JP4583849B2 - New diabetes-related factors - Google Patents

Description

  The present invention relates to a method for screening a therapeutic or preventive agent for diabetes, a pharmaceutical composition for diabetes, a diagnostic agent and diagnostic method for diabetes, and a diagnostic kit for diabetes.

  Diabetes is mainly characterized by symptoms such as polydipsia, polyuria, weight loss, and chronic hyperglycemia, and is generally a disease accompanied by complications such as retinopathy, nephropathy, and peripheral neuropathy. Depending on the etiology of diabetes, primary diabetes (insulin-dependent diabetes (type I diabetes), non-insulin-dependent diabetes (type II diabetes)), secondary diabetes (pancreatic diabetes, extrapancreatic / endocrine diabetes, drugs Induced diabetes). Further, diabetes is known to be a risk factor for arteriosclerotic diseases such as myocardial infarction and cerebral infarction.

  Conventionally, as a method for treating diabetes, for example, improvement of life by diet therapy, exercise therapy, etc., control of factors related to glucose metabolism such as insulin injection, insulin secretion regulator or insulin sensitivity regulator, α-glucosidase, etc. Therapeutic methods targeting the control of the function of factors related to sugar absorption have been performed.

On the other hand, mouse KLF7 (Kruppel-like transcription factor 7) has been reported to play an important role in neurogenesis (see, for example, Non-Patent Document 1). It has also been reported that KLF7 can regulate TrkA (receptor for nerve growth factor (NGF)) gene expression in the peripheral nervous system. (For example, refer nonpatent literature 2).
Laub, F. et al., Dev, Biol. 2001 May 15; 233 (2): 305-18 Lei L. et al., Development. 2001 Apr: 128 (7) 1147-58

  However, there are cases in which a desired effect cannot be obtained even when a conventional method for treating diabetes is applied.

  Human KLF7 is presumed to be a transcription factor from its amino acid sequence, but its detailed function is not clear. Furthermore, it is still unclear how KLF7 is related to the development of diabetes.

  Therefore, an object of the present invention is to provide an efficient screening method for a therapeutic or prophylactic agent for diabetes by evaluating the expression of KLF7 or its activity, and a screening kit capable of simply and rapidly performing the screening method. And

  The present invention also provides a substance obtained by the screening method, which is preferably used as a therapeutic or preventive agent for diabetes, and a pharmaceutical composition comprising the substance suitable for treating or preventing diabetes as an active ingredient. Objective.

  Furthermore, an object of the present invention is to provide a detection method for easily detecting a nucleic acid contributing to the onset of diabetes from a test sample obtained from a diabetic patient.

That is, the gist of the present invention is as follows.
[1] A screening method for a therapeutic or prophylactic agent for diabetes, characterized by evaluating the expression level of KLF7 in the presence of a test substance,
[2] (1) a nucleic acid encoding the KLF7, and (2) KLF7 nucleic acid encoding is introduced to, cells expressing KLF7
Or comprising at least one Ranaru selected from the group, a kit for use in the screening method of [1] above,
[3] A method for detecting a nucleic acid that contributes to the onset of type II diabetes, comprising detecting the substitution of the 35092nd base from C to A in the base sequence of the second intron of the KLF7 gene ,
[4] afflicted with type II diabetes, characterized by detecting substitution of the 35092nd base from C to A in the base sequence present in the second intron of the KLF7 gene in a test sample derived from the test individual A method for selecting a test individual having a high probability of undergoing a diagnosis , and [5] type II diabetes comprising a probe or primer for detecting a C to A substitution at the 35092th base present in the second intron of the KLF7 gene the diagnostic kit of the possibility of suffering from
About the.

  According to the method for screening a therapeutic or prophylactic agent for diabetes of the present invention, a substance capable of treating diabetes and acting on diabetes based on KLF7 can be conveniently and efficiently screened in a diabetic patient. There is an excellent effect. Further, according to the pharmaceutical composition for diabetes of the present invention, diabetes can be treated or prevented from developing in diabetes patients, and symptoms can be reduced or prevented from developing for diabetes based on KLF7. There is an excellent effect of being able to. Furthermore, according to the method for detecting a nucleic acid contributing to the onset of diabetes of the present invention, there is an effect that it can be easily detected from a test sample obtained from a diabetic patient.

  One major feature of the screening method of the present invention is that the expression of KLF7 gene or the activity of KLF7 is evaluated in the presence of a test substance.

  Conventional diabetes-related genes were genes encoding individual factors involved in insulin expression, insulin secretion, or insulin responsiveness, but KLF7 is a transcription factor involved in all of them, so all diabetic patients It is possible to screen for usable drugs.

  That is, by examining the influence of a test substance on the expression or activity of KLF7, which is associated with the onset of diabetes, screening of substances effective as therapeutic or preventive drugs for diabetes is efficiently performed. The influence of the test substance on the expression of KLF7 or its activity is preferably examined using the expression in the absence of the test substance as a control.

  The screening method of the present invention can be used for pharmacological evaluation of candidate substances for therapeutic or prophylactic drugs for diabetes.

  KLF7 used in the present invention is a factor known to be involved in the regulation of TrkA gene expression in neurogenesis or the peripheral nervous system, and is a polypeptide having the amino acid sequence shown in SEQ ID NO: 2. .

  Surprisingly, in the second intron of the KLF7 gene, the present invention is frequently found in the genotype where the 35092th A is an A, and the abnormal expression of KLF7 can cause diabetic deterioration or aggravation in type II diabetic patients. Based on our findings that related symptoms appear. That is, the present invention is based on the inventors' knowledge that KLF7, which was known to act on the nervous system, is unexpectedly related to diabetes.

  The KLF7 gene used in the present invention can be obtained, for example, as follows.

  Human KLF7 cDNA is cloned by PCR using human Adipocyte Marathon-Ready cDNA (CLONTECH) as a template and human KLF7-specific primers. Human KLF7-specific primers use sense strand 5'-TGAGCCAGACAGACTGACAA-3 '(SEQ ID NO: 3) and antisense strand 5'-CCTTTAGACACTAGCCGATG-3' (SEQ ID NO: 4). PCR is KOD-PLUS (manufactured by TOYOBO) ), Perform 2 cycles at 95 ° C for 2 minutes, 94 ° C for 15 seconds, 55 ° C for 30 seconds, and 68 ° C for 2 minutes for 30 cycles. Then add a small amount of Ex Taq (Takara Bio) and react at 72 ° C for 2 minutes. The obtained PCR product was electrophoresed on a 0.8% agarose gel, the target DNA fragment was purified using MinElute Gel Extraction Kit (QIAGEN), and then pCR2.1 vector using TA Cloning Kit (Invitrogen). Incorporate into. The nucleotide sequence of the human KLF7 region of the obtained plasmid pCR2.1-KLF7 is represented by M13-Forward primer: 5′-GTAAAACGACGGCCAGTG-3 ′ (SEQ ID NO: 5) and M13-Reverse primer: 5′-CAGGAAACAGCTATGACC-3 ′ (sequence) Confirm by performing the sequence using No. 6). Sequencing reaction is performed using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), and electrophoresis and analysis are performed using Applied Biosystems 3700 DNA Analyzer.

