WO2009084739A1 - Procédé et composition pharmaceutique pour le traitement du cancer utilisant la protéine bmp10 - Google Patents

Procédé et composition pharmaceutique pour le traitement du cancer utilisant la protéine bmp10 Download PDF

Info

Publication number
WO2009084739A1
WO2009084739A1 PCT/JP2008/073981 JP2008073981W WO2009084739A1 WO 2009084739 A1 WO2009084739 A1 WO 2009084739A1 JP 2008073981 W JP2008073981 W JP 2008073981W WO 2009084739 A1 WO2009084739 A1 WO 2009084739A1
Authority
WO
WIPO (PCT)
Prior art keywords
mouse
seq
japan
weeks
gene
Prior art date
Application number
PCT/JP2008/073981
Other languages
English (en)
Japanese (ja)
Inventor
Kazuma Tomizuka
Kiyoshi Shimizu
Makoto Kakitani
Original Assignee
Kyowa Hakko Kirin Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kyowa Hakko Kirin Co., Ltd. filed Critical Kyowa Hakko Kirin Co., Ltd.
Publication of WO2009084739A1 publication Critical patent/WO2009084739A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1875—Bone morphogenic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • the present invention relates to the use and usage of bone morphogenetic ic protein ⁇ ( ⁇ ) as a cancer disease therapeutic agent.
  • Non-patent Documents 1 and 2 BMP family molecules have generally been found to be involved in the growth, differentiation, and apoptosis of various cells and are important for tissue and organ morphogenesis.
  • the signal peptide region After being synthesized as a (pre-pro form), the signal peptide region is cleaved, and the cysteine residue present on the C-terminal side in the cell forms a dimer (pro dimer) via a disulfide bond. After that, furin-like protease, the active substance C-terminal side
  • Non-patent Documents 5 and 6 Non-patent Documents 5 and 6).
  • BMP10 which belongs to the BMP family of molecules, has 65% homology with BMP9 compared to the C-terminal (mature) amino acid homology, and BMP-9 and BMP-10 are considered to form a subfamily.
  • Non-patent document 7 BMP-10 was expressed in the heart after birth from the fetal stage (Non-patent Documents 7, 8, and 9), and its gene-deficient animal was found to be fetal.
  • BMP-10 is known to be an indispensable molecule for heart formation because it causes embryonic lethality due to dysplasia of the heart within -10 days
  • Non-patent document 10 During the growth process, tumor cells need to grow blood vessels with the thickness of very fine hair in order to acquire the necessary oxygen and nutrients and carry out waste products. It is known that it cannot grow to more than l-2mm. This process is called angiogenesis (angiogenes is), and inhibition of this process is thought to be important for tumor growth and suppression of metastasis (Non-patent Document 11).
  • VEGF Vascular Endothelial Growth Factor
  • PDECGF Platelet-derived Endothelial Growth Factor
  • FGF Fibroblast Growth Factor
  • TNF ct tumor necrosis factor
  • IL-8 interleukin 8
  • IGF insulin-like growth factor
  • TSP-1 thrombospondin
  • Solubilized VEGFR-1 Solubilized VEGFR-1, angiotensin II (AngII), MMP inhibitor protein (RECK), etc.
  • AngII angiotensin II
  • RECK MMP inhibitor protein
  • VEGF which was discovered in the 1980s, is considered to be the protein that plays the most important role in tumor angiogenesis, and anti-VEGF antibodies with its inhibitory activity have various suppressive effects on tumor growth. It has been clarified using a tumor graft model (Non-patent Document 11). In 2004, anti-VEGF antibody (bevacizumab: trade name Avastin) was approved by the US Food and Drug Administration (FDA) as a treatment for advanced colorectal cancer (non-patented). Reference 11).
  • FDA US Food and Drug Administration
  • Sorafenib (trade name Nexavar (registered trademark)) and Sunitinib (trade name Sutent (registered trademark)
  • Sorafenib (trade name Nexavar (registered trademark)
  • Sunitinib (trade name Sutent)
  • KDR kinase
  • VEGF vascular endothelial growth factor
  • ALK3 and ALK6 belonging to the type I receptor group of TGF-beta superfamily molecules have been reported as non-patent documents 12). Recently, it has been reported that ALK-1 specifically expressed in vascular endothelium is a receptor (Non-patent Document 13). However, ALK-1,
  • Non-patent document 17 there is a report that promoted the opposite (Non-patent document 18).
  • the reason for the difference is that it was an in vitro test using vascular endothelium of different origin, that is, it was not a test that examined angiogenesis in adults.
  • BMP9 which forms a subfamily with BMP10, has been isolated from humans, mice, and sexkeys, and its sequence information has been made public.
  • sequence information of human or mouse-derived BMP9 is, for example, human BMP9
  • NM_016204. 1, Q9UK05, AAD56960, etc., mouse BMP9 is registered with Genbank as accession number country—019506, Q9WV56, NP—0662379. From the analysis using vascular endothelial cells, etc., BMP-9 has been reported to suppress the angiogenesis in vitro using cells (Non-patent Documents 13 and 19). The role of BMP9 in angiogenesis has not been reported and has not been clarified.
  • Patent Document 1 International Publication No. W0 2007/040912 Pamphlet
  • Non-Patent Document 1 Urist, M.R., Science, 150, 893-899 (1965)
  • Non-Patent Document 2 Wozney, JM, et al., Science, 242, 1528-1534 (1988)
  • Non-Patent Document 3 Hogan, BL, Curr. Opin. Genet. Dev. 6, 432-438 (1996)
  • Non-Patent Document 4 ten Dijke, P., et al., Mol. Cell Endocrinol., 211,
  • Non-Patent Document 5 Constam, D.B., and Robertson, E. J. et al., J. Cell.
  • Non-Patent Document 7 Neuhaus, H., et al., Mech. Dev., 80, 181-184 (1999)
  • Non-Patent Document 8 Somi, S., et al., Anat. Rec. A Discov. Mol. Cell Evol Biol.
  • Non-Patent Document 9 Teichmann, U. and Kessel, M., Dev. Genes Evol. 214,
  • Non-patent literature 1 0 Chen, H., et al., Development, 131, 2219-2231 (2004) Non-patent literature 1 1 Molecular biology of cancer and angiogenesis, Nanzando (2006)
  • Non Patent Literature 1 2 azerargues, S., et al., J. Biol. Chem., 280, 32122-32132 (2005)
  • Non-Patent Literature 1 3 David, L., et al., Blood, 109, 1953-1961 (2007)
  • Non-Patent Literature 1 4 Johnson, DW, et al., Nat. Genet., 13, 189-195 (1996)
  • Non-patent literature 1 6 Urness, L. Nat. Genet., 26, 328-331 (2000) Non-patent literature 1 7 Lamouille, Blood, 15, 4495-4501 (2002) Non-patent literature 1 8 Goumans M. et al. EMB0, 21, 1743-1753 (2002) Non-patent literature 1 9 Scharpfenecker, M., et al., J. Cell Sic., 120, 964-972 (2007)
  • Non-Patent Document 2 0 Seki, T., et al., Lab. Investigation, 86, 116-129 (2006) Disclosure of the invention
  • BMP9 has growth inhibitory activity against solid tumor cells.
  • the present inventor created a mouse that overexpresses BMP9 and BMP10, and overexpression of BMP9 and BMP10 causes blood to accumulate in the abdominal cavity and thoracic cavity (only in the abdominal cavity in the case of BMP10), and reddening due to blood leakage in the lymph nodes It was found that this was caused. Furthermore, analysis using dyes confirmed that BMP9 overexpression enhances vascular permeability.
  • the present invention is as follows.
  • a pharmaceutical composition for treating and / or preventing cancer comprising at least one of the following (a) to (c):
  • [2] The pharmaceutical composition of [1], wherein the BMP10 protein or a functional fragment thereof is derived from human or mouse.
  • SEQ ID NO: 2 4 at least 3 1 4th to 4 2 1st, or SEQ ID NO: 2
  • a pharmaceutical composition for treating and / or preventing cancer according to [1] or [2]
  • 2 7 has at least 9 4 9th to 1 2 7 5th base sequence, or
  • FIG. 1 shows the structure of the pPSs mBMP9 vector.
  • 5 'enhancer Mouse Ig
  • PS promoter Mouse Ig ⁇ promoter region PS
  • signal peptide PS promoter Downstream mouse Ig ⁇ signal peptide region
  • Intron Mouse Ig K signal peptide code region Intron region
  • raBMP9 mouse BMP9 gene without a unique signal peptide coding region
  • ⁇ polyA mouse Ig ⁇ polyA signal region
  • enhancer mouse Ig ⁇ 3 'enhancer region
  • Amp ampicillin resistance gene.
  • FIG. 2 shows the structure of the pUS mBMP9 KI vector in which the mouse BMP9 gene is inserted into the cloning site.
  • PS promoter Mouse Ig ⁇ promoter region PS, Signal peptide cording region: A region composed of mouse Ig ⁇ signal peptide coding region and mouse Ig K signal peptide coding region downstream of PS promoter, mBMP9 (-SP): Mouse BMP9 gene without unique signal peptide coding region, CK: Mouse Ig K gene constant region, Total CK polyA: Mouse Ig / c polyA signal region consisting of 436 bp downstream of Cc termination codon, C ⁇ polyA Partial : Mouse Ig ⁇ polyA signal region consisting of 309 bp downstream of C ⁇ termination codon, loxPV-Puro : Pyromycin resistance gene having loxPV sequence, which is a partial mutant sequence of loxP sequence, DT-A : Diphtheria toxin A chain gene and p
  • FIG. 3 is a diagram showing the structure, the allele structure from which drug resistance genes (loxp-neo, loxpv-puro) have been removed, and the position of a probe for Southern analysis.
  • mBMP9 (-SP): Mouse BMP9 gene without unique signal peptide coding region, Cc: Mouse Ig ⁇ gene constant region, loxpv-puro: LoxPV sequence which is a partial mutant sequence of loxP sequence at both ends Puromycin resistance gene, loxp-neo: neomycin resistance gene with loxP sequence at both ends, Ck3, probe: mBMP9 (-SP) + loxpv-puro gene introduction and loxpv-puro gene removal clone selection probe, 3 ' ⁇ -probe: Southern analysis probe for selection of clones for introduction and removal of loxp-neo, E: EcoRI restriction enzyme site.
  • FIG. 4 shows the structure of an N-terminal His-tagged mBMP9 complex recombinant expression vector.
