WO2009087686A2 - Procédés de détection fondés sur des acides nucléiques - Google Patents

Procédés de détection fondés sur des acides nucléiques Download PDF

Info

Publication number
WO2009087686A2
WO2009087686A2 PCT/IN2009/000014 IN2009000014W WO2009087686A2 WO 2009087686 A2 WO2009087686 A2 WO 2009087686A2 IN 2009000014 W IN2009000014 W IN 2009000014W WO 2009087686 A2 WO2009087686 A2 WO 2009087686A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleic acid
oligonucleotides
oligonucleotide
detection
Prior art date
Application number
PCT/IN2009/000014
Other languages
English (en)
Other versions
WO2009087686A3 (fr
Inventor
Rajeev Soni
Nupur Mehrotra
Prabuddha Kumar Kundu
Kajal Arora
Original Assignee
Premas Biotech Pvt.Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Premas Biotech Pvt.Ltd filed Critical Premas Biotech Pvt.Ltd
Publication of WO2009087686A2 publication Critical patent/WO2009087686A2/fr
Publication of WO2009087686A3 publication Critical patent/WO2009087686A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6862—Ligase chain reaction [LCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates to nucleic acid based detection method for detecting disease and non-disease related conditions inclusive of but not limited to infections, drug resistance, mutations, genetic diseases, cancer and/or SNP variations in a sample.
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • RT-PCR reverse transcription polymerase chain reaction
  • 3SR/NASBA Self- Sustained Synthetic Reaction
  • Q.beta.-Replicase Q.beta.
  • NAATs nucleic acid amplification tests
  • PPV positive predictive value
  • NPV negative predictive value
  • the present invention relates to a nucleic acid based detection method for the diagnosis of disease and non disease related conditions inclusive of but not limited to microorganisms, pathogens, mutations, cancer and/or single nucleotide polymorphism (SNP) variations in a sample.
  • SNP single nucleotide polymorphism
  • One aspect of the present invention relates to a process for detecting a target nucleic acid in a sample using dual isothermal nucleic acid amplification reactions, the process comprises (a) providing a reaction mixture comprising a sample containing or suspected of containing a target nucleic acid; a set of oligonucleotides containing at least four oligonucleotides, wherein a first oligonucleotide of the set is complementary to a third oligonucleotide and a second oligonucleotide of the set is complementary to a fourth oligonucleotide; and a thermostable ligase; (b) subjecting the reaction mixture under isothermal conditions to obtain a first resultant reaction mixture thereby amplifying the target nucleic acid, wherein the isothermal conditions comprises one cycle of denaturation at a temperature ranging from about 90 0 C to 99 ⁇ C for 30 seconds to 10 minutes; and annealing and amplification at a temperature
  • Another aspect of the present invention relates to a process for detecting a target nucleic acid in a sample using dual isothermal nucleic acid amplification reaction, the process comprises (a) providing a reaction mixture comprising a sample containing or suspected of containing a target nucleic acid; a set of oligonucleotides containing at least four oligonucleotides, wherein a first oligonucleotide of the set is complementary to a third oligonucleotide and a second oligonucleotide of the set is complementary to a fourth oligonucleotide; and thermostable ligase; (b) subjecting the reaction mixture under isothermal conditions to obtain a first resultant reaction mixture, wherein the isothermal conditions are one cycle of denaturation at 95 0 C for 10 minutes; and annealing and amplification at 65 0 C for 3 minutes; and 14 cycles of denaturation at 95°C for 1 minute and annealing and amplification at
  • Yet another aspect of the present invention relates to a set of oligonucleotides for detection of sequence specific regions that are implicated in susceptibility to prostate cancer in a sample, wherein the nucleotide sequence of the set of oligonucleotides is selected from the group consisting of the nucleotide sequence as set forth in SEQ ID NO: 92-95 and SEQ ID NO: 97-100.
  • kits for detection of sequence specific regions that are implicated in susceptibility to prostate cancer comprising the set of oligonucleotides selected from the group consisting of the nucleotide sequence as set forth in SEQ ID NO: 92-95 and SEQ ID NO: 97-100.
  • the present invention may be applicable, but not limited to the detection of diseases, mutations and/or SNP variations and can detect genomic DNA from a variety of samples obtained from any source.
  • the present invention provides a process that leads to an improved amplification signal and yields consistent and reproducible results. Furthermore, the present invention helps in improving sensitivity, specificity, reproducibility of data and is capable of detecting very low titres of the target, as compared to currently used nucleic acid amplification processes.
  • Figure 1 shows gel photograph for dual isothermal nucleic acid amplification reaction (DINAR) using the oligonucleotide set 1 for detection of M. tuberculosis.
  • DINAR isothermal nucleic acid amplification reaction
  • Figure 2 shows gel photograph for dual isothermal nucleic acid amplification reaction (DINAR) using the oligonucleotide set 17 for detection of M. tuberculosis.
  • DINAR isothermal nucleic acid amplification reaction
  • Figure 3 shows gel photograph for dual isothermal nucleic acid amplification reaction (DINAR) for detection of prostate cancer.
  • DINAR dual isothermal nucleic acid amplification reaction
  • the present invention relates to a nucleic acid based detection method for the identification of disease and non disease related conditions inclusive of but not limited to microorganisms, pathogens, mutations, cancer and/or single nucleotide polymorphism (SNP) variations in a sample.
  • disease and non disease related conditions inclusive of but not limited to microorganisms, pathogens, mutations, cancer and/or single nucleotide polymorphism (SNP) variations in a sample.
  • SNP single nucleotide polymorphism
  • the nucleic acid based detection method for the identification of infectious diseases, genetically transmitted diseases, cancer and/or SNP variations in samples is herein after also referred as Dual Isothermal Nucleic Acid Amplification Reaction (DINAR) in which two similar but separate reactions are performed wherein the product obtained from the first reaction is used as a template for the second reaction.
  • the product from the first reaction may or may not have undergone suitable processing by passing through a purification column.
  • DINAR has an advantage over standard ligase chain reaction as the latter has been known to give non-reproducible results coupled with poor amplification signals.
  • Another embodiment of the present invention provides method of detection of target nucleic acid, said method comprising providing sample for detection; providing oligonucleotide sequences specific for the target nucleic acid; performing the first isothermal nucleic acid amplification reaction under suitable conditions for appropriate number of cycles; performing the second isothermal nucleic acid amplification reaction using the product of the first reaction as such or after suitable processing and using said oligonucleotides under suitable conditions for appropriate number of cycles and detecting the presence of amplified nucleic acid.
  • the reaction product may be analyzed using various modes, but not limited to one of the following namely, agarose gel electrophoresis, solution phase colorimetric detection using enzymes and photoactivity assays, solid phase colorimetric detection using enzymes and photoactivity assays, solution phase fluorimetric detection, solid phase fluorimetric detection, solution phase chemiluminiscent detection, solid phase chemiluminiscent detection, solution phase using nanoparticles, solid phase using nanoparticles, solution phase using radioactive detection, solid phase using radioactive detection.
  • the method described in the present invention for nucleic acid detection by amplification of the target nucleic acid in the sample (if present), leads to the enhancement of amplification signal by overcoming inhibition due to genomic DNA, other reaction constituents or reaction conditions.
  • the method is also highly sensitive in eliminating the problem of non specific amplification that leads to false-positives.