  Examples of the “test substance” used in the screening method of the present invention include a substance contained in a sample such as a cell extract of an organism, a cell-free extract of the organism, a cell culture supernatant of the organism, Examples include chemically produced substances, chemically synthesized compounds, and the like.

  More specifically, examples of the test substance include compounds, peptides, peptidomimetics, various proteins, nucleic acids, nucleic acid analogs, antibodies, antibody fragments, and the like. In addition, the said compound also includes the compound of the combinatorial library obtained by combinatorial chemistry. The antibody and antibody fragment include a monoclonal antibody, a polyclonal antibody, a single chain antibody, a chimeric antibody, a humanized antibody, a Fab fragment, and the like. Examples of the nucleic acid and nucleic acid analog include antisense nucleic acid, ribozyme, PNA and the like.

  Here, examples of the organism include plants, animals, and microorganisms.

  Examples of the “activity of KLF7” include “an event caused by expressing KLF7”.

  Specific examples of the event include regulation of various gene expressions, suppression of insulin secretion, suppression of differentiation into adipocytes, and the like. Examples of the regulation of gene expression include suppression of insulin gene expression, suppression of hexokinase gene expression, suppression of leptin gene expression, suppression of adiponectin gene expression, and enhancement of IL-6 gene expression. In the screening method of the present invention, by evaluating such an event as an index of the activity of KLF7, there is an excellent effect that the activity of the test substance against KLF7 can be more easily evaluated. Therefore, when the activity of KLF7 is evaluated using the regulation of the expression of each gene as an index, it is preferable that the gene is operably linked so that the expression is affected by KLF7.

  Specifically, the screening method of the present invention evaluates an event caused by expressing the KLF7 gene in the presence of a test substance.

More specifically, the screening method of the present invention comprises (I) a step of introducing a nucleic acid encoding KLF7 into a cell,
(II) a step of measuring the expression level or activity of KLF7 in the cells obtained in step (I) in the presence of the test substance; and (III) the expression level or activity measured in the absence of the test substance. Selecting a test substance that results in suppression of expression or inhibition of activity as a candidate substance for treating or preventing diabetes,
including.

  Examples of the nucleic acid containing a gene encoding KLF7 include a nucleic acid encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, for example, a nucleic acid having a base sequence shown in SEQ ID NO: 1.

  In the present invention, if the encoded polypeptide exhibits biological activity equivalent to the polypeptide having the amino acid sequence shown in SEQ ID NO: 2 (hereinafter also referred to as wild-type KLF7), The nucleic acid encoding KLF7 may be a variant of a nucleic acid encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

  Biological activity equivalent to wild-type KLF7 indicates that their properties are qualitatively (eg, physiologically or pharmacologically) homogeneous. Therefore, it is preferable that the above activities are equivalent (for example, about 0.01 to 100 times, preferably about 0.1 to 10 times, more preferably 0.5 to 2 times), but the amount of these activities, the amount of protein molecular weight, etc. Target elements may be different.

As a variant of the nucleic acid encoding the wild type KLF7, for example,
1) Substitution, deletion, addition or insertion of at least one residue, specifically, one or more, preferably one or several amino acid residues in the amino acid sequence shown in SEQ ID NO: 2. A nucleic acid encoding an amino acid sequence having
2) a nucleic acid capable of hybridizing under stringent conditions with an antisense strand of a nucleic acid encoding wild type KLF7,
3) A value obtained by aligning the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2 to an optimal state by the Lipman-pearson method (Science, 227, p1435 (1985)) Examples include nucleic acids having a base sequence of 50%, preferably 80% or more, more preferably 90% or more.

  The nucleic acid of 1) may be a naturally derived variant or a mutant having an artificial mutation. A mutant having an artificial mutation can be prepared by site-directed mutagenesis or the like according to the description in, for example, Molecular Cloning a Laboratory Manual 3rd edition.

  In the present specification, examples of the stringent conditions include 6 × SSC (composition of 1 × SSC: 0.15M NaCl, 0.015M sodium citrate, pH 7.0), 0.5% SDS, 5 × Denhardt, and 100 μg / Incubate in a solution containing ml denatured salmon sperm DNA and 50% formamide at 50 ° C., more stringent for 12 hours at 60 ° C. and low ionic strength, eg 0.5 × SSC, more stringent 0.1 × Wash under conditions such as SSC and / or higher temperature, 50 ° C or higher, 55 ° C for more stringent, 60 ° C for more stringent, 65 ° C for more stringent Conditions are mentioned.

  In the step (I), when the nucleic acid encoding KLF7 is introduced into a cell, the nucleic acid is ligated to an appropriate vector, and the resulting recombinant vector is introduced into the cell by a conventional gene introduction method. May be. In the step (I), the nucleic acid may be used as so-called naked-DNA, and is supported on a conventional carrier such as a liposome, a gold particle, or a virus extract (hereinafter referred to as nucleic acid introduction). May also be used.

  From the viewpoint of establishing a stable expression cell line, the vector preferably contains an antibiotic resistance gene. For example, pcDNA3.1, pCDM8, pREP, pUC19, pTrxFus (trade name, Invitrogen) PET-3, pET-11, pBluescriptII SK (+), pBluescriptII SK (-), pCMV-Script (STRATAGENE), pCl-neo (Promega), pAxCAwr, pUC118, pSTV28 (Takara Bio) Manufactured).

  Examples of the gene introduction method include an electroporation method (Cytotechnology, 3 (2), 133-140 (1990)), a calcium phosphate method (JP-A-2-27075), a lipofection method (Proceedings of the National Academy of). Sciences USA, 84, 7413 (1987); Vilology, 52, 456 (1973)), DEAE dextran method, particle gun method, virus-based method, and the like.

  When using a method using a virus, it is preferable to use an adenovirus, a retrovirus, a lentivirus, or the like.

  The cells are preferably mammalian cells, for example, HIT-T15 (hamster β cells, manufactured by Dainippon Pharmaceutical), HPA (human adipocytes, manufactured by Zen-Bio, Inc.), L6 (rat skeletal muscle cells). , ATCC: CRL-1458), 3T3-L1 (mouse fibroblast, ATCC: CL-173), HEK293 (human embryonic kidney cell, ATCC: CRL-1573) of human-derived cell line, HeLa (cervical cancer cell, ATCC: CCL-2) HBT5637 (leukemia cells, JP-A 63-299), BALL-1 (leukemia cells) and HCT-15 (colon cancer cells), human renal glomerular epithelial cells, mouse-derived strain cells Sp2 / 0-Ag14 (mouse myeloma cells, ATCC: CRL-1581) and NSO (mouse myeloma cells), mouse glomerular epithelial cells, monkey-derived cell line COS-1 (African green monkey kidney cells (SV40 transformed cells) , ATCC: CRL-1650) and COS-7 (African green monkey kidney cells (SV40 transformed cells), ATCC: CRL-1651), hamster-derived cell line CHO-K1 ( Chinese hamster ovary cells, ATCC: CCL-61) and BHK-21 (C-13) (Sicilian hamster offspring cells, ATCC: CCL-10), rat-derived cell line PC12 (adrenal pheochromocytoma, ATCC: CRL-1721) and YB2 / 0 (rat myeloma cells, ATCC: CRL-1662), rat glomerular epithelial cells, and the like. Of these, human-derived cells are preferable from the viewpoint of therapeutic drug screening.