  • Kozak Kozak sequence
  • SP mouse BMP9 specific signal sequence
  • His-tag His-tag
  • FIG. 5 is a diagram showing an SDS-PAGE electrophoresis image of silver-stained purified N-terminal His-type mBMP9 complex.
  • FIG. 6 shows the effect of N-terminal His-type mBMP9 complex on HUVEC cell proliferation.
  • FIG. 7 shows the antitumor effect of N-terminal His-type mBMP9 complex on human lung cancer (LC-6) tumor model.
  • FIG. 8 is a graph showing the antitumor effect of N-terminal His-type mBMP9 complex on human pancreatic cancer (BxPC-3) tumor model.
  • FIG. 9 shows the structure of the pPSs hBMP9 vector.
  • 5 'enhancer Mouse Ig ⁇ 5' enhancer region
  • PS promoter Mouse Ig ⁇ promoter region
  • signal peptide Mouse promoter downstream of mouse Ig ft signal peptide
  • Intron Mouse Ig ⁇ signal peptide code Intron region sandwiched between regions
  • hBMP9 (-SP) human BMP9 gene without unique signal peptide coding region
  • ⁇ polyA mouse Ig ⁇ polyA signal region
  • 3 'enhancer 3 of mouse Ig / 'Enhancer region
  • Amp Ampicillin resistance gene.
  • FIG. 10 shows the structure of the pUShBMP9 KI vector in which the human BMP9 gene has been inserted into the cloning site.
  • PS promoter Mouse Ig / c promoter region PS, Signal peptide cording region: PS promoter A region composed of a torrent mouse Ig / cyananopeptide coding region and an intron region sandwiched between mouse Ig K signal peptide coding regions , HBMP9 (-SP): human BMP9 gene without unique signal peptide coding region, CK: mouse Ig / c gene constant region, Total CK polyA: mouse Ig ⁇ polyA signal sequence consisting of 436 bp downstream of C ⁇ termination codon Region, C ⁇ polyA Partial: C ⁇ 309 bp downstream of the stop codon, mouse Ig K polyA signal region, loxPV-Puro: a part of the loxP sequence A piomycin-resistant gene with loxPV sequences at both ends, DT -A:
  • Figure 11 shows the allele structure targeted to the drug resistance gene (loxp-neo), and the allele structure targeted to the human BMP9 (-SP) + drug resistance gene (loxpv-puro) using the pUShBMP9 KI vector.
  • Drug resistance genes (loxp-neo, loxpv-puro) It is a figure which shows the position of the probe for an allele structure and Southern analysis from which was removed.
  • hBMP9 human BMP9 gene without unique signal peptide coding region
  • C ⁇ mouse Ig / c gene constant region
  • loxpv-puro loxPV sequence which is a partial mutant sequence of ⁇ sequence Puromycin resistance gene
  • loxp-neo neomycin resistance gene with ⁇ sequences at both ends
  • Ck3 'probe hBMP9 (-SP) + loxpv-puro gene introduction and loxpv-puro gene removal clone analysis probe 3 'pro-probe: Southern analysis probe for loxp-neo gene transfer and removal clone selection
  • E EcoRI restriction enzyme site.
  • Figure 12 shows the structure of the pPSs mBMPIO vector.
  • 5 'enhancer Mouse Ig / 5' enhancer region
  • PS promoter Mouse Ig ⁇ promoter region PS, signal peptideiPS promoter Downstream mouse Ig ⁇ signal peptide region
  • Intron Mouse Ig ⁇ signal peptide code region Sandwiched intron region
  • mBMP10 (-SP) mouse BMP10 gene without unique signal peptide coding region
  • / polyA mouse Ig ⁇ polyA signal region
  • 3 'enhancer 3' enhancer region of mouse Ig ⁇ Amp: Ampicillin resistance gene.
  • FIG. 13 shows the structure of the pUS mBMPIO KI vector in which the mouse BMP10 gene was inserted into the cloning site.
  • PS promoter A promoter mouse Ig K promoter region
  • PS, signal peptide cording region consists PS promoter A promoter f flow Ma 1 É1 ⁇ 2 Ig signals to Puchidokodo region and mouse Ig K signal peptidase Puchidokodo regions fin preparative port down region sandwiched in MBMP10 (-SP): Mouse BMP10 gene without a unique signal peptide coding region
  • CK Mouse Ig / gene constant region
  • Total C / c polyA Mouse Ig kappa polyA signal consisting of 436 bp downstream of CK stop codon Region
  • Partial Mouse Ig kappa polyA signal region consisting of 309 bp downstream of C c stop codon
  • loxPV- Puro Partial mutation sequence of ⁇ sequence A puromycin resistance
  • Figure 14 shows the allele structure targeted to the drug resistance gene (loxp-neo), and the allele structure targeted to the mouse BMP10 (-SP) + drug resistance gene (loxpv-puro) using the pUSmBMPIO KI vector.
  • Drug resistance gene (loxp-neo, It is a figure which shows the position of the allele structure from which loxpv-puro) was removed, and the probe for Southern analysis.
  • mBMP10 Mouse BMP10 gene without unique signal peptide coding region ,: Mouse Ig / c gene constant region, loxpv-puro: puromycin having loxPV sequence at both ends, which is a partial mutant sequence of loxP sequence Resistance gene, loxp-neo: neomycin metagene having loxP sequence at both ends, Ck3, probe: raBMPIO (-SP) + loxpv-puro gene introduction and loxpv-puro gene removal Southern analysis probe for selection, 3 ' ⁇ -probe: Southern analysis probe for selection of loxp-neo gene transfer and removal clones, E: EcoRI restriction enzyme site.
  • Figure 15 shows the structure of the pPSs hBMPIO vector.
  • 5 'enhancer Mouse Ig ⁇ 5 enhancer region
  • PS promoter Mouse Ig ⁇ promoter region
  • signal peptide Mouse Ig downstream signal coding region of PS promoter
  • Intron Mouse Ig ⁇ signal peptide code region Sandwiched intron region
  • hBMPIO (-SP) human BMP10 gene without unique signal peptide coding region
  • f polyA mouse Ig ⁇ polyA signal region
  • 3 enhancer 3 enhancer region of mouse Ig ⁇ Amp: Ampicillin resistance gene.
  • FIG. 16 shows the structure of the pUS hBMPIO KI vector in which the human BMP10 gene was inserted into the cloning site.
  • PS promoter A promoter mouse Ig kappa promoter region PS, Signal peptide cording region: PS promoter Bok flow Ma, consists Intoro emission region between the É1 ⁇ 2 Ig / c Shigunanore petit-coded region and murine Ig kappa Shidanaru Bae Puchidokodo region
  • HBMP10 (-SP) human BMP10 gene without unique signal peptide coding region, C ⁇ : mouse IgK gene constant region, Total CK polyA: mouse Ig / polyA signal consisting of 436 bp downstream of CK termination codon Region, C / c polyA Partial: mouse Ig kappa polyA signal region consisting of 309 bp downstream of C kappa termination codon, loxPV-Puro: a part of loxP sequence, a pi
  • Figure 17 shows an allele structure targeted to a drug resistance gene (loxp-neo), and an allele targeted to human BMP10 (-SP) + drug resistance gene (loxpv-puro) using the pUShBMPIO KI vector.
  • hBMP10 human BMP10 gene without unique signal peptide coding region
  • C / c mouse Ig / c gene constant region
  • loxpv-puro loxPV sequence, which is a partial mutant sequence of loxP sequence Puromycin resistance gene
  • loxp-neo neomycin metagene with loxP sequence at both ends
  • Ck3 'probe hBMPIO (-SP) + loxpv-puro gene transfer and loxpv-puro gene removal clone analysis
  • 3 'pro-probe Southern analysis probe for loxp-neo gene transfer and removal clone selection
  • E EcoRI restriction enzyme site.
  • FIG. 18 shows the structure of an N-terminal His-tagged mBMP10 complex recombinant expression vector.
  • Kozak Kozak sequence
  • SP mouse BMP10 specific signal sequence
  • His-tag His6 tag sequence
  • mBMPIO (-SP) mouse BMP10 gene without specific signal peptide coding region
  • SV40 polyA SV40 polyA signal region
  • 5 ′ neo 5 ′ region of neo resistance gene
  • P LNlV5 A vector in which a V5 tag sequence has been inserted into the pLNl vector. .
  • FIG. 19 is a diagram showing an SDS-PAGE electrophoresis image of silver-stained purified N-terminal His-type mBMPIO complex.
  • ⁇ 20 is a graph showing the BMP signal transduction activity in the ALK1-introduced HepG2 strain of the N-terminal His-type mBMPIO complex.
  • Figure 21 shows the antitumor effect of N-terminal His-type mBMPIO complex on human spleen cancer (BXPC3) fl serious tumor model.
  • Fig. 22 shows the antitumor activity of N-terminal His-type mBMPIO complex against human endometrial carcinoma (AN3CA) tumor model.
  • Figure 23 shows the antitumor activity of the N-terminal His-type mBMPIO complex against the human glioma (U87MG) tumor model.
  • the present invention relates to any of BMP10 protein, a nucleic acid encoding BMP10 protein, an expression vector containing a nucleic acid encoding BMP10 protein, or a combination thereof.
  • a pharmaceutical composition for treating and / or preventing cancer is provided.
  • BMP10 used in the present invention is known and isolated from humans, mice, rats, etc., and its sequence information is publicly available.
  • the sequence information of human or mouse-derived BMP10 is, for example, human BMP10 as an acc. Session number AF101441, NP_055297.1, ⁇ —014482.1, etc., mouse BMP10 as an acc. Session number Q9R229, NTJ339353. You can use them.
  • the BMP10 protein or the nucleic acid encoding the same is not particularly limited, but is preferably derived from human or mouse.
  • the introduced and Z or expressed genes and proteins are derived from humans. Preferably there is.
  • a pharmaceutical for treating and / or preventing cancer comprising as an active ingredient any one of the BMP10 protein of the present invention, a nucleic acid encoding the BMP10 protein, an expression vector containing a nucleic acid encoding the BMP10 protein, or a combination thereof.
  • the composition includes
  • BMP 10 protein or functional fragment thereof is included.
  • BMP10 protein is
  • BMP10 protein having a known amino acid sequence registered in B a nk etc. can be used, but preferably SEQ ID NO: 24 (mouse BMP10) or SEQ ID NO: 2
  • a BMP10 protein having the amino acid sequence shown by 8 (human BMP10), particularly preferably a BMP10 protein having the amino acid sequence shown by SEQ ID NO: 28 is used.
  • the sequences shown in SEQ ID NO: 24 and SEQ ID NO: 28 include a signal sequence and pro-region, and the pharmaceutical composition of the present invention includes at least a mature part excluding the signal sequence and pro-region. It only has to be done.