  • Another embodiment of the present invention provides a nucleic acid based detection method (DINAR) that is highly sensitive, specific, easy to use, capable of detecting very low titers, as exemplified by detection of upto 1.6 genomic equivalents of M. tuberculosis genomic DNA that corresponds to 8fg and significantly lower than attomole quantities of the nucleic acid present and yields consistent and reproducible results.
  • DINAR nucleic acid based detection method
  • the genomic DNA used can be extracted from the sample by using methods well known in the art.
  • Yet another embodiment of the present invention provides DINAR for the detection of target nucleic acid of disease or non-disease related conditions inclusive but not limited to infectious diseases, genetically transmitted diseases, cancer and/or SNP variations in samples of human, veterinary and/or plant origin, wherein the sample may be selected from a group consisting of blood, sputum, tissues, saliva, cerebro-spinal fluid, pleural fluid, lymph, synovial fluid, semen and other body fluids, milk and other body secretions, urine and other body excretions, bronchoalveolar lavage and other washings from a subject and plant extracts.
  • the sample may be selected from a group consisting of blood, sputum, tissues, saliva, cerebro-spinal fluid, pleural fluid, lymph, synovial fluid, semen and other body fluids, milk and other body secretions, urine and other body excretions, bronchoalveolar lavage and other washings from a subject and plant extracts.
  • Another embodiment of the present invention provides a method for detection of a target nucleic acid of bacteria, wherein said bacteria includes Mycobacterium species that include M. tuberculosis anal ox M. bovis.
  • Another embodiment of the present invention provides a method for detection of a target nucleic acid of bacteria, wherein said bacteria is Mycobacterium tuberculosis.
  • Another embodiment of the present invention provides a method for detection of a target nucleic acid of bacteria, wherein said bacteria is Mycobacterium bovis.
  • Another embodiment of the present invention provides a method for detection of a target nucleic acid of bacteria, wherein said bacteria is Mycobacterium avium.
  • Another embodiment of the present invention provides a method for detection of a target nucleic acid of bacteria, wherein said bacteria is M. avium subsp. paratuberculosis KlO.
  • Another embodiment of the present invention provides a method for detection of a target nucleic acid of bacteria, wherein said bacteria is M. avium 104.
  • Yet another embodiment of the present invention provides a method for detection of a target nucleic acid of viruses, wherein said virus includes Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis D virus and/or Hepatitis E virus.
  • Yet another embodiment of the present invention provides a method for detection of a target nucleic acid of viruses, wherein said virus includes Hepatitis B and Hepatitis C virus.
  • Yet another embodiment of the present invention provides a method for detection of a target nucleic acid of viruses, wherein said virus is Hepatitis B virus.
  • Yet another embodiment of the present invention provides a method for detection of a target nucleic acid of viruses, wherein said virus is Hepatitis C virus.
  • Yet another embodiment of the present invention provides a method for detection of sequence specific regions that are implicated in susceptibility to prostate cancer. . .
  • Yet another embodiment of the present invention provides a method for detection of a target nucleic acid of mammals, wherein said mammals can be humans and/or animals.
  • Yet another embodiment of the present invention provides a method for detection of a target nucleic acid of plant species.
  • Another embodiment of the present invention provides a method of detection of nucleic acid in a sample, wherein the method is useful for detecting mutations in a sample, wherein the mutation may be mutation resulting in drug resistance.
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 1 as set forth in SEQ ID NO: 2-5 is designed from nucleotide position 62716-62765 (SEQ ID NO: 1) of the DNA sequence of Mycobacterium tuberculosis CDC1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 2 as set forth in SEQ ID NO: 7-10 is designed from nucleotide position 85252-85301 (SEQ ID NO: 6) of the DNA sequence of Mycobacterium tuberculosis CDCl 551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis. This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 3 as set forth in SEQ ID NO: 12-15 is designed from nucleotide position 82712-82761 (SEQ ID NO: 11) of the DNA sequence of Mycobacterium tuberculosis CDC1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 4 as set forth in SEQ ID NO: 17-20 is designed from nucleotide position 2041-2088 (SEQ ID NO: 16) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
  • GAA AGG GCG CAA TGG ACG CGG CTA CGA CAA GAG TTG GCC TCA CCG
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 5 as set forth in SEQ ID NO: 22-25 is designed from nucleotide position 79850 to 79897 (SEQ ID NO: 21) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis. Region 5:
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 6 as set forth in SEQ ID NO: 27-30 is designed from nucleotide position 4206202-4206249 (SEQ ID NO: 26) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 7 as set forth in SEQ ID NO: 32-35 is designed from nucleotide position 4203720-4203769 (SEQ ID NO: 31) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 8 as set forth in SEQ ID NO: 37-40 is designed from nucleotide position 3002631-3002680 (SEQ ID NO: 36) of the DNA sequence of Mycobacterium tuberculosis CDC1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 9 as set forth in SEQ ID NO: 42-45 is designed from nucleotide position 50070 to 50119 (SEQ ID NO: 41) of the DNA sequence of Mycobacterium tuberculosis CDC1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis, Mycobacterium bovis and Mycobacterium avium paratuberculosis KlO and Mycobacterium avium 104.
  • 9A GAT GCC GCG GTC CTT GGC GAT CTT G SEQ ID NO: 42
  • 9B GCC GCC CGC ACC GCG TCG ATG ATG A SEQ ID NO: 43
  • 9C CAA GAT CGC CAA GGA CCG CGG CAT C
  • 9D TCA TCA TCG ACG CGG TGC GGG CGG C SEQ ID NO: 45
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 10 as set forth in SEQ ID NO: 47-50 is designed from nucleotide position 20679 to 20720 (SEQ ID NO: 46) of the DNA sequence of Mycobacterium aviumlO4 (Accession number CP000479). This region is specific to detect Mycobacterium avium 104 and Mycobacterium avium paratuberculosis KlO.
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 11 as set forth in SEQ ID NO: 52-55 is designed from nucleotide position 2152482 to 2152432 nucleotide (SEQ ID NO: 51) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect drug resistance against Isoniazid due to mutation in Kat G gene of Mycobacterium tuberculosis, Mycobacterium bovis. In case of absence of drug resistance the wild type KAT G gene has Serine (S) at position 315.
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 12 as set forth in SEQ ID NO: 62-65 is designed from nucleotide position designed from 242 to 284 nucleotide (SEQ ID NO: 61) of the DNA sequence of hepatitis B virus (Accession number NC_003977). This region is specific to detect Hepatitis B Virus.
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 13 as set forth in SEQ ID NO: 67-70 is designed from nucleotide position from 672 to 717 nucleotide (SEQ ID NO: 66) of the DNA sequence of hepatitis B virus (Accession number NC 003977). This region is specific to detect Hepatitis B Virus
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 14 as set forth in SEQ ID NO: 72-75 is designed from nucleotide position 48-106 nucleotide (SEQ ID NO: 71) of the DNA sequence of hepatitis C virus (Accession number NC_004102). This region is specific to detect Hepatitis C Virus. Region 14:
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 15 as set forth in SEQ ID NO: 77-82 is designed from nucleotide position 127-176 nucleotide (SEQ ID NO: 76) of the DNA sequence of hepatitis C virus (Accession number NC_004102). This region is specific to detect Hepatitis C Virus.
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 16 as set forth in SEQ ID NO: 82-85 is designed from nucleotide position 204-261 nucleotide (SEQ ID NO: 81) of the DNA sequence of hepatitis C virus (Accession number NC_004102). This region is specific to detect Hepatitis C Virus.
  • AAA CCC GCT CAA TGC CTG GAG ATT TGG GCG TGC CCC CGC AAG ACT