  Next, in step (II), the expression level or activity of KLF7 in cells expressing KLF7 is measured in the presence of the test substance.

In step (II), the expression level or activity of KLF7 is, for example,
-Cells are cultured in a medium containing a test substance, and total RNA is extracted from the obtained cells. Using the obtained total RNA as a template, KLF7, insulin, hexokinase, leptin, adiponectin and IL-6 (this specification) RT-PCR using primers (pairs) according to the document (which may be subject to evaluation);
-Cells are cultured in a medium containing the test substance, total RNA is extracted from the obtained cells, cDNA is synthesized using the obtained total RNA as a template, and real-time using primers and probes according to the evaluation target A method of performing quantitative PCR;
-A method of introducing a reporter gene linked to a promoter region of an evaluation control into a cell and conducting a reporter assay using cells obtained by culturing in a medium containing a test substance;
-A method of culturing cells in a medium containing a test substance, extracting total RNA from the obtained cells, and performing Northern blot analysis using a probe according to the evaluation target;
A method of culturing cells in a medium containing a test substance, preparing a cell-free extract from the obtained cells, and performing an immunoassay using the obtained cell-free extract and an antibody against the evaluation target;
-A method of culturing cells in a medium containing a test substance, and performing an immunoassay using the obtained culture supernatant and an antibody against the evaluation target;
-A method using an assay kit capable of culturing cells in a medium containing a test substance and quantifying the amount of the evaluation target in the obtained cells or cell supernatant;
-A method for culturing cells in a medium containing a test substance and subjecting the obtained cells to an assay capable of evaluating differentiation into adipocytes;
Or the like. Among these, from the viewpoint of performing screening rapidly and in large quantities, a method capable of processing rapidly and in large quantities is desirable, and immunoassays and reporter assays are desirable.

  The medium may be any medium suitable for culturing mammal-derived cells. For example, MEM medium (Science, 130, 432 (1959)), DMEM medium (Virology, 8, 396 (1959)), RPMI1640 medium (The Journal of the American Medical Association, 199, 519 (1967)) and the like with fetal calf serum (FCS) added in an appropriate amount.

The culture can be performed under aerobic conditions such as shaking culture or deep aeration stirring culture. The culture temperature, culture time, and pH of the culture solution are set in a range suitable for various hosts. For example, the culture can be usually performed under conditions such as 15 to 40 ° C., 5 hours to 7 days, pH 3.0 to 9.0, and 5% CO ₂ . The pH can be adjusted using an inorganic or organic acid, an alkaline solution, urea, calcium carbonate, ammonia or the like. Moreover, you may add an antibiotic to a culture medium if desired.

  The primer used in the present invention can be prepared by conventional software that supports the design of the primer in consideration of, for example, known sequences such as Tm value and formation of secondary structure of nucleic acid. The primer chain length is not particularly limited, but is, for example, 15 to 40 nucleotides, and preferably 17 to 30 nucleotides.

  As a primer pair that can be used, for example, for the KLF7 gene, a primer pair consisting of a primer having the base sequence shown in SEQ ID NO: 30 and a primer having the base sequence shown in SEQ ID NO: 31; A primer pair consisting of a primer having the base sequence shown in SEQ ID NO: 7 and a primer having the base sequence shown in SEQ ID NO: 8; for the hexokinase gene, a primer having the base sequence shown in SEQ ID NO: 9 and SEQ ID NO: A primer pair consisting of a primer having the base sequence shown in FIG. 10; a primer pair consisting of a primer having the base sequence shown in SEQ ID NO: 11 and a primer having the base sequence shown in SEQ ID NO: 12 for the adiponectin gene; About IL-6 gene Primer pair consisting of a primer having the base sequence shown in column number 13 and a primer having the base sequence shown in SEQ ID NO: 14; for the leptin gene, a primer having the base sequence shown in SEQ ID NO: 15 and the sequence number : A primer pair composed of a primer having the base sequence shown by 16 and the like.

  The probe used in the present invention can be prepared by conventional software or the like in consideration of known sequences such as Tm value and the formation of secondary structure of nucleic acid, as in the case of the primer. The probe chain length is not particularly limited, but from the viewpoint of preventing non-specific hybridization, it is 15 or more consecutive nucleotides, preferably 18 or more nucleotides. The probe includes a nucleic acid consisting of a base sequence that does not exist in a known sequence in a database among nucleic acid sequences encoding a polypeptide to be detected, or an antisense strand thereof, and having a length of 15 or more consecutive nucleotides in the base sequence. Examples thereof include a nucleic acid having a base sequence or an antisense strand thereof.

  Examples of the reporter gene used in the present invention include β-galactosidase, chloramphenicol acetyltransferase, luciferase and the like. Specific examples of the reporter assay are described below. A vector in which the luciferase gene is linked downstream of the promoter region of the insulin gene is constructed and introduced into HIT-T15 cells. By infecting these cells with KLF7 adenovirus, KLF7 is overexpressed and a test substance is added to the medium. A test substance in which the luciferase activity that is suppressed by overexpression of KLF7 is restored to the luciferase activity observed in uninfected HIT-T15 cells is selected.

  The antibody used in the present invention is, for example, a rabbit or mouse using a polypeptide to be detected by a method described in 1992, published by John Weily & Sons, Inc, edited by John E. Coligan, Current Protocols in Immunology. Can be easily produced. The antibody used in the present invention may be a polyclonal antibody or a monoclonal antibody as long as it has the ability to specifically bind to the polypeptide to be detected. After purifying the monoclonal antibody, the peptidase It may be a fragment of an antibody obtained by treatment with the above. Furthermore, the antibody used in the present invention may be a derivative of the antibody, for example, a chimeric antibody, a humanized antibody, a Fab fragment, a single chain antibody, or an antibody modified by a known technique. The specificity of the antibody used in the present invention is, for example, by using the polypeptide to be detected and other polypeptides, reacting with the polypeptide to be detected by the octalony method, and showing a sedimentation line. It can be evaluated as an indicator that it does not react with the polypeptide and does not show a sedimentation line.

  The assay kit used in the present invention is not limited as long as it is a kit that can measure an evaluation target. For example, an insulin measurement kit (manufactured by Morinaga Seikagaku Co., Ltd.), a levis insulin measurement ELISA kit (Shibayagi) Manufactured).

Assays that can be used to evaluate differentiation into adipocytes used in the present invention include assays known in the art. For example, the following steps:
A step of seeding cells in a collagen-coated 6-well plate (manufactured by IWAKI) and culturing until confluent;
A step of inducing cell differentiation, washing the cells that have passed each day after differentiation induction with PBS three times, and then fixing with 1 ml of 10% formalin-containing PBS;
A step of removing PBS containing 10% formalin and leaving it to air dry at 4 ° C for 1 hr or longer; 1 ml of oil red O solution (0.5% oil red O isopropanol solution: distilled water = 6: 4 (w / w)) to each well Add and leave at room temperature for 15 minutes, then wash with distilled water three times; and after taking a picture, add 100 μl isopropanol to each well to elute oil red O and measure the absorbance (OD540). An oil red O assay having a step of measuring the amount of accumulation is included.

