cell. Biol. 179, 1385-1398 (2007).

27 Jaramillo, M, Pelletier, J, Edery, I, Nielsen, PJ, Sonenberg, N. Multiple mRNAs encode the murine translation initiation factor eIF-4E. J. Biol. Chem. 266, 10446-10451 (1991).

Claims

1. A compound capable of modulating the expression, function and/or activity of eukaryotic translation initiation factor 4E (eIF4E), for treating a behavioural disorder in a subject.

2. Use of a compound capable of modulating the expression, function and/or activity of eIF4E, in the manufacture of a medicament, for the treatment of a behavioural disorder in a subject

3. A method of treating a patient suffering from a behavioural disorder, said method comprising the step of administering a therapeutically effective amount of a compound capable of modulating the expression, function and/or activity of eEF4E.

4. The compound of claim 1, use of claim 2 or method of claim 3, wherein the compound modulates the function and/or expression of the eIF4E gene, its protein product, eIF4E associated proteins and/or nucleic acid sequences.

5. The compound of claim 1, use of claim 2 or method of claim 3, wherein the compound modulates the function, expression or activity of the eukaryotic elongation factors (elF) 4A/4G, eIF4B, eIF3, eukaryotic initiation factor 4E binding proteins (eIF4E-BP: for example the specific proteins 4EBP 1, 4EBP2, or 4EBP3) and/or mascin and cytoplasmic polyadenylation element binding protein (CPEB).

6. The compound, use or method of claims 1-5, wherein the behavioural disorder is autism and/or schizophrenia.

7. An eIF4E gene sequence or fragment thereof, which gene sequence or fragment thereof, is capable of expressing one or more copies of the eIF4E protein, for use in treating a behavioural disorder.

6. A method for screening, identifying and/or testing agents which may be useful in the treatment of a behavioural disorder, said method comprising the steps of:

(a) contacting a test agent or agents with the eukaryotic initiation factor 4E (eIF4E) gene, its protein product or an eIF4E associated nucleic acid or protein; and

(b) detecting any interaction between the test agent or agents and the eIF4E gene, its protein product or the eIF4E associated nucleic acid or protein.

7. The method of claim 6, wherein an interaction between a test agent(s) and the eIF4E gene, its protein product or the eIF4E associated nucleic acid or protein, may be detected by immunological techniques such as enzyme linked immunosorbant assays (ELISA), immunoblotting, immunofluorescence, immunohistochemical staining and/or co-immunoprecitation.

8. The method of claims 6 or 7, wherein the test agent(s) is/are labelled so as to permit detection of test agent(s)/eIF4E gene, test agent(s)/eIF4E protein product, test agent(s)/eEF4E associated nucleic acid and/or test agent(s)/eIF4E associated protein complexes.

9. The method of claims 6-8, wherein the test agents are selected from the group consisting of small compounds (such as small organic molecules); antibodies; antibody fragments (such as, for example Fab, Fab(2) and nanobody fragments); the eIF4E gene; eIF4E regulatory elements (such as promoters, associated regulatory elements or the like); protein products; and fragments of any of these.

10. The methods of claims 6-9, wherein the test agents are nucleic acids (either DNA or RNA) or proteins which interact with the eIF4E gene or its protein product.

11. The methods of claims 6-10, comprising the further step of detecting any modulation of the activity and/or expression of the eEF4E gene, its protein product or an eIF4E associated nucleic acid or protein, by the test agent or agents.

12. The method of claim 11 , wherein the modulation manifests as either an increase or decrease in the activity or expression of the eIF4E gene, its protein product or an eIF4E associated nucleic acid or protein, relative to the activity or expression of the eIF4E gene, its protein product or an eIF4E associated nucleic acid or protein, in a normal or control assay.

13. An agent detected by the methods of claim 6-12, for use in treating a behavioural disorder.

14. The use of an agent detected by the methods of claims 6-12, in the manufacture of a medicament for the treatment of a behavioural disorder.

15. A method of treating a subject suffering from or predisposed to developing a behavioural disorder, said method comprising the step of administering an effective amount of an agent screened, identified or tested by the methods of claims 6-12

17. A method of diagnosing a genetic predisposition to a behavioural disorder in a subject, said method comprising the steps of;

(a) providing a sample of nucleic acid from a subject

(a) detecting the presence of a mutation in the eIF4E gene, its protein product, an associated protein sequence and/or associated nucleic acid sequence.

18. The method of claim 17, wherein the mutation is selected from the group consisting of single or multiple base pair amino acid insertions; substitutions; and deletions

19. The method of claims 17 or 18, wherein an associated nucleic acid sequence comprises or encodes the eIF4E promoter region, a transcription factor or other regulatory element involved (either directly or indirectly) with eIF4E expression.

20. The method of claims 17 to 19, wherein the detection of a mutation or alteration in the eEF4E gene, its protein product, an associated protein sequence and/or associated nucleic acid sequence, indicates that a subject has or is predisposed to developing a behavioural disorder.

21. The method of claims 17 to 20, wherein the detection of the insertion of an additional cytosine into the eIF4E promoter indicates that a subject has or is predisposed to developing a behavioural disorder.

22. The method of claim 17 to 20, wherein the detection of a balanced translocation of chromosomes 4 and 5 ((46,XY,t(4:5)(q22;q31.3) indicates that a subject has or is predisposed to developing a behavioural disorder.

23. The method of claims 17 to 20, wherein the detection of any of the mutations listed in Table 1 of the specification, indicates that a subject has or is predisposed to developing a behavioural disorder.

24. A method of diagnosing a behavioural disorder in a subject, said method comprising the steps of:

(a) providing a sample of nucleic acid from a subject; and

(b) detecting the presence of one or more of:

1. a balanced translocation of chromosomes 4 and 5 ((46,XY,t(4:5)(q22;q31.3).

2. the insertion of an additional cytosine into the eIF4E promoter; and/or

3. one or more of the mutations listed in Table 1 of the specification.

25. A non-human transgenic animal for use in studying a behavioural disorder and/or screening test agents potentially useful in the treatment of a behavioural disorder, wherein said non-human transgenic animal comprises a chromosomally incorporated or extra-chromosomal altered or mutated eIF4E gene or eIF4E associated gene.

26. A method of testing or evaluating the efficacy of a test agent for use in treating a behavioural disorder, said method comprising the steps of: a) administering a test agent or agents to a transgenic animal in accordance with the ninth aspect of the present invention; and b) comparing the effect of said test agent on the behaviour of said transgenic animal with the behaviour of a control animal not administered the test agent, wherein a change in behaviour of the transgenic animal of step (a) as compared to the control c) animal, identifies said test agent as potentially useful in the treatment of a behavioural disorder.