  • Another embodiment of the present invention provides a diagnostic kit for detecting presence of nucleic acid in samples associated with infectious diseases caused by microorganisms, genetically transmitted diseases, cancer and/or SNP variations.
  • the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 17 as set forth in SEQ ID NO: 87-90 is designed from nucleotide position 484256 to 484207 (SEQ ID NO: 86) of the DNA sequence of Mycobacterium tuberculosis CDC1551 (Accession number AE000516).
  • a phosphate group was attached to the 5' end of the oligonucleotides as set forth in SEQ ID NO: 88 and SEQ ID NO: 89.
  • the oligonucleotide set as set forth in SEQ ID NO: 87-90 was tested with sputum, blood, ascitic fluid, bronchial washing samples, pleural fluid, urine, semen, tissue samples, milk, serum and pure culture of Mycobacterium species.
  • the present invention provides oligonucleotides useful for detection of sequence specific regions that are implicated in susceptibility to prostate cancer (oligonucleotide set 18 and set 19) having nucleotide sequence as set forth in SEQ ID NO: 92-95 and SEQ ID NO: 97-100.
  • the oligonucleotide set 18 as set forth in SEQ ID NO: 92-95 is designed to include the INDELl region in the MSRl gene that corresponds to nucleotide position -14458bp (SEQ ID NO: 91) of the DNA sequence of Homo sapiens chromosome 8 (Accession number NT_030737). This region is specific to detect presence of marker INDELl which is an MSRl sequence variant and maybe implicated in association with prostate cancer risk.
  • Region 18 AAA AAC CAA ACC AAA TTA TTG CTG ATA CAA TAA AGC ATT CAT CTC ATC AT SEQ ID:91
  • INDEL1-18A AAA AAC CAA ACC AAA TTA TTG CTG A SEQ ID:92 INDELlM-18B: TAC AAT AAA GCA TTC ATC TCA TCA T SEQ ID:93 INDEL1-18C: TCA GCA ATA ATT TGG TTT GGT TTT T SEQ ID:94 INDELlM-18D: ATG ATG AGA TGA ATG CTT TAT TGT A SEQ ID:95
  • INDELl a 15 base pair sequence INDELl is present in the gene MSRl.
  • the insertion of INDELl can be detected using the oligonucleotide set (SEQ ID NO: 92-95).
  • the oligonucleotide set 19 as set forth in SEQ ID NO: 97-100 is designed by deleting the INDELl region in the MSRl gene that corresponds to nucleotide position -14458bp (SEQ ID NO: 96) of the DNA sequence of Homo sapiens chromosome 8 (Accession number NT_030737). This region is specific to detect the absence of marker INDELl which is an MSRl sequence variant and maybe implicated in association with prostate cancer risk.
  • INDEL1-19A AAA AAC CAA ACC AAA TTA TTG CTG A SEQ ID:97
  • INDELlN-19B ATC TCA TCA TAC ACA CAC AGA CAC A SEQ ID:98 INDEL1-19C: TCA GCA ATA ATT TGG TTT GGT TTT T SEQ ID:99 INDEL1N-19D: TGT GTC TGT GTG TGT ATG ATG AGA T SEQ ID:100
  • the 15 base pair sequence INDELl is deleted in the gene MSRl.
  • This mutation by deletion can be detected using the oligonucleotide set (SEQ ID NO: 97- 100).
  • a phosphate group was attached to the 5' end of the oligonucleotides as set forth in SEQ ID NO: 98 and SEQ ID NO: 99.
  • Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for detection of an organism, wherein the organism is selected from a group comprising of bacteria, mammals, plants, viruses, fungi, protozoa and parasites.
  • Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide set or primers used interchangeably herein, wherein the oligonucleotide set comprises at least four oligonucleotides, wherein the oligonucleotides having size ranging from 15-50 bp.
  • the four oligonucleotides are designated as A, B, C, D, wherein first oligonucleotide (A) is complementary to third oligonucleotide (C) and second oligonucleotide (B) is complementary to fourth oligonucleotide (D).
  • the second and third oligonucleotide (B and C) has a phosphate group attached to the 5' end.
  • the 3' end of the second and third oligonucleotide (B and C) is optionally modified.
  • the second and third oligonucleotide (B and C) of each oligonucleotide set disclosed in the present invention are modified by adding phosphate group at the 3' end.
  • the modification may be carried out by adding phosphate, deoxy, alkyl or aryl group at the 3' end.
  • One embodiment relates to a probe that can be optionally attached to any of the four (A, B, C and D) oligonucleotides in each set wherein the probe is selected from a group consisting of radioactive, colorimetric, enzymatic, fluorescent, chemiluminiscent, and photo-active probe.
  • Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Mycobacterium species that include M. tuberculosis, M. avium and/or M. bovis.
  • Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Mycobacterium species that include M.tuberculosis and/or M. bovis.
  • Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Mycobacterium tuberculosis.
  • Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Mycobacterium bovis.
  • Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Mycobacterium avium.
  • Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of M. avium subsp. paratuberculosis KlO.
  • Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of M. avium 104.
  • Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Hepatitis virus that include Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis D virus and Hepatitis E virus.
  • Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Hepatitis B virus and/or Hepatitis C virus.
  • Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Hepatitis B virus.
  • Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Hepatitis C virus.
  • Another embodiment of the present invention relates to a kit for detection of sequence specific regions that are implicated in susceptibility to prostate cancer.
  • one embodiment provides a process for detecting a target nucleic acid in a sample using dual isothermal nucleic acid amplification reactions, the process comprises (a) providing a reaction mixture comprising a sample containing or suspected of containing a target nucleic acid; : a set of oligonucleotides containing at least four oligonucleotides, wherein a first oligonucleotide of the set is complementary to a third oligonucleotide and a second oligonucleotide of the set is complementary to a fourth oligonucleotide; and a thermostable ligase; (b) subjecting the reaction mixture under isothermal conditions to obtain a first resultant reaction mixture thereby amplifying said target nucleic acid, wherein the isothermal conditions comprises one cycle of denaturation at a temperature ranging from about 9O 0 C to 99 0 C for 30 seconds to 10 minutes; and annealing and amplification at
  • Another embodiment of the present invention provides a process for detecting a target nucleic acid in a sample using dual isothermal nucleic acid amplification reaction, the process comprises (a) providing a reaction mixture comprising a sample containing or suspected of containing a target nucleic acid; a set of oligonucleotides containing at least four oligonucleotides, wherein a first oligonucleotide of the set is complementary to a third oligonucleotide and a second oligonucleotide of the set is complementary to a fourth oligonucleotide; and thermostable ligase; (b) subjecting the reaction mixture under isothermal conditions to obtain a first resultant reaction mixture, wherein the isothermal conditions are one cycle of denaturation at 95 0 C for 10 minutes; and annealing and amplification at 65 0 C for 3 minutes; and 14 cycles of denaturation at 95 0 C for 1 minute and annealing and amplification at 65
  • step (c) optionally comprises passing the first resultant reaction mixture through a purification column to obtain flowthrough and subjecting a part or whole of the flowthrough under the isothermal conditions to obtain a second resultant reaction mixture.
  • One embodiment of the present invention provides set of oligonucleotides, wherein a phosphate group is attached to the 5' end of the second and third oligonucleotides.
  • Another embodiment of the present invention provides a set of oligonucleotides, wherein the 3' end of the second and third oligonucleotides are optionally modified.
  • Another embodiment of the present invention provides a set of oligonucleotides, wherein the 3' end of the second and third oligonucleotides are optionally modified, wherein the modification is carried out by adding a phosphate, deoxy, alkyl or aryl group at the 3' end.
  • Another embodiment of the present invention provides a set of oligonucleotides, wherein the 3' end of the second and third oligonucleotides are optionally modified, wherein the modification is carried out by adding phosphate group at the 3' end.