  Subsequently, in step (III), the test substance that suppresses the expression or inhibits the activity is compared with the expression level or activity measured in the absence of the test substance. Select as a candidate substance.

  In addition, “measured in the absence of the test substance” means that the measurement was performed in the step (II) by expressing KLF7 in the cell obtained in the step (I) in the absence of the test substance. It is a standard for grasping the suppression of KLF7 expression or inhibition of activity in the presence of the test substance. Specifically, the cell in such a case, or an extract of the cell is used as a control.

  As a result of measuring the expression or activity of KLF7, when suppression of KLF7 expression or inhibition of activity is observed compared to the control, the test substance is determined to be a candidate substance for treating or preventing diabetes, A test substance is selected as a candidate substance.

  The selected candidate substance is thought to have a characteristic property of suppressing the expression of KLF7 at the cellular level or inhibiting the activity of KLF7 at the cellular level, and specifically suppresses the expression of KLF7. It has an excellent effect of being able to specifically inhibit the activity of KLF7.

  The present invention also provides a screening kit comprising KLF7, a nucleic acid encoding KLF7, a cell into which the nucleic acid has been introduced, a KLF7 antibody, and the like used for screening for a therapeutic or prophylactic agent for diabetes.

As the screening kit of the present invention, specifically,
-A kit comprising KLF7,
-A kit comprising a nucleic acid encoding KLF7,
-A kit comprising cells into which a nucleic acid encoding KLF7 has been introduced;
-A kit comprising an antibody against KLF7 or a fragment thereof,
Etc.

  Each kit may contain the probe and / or primer pair that can be suitably used in the screening method of the present invention, if desired. Furthermore, if desired, detection reagents, buffers, standard substances, instructions for carrying out the screening method of the present invention, and the like may be included.

  According to the screening kit of the present invention, there is an excellent effect that the screening method can be carried out simply and rapidly at a high throughput.

  Our knowledge that KLF7 is unexpectedly associated with diabetes provides a pharmaceutical composition for use in the treatment or prevention of diabetes with a substance that suppresses or inhibits the expression of KLF7. .

  The pharmaceutical composition of the present invention is characterized by containing a substance obtained by the screening method of the present invention as an active ingredient. Therefore, the pharmaceutical composition of the present invention exerts a therapeutic or prophylactic effect on diabetes through suppression of KLF7 expression or inhibition of activity.

  The content of the substance in the pharmaceutical composition of the present invention can be appropriately adjusted according to the disease to be treated, the age, weight, etc. of the patient, and may be any therapeutically effective amount. Since the content varies depending on the type of the substance, it cannot be said unconditionally. However, when the substance is a low molecular compound or a high molecular compound, for example, 0.0001 to 1000 mg, preferably 0.001 to 100 mg, the substance is a polypeptide or In the case of the derivative, for example, 0.0001 to 1000 mg, preferably 0.001 to 100 mg. When the substance is a nucleic acid or a derivative thereof, for example, 0.0001 to 1000 mg, preferably 0.001 to 100 mg is desirable.

  The pharmaceutical composition of the present invention may further contain various auxiliaries capable of stably holding the substance. Specifically, pharmaceutically acceptable auxiliaries, excipients, binders, and stabilizers that exhibit the property of inhibiting the active ingredient from degrading before reaching the site where the active ingredient is to be delivered. Agents, buffers, solubilizers, isotonic agents and the like.

  The dosage form of the pharmaceutical composition of the present invention is appropriately selected according to the type of active ingredient; individual, organ, local site, tissue to be administered; age, weight, etc. of the individual to be administered. Examples of the administration form include subcutaneous injection, intramuscular injection, intravenous injection, and local administration.

  The dosage of the pharmaceutical composition of the present invention is also appropriately selected according to the type of the active ingredient; the individual, organ, local site, tissue to be administered; age, weight, etc. of the individual to be administered. The method of administration is not particularly limited, but when the active ingredient is a low molecular compound or a high molecular compound, the amount of the active ingredient is 0.0001 to 1000 mg / kg body weight, preferably 0.001 to 100 mg / kg body weight, polypeptide Or in the case of a derivative thereof, for example, 0.0001 to 1000 mg / kg body weight, preferably 0.001 to 100 mg / kg body weight, and in the case of a nucleic acid or derivative thereof, for example, 0.0001 to 1000 mg / kg body weight, preferably 0.001 to 100 mg / kg. In order to obtain a single dose of kg body weight, administration may be performed a plurality of times per day, for example, 1 to 3 times.

  The pharmacological evaluation of the pharmaceutical composition of the present invention can be performed using, for example, blood insulin level, blood glucose level, blood IL-6, blood C peptide, urine C peptide and the like as indices.

  Furthermore, according to the present invention, in the present inventor's knowledge that, in the second intron of the KLF7 gene, a genotype whose 35092 is A is frequently observed in a patient who developed type II diabetes. Based on this, a diagnostic method for susceptibility to type II diabetes disease is provided. Such a diagnostic method is also included in the present invention.

  The diagnostic method of the present invention is characterized by detecting a polymorphism in the second intron of the KLF7 gene.

  In the diagnostic method of the present invention, specifically, a polymorphism in the nucleotide sequence of SEQ ID NO: 17, ie, a mutation is detected.

  In addition, since the diagnosis method of the present invention uses polymorphism in the second intron of the KLF7 gene, that is, mutation, as an index, the susceptibility to type II diabetes disease in a test individual can be diagnosed with high reliability. There is an excellent effect that susceptibility to type II diabetes can be easily and rapidly diagnosed.

  The polymorphism, that is, mutation means a polymorphism of at least one base, for example, having a substitution, deletion, addition or insertion of at least one base.

  In the present specification, “at least one base” means one base to several hundred bases, preferably one or more, preferably one or several.

  The polymorphism can be detected by performing nucleic acid polymorphism analysis means or the like.

Specifically, the polymorphism is stringent to, for example, a nucleic acid (sense nucleic acid) having the base sequence of (I) the second intron of the KLF7 gene, or (II) the second intron of the KLF7 gene, or an antisense strand thereof. Using nucleic acids selected from the group consisting of nucleic acids that can hybridize under various conditions, by direct sequencing method, Taqman method, Allele specific oligonucleotide hybridization (ASO) method, SSCP method, DGGE method, MALDI-TOF / MS method It can be detected by performing analysis, analysis using clevage or the like, or (III) performing PCR or the like using a primer pair capable of amplifying the nucleic acid of (I).

  The nucleic acid (II) is at least several nucleotides long, preferably several nucleotides to several tens of nucleotides long. Specifically, the nucleic acid (II) is at least 12 nucleotides in length, preferably 18 nucleotides or more.