  • SEQ ID NO: 2 4 3 1 4th to 4 2 1st sequence corresponds to mature part
  • SEQ ID NO: 2 8 3 1 7th to 4 2 4th sequence corresponds to mature part To do. That is, the pharmaceutical composition of the present invention comprises a protein consisting of a sequence comprising at least the sequence of SEQ ID NO: 24 from the 3rd 4th to 421st sequence, and at least the sequence of SEQ ID NO: 28.
  • the protein includes a small number of SEQ ID NO: 24, SEQ ID NO: 28, and SEQ ID NO: 24. At least 3 1 4 to 4 2 1st, or at least 3 1 7th to 4 2 of amino acid sequence having the sequence shown in the 4th 4th sequence of 1 to several amino acids Also included are proteins having deletions, substitutions, additions or insertions and having an activity of inhibiting cancer growth.
  • the range of “1 to several” is not particularly limited, for example, 1 to 20, preferably 1 to 10, more preferably 1 to 7, more preferably 1 to 5, especially Preferably 1 to 3, one or two is one or two.
  • Such proteins include, for example, orthologs of mammalian species different from mouse.
  • the protein may be in the form of a fusion protein in which a labeled peptide is bound to the C-terminus or N-terminus of the polypeptide.
  • Typical labeled peptides include 6- to 10-residue histidine repeats (His tag), FLAG, myc peptide, GFP polypeptide, etc., but the labeled peptide is not limited to these.
  • the protein can be produced and purified using genetic engineering techniques, as is well known to those skilled in the art. That is, it is possible to incorporate the DNA encoding the protein or a fragment thereof into an appropriate vector, introduce the vector into an appropriate host cell, and express the protein.
  • the host cell known cells such as E. coli, yeast, SF9, SF21, C0S1, C0S7, CH0, HEK293 can be used.
  • the expressed protein is extracted from the culture supernatant of the host cell by known methods used for protein purification, such as ammonium sulfate salting out, precipitation separation with organic solvents (ethanol, methanol, acetone, etc.), ion exchange chromatography, isoelectricity.
  • the functional fragment of BMP10 protein that can be contained in a pharmaceutical composition means a part of BMP10 protein that retains the activity of BMP10 protein capable of inhibiting cancer growth.
  • BMP10 protein of the present invention a nucleic acid encoding the BMP10 protein
  • BMP10 A pharmaceutical composition for gene therapy includes a pharmaceutical composition for treating and / or preventing cancer comprising any of expression vectors containing a nucleic acid encoding a protein or a combination thereof as an active ingredient.
  • the gene therapy pharmaceutical composition comprises:
  • a nucleic acid encoding BMP10, an expression vector containing a nucleic acid encoding BMP10, a transformant containing a nucleic acid encoding BMP10, or a BMP10 protein, or a combination thereof can be included.
  • Nucleic acids encoding BMP10 contained in the pharmaceutical composition include mRNA and DNA, and fragments thereof. These nucleic acids can be transcribed and translated in the introduced target cells to express the BMP10 protein or a fragment thereof.
  • the mRNA can be prepared using genetic engineering techniques, as is well known to those skilled in the art. For example, it can be synthesized in vitro by chemical synthesis or a transcription system using a promoter and RNA polymerase.
  • As the DNA a DNA having a known nucleotide sequence registered in the above Genbank or the like can be used.
  • the sequences shown in SEQ ID NO: 23 (mouse BMP10) and SEQ ID NO: 27 (human BMP10) are used.
  • DNA having the sequence shown in SEQ ID NO: 27 is particularly preferable.
  • the sequences shown in SEQ ID NOs: 23 and 27 include a signal sequence and pro-region, and the pharmaceutical composition of the present invention includes at least a mature part excluding the signal sequence and pro-region. Just do it.
  • the pharmaceutical composition of the present invention comprises DNA consisting of a sequence comprising at least the 94th to 1266th sequences of SEQ ID NO: 23, and at least 9 49 of SEQ ID NO: 27.
  • 1 2 7 Contains DNA consisting of a sequence containing the 5th sequence.
  • DNA also contains at least 9 of SEQ ID NO: 2, SEQ ID NO: 2 7, and SEQ ID NO: 2 3.
  • a protein having deletion, substitution, addition or insertion of one to several nucleotides and having an activity of inhibiting cancer growth also includes DNA to be coded.
  • the range of “1 to several” is not particularly limited, but for example, 1 to 20, preferably 1 to 10, more preferably 1 7, more preferably 1 to 5, particularly preferably 1 to 3, or 1 or 2.
  • DNA includes at least 9 4 0th to 1 2 6 6th from SEQ ID NO: 2 3; SEQ ID NO: 2 7; SEQ ID NO: 2 3; or at least 9 4 from 9th to 1 2 7
  • DNA that encodes a protein that hybridizes under stringent conditions with DNA consisting of a sequence complementary to the DNA consisting of the sequence shown in the fifth sequence and has the activity of inhibiting cancer growth.
  • the stringent condition means a condition where a so-called specific hybrid is formed and a non-specific hybrid is not formed.
  • the sodium concentration is 10 mM to 300 mM, preferably It is 20-100 mM and the temperature is 25 ° C-70 ° (: preferably 42 ° C-55 ° C.
  • DNA includes SEQ ID NO: 2 3, SEQ ID NO: 2 7, SEQ ID NO: 2 3 at least 9 4 0th to 1 2 6 6th, or at least 9 4 9th power of SEQ ID NO: 2 7, etc. 1 2 7 5th sequence and BLAST (Basic Local Alignment Search Tool at the National Center for Biological Information (e.g., the US National Biological Information Center Basic Local Alignment Search Tool), etc. (for example, default, ie, default parameters), 80% or more, more preferably 90 % Or more, most preferably 95% or more
  • the base sequence having homology and also includes a DNA encoding a protein having the activity of inhibiting the growth of cancer.
  • Such DNA includes, for example, DNA encoding orthologs of mammalian species different from mice and humans.
  • the nucleic acid fragment encoding BMP10 contained in the pharmaceutical composition means a nucleic acid encoding a fragment that retains the activity of BMP10 protein capable of inhibiting cancer growth.
  • Methods for introducing nucleic acid into a subject include a method using a viral vector and a method using a non-viral vector, and various methods are known (separate volume experimental medicine, basic technology of gene therapy, Yodosha, 1996; separate volume) Experimental Medicine, Gene Transfer & Expression Analysis Experiment Method, Yodosha, 1997; edited by the Japanese Society of Gene Therapy, Gene Therapy Development Research Handpook, NTS, 1999).
  • Typical viral vectors for gene transfer are methods using viral vectors such as adenovirus, adeno-associated virus, and retrovirus.
  • Detoxified retrovirus Herpes virus, vaccinia quinoles, box virus, polio violet, cinbis violet
  • a gene into a cell by introducing the gene of interest into a DNA virus or RNA virus such as Sendai virus, SV40, or immunodeficiency virus (HIV) and infecting the cell with a recombinant virus. is there.
  • a DNA virus or RNA virus such as Sendai virus, SV40, or immunodeficiency virus (HIV)
  • the expression vector is linked to an appropriate vector using a genetic engineering technique well known to those skilled in the art so that the DNA encoding BMP10 or a fragment thereof can function with a promoter and Z or other regulatory sequences. Then, it can be made by inserting. “Functionally linked and inserted” means that the BMP10 protein is expressed under the control of the promoter and other regulatory sequences in the cell into which the expression vector has been introduced. It also means that other control sequences are linked and incorporated into the vector.
  • the nucleic acid can be once introduced into an appropriate host cell using the above method, and the transformant can be transplanted into a subject.
  • the origin of the host cell may be any of auto (auto), allogeneic (al io), and xeno.
  • auto auto
  • allogeneic al io
  • xeno xeno
  • Heterogeneous sources include pig monkeys and other mammals.
  • the pharmaceutical composition used for the above gene therapy can deliver BMP10 to a subject by various administration methods used in the field of gene therapy.
  • the effectiveness of such gene therapy includes, for example, hepatocyte growth factor (HGF; Dai et al., J. Am. Soc. Nephrol. 15: 2637-2647, 2004), erythropoietin (EPO; Rivera et al., Blood, 105: 1424-1430, 2004).
  • HGF hepatocyte growth factor
  • EPO erythropoietin
  • the nucleic acid or expression vector may be administered directly to the subject (in V ivo method), or introduced into cells collected from the subject and selected for transformed cells that express the desired BMP10.
  • the cells may be administered to the subject (ex V i V o method).
  • Gene delivery mechanisms that can be used to administer the expression vector to the tissue or cell of interest include colloidal dispersion systems, liposome-derived systems, artificial virus envelopes, and the like.
  • the delivery system can utilize macromolecular complexes, nanocapsules, microspheres, beads, oil-in-water emulsions, micelles, mixed micelles, ribosomes, and the like.
  • Direct administration of nucleic acid or expression vector can be, for example, intravenous injection (including infusion), intramuscular injection, intraperitoneal It can be performed by injection, subcutaneous injection or the like.
  • cell transfer (transformation) of an expression vector can be performed using a general gene transfer method such as the calcium phosphate method, the DEAE dextran method, the electroporation method, or the lipofection method. it can.
  • the amount of nucleic acid, expression vector or transformant to be used varies depending on the route of administration, the number of administrations, and the type of subject, but can be appropriately determined using a method routine in this technical field. '
  • Solid cancer is mentioned as cancer which can be treated using the pharmaceutical composition of this invention.
  • Solid cancer means tumor cells that grow as multicellular mass supported by blood vessels, such as oral cancer, colon cancer, colorectal cancer, lung cancer, breast cancer, brain tumor, melanoma, renal cell cancer, stomach cancer, Knee cancer, cervical cancer, endometrial cancer, ovarian cancer, esophageal cancer, liver cancer, squamous cell carcinoma of the head and neck, skin cancer, bladder cancer, urinary tract cancer, prostate cancer, choriocarcinoma, pharyngeal cancer, laryngeal cancer , Sarcoma, male embryo, endometrial hyperplasia, endometriosis, embryonal, fibrosarcoma, force positive sarcoma, hemangioma, cavernous hemangioma, hemangioblastoma, retinoblastoma, star Sarcomatomas, neurofibromas, rare process atheromas, medulloblasto
  • the pharmaceutical composition of the present invention can be directly administered to cancer by injection and Z or transplantation, and can also be administered orally or parenterally (for example, intravenous administration, intraarterial administration, local administration by injection). Administration to the abdominal cavity or thoracic cavity, subcutaneous administration, intramuscular administration, sublingual administration, percutaneous absorption or rectal administration, etc.).