  • Another embodiment of the present invention provides a set of oligonucleotides, wherein at least one oligonucleotide of the set of oligonucleotides is optionally attached to a probe selected from the group consisting of radioactive, colorimetric, enzymatic, fluorescent, chemiluminiscent, and photo-active probes.
  • the process for detecting a target nucleic acid in a sample using dual isothermal nucleic acid amplification reaction as disclosed in the present invention wherein the process detects a target nucleic acid of disease or non-disease related conditions selected from the group consisting of infectious diseases, genetically transmitted diseases, cancer, SNP variations, mutations and drug resistance, and combinations thereof.
  • One embodiment of the present invention provides the sample of human, veterinary, plant or microorganism origin.
  • Another embodiment of the present invention provides the sample selected from the group consisting of blood, sputum, tissue, saliva, cerebro-spinal fluid, pleural fluid, lymph, synovial fluid, semen, other body fluids, milk and other body secretions, urine, other body excretions, broncho-alveolar lavage and other washings from a subject.
  • Another embodiment of the present invention provides the sample of plant origin.
  • One embodiment of the present invention relates to micro-organism selected from the group consisting of bacteria, viruses, fungi, arachea, protozoans, and combinations thereof.
  • micro-organisms wherein the said micro-organism is selected from the group consisting of M. tuberculosis, M. bovis, M. avium, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis D virus and Hepatitis E virus.
  • a set of oligonucleotides for detection of Mycobacterium nucleic acid in a sample wherein the nucleotide sequence of said set of oligonucleotides is selected from the group consisting of the nucleotide sequence as set forth in SEQ ID NO: 2-5, SEQ ID NO:7-10, SEQ ID NO:12- 15, SEQ ID NO:17-20, SEQ ID NO:22-25, SEQ ID NO:27-30, SEQ ID NO:32-35, SEQ ID NO:37-40, SEQ ID NO:42-45, SEQ ID NO:47-50 and SEQ ID NO: 87-90, wherein Mycobacterium is selected from the group consisting of Mycobacterium tuberculosis, M. avium and M. bovis.
  • a set of oligonucleotides for detection of nucleic acid of Mycobacterium in a sample wherein said set of oligonucleotides is selected from the group consisting of nucleotide sequence as set forth in SEQ ID NO: 42-45 and SEQ ID NO: 47-50, wherein Mycobacterium is selected from the group consisting of Mycobacterium avium paratuberculosis KlO and Mycobacterium avium 104.
  • a set of oligonucleotides for detection of nucleic acid of Mycobacterium tuberculosis nucleic acid in a sample wherein said set of oligonucleotides is selected from the group consisting of nucleotide sequence as set forth in SEQ ID NO: 2-5, SEQ ID NO:7-10, SEQ ID NO:12-15, SEQ ID NO:17-20, SEQ ID NO:22-25, SEQ ID NO:27-30, SEQ ID NO:32-35, SEQ ID NO:37-40, SEQ ID NO: 42-45 and SEQ ID NO: 87-90.
  • a set of oligonucleotides for detection of nucleic acid of Mycobacterium bovis in a sample wherein said set of oligonucleotides is selected from the group consisting of the nucleotide sequence as set forth in SEQ ID NO: 2-5, SEQ ID NO: 7-10, SEQ ID NO: 12-15, SEQ ID NO: 17-20, SEQ ID NO: 22-25, SEQ ID NO: 27-30, SEQ ID NO: 32- 35, SEQ ID NO: 37-40, SEQ ID NO: 42-45 and SEQ ID NO: 87-90.
  • a set of oligonucleotides for nucleic acid detection of Mycobacterium tuberculosis and Mycobacterium bovis in a sample wherein the nucleotide sequence of said set of oligonucleotides is as set forth in SEQ ID NO: 2-5, SEQ ID NO: 7-10, SEQ ID NO: 12- 15, SEQ ID NO: 17-20, SEQ ID NO: 22-25, SEQ ID NO: 27-30, SEQ ID NO: 32-35, SEQ ID NO: 37-40, SEQ ID NO: 42-45 and SEQ ID NO: 87-90.
  • a set of oligonucleotides for nucleic acid detection of Hepatitis virus in a sample wherein the nucleotide sequence of said set of oligonucleotides is as set forth in SEQ ID NO: 62-65, SEQ ID NO: 67-70, SEQ ID NO: 72-75, SEQ ID NO: 77-80 or SEQ ID NO: 82-85, said Hepatitis virus being selected from the group consisting of Hepatitis B and C virus.
  • a set of oligonucleotides for nucleic acid detection of Hepatitis B virus in a sample wherein the nucleotide sequence of said set of oligonucleotides is as set forth in SEQ ID NO: 62-65 or SEQ ID NO: 67-70.
  • a set of oligonucleotides for nucleic acid detection of Hepatitis C virus in a sample wherein the nucleotide sequence of said set of oligonucleotides is as set forth in SEQ ID NO: 72-75, SEQ ID NO: 77-80 or SEQ ID NO: 82-85.
  • nucleotide sequence of said set of oligonucleotides is selected from the group consisting of the nucleotide sequence as set forth in SEQ ID NO: 92-95 and SEQ ID NO: 97-100.
  • kits for detection of a nucleic acid of a Mycobacterium species in a sample comprising the set of oligonucleotides selected from the group consisting of the nucleotide sequence as set forth in SEQ ID NO: 2-5, SEQ ID NO:7-10, SEQ ID NO:12-15, SEQ ID NO:17-20, SEQ ID NO:22-25, SEQ ID NO:27-30, SEQ ID NO:32-35, SEQ ID NO:37-40, SEQ ID NO:42-45, SEQ ID NO:47-50 and SEQ ID NO: 87-90 wherein the Mycobacterium is selected from the group consisting of Mycobacterium tuberculosis, M. avium and M. bovis.
  • kits for detection of a nucleic acid of a Mycobacterium species in a sample comprising the set of oligonucleotides selected from the group consisting of nucleotide sequence as set forth in SEQ ID NO: 42-45 and SEQ ID NO: 47-50, wherein the Mycobacterium is selected from the group consisting of Mycobacterium avium paratuberculosis KlO and Mycobacterium avium 104.
  • kits for detection of a nucleic acid of Mycobacterium tuberculosis in a sample comprising the set of oligonucleotides selected from the group consisting of nucleotide sequence as set forth in SEQ ID NO: 2-5, SEQ ID NO:7-10, SEQ ID NO:12-15, SEQ ID NO:17-20, SEQ ID NO:22-25, SEQ ID NO:27-30, SEQ ID NO:32-35, SEQ ID NO:37-40, SEQ ID NO: 42-45 and SEQ ID NO: 87-90.
  • kits for detection of a nucleic acid of Mycobacterium bovis in a sample
  • the kit comprises the set of oligonucleotides selected from the group consisting of the nucleotide sequence as set forth in SEQ ID NO: 2-5, SEQ ID NO: 7-10, SEQ ID NO: 12-15, SEQ ID NO: 17-20, SEQ ID NO: 22-25, SEQ ID NO: 27-30, SEQ ID NO: 32-35, SEQ ID NO: 37-40, SEQ ID NO: 42-45 and SEQ ID NO: 87-90.
  • kits for detection of a nucleic acid of Mycobacterium tuberculosis and Mycobacterium bovis in a sample wherein said kit comprises the set of oligonucleotides is as set forth in SEQ ID NO: 2-5, SEQ ID NO: 7-10, SEQ ID NO: 12-15, SEQ ID NO: 17-20, SEQ ID NO: 22-25, SEQ ID NO: 27-30, SEQ ID NO: 32-35, SEQ ID NO: 37-40, SEQ ID NO: 42-45 and SEQ ID NO: 87-90.
  • kits for detection of a nucleic acid of a Hepatitis virus comprising the set of oligonucleotides is as set forth in SEQ ID NO: 62-65, SEQ ID NO: 67-70, SEQ ID NO: 72-75, SEQ ID NO: 77-80 or SEQ ID NO: 82-85, wherein the Hepatitis virus being selected from the group consisting of Hepatitis B and C virus.
  • kits for detection of a nucleic acid of Hepatitis B virus comprising the set of oligonucleotides is as set forth in SEQ ID NO: 62-65 or SEQ ID NO: 67-70.
  • kits for detection of a nucleic acid of Hepatitis C virus comprising the set of oligonucleotides is as set forth in SEQ ID NO: 72-75, SEQ ID NO: 77-80 or SEQ ID NO: 82-85.
  • kits for detection of sequence specific regions that are implicated in susceptibility to prostate cancer wherein said kit comprises the set of oligonucleotides selected from the group consisting of the nucleotide sequence as set forth in SEQ ID NO: 92-95 and SEQ ID NO: 97-100.
  • An embodiment of the present invention is to provide a kit containing all the necessary reagents to perform the methods of detection disclosed herein.
  • the kit may contain specific oligonucleotide sequence sets optionally attached to a label, a suitable buffer and a thermostable ligase.
  • the kit may further contain a set of printed instructions indicating that the kit is useful for detection of the specific disease and/or non disease related conditions as disclosed in the present invention.
  • Dual isothermal nucleic acid amplification reaction for detecting Mycobacterium DNA using oligonucleotide set (Set 1)
  • the oligonucleotide set (Set 1) having nucleotide sequence as set forth in SEQ ID NO: 2- 5 were synthesized using the methods well known in the art. These oligonucleotides were designed from nucleotide position 62716-62765 (SEQ ID NO: 1) of the DNA sequence of Mycobacterium tuberculosis CDC1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