  The primer pair (III) can be prepared by conventional software that supports the design of the primer in consideration of, for example, known sequences such as Tm values and formation of secondary structures of nucleic acids. The primer chain length is not particularly limited, but is, for example, 15 to 40 nucleotides, and preferably 17 to 30 nucleotides.

Examples of nucleic acid and primer pairs that can be used for detection of the polymorphism include, for example,
Polynucleotide whose KLF7 second intron +35092 is A (SEQ ID NO: 18):
5'-AAAACCCAAAAGACAGTGGTATACTATGTTAGGAAATCTAGTCTTTCAGGAATGAGTTAAACAGCCCTTTCCCAAGCCTGACCAGCAGGCAGCACAGGCTGGTTGGGTGTAATCCCTTTTG-3 ';
Primer (SEQ ID NO: 19) for detecting a polynucleotide containing a portion of KLF7 second intron + 35092:
5'-TTTCCTTTCTGCCTGGACTG-3 ';
Primer (SEQ ID NO: 20) for detecting a polynucleotide containing the second intron of KLF7 + 35092 portion:
5'-CTCCTCCCTAGCCCATCAAC-3 ';
Probe for detecting the second intron of KLF7 gene + 35092 whose base is C (SEQ ID NO: 21):
5'-ATGACGTGGCAGACCCAGCCCTTTCCCAAGCCTG-3 ';
Probe for detecting the second intron of KLF7 gene + 35092 whose base is A (SEQ ID NO: 22):
5'-CGCGCCGAGGACAGCCCTTTCCCAAGCCTG-3 ';
Invader probe (SEQ ID NO: 23) for detecting whether the base of KLF7 gene second intron +35092 is C or A:
5'-GTCTTTCAGGAATGAGTTAAN-3 ';
Etc.

  Examples of the test individual include mammals, specifically humans and non-human mammals such as mice, rats, rabbits, monkeys, and dogs.

  Examples of the sample used in the diagnostic method of the present invention include biological samples obtained from the test individual, such as saliva, skin, peripheral blood, extracted organs, various tissues, hair, body fluids and the like.

  In the diagnostic method of the present invention, when the polymorphism is detected, it becomes an indicator that the subject individual has developed diabetes or is predicted to develop in the future.

  The present invention also provides a method for detecting a nucleic acid that contributes to the development of diabetes in a test nucleic acid sample.

  According to the detection method of the present invention, since the polymorphism is detected, the nucleic acid contributing to the onset of diabetes can be easily and quickly detected from the test nucleic acid sample.

  The test nucleic acid sample used in the detection method of the present invention can be prepared from an individual cell or tissue by a conventional method.

  The detection method of the present invention can be applied to, for example, blood transfusion, examination of collected blood, and the like.

  The detection method of the present invention can be carried out more easily and quickly by a detection kit containing at least one selected from the group consisting of (I) to (III). Such a detection kit is also included in the present invention.

  The detection kit of the present invention contains at least one selected from the group consisting of the nucleic acid (I), the nucleic acid (II) and the primer pair (III).

  Since the kit of the present invention contains the nucleic acid, primer pair, and the like, it is possible to easily and quickly diagnose susceptibility to type II diabetes, and from a test sample obtained from a patient suspected of having diabetes and diabetes, The nucleic acid contributing to the onset of diabetes can be detected easily and quickly. Therefore, the detection kit of the present invention is useful for the diagnostic method of the present invention and the detection method of the present invention.

  The present invention will be described with reference to the following examples, but the present invention is not limited to such examples. In the following examples, unless otherwise specified, genetic manipulation, cell culture, etc., Molecular Cloning: A Laboratory Manual, Second Edition (1989) (Cold Spring Harbor Laboratory Press), Current Protocols in Molecular Biology (Greene Publishing Associates and Wiley-Interscience).

Example 1
Under the informed consent, type II diabetics who regularly visit Shiga Medical University, Tokyo Women's Medical University, Juntendo University or Kawasaki Medical University, and 564 controls recruited through several medical facilities in Japan Experiments were conducted on patients.

  The peripheral blood of the type II diabetic and control patients was collected, and 7 ml of the peripheral blood obtained was centrifuged at 3000 rpm for 10 minutes to remove plasma. Subsequently, erythrocyte lysate was added to the obtained product and incubated at room temperature for 20 minutes. Thereafter, the incubated mixture was centrifuged at 3000 rpm for 5 minutes, and the supernatant was removed. Proteinase K was added to the resulting precipitate and incubated at 37 ° C. for 4 hours or longer. The obtained product was treated with phenol-chloroform, and isopropanol was added to the obtained upper layer (aqueous layer) to cause precipitation of DNA. Next, centrifugation (12000 rpm, 10 minutes) was performed, DNA was collected, 1 ml 70% ethanol was added, and the resulting DNA pellet was added to TE buffer (composition: 10 mM Tris-HCl, 1 mM EDTA (pH 8. 0)) to obtain a DNA sample.

  Using the DNA sample, genotype was determined by the invader method. SNPs to be analyzed were randomly selected from the JSNP database (IMS-JST SNPs database: http://snp.ims.u-tokyo.ac.jp). The genotype of each SNP locus was analyzed by the invader method combined with Multiplex PCR (see, for example, Ohnishi Y. et al., J. Human. Genet., 46, 471-477, 2001).

  A more detailed genetic polymorphism search was performed by the direct sequence method. Target sites were amplified using PCR primers designed based on GenBank information (accession numbers: NM003709 and BC012919) related to the genomic sequence including KLF7. In designing PCR primers, as described in Bedell et al., Bioinformatics, 16, 1040-1041, 2000, trade name: REPEATMASKER program (supplied by the University of Washington, web page address: http: //repeaTmasker.genome. The repetitive elements were excluded from the search target.

The reaction conditions in Multiplex PCR are the reaction solution (composition: 16.6 mM (NH ₄ ) ₂ SO ₄ , 67 mM Tris (pH 8.8), 6.7 mM MgCl ₂ , 10 mM 2-mercaptoethanol, 6.7 μM EDTA, 1.5 mM dNTP, 10xTaq Mix (2.5U / μl Taq DNA polymerase, 31.25U / μl Taq Antibody), 0 or 10% DMSO, each 0.25μM primer), reaction at 95 ° C for 5 minutes, then 95 ° C for 15 seconds and 60 ° C for 45 seconds And 40 cycles of a reaction at 72 ° C. for 3 minutes.

The amplified product was diluted 1:11 with dH ₂ O and dispensed into each well of a 384 plate. Next, the plate was air-dried, and 3 μl of invader reaction solution (composition: 10 × buffer, 10 × FRET probe, 10 × clevase, allele probe) was added to each well on the plate. The plate was then incubated at 63 ° C. for 20 minutes, and then fluorescence (520 nm, 546 nm) was measured for each well of the plate.

  Genotyping was performed on 83,540 SNP loci in each of 188 patients with diabetes and 564 patients in the control group. SNPs that showed significant differences in genotype or allelic frequency between diabetic patients and control individuals by evaluating statistical data using a 2x3 or 2x2 contingency table Selected.