  • a transformant when included as a component of the pharmaceutical composition, it is also possible to fill the cells with a suitable carrier such as atelocollagen gel and inject locally.
  • Excipients include, for example, lactose, fructose, glucose, corn starch, sonorebit and crystalline cellulose, sterile water, ethanol, glycerol, physiological saline, buffer solution, etc.
  • disintegrants include, for example, starch, sodium alginate, Gelatin, calcium carbonate, calcium citrate, dextrin, magnesium carbonate, and synthetic magnesium silicate include binders such as methylcellulose or its salts, ethylsenolose, gum arabic, gelatin, hydroxypropylcellulose And lubricants such as talc, magnesium stearate, polyethylene glycol and hydrogenated vegetable oil, and stabilizers such as arginine, histidine, lysine, and methioni.
  • amino acids such as amino acid, human serum albumin, gelatin, dextran 40, methinoresenorelose, sodium sulfite, sodium metasulfite, and other additives include syrup, petrolatum, glycerin, ethanol , Propylene glycol, citrate, sodium chloride, sodium nitrite and sodium phosphate.
  • known immunosuppressive agents such as cyclosporine, acrolimus hydrate, cyclophosphamide, azathioprine, mizoribine, and methotrexate may be used.
  • BMP10 contained in the pharmaceutical composition of the present invention may vary depending on factors such as the patient's age, weight, and severity of the disease, but mRNA, expression vector, and protein are 0. In the case of a transformant, an amount appropriately selected from the range of about 10 2 cells to about 10 9 cells can be included.
  • the gene contained in the pharmaceutical composition and the gene delivery to the target tissue or cell of the expression vector can use various administration methods used in the field of gene therapy.
  • colloid dispersion systems ribosome induction systems, artificial virus envelopes, macromolecular complexes, nanocapsules, microspheres, beads, oil-in-water emulsions, micelles, mixed micelles, ribosomes, etc.
  • the calcium phosphate method, DEAE dextran method, calcium chloride, rubidium chloride method, electoporation method, electroporation injection method, ribofusion method, gene gun method, etc. can be used. It is.
  • the present invention further includes a method for treating cancer using the pharmaceutical composition of the present invention.
  • Cancers that can be treated by the method include solid cancers as defined above.
  • Another object of the present invention is to provide a B cell-specific expression knock-in chimeric mouse for analyzing the in vivo function of BMP10 and a method for producing the same.
  • Kakitani et al. As a method for efficiently analyzing in vivo functions of secreted proteins with unknown functions, Kakitani et al. (Kakitani, M., et al., Nucleic Acids Res., 33, e85 (2005)) are the following (i) to (iii) A method for producing a genetically modified mouse comprising the steps of (I) A mouse ES cell in which a foreign cDNA expression unit linked to an Ig ⁇ promoter is inserted into the downstream region of the immunoglobulin ⁇ chain gene by homologous recombination (knock-in) is prepared.
  • a chimeric mouse is prepared by injecting a genetically modified mouse ES cell into an embryo of a functional B cell and an immune globulin heavy chain knockout mouse deficient in antibody-producing ability.
  • the B cells of the obtained chimeric mice are derived from the genetically modified ES cells that were all injected regardless of the color ratio of the hair color.
  • the protein encoded by the knocked-in foreign cDNA is secreted from knock-in (K I) chimeric mouse B cells, but the expression level does not depend on the chimera rate for the above reasons.
  • R-spondin 1 protein was found to have strong intestinal epithelial growth-promoting activity, and this system functions as a secretory factor It proved to be very useful for evaluation.
  • a method for producing a BMP10 knock-in chimeric mouse according to the present invention is described by Kakitani et al. (Kakitani,
  • the secretory signal sequence of BMP10 is replaced with the secretory signal sequence of the mouse Ig ⁇ gene.
  • the region from the N-terminal to the 21st dalysin of human BMP10 protein, or when knocking in mouse BMP10, the N-terminal of mouse BMP10 protein It is preferable to replace the region from 2 to the first darsine.
  • Human or mouse BMP10 knock ink Mera mice and control chimera mice prepared using ES cells that did not contain foreign cDNA expression units As described in the report of Kajitani et al.
  • Example 33 of this specification as a phenotype specific to mouse BMP10 knock-in chimera mice, ascites, lymphoid tissue, small intestine and knees were observed to be red due to bleeding as compared to control chimera mice. It was shown to be very similar to the phenotype observed in human BMP9 and mouse BMP9 knock-in chimeric mice. In addition, in Example 34, increased vascular permeability was observed in mouse BMP10 knock-in chimeric mice compared to control chimeric mice, which was very similar to the phenotype observed in mouse BMP9 knock-in chimeric mice.
  • a knock-in vector for specifically expressing BMP10 in mouse B cells.
  • a knock-in vector includes a nucleic acid encoding BMP10 and a transcriptional regulatory sequence that directs expression in B cells.
  • a transcriptional regulatory sequence that directs expression in B cells any sequence known to those skilled in the art can be used.
  • a B cell-specific promoter an immunoglobulin (I g) gene (c chain gene)
  • I g immunoglobulin
  • the BMP 10 knock-in mouse can be produced, for example, according to an established method (Shinichi Aizawa, Biomanual Series 8, Gene Targeting, Yodosha, 1995). Specifically, a BMP10 knock-in vector (nucleic acid construct) is introduced into a mouse embryonic stem (ES) cell, and this is inserted into a host embryo (preferably B cell-deficient strain embryo) embryo placental cyst or 8-cell stage embryo into a capillary tube. Inject using etc. Embryo placental vesicles or 8-cell embryos can be transplanted directly into the oviduct of a homozygous foster parent non-human animal or cultured for one day.
  • ES mouse embryonic stem
  • mBMP9 (-SP) FW: AAGCCGCTGCAGAACTGGGAACAAG (SEQ ID NO: 1)
  • mBMP9 (-SP) RV TTGGCCGGCCCTACCTACACCCACACTCAGCCACA (SEQ ID NO: 2): The underlined portion indicates the Fsel site.
  • the PCR-amplified fragment was enzymatically digested with Fsel (New England Biolab Japan Co., Ltd.), and the enzyme-treated fragment was recovered using the QIAquick PCR Purification Kit (Qiagen, Japan) according to the package insert.
  • SEQ ID NO: 3 The amino acid sequence encoded by SEQ ID NO: 3 (428 amino acids, SEQ ID NO: 4) is shown below.
  • Example 1 After digestion with Sfol and Fsel, the ends are digested with E. coli-derived alphophosphatase The DNA fragment prepared in Example 1 was inserted into the dephosphorylated product and then introduced into DH5a. DNA was prepared from the obtained transformant, and the base sequence of the ligated portion was confirmed to obtain the pPSs mBMP9 vector (Fig. 1).
  • Example 4 3-1 The pCk loxPV AP prepared in 1 was enzymatically digested with Pacl and Fsel and then terminally dephosphorylated using Escherichia coli C75-derived alphophosphatase.
  • the pPSs mBMP9 vector of Example 2 above was enzymatically digested with Pacl and Fsel, and an approximately 2 kb fragment separated and recovered from 0.8% agarose gel was inserted. STRATAGENE). DNA was prepared from the obtained transformant, the base sequence of the ligation part was confirmed, and the pUSmBMP9 KI vector (FIG. 2) was obtained.
  • mouse BMP9 signal sequence is replaced with the mouse Ig K signal sequence (indicated by underline) containing the intron region) 1522 bp containing the mouse BMP9 pro body sequence, SEQ ID NO: 5
  • amino acid sequence encoded by the cDNA 426 amino acids, the boxed portion indicates the mouse Ig K signal sequence, SEQ ID NO: 6
  • Mouse Ig ⁇ signal sequence information including intron region was obtained from UCSC mouse genome database based on MUSIGKVRl (accession number K02159) obtained from GenBank.
  • Example 5 pUSmBMP9 KI vector and RS element targeting 'Acquiring PLmBMP9 mouse ES cell line using mouse ES cell line
  • a line was obtained with the restriction enzyme Notl (Takara Bio Inc., Japan) according to the method shown in Example 4.
  • the pUSmBMP9 KI shaped vector was introduced into RS element 'targeting mouse ES cells.
  • RS element 'targeting' mouse ES cells were obtained by the method described in Example 10 of WO 2006/78072 pamphlet.
  • RS element targeting 'Mouse ES cells were cultured according to known methods (Shinichi Aizawa, supra). Feeder cells were treated with mitomycin C (Sigma Aldritch Japan, Japan). Purchased from Invitrogen, Japan). First, the grown RS element 'targeting' mouse ES cells are trypsinized and suspended in HBS to 3 ⁇ 10 7 Zml, and then 0.5 ml of the cell suspension is added to the lO ⁇ g vector. It was mixed with DNA and subjected to electrification with Gene Pulcer cuvette (electrode distance: 0.4 cm, Japan Bio-Rad Laboratories Co., Ltd.) (capacity: 960 // F, voltage: 250 V, room temperature). ).
  • genomic DNA was prepared from 10 6 to 10 7 cells using Puregene DNA Isolation Kits (Qiagen, Japan). These pure mouth metamorphic RS elements' targeting mouse ES cell genomic DNA was digested with the restriction enzyme EcoRI (Takara Bio Inc., Japan) and separated by agarose gel electrophoresis. Subsequently, Southern blotting was performed, and the 3 ′ end DNA fragment of the Ig light chain J / -CK genomic DNA used in the invention described in WO 00/00383 (see Example 48) ( Xhol to EcoRI, about 1.4 kb, International Publication No.
  • WO 00/10383 brochure Figure 5 Homologous recombinants were detected using Ck 3 'probe as a probe. Wild-type RS element 'Targeting' Mouse ES cells detected one band by EcoRI digestion. In the homologous recombinant, a new band is expected to appear in addition to this band (Fig. 3). This new band was confirmed in the force puromycin resistant strain. That is, in these clones, mouse BMP9-CDNA was inserted downstream of the immune globulin kappa chain gene of one allele.
  • Example 6 Acquisition of USmBMP9 mouse ES cell line from which drug resistance gene was removed from PLmBMP9 mouse ES cell line
  • PLmBMP9 murine ES cell lines than two drug resistance genes (Puro r, Neo r) for USmBMP9 transgenic ES cell lines acquired removing the, pCAGGS- Cre vector (Sunaga et al., Mol Reprod Dev, 46:. 109-113 , 1997) was introduced into PLmBMP9 mouse ES cells in accordance with established methods (Shinichi Aizawa, Bioman Yuanore Series 8, Gene Targeting, Yodosha, 1995).