  • a phosphate group was attached to the 5' end of the oligonucleotides as set forth in SEQ ID NO: 3 and SEQ ID NO: 4.
  • the oligonucleotide set as set forth in SEQ ID NO: 2-5 was tested with blood, milk, sputum, pleural effusion, urine, stool, lung tissue, cotyledons, semen, ascitic fluid, bronchial washing samples and pure culture of Mycobacterium species.
  • the DINAR for detecting Mycobacterium DNA was performed in two steps as given below.
  • the isothermal nucleic acid amplification reaction was performed using oligonucleotide having nucleotide sequences as set forth in SEQ ID NO: 2-5 for detection of Mycobacterium DNA in samples.
  • the total volume of the reaction mixture was 20 ⁇ l.
  • the final concentration of the components of the reaction mixture was 2 ⁇ l buffer (10X), 1 ⁇ l Thermostable ligase (5U/ ⁇ l), 1 ⁇ l each of oligonucleotides IA, IB, 1C and ID (SEQ ID NO: 2-5) at concentration 2.5ng each, lOOng of template DNA and ultrapure water to bring the reaction volume to 20 ⁇ l.
  • the cycling reaction employed is as follows: first cycle at 95 0 C for 10 min and 6O 0 C for 3 min followed by 14 cycles at 95 0 C for 1 min and 6O 0 C for 1 min.
  • Various samples and controls were used for detection of Mycobacterium DNA.
  • the description of the different reactions (reactions 1-7) used as template DNA is given below.
  • Reaction 1 NC-Negative control- no template DNA in the reaction mixture
  • Reaction 2 HGD-Negative control- template DNA from healthy subject (not infected
  • Reaction 4 S8-template DNA from sputum sample of confirmed Mycobacterium infected patient
  • Reaction 5 S9- template DNA from sputum sample of suspected Mycobacterium infected patient
  • Reaction 6 SlO- template DNA from sputum sample of suspected Mycobacterium infected patient
  • Reaction 7 SI l- template DNA from sputum sample of suspected Mycobacterium infected patient After completion of 15 cycles of reaction in the thermocycler, the resultant reaction mixture was processed through a purification column and the flow through obtained was used as a template for the second isothermal nucleic acid amplification reaction.
  • isothermal nucleic acid amplification reaction was performed using the same primer set as used in the first step (SEQ ID NO: 2-5).
  • the reaction mixture used for performing the second isothermal nucleic acid amplification reaction was 8 ⁇ l of the flow through obtained by processing the final reaction mixture of reactions 1-7 of step I 9 2 ⁇ l buffer (10X) 5 1 ⁇ l Thermostable ligase (5U/ ⁇ l), l ⁇ l each of oligonucleotides IA, IB, 1C and ID (SEQ ID NO: 2-5) at concentration 2.5ng each and ultrapure water to bring the reaction volume to 20 ⁇ l.
  • the cycling reaction was carried out as follows: 23 cycles 95°C for 1 min and 6O 0 C for 1 min.
  • the amplified DNA products obtained can also be detected by various other methods known in the art such as solution phase colorimetric detection using enzymes and photoactivity assays, solid phase colorimetric detection using enzymes and photoactivity assays, solution phase fluorimetric detection, solid phase fluorimetric detection, solution phase chemiluminiscent detection, solid phase chemiluminiscent detection, solution phase using nanoparticles, solid phase using nanoparticles, solution phase using radioactive detection and solid phase using radioactive detection method.
  • primer set having nucleotide sequence as set forth in SEQ ID: 2-5 are useful in the detection of Mycobacterium infection.
  • DINAR assay employing primer set having nucleotide sequence as set forth in SEQ ID NO: 2-5 is sensitive and easy to use for the detection of Mycobacterium infection in patients.
  • primer set SEQ ID NO: 2-5 detect DNA of Mycobacterium tuberculosis and Mycobacterium bovis but not Mycobacterium avium strain.
  • reaction conditions employed for the above described process employed annealing and ligation temperatures varying from 55°C to 74° C for duration of 1 min and using different primer sets. The results obtained were similar as for the above described reaction set up. Other primer sets were tested with the same set of samples with similar results. The enzyme concentration for thermostable ligase was varied from 1-10 units with consistent and reproducible results.
  • A) Culture method The decontaminated samples were inoculated on Lowenstein- Jensen slants and 7H9 Middlebrook's liquid media for growth and incubated at 37°C for 3-4 weeks. Growth of MTB colonies was evident in all cases.
  • Dual isothermal nucleic acid amplification reaction for detecting
  • the oligonucleotide set (Set 1) as provided in example 1 was used for the detection of Mycobacterium tuberculosis.
  • the DINAR for detecting Mycobacterium DNA was performed in two steps as given below.
  • the isothermal nucleic acid amplification reaction was performed using oligonucleotide having nucleotide sequences as set forth in SEQ ID NO: 2-5 for detection of Mycobacterium DNA in samples.
  • the total volume of the reaction mixture was 20 ⁇ l.
  • the final concentration of the components of the reaction mixture was 2 ⁇ l buffer (10X), 1 ⁇ l Thermostable ligase (5U/ ⁇ l), 1 ⁇ l each of oligonucleotides IA, IB, 1C and ID (SEQ ID NO: 2-5) at concentration 2.5ng each, lOOng of template DNA and ultrapure water to bring the reaction volume to 20 ⁇ l.
  • the cycling reaction employed is as follows: first cycle at 95°C for 10 min and 60 0 C for 3 min followed by 14 cycles at 95 0 C for 1 min and 60 0 C for 1 min.
  • Various samples and controls were used for detection of Mycobacterium DNA.
  • the description of the different reactions (reactions 1-7) used as template DNA is given below.
  • Reaction 1 NC-Negative control- no template DNA in the reaction mixture
  • Reaction 2 HGD-Negative control- template DNA from healthy subject (not infected
  • Reaction 4 S8-template DNA from sputum sample of confirmed Mycobacterium infected patient
  • Reaction 5 S9- template DNA from sputum sample of suspected Mycobacterium infected patient
  • Reaction 6 SlO- template DNA from sputum sample of suspected Mycobacterium infected patient
  • Reaction 7 SIl- template DNA from sputum sample of suspected Mycobacterium infected patient
  • the resultant reaction mixture was used as a template for the second isothermal nucleic acid amplification reaction without any processing.
  • isothermal nucleic acid amplification reaction was performed using the same primer set as used in the first step (SEQ ID NO: 2-5).
  • the reaction mixture used for performing the second isothermal nucleic acid amplification reaction was 8 ⁇ l of the final reaction mixture of reactions 1-7 obtained from resulting reaction mixture (non-processed) of step 1, 2 ⁇ l buffer (10X), 1 ⁇ l Thermostable ligase (5U/ ⁇ l), I ⁇ l each of oligonucleotides IA, IB, 1C and ID (SEQ ID NO: 2-5) at concentration 2.5ng each and ultrapure water to bring the reaction volume to 20 ⁇ l.
  • the cycling reaction was carried out as follows: 23 cycles 95 0 C for 1 min and 6O 0 C for 1 min.
  • reaction mixture of reactions 1-7 was electrophoresed on a 2.5% agarose gel at 100V for 45 min and the DNA products were identified using methods known in the art.
  • the gel picture was captured on a gel documentation system.
  • the amplified DNA products obtained can also be detected by various other methods known in the art such as solution phase colorimetric detection using enzymes and photoactivity assays, solid phase colorimetric detection using enzymes and photoactivity assays, solution phase fluorimetric detection, solid phase fluorimetric detection, solution phase chemiluminiscent detection, solid phase chemiluminiscent detection, solution phase using nanoparticles, solid phase using nanoparticles, solution phase using radioactive detection and solid phase using radioactive detection method.
  • reaction 1 marked as lane NC (negative control sample) and reaction 2 marked as lane HGD (template DNA from healthy subject).
  • a fragment of 25bp was obtained in reaction 1 and 2 and these correspond to primer annealing as expected.
  • reaction 3 marked as lane PCl (positive control) and the reaction 4 marked as lane S 8 (sample containing Mycobacterium DNA).
  • Amplification of 50 bp fragment was observed in reactions 5-7 marked as lane S9-S11 confirming presence of Mycobacterium DNA in the suspected patients.
  • primer set having nucleotide sequence as set forth in SEQ ID: 2-5 are useful in the detection of Mycobacterium infection.