  In addition, statistical analysis of correlation analysis, haplotype frequency and Hardy-Weinberg equilibrium and calculation of linkage disequilibrium coefficient (D ') are described in Devlin B. et al. Genomics, 29, 311-322, 1995 and Nielsen DM. Et al. Am. Hum. Genet., 63, 1531-1540, 1998.

  In screening, 2,015 SNP loci that showed a P value of less than 0.01 between diabetic and control patients were analyzed for a larger number of patients.

As a result, as shown in Table 1, the distribution of the genotype of one SNP locus in the second intron of the KLF7 gene of chromosome 2 short arm 32 showed a strong association with type II diabetes (A vs. A). C: χ ² = 16.3, P = 0.000053, odds ratio = 1.51, 95% CI 1.23-1.85).

  In addition, as shown in FIG. 1, linkage disequilibrium mapping of the region around the landmark SNP in the KLF7 gene shows that linkage disequilibrium in this region spreads about 20 kb upstream and 60 kb downstream of the landmark site. Indicated.

  Thus, a region important for susceptibility to type II diabetes is probably present within this 80 kb high linkage disequilibrium block. Further, since there is no gene other than KLF7 in this linkage disequilibrium block, KLF7 itself is considered to be a candidate for susceptibility to diabetes.

Example 2
In order to investigate the influence of the expression of the KLF7 gene, the KLF7 gene was introduced into various cells, and the behavior of each cell was confirmed.

1. Cloning of human KLF7 cDNA
Human KLF7 cDNA was cloned by PCR using Human Adipocyte Marathon-Ready cDNA (CLONTECH) as a template and using a human KLF7 gene-specific primer. The human KLF7 gene-specific primer uses sense strand 5'-TGAGCCAGACAGACTGACAA-3 '(SEQ ID NO: 3) and antisense strand 5'-CCTTTAGACACTAGCCGATG-3' (SEQ ID NO: 4). PCR is KOD-PLUS (TOYOBO) The product was subjected to 30 cycles of 95 ° C for 2 minutes, 94 ° C for 15 seconds, 55 ° C for 30 seconds, and 68 ° C for 2 minutes. Thereafter, a small amount of Ex Taq (manufactured by Takara Bio Inc.) was added and reacted at 72 ° C. for 2 minutes. The obtained PCR product was electrophoresed on a 0.8% agarose gel, the target DNA fragment was purified using MinElute Gel Extraction Kit (QIAGEN), and then pCR2.1 vector using TA Cloning Kit (Invitrogen). Built in. The nucleotide sequence of the human KLF7 region of the obtained plasmid pCR2.1-KLF7 is represented by M13- Forward primer: 5'-GTAAAACGACGGCCAGTG-3 '(SEQ ID NO: 5) and M13-Reverse primer: 5'-CAGGAAACAGCTATGACC-3' (sequence) It confirmed by performing the sequence using number: 6). Sequencing reaction was performed using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), and electrophoresis and analysis were performed using Applied Biosystems 3700 DNA Analyzer. The base sequence of the obtained human KLF7 cDNA is shown in SEQ ID NO: 1.

2. Production of adenovirus A human KLF7 adenovirus for introducing the KLF7 gene into each cell was produced using the Adenovirus Expression Vector Kit (TaKaRa). To the cosmid vector pAxCAwt: The human KLF7 cDNA cloned in (1) was incorporated, and human KLF7 adenovirus was prepared according to the protocol.

3. Cell culture
HPA was purchased from Zen-Bio, Inc., HIT-T15 from Dainippon Pharmaceutical, and 3T3-L1 and L6 from the American Type Culture Collection. HPA in DMEM: HAM F-10 = 1: 1 (10% FBS, 50 U / ml penicillin G, 50 μg / ml streptomycin), HIT-T15 in RPMI1640 (10% FBS, 50 U / ml penicillin G, 50 μg / ml streptomycin) 3T3-L1 and L6 were cultured in DMEM (10% FBS, 50 U / ml penicillin G, 50 μg / ml streptomycin) at 37 ° C. in a 5% CO ₂ environment.

4). Confirmation of mRNA expression level in HPA HPA on the 13th day after differentiation induction was infected overnight with LacZ or KLF7 adenovirus, and 5 days later, total RNA was prepared from each cell using RNeasy Mini Kit (QIAGEN). The resulting total RNA was synthesized using the SuperScript First-strand Synthesis System for RT-PCR (manufactured by Invitrogen). Using this as a template, KLF7-specific primer, leptin-specific primer, adiponectin-specific primer and IL- By performing quantitative PCR using 6-specific primers (SEQ ID NO: 30 and 31, SEQ ID NO: 15 and 16, SEQ ID NO: 11 and 12, and SEQ ID NO: 13 and 14, respectively) I examined it. Β-actin was used to correct the quantitative results. PCR for KLF7 is 1 cycle for 2 minutes at 95 ° C, 30 seconds for 95 ° C, 30 seconds for 68 ° C, 40 cycles for 30 seconds for 72 ° C, PCR for leptin, adiponectin, IL-6 and β-actin is Reaction and analysis were performed using Mx3000P Multiplex Quantitative PCR System (STRATAGENE) at 95 ° C for 2 minutes for 1 cycle, 95 ° C for 30 seconds, 60 ° C for 30 seconds, and 72 ° C for 30 seconds for 40 cycles. . The result is shown in FIG. For β-actin, a primer pair consisting of a primer having the base sequence shown in SEQ ID NO: 24 and a primer having the base sequence shown in SEQ ID NO: 25 was used.

As a result, KLF7 was upregulated approximately 196 times by viral infection. Along with this overexpression of KLF7, adiponectin and leptin were suppressed by 54% and 78%, respectively. 6 was confirmed to have a 17-fold increase in expression.

5). Confirmation of insulin mRNA expression level in HIT-T15
A 6-well plate (CORNING) was incubated with 5 × 10 ⁵ / well of HIT-T15 for 2 days, and then infected with KLF7 adenovirus at 0, 1, 3, 10 and 30 MOI for 1 hour. Two days after infection, the cells were washed with PBS, and then total RNA was purified using RNeasy Mini Kit (manufactured by QIAGEN). CDNA was synthesized from this totalRNA using SuperScript First-strand Synthesis System for RT-PCR (manufactured by Invitrogen). KLF7-specific primer (SEQ ID NO: 30 and 31) and insulin-specific primer using the obtained cDNA as a template Quantitative PCR was performed using (SEQ ID NOs: 7 and 8) to measure the expression level of each gene mRNA. MGAPDH was used to correct the quantitative results. PCR is 95 ° C for 2 minutes for 1 cycle, 95 ° C for 30 seconds, 68 ° C for 30 seconds, 72 ° C for 30 seconds for 40 cycles, PCR for mGAPDH is 95 ° C for 2 minutes for 1 cycle, 95 ° C Reactions and analyzes were performed using Mx3000P Multiplex Quantitative PCR System (manufactured by STRATAGENE) in 40 cycles of 30 seconds at 60 ° C for 30 seconds and 72 ° C for 30 seconds. The result is shown in FIG. For mGAPDH, a primer pair consisting of a primer having the base sequence shown in SEQ ID NO: 26 and a primer having the base sequence shown in SEQ ID NO: 27 was used.