  • PLmBMP9 mouse ES cells were cultured in accordance with known methods (Shinichi Aizawa, supra). Feeder cells were treated with mitomycin C (Sigma-Aldrich Japan, Japan) G418-resistant primary cultured cells (Invitrogen, Japan) Purchased from the company). First, the expanded PLmBMP9 mouse ES cells were treated with trypsin, and 3 X 10 7 Suspend in HBS so that there are 0.5 ml / ml, mix 0.5 ml of the cell suspension with 10 g of vector and DNA, and use a gene pulser tube (electrode distance: 0.4 cm, Japan Biotechnology). 'Elect mouth porcelain was performed at Raddora Bora Tories Co., Ltd. (capacity:
  • Example 7 Production of USmBMP9 KI chimeric mouse using USmBMP9 mouse ES cell line and B lymphocyte-deficient mouse strain-derived host embryo
  • the USmBMP9 mouse ES cell line obtained in Example 6 above and confirmed to have mouse BMP9-CDNA inserted downstream of the immunoglobulin / chain gene was established from a frozen stock, and these were converted to the above immunoglobulin ⁇ chain.
  • 8-10 embryos were injected into each 8-cell embryo obtained by mating male and female mice homozygous for knockout mice.
  • ES medium Shinichi Aizawa, Biomanual Series 8, Gene Targeting, Yodosha, 1995
  • ICR pseudopregnancy MCH
  • Example 1 Chimeric mice prepared according to the method described in 1 were phenotypic analysis experiments of USmBMP9 KI chimeric mice performed in Example 9 below, and Evans of Example 10 It was used as a control chimera individual in the vascular permeability test of USmBMP9 KI chimeric mice using blue.
  • Necropsy of 7 USmBMP9KI chimeric mice was performed at 7 weeks at 3 weeks, 9 at 4 weeks, and 6 at 5 weeks. As a result, red pleural effusion was observed in 1 individual at 3 weeks of age and all individuals at 4 weeks and 5 weeks of age.
  • Necropsy of 7 USmBMP9KI chimeric mice was performed at 7 weeks at 3 weeks, 9 at 4 weeks, and 6 at 5 weeks. As a result, mesenteric lymph node redness was observed in all individuals from 3 weeks to 5 weeks of age.
  • Necropsy of 7 USmBMP9KI chimeric mice was performed at 7 weeks at 3 weeks, 9 at 4 weeks, and 6 at 5 weeks. As a result, reddening of the submandibular lymph nodes was observed in all individuals from 3 weeks to 5 weeks of age.
  • Necropsy of 7 USmBMP9 KI chimeric mice was performed at 7 weeks at 3 weeks, 9 at 4 weeks, and 6 at 5 weeks. As a result, redness of the inguinal lymph nodes was observed in all individuals from 3 weeks to 5 weeks of age.
  • Necropsy of 7 USmBMP9 KI chimeric mice was performed at 7 weeks at 3 weeks, 9 at 4 weeks, and 6 at 5 weeks. As a result, all three-week-old individuals, eight at four-week-old, and all five-week-old individuals showed reddening of popliteal lymph nodes.
  • Necropsy of 7 USmBMP9 KI chimeric mice was performed at 7 weeks at 3 weeks, 9 at 4 weeks, and 6 at 5 weeks.
  • 5 individuals at 3 weeks of age, and all individuals at 4 weeks and 5 weeks of age had red spots or red spots on part of the surface of the small intestine.
  • Necropsy of 7 USmBMP9 KI chimeric mice was performed at 7 weeks at 3 weeks, 9 at 4 weeks, and 6 at 5 weeks.
  • 2 individuals at 3 weeks of age, 5 individuals at 4 weeks of age, and 4 individuals at 5 weeks of age showed redness on part of the spleen surface.
  • Intra-sinus red blood cells are characteristically observed in USmBMP9 KI chimeric mice, as observed using H & E-stained pathological sections of mesenteric and inguinal lymph nodes derived from 3-week-old control chimeric mice and USmBMP9 KI chimeric mice. It was. Sinus erythrocytes are images suggesting blood absorption through the lymphatics, indicating the possibility of hemorrhagic changes in the surrounding area. However, no obvious bleeding lesion was observed in the macroscopic / histological findings, suggesting the possibility of microhemorrhages such as leakage of erythrocytes outside the blood vessels.
  • Example 10 Vascular permeability test of USmBMP9 KI chimeric mice
  • Example 1 Expression and preparation of recombinant N-terminal His-type mBMP9 complex
  • V5S 5'- GATCC GCTA6C GTCGAC G8TAAGCCTATCCCTAACCCTCTCCTC88TCTCGATTCTAC8 GA C-3 '(K «number 7)
  • V5AS 3'- G CGATCG CAGCT6 CCATTCeGATA66GAnGGGAGA6aAGCCAGA6CTAAGATGC ACT BAGCT-6'
  • the synthetic oligo DNA was introduced into the BamHI-XhoI site on the pLNl vector described in the report of Kakeda et al. (Gene Ther. 12: 852-856, 2005) to construct a pLNlV5 vector.
  • mBMP9 5HisFw CATCATCACCATCACCAT AAGCCGCTGCAGAACTGGGAA
  • mBMP9SalIRv ACGCGTCGACCTACCTACACCCACACTCAG
  • the obtained 1249 bp amplified fragment was separated and recovered on a 0.8% gel.
  • QIAquick Gel Extraction Kit Qiagen, Japan
  • the amplified fragment (His mBMP9 Sai l) was recovered according to the package insert used. Add the DNA amplification fragments (NhelHis mBMP9) and (His mBMP9 Sail) obtained in the above two PCRs to PrimeSTAR buffer to a total volume of 100 / x1, heat to 100 ° C for 10 minutes, and then return to room temperature. Annealed the Hi s tag region.
  • SEQ ID NOs: 9 and 12 and 10 pmol of each of the two primers, Prime STAR HS DNA Polymerase (Takara Bio Inc., Japan) were added, and the extension reaction was performed at 72 ° C for 3 minutes, and then at 98 ° C 10 Second, 57 ° C for 5 seconds, and 72 ° C for 1 minute and 20 seconds for 20 cycles. Finally, after incubation at 72 ° C for 3 minutes, the 1332 bp amplified fragment was separated on a 0.8% gel. It was collected. The amplified fragment was recovered from the recovered gel using QIAquick Gel Extraction Kit (Qiagen, Japan) according to the package insert.
  • QIAquick Gel Extraction Kit Qiagen, Japan
  • Example 1 1 1 1 1 1 The PCR-amplified fragments recovered in 2 were enzymatically digested with Nhel and Sail (Nipponguchi Shu-Diagnotics Co., Ltd.), and separated and recovered on a 0.8% agarose gel. Using the QIAquick Gel Extraction Extraction Kit (Qiagen, Japan), the enzyme-treated fragments were recovered from the recovered gel according to the package insert. The obtained enzyme-treated fragment was introduced into the Nhel 'Sail site of the PLN1V5 vector prepared in Example 1 1-1-1, and an N-terminal His-type mBMP9 complex recombinant expression vector (FIG. 4) was constructed.
  • amino acid sequence including the polynucleotide sequence from the start codon to the stop codon of the N-terminal His-type mBMP9 complex recombinant cDNA (1305 bp, SEQ ID NO: 13), and the signal sequence of ⁇ 1 ⁇ 9 encoded by the cDNA (434 amino acids, SEQ ID NO: 14).
  • the underlined portion indicates the signal sequence portion of mouse BMP9
  • the box indicates the histidine tag portion
  • the italic body indicates the mouse BMP9 pro body portion.
  • SEQ ID NO: 1 4 (including mBMP9 signal sequence (underlined part))
  • Example 1 1 1 1 The N-terminal His-type mBMP9 complex recombinant expression vector obtained in 3. was introduced into E. coli DH5a, and DNA was purified from the resulting transformant using a plasmid purification kit (Qiagen plasmid Maxi kit; Qiagen, Japan).
  • a plasmid purification kit Qiagen plasmid Maxi kit; Qiagen, Japan.
  • the Free style 293F cells use the (Japan Invitrogen Ltd.) Free style 293 Expression Medium (Japan Invitrogen Corporation) Rere, 37 ° C, 5% C0 2, 125 rpm conditions, cell density from IxlO 5 3xl0 6 Incubate within the range of cells / ml.
  • 0pti_MEM I Reduced Serum Medium Invitrogen, Japan
  • Opti-MEM I Reduced Serum Medium was added and incubated at room temperature for 5 minutes each.
  • the two solutions were mixed and incubated for another 20-30 minutes at room temperature. Thereafter, the expression vector treated by the above method was added to a medium containing 1 ⁇ 10 9 cells / L of Free style 293F cells and cultured for 3 days.
  • the target protein was recovered by adding 50 ml of PBS containing Imidazole.
  • AKTAexplorerlOs (GE Healthcare Bioscience, Japan) was used for the separation and purification operation. Endotoxin removal treatment was performed before use. 1 1 1 3— 3. Ion exchange chromatography
  • Example 1 Obtained in Example 1 1 1 3-2 on a strong anion exchange column equilibrated with PBS (Hi Trap Q HP 1 mL; GE Healthcare Biosciences, Japan) under a flow rate of lmL / min The target protein was added. The force ram was sequentially washed with 10 ml of PBS containing 15 ml of PBS and 80 mM NaCl. After completion of the washing operation, 20 ml of PBS containing lOOmMNaCl and 25 ml of PBS containing 140 mMNaCl were sequentially applied to the column to recover the target protein. AKTAexplorerlOs (GE Healthcare Bioscience Co., Ltd., Japan) was used for the separation and purification operation. Endotoxin removal treatment was performed before use.
  • PBS His Trap Q HP 1 mL; GE Healthcare Biosciences, Japan
  • Example 1 1 1 After replacing the buffer in the purified sample obtained in 3-3 with PBS using an ultrafiltration membrane VIVASPIN20 10,000 MWC0 PES (Sartorius Japan, Japan), sample was concentrated. After the concentration operation, it was filtered through a 0.22 / m filter (Millex GV; Japan Millipore, Japan). The operation was performed in a clean bench whenever possible. Example 1 All steps performed in 1-3 were carried out in a low greenhouse (+ 4 ° C) or on ice, except for work in a clean bench.
  • Example 1 Activity measurement of N-terminal His-type mBMP9 complex in vitro (Invitro test)
  • a cell line into which a reporter plasmid capable of detecting a BMP signal was stably introduced was used.