  • DINAR assay employing primer set having nucleotide sequence as set forth in SEQ ID NO: 2-5 is sensitive and easy to use for the detection of Mycobacterium infection in patients.
  • primer set SEQ ID NO: 2-5 detect DNA of. Mycobacterium tuberculosis and Mycobacterium bovis but not Mycobacterium avium strain.
  • reaction conditions employed for the above described process employed annealing and ligation temperatures varying from 60° to 74° C for duration of 1 min and using different primer sets. The results obtained were similar as for the above described reaction set up. Other primer sets were tested with the same set of samples with similar results. The enzyme concentration for thermostable ligase was varied from 1-10 units with consistent and reproducible results.
  • A) Culture method The decontaminated samples were inoculated on Lowenstein- Jensen slants and 7H9 Middlebrook's liquid media for growth and incubated at 37 0 C for 3-4weeks. Growth of MTB colonies was evident in all cases.
  • Dual isothermal nucleic acid amplification reaction for detecting Mycobacterium DNA using oligonucleotide Set 2 (SEQ ID NO: 7-10
  • the oligonucleotide set (Set 2) having nucleotide sequence as set forth in SEQ ID NO: 7- 10 were synthesized using the methods well known in the art. These oligonucleotides were designed from nucleotide position 85252-85301 (SEQ ID NO: 6) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis. This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
  • a phosphate group was attached to the 5' end of the oligonucleotides as set forth in SEQ ID NO: 8 and SEQ ID NO: 9.
  • the oligonucleotides as set forth in SEQ ID NO: 8 and SEQ ID NO: 9 were modified at 3' end by adding phosphate group.
  • the DINAR for detecting Mycobacterium DNA was performed in two steps as discussed in example 1.
  • the amplified DNA products obtained can also be detected by various other methods known in the art as provided in example 1. The result clearly indicates that the oligonucleotide set having nucleotide sequence as set forth in SEQ ID: 7-10 are useful in the detection of Mycobacterium infection.
  • Dual isothermal nucleic acid amplification reaction for detecting Mycobacterium DNA using oligonucleotide Set 2 (SEQ ID NO: 7-10
  • the oligonucleotide set (Set 2) as provided in example 3 was used in the detection of Mycobacterium tuberculosis and Mycobacterium bovis.
  • the DINAR for detecting Mycobacterium DNA was performed in two steps as discussed in example 2.
  • the amplified DNA products obtained can also be detected by various other methods known in the art as provided in example 2. The result clearly indicates that the oligonucleotide set having nucleotide sequence as set forth in SEQ ID: 7-10 are useful in the detection of Mycobacterium infection.
  • Dual isothermal nucleic acid amplification reaction for detecting Mycobacterium DNA using oligonucleotide Set 3 (SEQ ID NO: 12-15)
  • oligonucleotide sequences (Set 3) having nucleotide sequence as set forth in SEQ ID NO: 12-15 were synthesized using the methods well known in the art. These oligonucleotides were designed from nucleotide position 82712-82761 (SEQ ID NO: 11) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
  • 3D CTG GCT AAT GCT CAG ATC GCC CAT C SEQ ID NO: 15
  • a phosphate group was attached to the 5' end of the oligonucleotides as set forth in SEQ ID NO: 13 and SEQ ID NO: 14.
  • the oligonucleotides as set forth in SEQ ID NO: 13 and SEQ ID NO: 14 were modified at 3' end by adding phosphate, group.
  • the oligonucleotide set as set forth in SEQ ID NO: 12-15 was tested with blood, milk, sputum, pleural effusion, urine, stool, lung tissue, cotyledons, semen, ascitic fluid, bronchial washing samples and pure culture of Mycobacterium species.
  • the DINAR for detecting Mycobacterium DNA was performed in two steps as discussed in example 1.
  • the amplified DNA products obtained can also be detected by various other methods known in the art as provided in example 1. The result clearly indicates that the oligonucleotide set having nucleotide sequence as set forth in SEQ ID: 12-15 are useful in the detection of Mycobacterium infection.
  • Dual isothermal nucleic acid amplification reaction for detecting Mycobacterium DNA using oligonucleotide Set 3 (SEQ ID NO: 12-15)
  • the oligonucleotide set (Set 3) as provided in example 5 was used in the detection of Mycobacterium tuberculosis and Mycobacterium bovis.
  • the DINAR for detecting Mycobacterium DNA was performed in two steps as discussed in example 2.
  • the amplified DNA products obtained can also be detected by various other methods known in the art as provided in example 1. The result clearly indicates that the oligonucleotide set having nucleotide sequence as set forth in SEQ ID: 12-15 are useful in the detection of Mycobacterium infection.
  • Dual isothermal nucleic acid amplification reaction for detecting Mycobacterium DNA using oligonucleotide Set 4 (SEQ ID NO: 17-20)
  • oligonucleotide sequences having nucleotide sequence as set forth in SEQ ID NO: 17-20 were synthesized using the methods well known in the art. These oligonucleotides were designed from nucleotide position 2041-2088 (SEQ ID NO: 16) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
  • Region 4 GAA AGG GCG CAA TGG ACG CGG CTA CGA CAA GAG TTG GCC TCA CCG
  • a phosphate group was attached to the 5' end of the oligonucleotides as set forth in SEQ ID NO: 18 and SEQ ID NO: 19.
  • the oligonucleotides as set forth in SEQ ID NO: 18 and SEQ ID NO: 19 were modified at 3' end by adding phosphate group.
  • the oligonucleotide set as set forth in SEQ ID NO: 17-20 was tested with blood, milk, sputum, pleural effusion, urine, stool, lung tissue, cotyledons, semen, ascitic fluid, bronchial washing samples and pure culture of Mycobacterium species.
  • the DINAR for detecting Mycobacterium DNA was performed in two steps as discussed in example 1.
  • the amplified DNA products obtained can also be detected by various other methods known in the art as provided in example 1. The result clearly indicates that the oligonucleotide set having nucleotide sequence as set forth in SEQ ID: 17-20 are useful in the detection of Mycobacterium infection.
  • Dual isothermal nucleic acid amplification reaction for detecting Mycobacterium DNA using oligonucleotide Set 4 (SEQ ID NO: 17-20)
  • the oligonucleotide set (Set 4) as provided in example 7 was used in the detection of Mycobacterium tuberculosis and Mycobacterium bovis.
  • the DINAR for detecting Mycobacterium DNA was performed in two steps as discussed in example 2.
  • the amplified DNA products obtained can also be detected by various other methods known in the art as provided in example 1. The result clearly indicates that the oligonucleotide set having nucleotide sequence as set forth in SEQ ID: 17-20 are useful in the detection of Mycobacterium infection.
  • Dual isothermal nucleic acid amplification reaction for detecting Mycobacterium DNA using oligonucleotide set (Set 17)
  • the oligonucleotide set (Set 17) having nucleotide sequence as set forth in SEQ ID NO: 87-90 were synthesized using the methods well known in the art. These oligonucleotides were designed from nucleotide position 484256 to 484207 (SEQ ID NO: 86) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516).
  • a phosphate group was attached to the 5' end of the oligonucleotides as set forth in SEQ ID NO: 88 and SEQ ID NO: 89.
  • the oligonucleotides set as set forth in SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89 and SEQ ID NO: 90 were tested with sputum, blood, ascitic fluid, bronchial washing samples, pleural fluid, urine, semen, tissue samples, milk, serum and pure culture of Mycobacterium species.
  • the DINAR for detecting Mycobacterium DNA was performed in two steps using the oligonucleotide set (Set 17) having nucleotide sequence as set forth in SEQ ID NO: 87- 90. The detailed procedure is given below.
  • the isothermal nucleic acid amplification reaction was performed using oligonucleotide having nucleotide sequences as set forth in SEQ ID NO: 87-90 for detection of Mycobacterium DNA in samples.
  • the total volume of the reaction mixture was 30 ⁇ l.
  • the final concentration of the components of the reaction mixture was 3 ⁇ l buffer (10X), 1 ⁇ l Thermostable ligase (5U/ ⁇ l), 1 ⁇ l of each oligonucleotide 17A, 17B, 17C and 17D (SEQ ID NO: 87-90) at concentration 2.5ng each, lOOng of template DNA and ultrapure water to bring the reaction volume to 30 ⁇ l.
  • the cycling reaction employed is as follows: first cycle at 95 0 C for 10 min and 72 0 C for 3 min followed by 14 cycles at 95°C for 1 min and 72 0 C for 1 min.