Effect on mRNA expression in HIT-T15 As a result, a marked increase in the expression of KLF7 was observed as the number of MOI infections increased (A in FIG. 3). In addition, a decrease in the amount of insulin expression was confirmed as the KLF7 expression was increased, and an approximately 74% decrease in the amount of insulin expression was observed during 30 MOI KLF7 adenovirus infection (FIG. 3B).

6). Confirmation of insulin secretion in HIT-T15
A 24-well plate (CORNING) was plated with HIT-T15 at 1 × 10 ⁵ / well for 2 days, and then infected with 10 MOI of LacZ adenovirus or KLF7 adenovirus for 1 hour. Two days after infection, the cells were washed 3 times with Hepes-Krebs buffer (119 mM NaCl, 4.75 mM KCl, 5 mM NaHCO ₃ , 2.54 mM CaCl ₂ , 1.2 mM MgSO ₄ , 20 mM Hepes pH 7.4) /0.2% BSA, and then 1 ml Hepes- Krebs buffer / 0.2% BSA was added and cultured in a CO ₂ incubator at 37 ° C. for 2 hours. Thereafter, 500 μl of Hepes-Krebs buffer / 0.2% BSA having a glucose concentration of 0 mM, 2.7 mM, 10 mM, or 16.7 mM was added and cultured at 37 ° C. for 1 hour in a CO ₂ incubator, and the culture solution was collected. The amount of insulin secreted into the obtained culture broth was measured using an insulin measurement kit (manufactured by Morinaga Biochemical Research Institute). Moreover, after lysing the cells in each well with RIPA buffer, the protein amount was measured using Bio-Rad Dc Protein Assay Kit (manufactured by Bio-Rad), and the amount of protein was corrected. The result is shown in FIG.

Effect of HIT-T15 on insulin secretion As a result, HIT-T15 and HIT-T15 / LacZ showed an increase in insulin secretion with an increase in glucose concentration. However, HIT-T15 / KLF7 markedly suppressed insulin secretion due to glucose stimulation.

7). Confirmation of expression level of hexokinase mRNA in L6
A 6-well plate (CORNING) was cultured with L6 at 5 × 10 ⁵ / well for 2 days and then infected with KLF7 adenovirus at 0, 1, 3, 10, 30 and 100 MOI overnight. Two days after infection, the cells were washed with PBS, total RNA was prepared using RNeasy Mini Kit (manufactured by QIAGEN), and SuperScript First-strand Synthesis System for RT-PCR (manufactured by Invitrogen) was prepared from the obtained total RNA. cDNA was synthesized. Using this cDNA as a template, the expression level of each gene mRNA was examined by quantitative PCR using a KLF7-specific primer (SEQ ID NOs: 30 and 31) and a hexokinase-specific primer (SEQ ID NOs: 9 and 10). RGAPDH was used to correct the quantitative results. PCR is 95 ° C for 2 minutes for 1 cycle, 95 ° C for 30 seconds, 68 ° C for 30 seconds, 72 ° C for 30 seconds for 40 cycles, and reactions and analysis are performed using the Mx3000P Multiplex Quantitative PCR System (STRATAGENE). I did it. The result is shown in FIG. For rGAPDH, a primer pair consisting of a primer having the base sequence shown in SEQ ID NO: 28 and a primer having the base sequence shown in SEQ ID NO: 29 was used.

Effect of L6 on hexokinase mRNA expression As a result, an increase in the expression of KLF7 was observed as the number of MOIs increased (A in FIG. 5). A decrease in the expression level of hexokinase was confirmed as the expression of KLF7 increased, and a decrease in the expression level of hexokinase of about 47% was observed when KLF7 adenovirus was infected with 100 MOI (FIG. 5B).

8). Effect on adipocyte differentiation The following oil red O assay was used to confirm differentiation into adipocytes.
A collagen-coated 6-well plate (manufactured by IWAKI) was cultured with 3T3-L1 or HPA until the cells became confluent at 1 × 10 ⁵ / well, and then infected with 100 MOI of LacZ adenovirus or KLF7 adenovirus overnight. 2 days after infection, 3T3-L1 is in DMEM (10% FBS, 50 U / ml penicillin G, 50 μg / ml streptomycin, 0.5 mM 3-isobutyl-1-methylxanthine, 1 μM dexamethasone, 1 μM insulin), HPA is DMEM: HAM F -10 = 1: 1 (10% FBS, 50 U / ml penicillin G, 50 μg / ml streptomycin, 0.2 mM indomethacin, 2 μM insulin, 1 μM dexamethasone, 0.5 mM 3-isobutyl-1-methylxanthine) After that, cells that had passed each day were washed three times with PBS, and then fixed with 1 ml of 10% formalin-containing PBS. After leaving at 4 ° C. for 1 hour or longer, PBS containing 10% formalin was removed and air-dried. 1 ml of oil red O solution (0.5% oil red O isopropanol solution: distilled water = 6: 4) was added and allowed to stand at room temperature for 15 minutes, followed by washing with distilled water three times. After photography, oil red O was eluted by adding 100 μl of isopropanol to each well, and absorbance measurement (OD540) was performed to determine the amount of accumulated fat.

  Accumulation of lipid droplets was observed with HPA and HPA / LacZ on day 13 (a and b in FIG. 6A, respectively), but almost no accumulation of lipid droplets was observed with HPA / KLF7 (c in FIG. 6A). In addition, d of FIG. 6A shows the whole image at the time of dyeing | staining.

  In addition, when oil red O was extracted using isopropanol and the absorbance was measured to quantify the amount of lipid droplets, a marked decrease in the amount of accumulated lipid droplets was observed due to overexpression of KLF7 (FIG. 6B). This suggests that overexpression of KLF7 suppresses HPA differentiation into adipocytes.

  In 3T3-L1, as shown in FIG. 7A, untreated (not infected with virus) 3T3-L1 (3T3-L1 /-) and LacZ adenovirus-infected 3T3-L1 (3T3-L1 / LacZ) The accumulation of lipid droplets began to be observed on the third day after differentiation induction, and the increase in the amount of accumulated lipid droplets was confirmed with the passage of days in most cells (a and b in FIG. 7A, respectively). On the other hand, in KLF7 adenovirus-infected 3T3-L1 (3T3-L1 / KLF7), accumulation of lipid droplets was hardly observed even 10 days after differentiation induction (c in FIG. 7A). In addition, d of FIG. 7A shows the whole image at the time of dyeing | staining.

  In addition, oil red O was extracted with isopropanol and the absorbance was measured to quantify the amount of lipid droplets in each elapsed day. A marked decrease in the amount of accumulated lipid droplets was observed due to overexpression of KLF7 (Fig. 7B). This suggests that overexpression of KLF7 suppresses differentiation of 3T3-L1 into adipocytes.