  • a reporter plasmid (p (GCCG) 12-Luc / neo) capable of detecting BMP signals was used as a hepatoma cell line, HepG2 (ATCC).
  • the gene was introduced into a stable introduction strain HepG2 (38-5).
  • Plasmid (p (GCCG) 12-Luc / neo) was prepared according to the method described by Kusanagi et al. In Mol. Biol. Cell., 2000, 11 (2): 555-65.
  • luciferase activity For the measurement of luciferase activity, a solution containing various concentrations of BMP9 was added to this cell line and incubated for 5 hours, and then a chemiluminescence reagent (Steady Glo TM Luciferase assay system, available from Promega Corporation, Japan) was used. Carried out.
  • a chemiluminescence reagent (Steady Glo TM Luciferase assay system, available from Promega Corporation, Japan) was used. Carried out.
  • Example 13 Effect of N-terminal His-type mBMP9 complex on proliferation of human cord blood vein endothelial cells (HUVEC)
  • HUVEC cells obtained from BioWhittaker In, USA
  • medium containing 2% FBS, hFGF-B, VGEF, hEGF, GA-1000, Hydrocortisone, Ascorbic Acid, Heparin, R3-IGF-1 (EBM-2+ Complete Supplement Mix)
  • 100 1 seeds were seeded at a rate of 3 1.2 xlO per lwell of a 96-well plate.
  • the medium was changed to 100 ⁇ l of a growth medium containing various concentrations of N-terminal His-type mBMP9 complex, and the culture was continued at 37 ° C for 2 days.
  • Example 14 Antitumor activity of N-terminal His-type mBMP9 complex against human lung cancer (LC-6) tumor model
  • the tumor model is a block of approximately 2 mm square of a tumor block of human lung cancer cell LC-6 (distributed from Japan Central Laboratory for Experimental Animals) under physiological saline (Otsuka Pharmaceutical Co., Ltd., Japan).
  • LC-6 human lung cancer cell
  • physiological saline Otsuka Pharmaceutical Co., Ltd., Japan
  • the nude mouse BALB-nu / nu: Japan Japan Chiarus Co., Ltd. Company
  • transplanted subcutaneously on the right ventral side When the tumor volume in the transplanted mice reached about 10 mm 3 , grouping was performed using a general-purpose grouping software (Visions, Japan) (5 animals per group). The day of grouping was defined as Dayl of administration start.
  • the administered BMP9 protein was prepared by using N-terminal His-type mBMP9 complex in PBS at protein concentrations of 15, 50 and 150 ⁇ g / mL, and 200 / L was administered to each individual via the tail vein.
  • PBS solution containing Endotoxin (Nihon Seikagaku Corporation) in the same dose as 15 ( ⁇ g / mL BMP9 solution in the highest dose group) was prepared and administered. Incidentally, their administration, three times a week, for 2 weeks were conducted.
  • RTV relative tumor volume
  • ⁇ RTV X tumor volume on day X I, tumor volume on day 1 of administration (Dayl)>.
  • ITG % Inhibition of Tumor Growth
  • the mouse BMP9 complex with N-terminal His tag sequence has a dose-dependent and significant difference in the tumor growth of LC-6 from the dose of 10 ⁇ g / head. (Fig. 7).
  • Example 15 Antitumor activity of N-terminal His-type mBMP9 complex against human pancreatic cancer (BxPC-3) tumor model
  • the tumor model was 100 ⁇ l of nude mouse (BALB-nu / nu: Japan Japan Chiarusu) containing 4xl0 6 human pancreatic cancer cell lines BxPC-3 (purchased from ATCC) per 100/1. ⁇ Rivaichi Co., Ltd.) was implanted subcutaneously on the right ventral side. For cultivation of BxPC-3, 10 ° /. RPMI medium containing FBS was used.
  • the administered BMP9 protein was prepared by using N-terminal His-type mBMP9 complex in PBS at a protein concentration of 15, 50, 150 / g / mL at the time of administration, and 200 // L was administered to each individual in the tail vein.
  • the highest dose group of 150 A PBS solution containing Endotoxin (Nippon Seikagaku Corporation) in the same amount as Endotoxin contained in a BMP9 solution of ⁇ g / mL was prepared and administered.
  • the mouse BMP9 complex (N-terminal His-type mBMP9 complex) with His tag sequence at the N-terminus has a dose-dependent and significantly different tumor growth of BxPC-3 than the dose of 10 ⁇ g / head. Suppression was confirmed (Fig. 8).
  • hBMP9 (-SP) FW: AAGCCACTGCAGAGCTGGGGACGAG (SEQ ID NO: 15)
  • hBMP9 (-SP) RV TTGGCCGGCCCTACCTGCACCCACACTCTGCCACG (SEQ ID NO: 16): The underlined portion indicates the Fsel site.
  • the amplified fragment was recovered from the recovered gel using QIAquick Gel Extraction Kit (Qiagen, Japan) according to the package insert.
  • the collected PCR amplified fragments are quenched with Fsel (Japan's New England Biolabs Japan Co., Ltd.) and then treated with QIAquick PCR Purification Kit (Qiagen, Japan) according to the package insert.
  • Fsel Japan's New England Biolabs Japan Co., Ltd.
  • QIAquick PCR Purification Kit Qiagen, Japan
  • amino acid sequence encoded by SEQ ID NO: 17 (429 amino acids, SEQ ID NO: 8) is shown below.
  • Example 1 ⁇ Construction of pPSs hBMP9 vector pPSs hBMP9
  • Example 4 of International Publication W0 2006/78072 pamphlet Example 4 3-1
  • the pPSs hBMP9 vector from Example 17 above was enzymatically digested with Pacl and Fsel, and an approximately 2 kb fragment separated and recovered from a 0.8% agarose gel was inserted. Introduced. DNA was prepared from the obtained transformant, and the base sequence of the ligation part was confirmed to obtain a pUShBMP9 KI vector (FIG. 10).
  • the polynucleotide sequence from the start codon to the stop codon of the pUShBMP9 KI vector hBMP9 expression unit (the human BMP9 signal sequence is replaced with the mouse Ig K signal sequence (underlined) containing the intron region) 1525bp including human BMP9 pro sequence, SEQ ID NO: 19), and amino acid sequence encoded by the cDNA (427 amino acids, boxed portion indicates mouse IgK signal sequence, SEQ ID NO: 20)
  • the Mouse Ig ⁇ signal sequence information including intron region was obtained from UCSC mouse genome database based on MUSIGKVR1 (accession number K02159) obtained from GenBank.
  • pUShBMP9 KI betater 60 ⁇ g was added with spenolemidine added (1 mM pH7.0 Japan Sigma-Aldrich Japan Co., Ltd.) buffer (Roche Diagnostats Japan Co., Ltd., H buffer for restriction enzymes) Digest for 5 hours at 37 ° C using Notl (Takara Bio Inc., Japan). After extraction with phenol / chloroform form, add 2.5 volumes of 100% ethanol and 0.1 volumes of 3 M sodium acetate. In addition-at 20 ° C
  • RS element 'targeting' mouse ES cells were obtained by the method described in Example 10 of WO 2006/78072 pamphlet.
  • RS element / targeting / mouse ES cells were cultured in accordance with known methods (Shinichi Aizawa, supra), and feeder cells were treated with mitomycin C (Sigma Al Dortsch Japan, Japan) G418-resistant primary cultured cells ( Purchased from Japan Invitrogen Co., Ltd.).
  • mitomycin C Sigma Al Dortsch Japan, Japan
  • G418-resistant primary cultured cells Purchased from Japan Invitrogen Co., Ltd.
  • the RS element targeting mouse ES cells that have been grown are trypsinized and suspended in HBS to 3 x 10 7 cells / ml, and then 0.5 ml of the cell suspension is added to 10 xg of vector.
  • Example 21 Acquisition of UShBMP9 mouse ES cell line from which drug resistance gene was removed from PLhBMP9 mouse ES cell line
  • PLhBMP9 murine ES cell lines than two drug resistance genes (Puro r, Neo r) for UShBMP9 transgenic ES cell lines acquired removing the, pCAGGS-Cre vector (Sunaga et al., Mol Reprod Dev, 46:. 109-113 , 1997) was introduced into PLhBMP9 mouse ES cells according to established methods (Shinichi Aizawa, Biomanual Series 8, Gene Targeting, Yodosha, 1995).
  • PLhBMP9 mouse ES cells were cultured according to a known method (Shinichi Aizawa, supra), and feeder cells were mitomycin C (Sigma-Aldrich Japan, Japan). Treated G418-resistant primary cultured cells (purchased from Invitrogen, Japan) were used. First, the grown PLhBMP9 mouse ES cells are trypsinized and suspended in HBS to 3 x 10 7 ml, and then 0.5 ml of the cell suspension is added to 10 // g vector.
  • B lymphocytes In homozygotes of the immune globulin chain gene knockout, functional B lymphocytes are deficient and antibodies are not produced (Kitamura et al., Nature, 350: 423-426, 1991). Embryos obtained by mating of the homozygous male and female individuals raised in a clean environment were used as hosts for the production of chimeric mice performed in this Example. In this case, B lymphocytes that are functional in chimeric mice are mostly derived from injected ES cells. In this example, the immunoglobulin ⁇ -chain gene knockout mouse described in the report of Tomizuka et al. (Proc. Natl. Acad. Sci. USA, 97: 722-7, 2000) Company) Individuals that had been backcrossed to the strain three or more times were used for host embryo preparation.
  • the UShBMP9 mouse ES cell line obtained in Example 21 above and confirmed to have human BMP9-cDNA inserted downstream of the immunoglobulin kappa chain gene was established from a frozen stock and 8-10 embryos were injected into each 8-cell embryo obtained by mating male and female mice homozygous for immunoglobulin ⁇ chain knockout mice.
  • ES medium Shinichi Aizawa, Biomanual Series 8, Gene Targeting, Yodosha, 1995
  • ICR pseudopregnancy MCH
  • Example 2 1 UShBMP9 mouse Inji produced using ES cell line: As a result of transplanting the embryos, offspring mice were born. Chimera individuals are judged by the presence of ES cell-derived wild color (dark brown) in the white color derived from the host embryo. Among the offspring chimera mice, individuals with apparently wild-colored hair color, ie, ES cell contributions were obtained. From these results, the US hBMP9 mouse ES cell line in which human BMP9-cDNA is inserted downstream of the immunoglobulin / chain gene is chimeric. It has been shown that it retains the ability to develop, that is, retains the ability to differentiate into normal tissues of mouse individuals.