  • Various samples and controls were used for detection of Mycobacterium DNA.
  • the description of the different reactions (reactions 1-8) used as template DNA is given below.
  • Reaction 1 NHD-Negative control- template DNA from healthy subject (not infected
  • Reaction 7 DNA isolated from H37Rv culture (PRv)
  • isothermal nucleic acid amplification reaction was performed using the same primer set as used in the first step (SEQ ID NO: 87-90).
  • the reaction mixture used for performing the second isothermal nucleic acid amplification reaction was 10 ⁇ l of the final reaction mixture of reactions 1-8 of step 1, 3 ⁇ l buffer (10X), 1 ⁇ l Thermostable ligase (5U/ ⁇ l), l ⁇ l each of oligonucleotides 17A, 17B, 17C and 17D (SEQ ID NO: 87-90) at concentration 2.5ng each and ultrapure water to bring the reaction volume to 30 ⁇ l.
  • the cycling reaction was carried out as follows: 23 cycles 95 0 C for 1 min and 72°C for 1 min.
  • the amplified DNA products obtained can also be detected by various other methods known in the art such as solution phase colorimetric detection using enzymes and photoactivity assays, solid phase colorimetric detection using enzymes and photoactivity assays, solution phase fluorimetric detection, solid phase fluorimetric detection, solution phase chemiluminiscent detection, solid phase chemiluminiscent detection, solution phase using nanoparticles, solid phase using nanoparticles, solution phase using radioactive detection and solid phase using radioactive detection method.
  • the amplification of 50 bp fragment so observed in the reactions 4-6 confirms the presence of Mycobacterium DNA in the suspected patients while absence of amplification in the reactions 2 and 3 indicates absence of Mycobacterium DNA in the suspected patients.
  • DINAR assay employing primer set having nucleotide sequence as set forth in SEQ ID NO: 87-90 is sensitive and easy to use for the detection of Mycobacterium infection in patients.
  • primer set SEQ ID NO: 87-90 detect DNA of Mycobacterium tuberculosis and Mycobacterium bovis but not Mycobacterium avium strain.
  • reaction conditions employed for the above described process employed annealing and ligation temperatures varying from 55°C to 74° C for duration of 1 min and using different primer sets. The results obtained were similar as for the above described reaction set up. Other primer sets were tested with the same set of samples with similar results. The enzyme concentration for thermostable ligase was varied from 1-10 units with consistent and reproducible results.
  • Dual isothermal nucleic acid amplification reaction for detecting Insertion/deletion of a region that may be associated with risk of prostate Cancer using oligonucleotide set (Set 18 and 19)
  • oligonucleotide set (Set 18) having nucleotide sequence as set forth in SEQ ID NO: 92-95 and the oligonucleotide set (Set 19) having nucleotide sequence as set forth in SEQ ID NO: 97-100 were synthesized using the methods well known in the art.
  • INDEL1-18A AAA AAC CAA ACC AAA TTA TTG CTG A SEQ ID: 92 INDELlM-18B: TAC AAT AAA GCA TTC ATC TCA TCA T SEQ ID:93 INDEL1-18C: TCA GCA ATA ATT TGG TTT GGT TTT T SEQ ID:94 INDELlM-18D: ATG ATG AGA TGA ATG CTT TAT TGT A SEQ ID:95
  • INDELl a 15 base pair sequence INDELl is present in the gene MSRl.
  • the insertion of INDELl can be detected using the oligonucleotide set 18 (SEQ ID NO: 92- 95).
  • the oligonucleotide set 18 as set forth in SEQ ID NO: 92-95 is designed to include the INDELl region in the MSRl gene that corresponds to nucleotide position -14458bp (SEQ ID NO: 91) of the DNA sequence of Homo sapiens chromosome 8 (Accession number NT_030737). This region is specific to detect presence/ absence of marker INDELl which is an MSRl sequence variant and maybe implicated in association with prostate cancer risk.
  • Region 19 AAA AAC CAA ACC AAA TTA TTG CTG A ATC TCA TCA TAC ACA CAC AGA CAC A SEQ ID NO: 96
  • INDEL1-19A AAAAACCAAACCAAATTATTGCTGA SEQ ID NO: 97
  • INDEL1N-19B ATCTCATCATACACACACAGACACA SEQ ID NO:98
  • INDEL1-19C TCAGCAATAATTTGG TTT GGT TTT T SEQ IDNO:99
  • INDELlN-19D TGTGTCTGTGTGTGTATGATGAGAT SEQ ID NO: 100
  • the 15 base pair sequence INDEL 1 is deleted in the gene MSRl.
  • This mutation by deletion can be detected using the oligonucleotide set 19 (SEQ ID NO: 97- 100).
  • a phosphate group was attached to the 5' end of the oligonucleotides as set forth in SEQ ID NO: 98 and SEQ ID NO: 99.
  • the oligonucleotide sets 18 and 19 as set forth in SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95 and SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100 were tested with a) Synthetic control of 250 bp containing the 15bp INDELl region having the following sequence:
  • the isothermal nucleic acid amplification reaction was performed using oligonucleotide having nucleotide sequences as set forth in SEQ ID NO: 92-95 and 97-100 for detection of presence/ absence of the INDELl region in the sample.
  • the total volume of the reaction mixture was 30 ⁇ l.
  • the final concentration of the components of the reaction mixture was 3.0 ⁇ l buffer (10X), 1 ⁇ l Thermostable ligase (5U/ ⁇ l), 1 ⁇ l of each oligonucleotide (SEQ ID NO: 92-95 with reaction 1 and 2 at concentration 2.5ng each for sequences 18A and 18C and IOng for sequences 18B and 18D and SEQ ID NO: 97- 100 at concentration 1.6ng each for sequences 19A, 19B, 19C and 19D with reaction 3 and 4), lOOng of template DNA and ultrapure water to bring the reaction volume to 30 ⁇ l.
  • the cycling reaction employed is as follows: first cycle at 95 0 C for 10 min and 65 0 C for 3 min followed by 17 cycles at 95 0 C for 1 min and 65°C for 1 min.
  • the description of the different reactions (reactions 1-4) used as template DNA is given below:
  • Sample 1 Synthetic control with INDELl region with the primer set as set forth in
  • Sample 2 Synthetic control without INDELl region with the primer set as set forth in SEQ ID: 92-95
  • Sample 3 Synthetic control with INDELl region with the primer set as set forth in
  • Sample 4 Synthetic control without INDELl region with the primer set as set forth in SEQ ID: 97-100.
  • isothermal nucleic acid amplification reaction was performed using the same primer set as used in the first step (SEQ ID NO: 92-95 with reaction 1 and 2 at concentration 2.5ng each for sequences 18A and 18C and IOng for sequences 18B and 18D and SEQ ID NO: 97-100 at concentration 1.6ng each for sequences 19A, 19B, 19C and 19D with reaction 3 and 4).
  • the reaction mixture used for performing the second isothermal nucleic acid amplification reaction was 10 ⁇ l of the final reaction mixture of reactions 1-4 of step 1, 3 ⁇ l buffer (10X), 1 ⁇ l Thermostable ligase (5U/ ⁇ l), l ⁇ l of each oligonucleotide (SEQ ID NO: 92-95 with reaction 1 and 2 at concentration 2.5ng each for sequences 18A and 18C and IOng for sequences 18B and 18D and SEQ ID NO: 97- 100 at concentration 1.6ng each for sequences 19A, 19B, 19C and 19D with reaction 3 and 4) and ultrapure water to bring the reaction volume to 30 ⁇ l.
  • the cycling reaction was carried out as follows: 23 cycles 95 0 C for 1 min and 65 0 C for 1 min.
  • the amplified DNA products obtained can also be detected by various other methods known in the art such as solution phase colorimetric detection using enzymes and photoactivity assays, solid phase colorimetric detection using enzymes and photoactivity assays, solution phase fiuorimetric detection, solid phase fluorimetric detection, solution phase chemiluminiscent detection, solid phase chemiluminiscent detection, solution phase using nanoparticles, solid phase using nanoparticles, solution phase using radioactive detection and solid phase using radioactive detection method.
  • reaction 4 contains the target DNA with INDELl deletion while reaction 3 which contains the target DNA with INDELl sequence insertion is giving a background signal.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un procédé, des ensembles d'oligonucléotides et des trousses pour détecter, dans un échantillon, des états pathologiques associés ou non à une maladie, ces états comprenant, de manière non exhaustive: des infections, une résistance aux médicaments, des mutations, des maladies génétiques, le cancer et/ou des variations de polymorphisme mononucléotidique.
PCT/IN2009/000014 2008-01-04 2009-01-05 Procédés de détection fondés sur des acides nucléiques WO2009087686A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IN45/DEL/2008 2008-01-04
IN45DE2008 2008-01-04