Example 3
Using the Adenovirus Expression Vector Kit (TaKaRa), human KLF7 cDNA is incorporated into the cosmid vector pAxCAwt, and human KLF7 adenovirus is prepared according to the protocol. By infecting 3T3-L1 cells with this KLF7 adenovirus, the obtained transformed cells are cultured in DMEM medium containing the compounds of the compound library at 5% CO ₂ and 37 ° C. for 4 to 24 hours. As a control, the same culture is performed in a DMEM medium not containing the compound in the compound library. Total RNA is extracted from the cultured cells. Subsequently, quantitative RT-PCR was performed using primers for KLF7, insulin, hexokinase, leptin, adiponectin, IL-6, β-actin, rGAPDH and mGAPDH in the same manner as in Example 2 using total RNA as a template. I do. The numerical values are normalized by the results of β-actin, rGAPDH and mGAPDH, and the expression levels of KLF7, insulin, hexokinase, leptin, adiponectin and IL-6 in the presence and absence of the compound are evaluated.

  Compare the expression levels of KLF7 gene, insulin gene, hexokinase gene, leptin gene, adiponectin gene and IL-6 gene in transformed cells of HIT-T15 cells, L6 cells or HPA cells with those in non-transformed cells The presence of the compound inhibits the increase in the expression level of the KLF7 gene and IL-6 gene in the transformed cells, and the suppression of the suppression of the expression level of the insulin gene, leptin gene, adiponectin gene and hexokinase gene as an indicator Screening candidate substances for the treatment or prevention of diabetes.

Example 4
A nucleic acid-containing sample is prepared from the peripheral blood of the subject individual by a conventional nucleic acid extraction method. The SNP detection microarray prepared based on the nucleic acid in the region of the second intron of the KLF7 gene is hybridized with the nucleic acid-containing sample, and one of the DNA strands of the resulting DNA hybrid is subjected to four types of fluorescently labeled dideoxy. Primer extension is performed using nucleotides and DNA polymerase. Based on the fact that SNP is detected using the fluorescence incorporated into the existing base as an indicator, the nucleic acid-containing sample is shown to contain a nucleic acid that contributes to the development of diabetes, and the test individual develops diabetes. Or is determined to have the possibility of developing in the future.

  The screening method of the present invention is useful for developing a means for treating or preventing diabetes. Moreover, the diagnostic method of the present invention is useful for making a therapeutic plan or preventive treatment for diabetes. Furthermore, the detection kit of the present invention can be used for diagnosis of diabetes and the like.

FIG. 1 shows linkage disequilibrium mapping around the KLF7 gene. FIG. 2 is a diagram showing the influence on leptin, adiponectin and IL-6 expression when the KLF7 gene is overexpressed in HPA. FIG. 3 is a diagram showing the effect on insulin gene expression when the KLF7 gene is overexpressed in HIT-T15. FIG. 4 is a diagram showing the influence on the amount of insulin secretion when the KLF7 gene is overexpressed in HIT-T15. FIG. 5 is a diagram showing the influence on hexokinase gene expression when the KLF7 gene is overexpressed in L6. FIG. 6A is a micrograph (× 100) after oil red O assay of HPA on day 13 of differentiation induction. FIG. 6B is a diagram quantifying the HPA oil red O assay on day 13 of differentiation induction. FIG. 7A is a photomicrograph (× 100) after 3T3-L1 oil red O assay. FIG. 7B is a diagram quantifying the oil red O assay of 3T3-L1.

SEQ ID NO: 3 shows the sequence of a sense primer for cloning of human KLF7 cDNA.
SEQ ID NO: 4 shows the sequence of an antisense primer for cloning of human KLF7 cDNA.
SEQ ID NO: 5 shows the sequence of the M13-Forward primer.
SEQ ID NO: 6 shows the sequence of the M13-Reverse primer.
SEQ ID NO: 7 shows the sequence of the sense primer for the insulin gene.
SEQ ID NO: 8 shows the sequence of the antisense primer for the insulin gene.
SEQ ID NO: 9 shows the sequence of the sense primer for the hexokinase gene.
SEQ ID NO: 10 shows the sequence of the antisense primer for the hexokinase gene.
SEQ ID NO: 11 shows the sequence of the sense primer for the adiponectin gene.
SEQ ID NO: 12 shows the sequence of the antisense primer for the adiponectin gene.
SEQ ID NO: 13 shows the sequence of the sense primer for IL-6 gene.
SEQ ID NO: 14 shows the sequence of an antisense primer for IL-6 gene.
SEQ ID NO: 15 shows the sequence of the sense primer for the leptin gene.
SEQ ID NO: 16 shows the sequence of the antisense primer for the leptin gene.
SEQ ID NO: 19 shows the sequence of a primer for detecting a polynucleotide containing the portion of KLF7 second intron + 35092.
SEQ ID NO: 20 shows the sequence of a primer for detecting a polynucleotide containing the portion of KLF7 second intron + 35092.
SEQ ID NO: 21 shows the sequence of a probe for detecting that the base of KLF7 second intron +35092 is C.
SEQ ID NO: 22 shows the sequence of a probe for detecting that the base of KLF7 second intron +35092 is A.
SEQ ID NO: 23 shows the sequence of an invader probe for detecting whether the base of KLF7 second intron + 35092 is C or A. n is an arbitrary base.
SEQ ID NO: 24 shows the sequence of the sense primer for the β-actin gene.
SEQ ID NO: 25 shows the sequence of the antisense primer for the β-actin gene.
SEQ ID NO: 26 shows the sequence of the sense primer for the mGAPDH gene.
SEQ ID NO: 27 shows the sequence of the antisense primer for the mGAPDH gene.
SEQ ID NO: 28 shows the sequence of the sense primer for the rGAPDH gene.
SEQ ID NO: 29 shows the sequence of the antisense primer for the rGAPDH gene.
SEQ ID NO: 30 shows the sequence of the sense primer for the KLF7 gene.
SEQ ID NO: 31 shows the sequence of the antisense primer for the KLF7 gene.

Claims (7)

  A screening method for a therapeutic or prophylactic agent for diabetes, comprising evaluating the expression level of KLF7 in the presence of a test substance. (I) a step of measuring the expression level of KLF7 in a cell into which a nucleic acid encoding KLF7 has been introduced in the presence of the test substance; and (II) a comparison with the expression level of KLF7 measured in the absence of the test substance. , Thereby selecting a test substance that causes suppression of expression as a candidate substance for the treatment or prevention of diabetes,
The method of claim 1 comprising:   The method according to claim 1 or 2, wherein the diabetes is type II diabetes. (1) nucleic acid encoding KLF7, and (2) KLF7 nucleic acid encoding is introduced to, cells expressing KLF7
At least one comprising a kit for use in the screening method according to any one of claims 1 to 3 is selected from or Ranaru group. A method for detecting a nucleic acid that contributes to the onset of type II diabetes, comprising detecting the substitution of the 35092nd base from C to A in the base sequence of the second intron of the KLF7 gene. Possibility of suffering from type II diabetes, characterized by detecting substitution of the 35092nd base from C to A in the base sequence present in the second intron of the KLF7 gene in a test sample derived from a test individual Method for selecting test subjects with a high level. A diagnostic kit for the possibility of suffering from type II diabetes, comprising a probe or primer for detecting a C to A substitution at the 35092th base present in the second intron of the KLF7 gene.