  • mBMPlO (-SP) FW AGCCCCATTATGGGCCTTGAGCAGT (SEQ ID NO: 2 1)
  • mBMPlO (-SP) RV TTGGCCGGCCCTATCTACAGCCACACTCAGACACA (SEQ ID NO: 2 2): The underlined portion indicates the Fsel site.
  • the amplified fragment was recovered from the recovered gel using QIAquick Gel Extraction Kit (Qiagen, Japan) according to the package insert.
  • the recovered PCR-amplified fragments are enzymatically digested with Fsel (Japan's New England 'Biolabs' Japan Co., Ltd.) It was collected.
  • mice BMP10 signal sequence, pro-region and mature body parts in SEQ ID NOS: 2 3 and 2 4 are shown in underlined, boxed, and italicized based on the information of GenBank accession numbers Q9R229 and AC155726. 4, respectively.
  • amino acid sequence encoded by SEQ ID NO: 23 (421 amino acids, SEQ ID NO: 24) is shown below.
  • Example 25 After digestion with Sfol and Fsel, the ends are digested with E. coli-derived alphophosphatase The DNA fragment prepared in Example 25 was inserted into the dephosphorylated product and then introduced into DH5a. DNA was prepared from the obtained transformant, the nucleotide sequence of the ligation part was confirmed, and the pPSs mBMPIO vector (Fig. 12) was obtained.
  • Example 4 of pCk loxPV ⁇ ⁇ ⁇ prepared in Example 3 was enzymatically digested with Sai l and Fsel, and then terminally dephosphorylated using Coli-derived C75-derived alkaline phosphatase.
  • the pPSs mBMPIO vector of Example 26 above was enzymatically digested with Sai l and Fsel, and an approximately 2 kb fragment separated and recovered from 0.8% agarose gel was inserted, and then the E. coli XL10-Gold Ultracompetent Cell (US STRATAGENE). DNA was prepared from the obtained transformant, and the base sequence of the ligated portion was confirmed, and the pUSmBMPIO KI vector (FIG. 13) was obtained.
  • the polynucleotide sequence from the start codon to the stop codon of the pUSmBMPIO KI vector mBMPIO expression unit (the mouse BMP10 signal sequence is replaced with the mouse Ig signal sequence (underlined) containing the intron region, and the mouse is located downstream of it.
  • Mouse Ig c signal sequence information including the intron region was obtained from the UCSC mouse genome database based on MUSIGKVR1 (accession number K02159) obtained from GenBank.
  • Example 28 Preparation of pUSmBMPIO KI vector for electroporation pUSmBMPlOKI vector 60 ⁇ g, added with spermidine (1 mM pH7.0 Japan Sigma-Aldrich Japan Co., Ltd.) buffer (Roche Japan Diagnostix Co., Ltd., H buffer for restriction enzymes), Notl (Takara Bio Inc., Japan) Company) for 5 hours at 37 ° C, extracted with phenol / chloroform, 2.5 volumes of 100% ethanol, and 0.1 volume of 3 M sodium acetate, and at -20 ° C Stored for 16 hours. The vector single-stranded with Notl was collected by centrifugation, and then sterilized with 70% ethanol.
  • Example 29 pUSmBMPIO KI vector and RS element ⁇ Targeting ⁇ Acquisition of PLmBMPIO mouse ES cell line using mouse ES cell line
  • RS element / targeting / mouse ES cells were cultured in accordance with known methods (Shinichi Aizawa, supra), and feeder cells were treated with mitomycin C (Sigma Al Anlagensch Japan, Japan). Purchased from Invitrogen, Japan).
  • the RS element / targeting / mouse ES cells grown were trypsinized and suspended in HBS to 3 ⁇ 10 7 Zml, and then 0.5 ml of the cell suspension was added to 10 ⁇ g of vector DNA.
  • the mixture was mixed with and subjected to electrification with a Gene Pulcer cuvette (electrode distance: 0.4 cm, Japan Bio-Rad Laboratories Co., Ltd.) (capacity: 960 / i F, voltage: 250 V, room temperature).
  • ES medium Suspended cells from the electroporation in 10 ml of ES medium (Shinichi Aizawa, supra) and seeded with feeder cells in advance are 100 mm tissue culture plastic plates. Yale (Falcon, Japanese Dickinson Co., Ltd.) was sown on one sheet. After 36 hours, the medium was replaced with an ES medium containing 0.8 / g / ml puromycin (Sigma Aldori Tsuchi Japan Co., Ltd., Japan).
  • mouse BMP10-cDNA was inserted downstream of the immune globulin kappa chain gene of one allele.
  • Example 30 Acquisition of USmBMPIO mouse ES cell line from which drug resistance gene was removed from PLmBMPlO mouse ES cell line
  • PLmBMPlO murine ES cell lines than two drug resistance genes (Puro r, Neo r) for USmBMPIO transgenic ES cell lines acquired removing the, pCAGGS-Cre vector (Sunaga et al., Mol Reprod Dev, 46: 109- 113, 1997) was introduced into PLmBMPlO mouse ES cells according to an established method (Shinichi Aizawa, Biomanure Series 8, Gene Targeting, Yodosha, 1995).
  • PLmBMPlO mouse ES cells were cultured according to the method described (Shinichi Aizawa, supra). Feeder cells were treated with mitomycin C (Sigma-Aldrich Japan Co., Japan). G418-resistant primary cultured cells (Invitrogen, Japan) Purchase from company) was used. First, the expanded PLmBMPI O mouse ES cells were trypsinized, and 3 X
  • Genomic DNA was prepared from 10 6 to 10 7 cells by Puregene DNA Isolation Kits (Qiagen, Japan). These mouse ES cell genomic DNAs were digested with the restriction enzyme EcoRI (Takara Bio Inc., Japan) and separated by agarose gel electrophoresis. Subsequently, a Southern blot was performed, and the 3 ′ end DNA fragment (XhoI to EcoRI, Ig light chain J / c-CK genomic DNA used in the invention described in WO 00/10383 pamphlet (see Example 48) was used. about
  • Example 31 Production of USmBMPlO KI chimeric mouse using USmBMPlO mouse ES cell line and host embryo derived from B lymphocyte-deficient mouse strain
  • Example 3 2 Preparation of a control mouth chimeric mouse
  • Example 1 of International Publication No. W0 2006/78072 Pamphlet Example 1 Chimeric mice prepared according to the method described in 1 were subjected to phenotyping analysis of USmBMPlO KI chimeric mice conducted in Example 3 3 below, and Example 3 4 It was used as a control chimera individual in the vascular permeability test of USmBMPlO KI chimera mice using Evans Blue.
  • Example 33 Phenotypic analysis of USmBMPlO KI chimeric mice
  • Necropsy was performed on 4 mice at 3 weeks of age and tetrameric USmBMPlO KI chimeric mice at 5 weeks of age. As a result, reddening of the submandibular lymph nodes was observed in all individuals at both 3 and 5 weeks of age.
  • mice at 3 weeks of age and 4 individuals at 5 weeks of age were subjected to autopsy of USmBMPlOKI chimeric mice.
  • 3 individuals at 3 weeks of age and 3 individuals at 5 weeks of age showed red spots or reddening on a part of the surface of the small intestine.
  • mice at 3 weeks of age and 4 individuals at 5 weeks of age were subjected to autopsy of USmBMPlOKI chimeric mice. As a result, one individual at 3 weeks of age and one individual at 5 weeks of age were found to be red.
  • Example 34 Vascular permeability test of USmBMPIO KI chimeric mice
  • hBMP-lOF (-SP): AGCCCCATCATGAACCTAGAGCAGT (SEQ ID NO: 29)
  • hBMP-lOR (KI): TTGGCCGGCCCTATCTACAGCCACATTCGGAGACG
  • the amplified fragment was recovered from the recovered gel using QIAquick Gel Extraction Kit (Qiagen, Japan) according to the package insert.
  • the recovered PCR amplified fragments are enzymatically digested with Fsel (New England Biolabs Japan Co., Ltd.), and the enzyme-treated fragments are prepared using the QIAquick PCR Purification Kit (Qiagen, Japan) according to the package insert. It was collected.
  • amino acid sequence encoded by SEQ ID NO: 27 (424 amino acids, SEQ ID NO: 28) is shown below.
  • E. coli-derived alphophosphatase After digestion with Sfol and Fsel, the ends are digested with E. coli-derived alphophosphatase After inserting the DNA fragment prepared in Example 35 into the dephosphorylated one, E. coli DH5 (introduced into the sample. DNA was prepared from the obtained transformant, and the base sequence of the ligation part was confirmed. The pPSs hBMPIO vector (Fig. 15) was obtained.
  • Example 3 7 Construction of pUShBMPIO KI vector pUShBMPIO KI
  • Example 6 Pancrete Example 4 After enzymatic digestion of pCk loxPV ⁇ ⁇ ⁇ prepared in Sail 3 with Sail and Fsel, end removal using Escherichia coli C75-derived Alf phosphatase
  • the pPSs hBMPIO vector of Example 36 described above was enzymatically digested with Sai l and Fsel into the phosphorylated product, and an approximately 2 kb fragment separated and recovered from 0.8% agarose gel was inserted. Installed in Gold Ultracompetent Cels (STRATAGENE, USA). DNA was prepared from the obtained transformant, the base sequence of the ligation part was confirmed, and the pUShBMPIO KI vector (FIG. 16) was obtained.
  • the polynucleotide sequence from the start codon to the stop codon of the hBMPIO expression unit in the pUShBMPIO KI vector (the human BMP10 signal sequence was replaced with the mouse Ig / c signal sequence [underlined portion] containing the intron region) 1504 bp containing human BMP 10 pro body sequence downstream, SEQ ID NO: 3 1), and amino acid sequence encoded by the cDNA (420 amino acids, boxed portion indicates mouse Ig / c signal sequence, SEQ ID NO: 3 2) is shown.
  • Mouse Ig c signal sequence information including the intron region was obtained from the UCSC mouse genome database based on MUSIGKVR1 (accession number K02159) obtained from GenBank.
  • Example 3 8 Preparation of pUShBMPIO KI vector for electroporation
  • pUShBMPlOKI vector g was used in a spermidine-supplemented buffer (1 mM pH7.0 Japan Sigma Aldrich Japan Co., Ltd.) buffer (Roche Japan Diagnostix Co., Ltd., H buffer for restriction enzymes), Notl (Takara Bio Inc., Japan) Company) for 5 hours at 37 ° C, extracted with phenol / chloroform, 2.5 volumes of 100% ethanol, and 0.1 volume of 3 M sodium acetate, at _20 ° C
  • a PLhBMPlO mouse ES cell line in which human BMPlO-cDNA was inserted downstream of the immunoglobulin kappa light chain gene by homologous recombination the restriction enzyme Notl (Takara Bio Inc., Japan) was obtained according to the method described in Example 38.