Publications (2)

Publication Number Publication Date
WO2009087686A2 true WO2009087686A2 (fr) 2009-07-16
WO2009087686A3 WO2009087686A3 (fr) 2009-11-12

Family

ID=40765454

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IN2009/000014 WO2009087686A2 (fr) 2008-01-04 2009-01-05 Procédés de détection fondés sur des acides nucléiques

Country Status (1)

Country Link
WO (1) WO2009087686A2 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991017239A1 (fr) * 1990-05-03 1991-11-14 Cornell Research Foundation, Inc. Systeme d'amplification d'adn induit par ligase thermostable, servant a detecter des maladies genetiques.
WO1995031571A2 (fr) * 1994-05-13 1995-11-23 Abbott Laboratories Materiaux et procedes de detection de microbacteries
US20040018521A1 (en) * 2002-05-07 2004-01-29 Jianfeng Xu Mutations in the macrophage scavenger receptor 1 gene alter risk of prostate cancer, asthma, and cardiovascular disease

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991017239A1 (fr) * 1990-05-03 1991-11-14 Cornell Research Foundation, Inc. Systeme d'amplification d'adn induit par ligase thermostable, servant a detecter des maladies genetiques.
WO1995031571A2 (fr) * 1994-05-13 1995-11-23 Abbott Laboratories Materiaux et procedes de detection de microbacteries
US20040018521A1 (en) * 2002-05-07 2004-01-29 Jianfeng Xu Mutations in the macrophage scavenger receptor 1 gene alter risk of prostate cancer, asthma, and cardiovascular disease

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HAMPL H ET AL: "Detection of HBV DNA by ligase chain reaction (LCR), a highly sensitive and quantifiable DNA probe assay" HEPATOLOGY, WILLIAMS AND WILKINS, BALTIMORE, MD, US, vol. 16, no. SUPPL. 4, 1 October 1992 (1992-10-01), page 132A, XP008105220 ISSN: 0270-9139 [retrieved on 2005-12-05] *
HSING ANN W ET AL: "MSR1 variants and the risks of prostate cancer and benign prostatic hyperplasia: a population-based study in China." CARCINOGENESIS DEC 2007, vol. 28, no. 12, December 2007 (2007-12), pages 2530-2536, XP002542383 ISSN: 1460-2180 *
KALIN I ET AL: "Evaluation of the ligase chain reaction (LCR) for the detection of points mutation" MUTATION RESEARCH LETTERS, ELSEVIER, vol. 283, no. 2, 1 October 1992 (1992-10-01), pages 119-123, XP025401141 ISSN: 0165-7992 [retrieved on 1992-10-01] *
KARTHIGESU VASANDRA DEVI ET AL: "The ligase chain reaction distinguishes hepatitis B virus S-gene variants" FEMS MICROBIOLOGY LETTERS, BLACKWELL PUBLISHING, AMSTERDAM, NL, vol. 131, no. 2, 1 September 1995 (1995-09-01), pages 127-132, XP008105219 ISSN: 0378-1097 [retrieved on 1999-12-16] *
SIMONE LAMPA ET AL: "An optimisation approach to increase DNA amplification success of otter faeces" CONSERVATION GENETICS, KLUWER ACADEMIC PUBLISHERS, DO, vol. 9, no. 1, 25 April 2007 (2007-04-25), pages 201-210, XP019571301 ISSN: 1572-9737 *

Also Published As

Publication number Publication date
WO2009087686A3 (fr) 2009-11-12

Similar Documents

Publication Publication Date Title
JP4969250B2 (ja) スペーサー領域を使用するプロテウス種の検出、同定、および区別
Taylor et al. Detection of Mycobacterium bovis in bovine clinical specimens using real-time fluorescence and fluorescence resonance energy transfer probe rapid-cycle PCR
CA2999403A1 (fr) Detection amelioree de courtes repetitions homopolymeres
TWI465572B (zh) Method, composition and system of amplification and detection of target microbial DNA
JP5916740B2 (ja) 核酸標的の定量的多重同定
WO2009087685A2 (fr) Procédé de détection d'acide nucléique de l'hépatite et ses utilisations
US11459620B2 (en) Compositions and methods for detection of Mycobacterium avium paratuberculosis
Wang et al. Nanoparticles-based lateral flow biosensor coupled with multiple cross displacement amplification Plus for simultaneous detection of nucleic acid and prevention of carryover contamination
EP3438280B1 (fr) Procédé de détection d'hémoplasme
WO2021201072A1 (fr) Ensemble d'amorces et sonde pour détection de ｓｔａｐｈｙｌｏｃｏｃｃｕｓ ａｒｇｅｎｔｅｕｓ
Gomes et al. Direct detection of Theileria annulata in bovine blood samples using standard and isothermal DNA amplification approaches
RU2455364C2 (ru) Способ идентификации микобактерий с помощью полимеразной цепной реакции
US9334542B2 (en) Compositions and methods for detection of microorganisms of the Mycobacterium avium complex excluding Mycobacterium avium paratuberculosis
WO2009087686A2 (fr) Procédés de détection fondés sur des acides nucléiques
US7749696B2 (en) Method and kit for the specific detection of M. tuberculosis
WO2009087687A1 (fr) Procédé de détection à base d'acides nucléiques, et utilisations correspondantes
WO2009087688A2 (fr) Procédé de détection d'acide nucléique de mycobactérium et ses utilisations
CN110512013B (zh) 一种应用高分辨率熔解曲线法鉴别三种棒状杆菌的方法
WO2024063637A1 (fr) Réactifs de pcr vert sybr, procédé et kit
Munkhtogtokh et al. Combination of upstream primer-multuplex PCR (UP-mpcr) and capillary electrophoresis for equine genetic analysis
JP2021073858A (ja) Ｂ型肝炎ワクチンに対する免疫応答性の遺伝的要因を検出する方法及びキット
CN117721228A (zh) mecA基因扩增用引物对、mecA基因检测试剂盒及mecA基因检测方法
Cross et al. Research Article A Rapid and Sensitive Diagnostic Screening Assay for Detection of Mycobacteria Including Mycobacterium tuberculosis Directly from Sputum without Extraction
WO2012136712A1 (fr) Moyens et procédés de quantification d'acides nucléiques
WO2010115912A2 (fr) Séquences d'acides nucléiques basées sur le gène bactérien ssra et son transcrit arntm pour la détection moléculaire de s. aureus

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09701428

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09701428

Country of ref document: EP

Kind code of ref document: A2