  • the RS element 'targeting' mouse according to the method established by the company pUShBMPIO KI vector (Shinichi Aizawa, BioManual Series 8, Gene Targeting, Yodosha, 1995) It was introduced into ES cells.
  • RS element 'targeting mouse ES cells were obtained by the method described in Example 10 of Japanese Patent Application No. 2 0 0 5-1 4 8 2 6 Panflets IV.
  • RS element targeting 'Mouse ES cells were cultured according to the method described by Shinichi Aizawa (supra), and vegetative cells were treated with mitomycin C (Sigma-Aldrich Japan, Japan). Purchased from Invitrogen, Japan). First, the RS element / targeting / mouse ES cells grown were trypsinized and suspended in HBS to 3 x 10 7 ml, and then 0.5 ml of the cell suspension was added to a 10 / g vector. The mixture was mixed with DNA and subjected to electrification with a gene pulser cuvette (electrode distance: 0.4 cm, Japan Bio-Rad Laboratories Co., Ltd.) (capacity: 960 F, voltage: 250 V, room temperature).
  • a gene pulser cuvette electronic distance: 0.4 cm, Japan Bio-Rad Laboratories Co., Ltd.
  • Electroporated cells were suspended in 10 ml of ES medium (Shinichi Aizawa, above) and seeded with feeder cells in advance. 100 mm tissue culture plastic petri dish (Falcon, Betaton Dickinson, Japan) ) Seeded on one sheet. After 36 hours, the medium was replaced with ES medium containing 0.8 / zg / ml puromycin (Sigma Aldrich Japan Co., Ltd., Japan). Pick up colonies that formed after 7 days and grow each to confluence in a 24-well plate.
  • the suspension was suspended in 2 ml of a storage medium (FBS + 10% DMS0, Sigma-Aldrich Japan Co., Ltd., Japan) and stored at -80 ° C. The remaining 1/3 is seeded on a 12-well gelatin-coated plate and cultured for 2 days. Genomic DNA from 10 6 to 10 7 cells is puregene DNA.
  • a storage medium FBS + 10% DMS0, Sigma-Aldrich Japan Co., Ltd., Japan
  • Wild-type RS element targeting 'Mouse ES cells detected a single band by EcoRI digestion. In homologous recombinants, it is expected that in addition to this band, a new band will appear at the bottom. (Fig. 17) Force This new band was confirmed in the puromycin-resistant strain. That is, in these clones, human BMPlO-cDNA was inserted downstream of the immunoglobulin ⁇ chain gene of one allele.
  • Example 40 Acquisition of UShBMPlO mouse ES cell line from which drug resistance gene was removed from PLhBMPlO mouse ES cell line
  • PLhBMPlO murine ES cell lines than two drug resistance genes (Puro r, Neo r) for UShBMPlO transgenic ES cell lines acquired removing the, pCAGGS-Cre vector (Sunaga et al., Mol Reprod Dev, 46: 109- 113, 1997) was introduced into PLhBMPlO mouse ES cells according to an established method (Shinichi Aizawa, Neuro Manual Series 8, Gene Targeting, Yodosha, 1995).
  • PLhBMPlO mouse ES cells were cultured according to the method described by Shinichi Aizawa (supra), and vegetative cells were treated with mitomycin C (Sigma Aldrich Japan Co., Ltd.) G418-resistant primary cultured cells (from Japan Invitrogen Co., Ltd.) Purchase).
  • the grown PLhBMPlO mouse ES cells are trypsinized and suspended in HBS to 3 x 10 7 cells / ml, and then 0.5 ml of the cell suspension is mixed with 10 x g of vector DNA. Electroporation was performed with Gene Pulser Cuvette (Electrode distance: 0.4 cm, Japan Bio. Rad Laboratories Co., Ltd.) (Capacity:
  • genomic DNA was prepared from 10 6 to 10 7 cells by Puregene DNA Isolation Kits (Qiagen, Japan). These mouse ES cell genomic DNA was converted to restriction enzyme EcoRI (Taka Japan) And digested with agarose gel electrophoresis. Subsequently, a Southern blot was performed, and the 3 ′ end DNA fragment (XhoI to EcoRI) of Ig light chain JK-C / c genomic DNA used in the invention described in the W00 / 00383 pamphlet (see Example 48).
  • Example 4 1 UShBMPIO KI chimeric mouse using UShBMPIO mouse ES cell line and B lymphocyte-deficient mouse strain-derived host embryo
  • UShBMPIO mouse ES cell line obtained in Example 40 above and confirmed to have human BMP10-cDNA inserted downstream of the immunoglobulin / c chain gene was frozen. They were injected into 8 cell stage embryos obtained by mating male and female mice of the above immunoglobulin ⁇ chain knockout mice homozygous, and 8 to 10 embryos were injected per embryo.
  • ES medium Shinichi Aizawa, Biomanual Series 8, Gene Targeting, Yodosha, 1995
  • ICR pseudopregnancy treatment MCH
  • Example 6 of Panflate Example 1 Chimeric mice prepared according to the method described in 1 were used in the expression analysis experiment of UShBMPIO KI chimeric mice performed in Example 4 3 below. Used as a control chimera individual.
  • Example 44 Expression and preparation of recombinant N-terminal His-type mBMPIO complex
  • V5S GATCCGCTAGCGTCGACGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTC GATTCTACGTGAC (SEQ ID NO: 7)
  • V5AS TCGAGTCACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTA CCGTCGACGCTAGCG (SEQ ID NO: 8)
  • V5S 5'- GATCC 6CTA6C GTCfiAC GGTAAGCCTATCCCTAACCCTCTCT CCTCGGTCTCGAnCTACG TGA C-3 * (S3 ⁇ 4 number 7)
  • V5AS 3 * - ⁇ C8ATC6 CAGCTG CCATTCQGATA6G6ATT6G8AeAeGAGCCAGAGCTAAeATCT8 MTA
  • the synthetic oligo DNA was introduced into the BamHI-XhoI site on the pLNl vector described in the report of Kakeda et al. (Gene Ther. 12: 852-856, 2005) to construct the pLNlV5 vector.
  • mBMPl ONhelkozakFw CTAGCTAGCCGGCCACC ATGGGGTCTCTGGTTCTGCC
  • the obtained 1290 bp amplified fragment was separated and recovered on a 0.8% gel.
  • the amplified fragment was recovered from the recovered gel using QIAquick Gel Extraction Kit (Qiagen, Japan) according to the package insert.
  • Example 4 4-1 The PCR-amplified fragment recovered in 1-2 was enzymatically digested with Nhel and Sail (Roche Diagnostics, Japan) and separated and recovered with 0.8% agarose gel. Enzyme-treated fragments were collected according to the package insert using the collected Genole power, et al. QIAquick Gel Extraction Extraction Kit (Qiagen, Japan). The obtained enzyme-treated fragment was obtained from the pLNlV5 vector prepared in Example 4 4-1 1 1.
  • Example 4 The N-terminal His-type mBMPIO complex recombinant expression vector obtained in 4-1-3 was introduced into Escherichia coli DH5a, and DNA was purified from the resulting transformant with a plasmid purification kit (Qiagen plasmid). axi kit; Qiagen, Japan).
  • the supernatant was collected and filtered with 0.22 ⁇ m FP (0.22 ⁇ m GP Express Membrane; Nippon Millipore, Japan) and cooled at 4 ° C. (cold room). When stored frozen, it was thawed and filtered through a 0.22 ⁇ m filter again.
  • PBS Dulecco's Phosphate Buffered Saline; SIGMA
  • SIGMA Stilicate's Phosphate Buffered Saline
  • B buffer PBS containing 0.5M Imidazole
  • the pretreated 1 L culture supernatant was applied to a Ni Sepharose column (His Trap HP 5 ml; GE Healthcare Biosciences, Japan) equilibrated with PBS. Then, add 25% of 0% B buffer, 25 ml of buffer with NaCl added to PBS to adjust the NaCl concentration to 1.85M, 0 ° / oB buffer 25ml, 5% B buffer 40ml, 8% B buffer 40ml in this order. Was washed. After the washing operation, 50 ml of 15% B buffer was added to the column to recover the target protein. For the separation and purification operation, AKTAexplorerlOs (GE Healthcare Biosciences, Japan) was used. Endotoxin removal treatment was performed before use.
  • PBS Dulecco's Phosphate Buffered Saline; SIGMA
  • SIGMA Dulecco's Phosphate Buffered Saline
  • the fraction containing the target protein obtained in 3-2 was added. Then 0 ° /. B buffer 20ml, The column was washed sequentially with 10 ml of 2% B buffer. After completion of the washing operation, 20 ml of 7% B buffer was applied to the column, and the target protein was recovered. After the washing operation, 50 mL of 2% B buffer, etc. 10 ° / is used to recover the target protein. After performing NaCl linear gradient to B buffer, 20 ml of 10% B buffer was applied to the column. Fractions for recovering the target protein were determined by SDS-PAGE analysis (silver-stained image) using a part of each obtained fraction. AKTAexplorerlOs (GE Healthcare Biosciences, Japan) was used for the separation and purification operation, and endotoxin removal treatment was performed before use.
  • AKTAexplorerlOs GE Healthcare Biosciences, Japan
  • Example 4 The buffer in the purified sample obtained in 4-3-3 was replaced with PBS using an ultrafiltration membrane VIVASPIN20 10,000 MWCO PES (Sartorius Japan Co., Ltd., Japan). Concentrated. After the concentration operation, filtration was performed using a 0.22 / xm filter (Mill ex GV; Japan Millipore Corporation, Japan). The operation was performed in a clean bench whenever possible. SDS-PAGE (silver staining) of the final purified product detects mature dimer, pro2mer, pro-region force S under non-reducing conditions, and mature monomer, pro-region, pro-single under reducing conditions. A mass was detected ( Figure 19).
  • the purified preparation prepared by the above operation contained a complex (complex body) consisting of two molecules of pro-region and one molecule of mature dimer.
  • Pro-regions and pro bodies were confirmed by Western blotting using an anti-His antibody PentaHis HRP Conjugate (Qiagen, Japan).
  • Example 4 5 Activity measurement of N-terminal His type mBMPIO complex in vitro (in vitro test)
  • a cell line stably introduced with a reporter plasmid capable of detecting a BMP signal and a human ALK1 full-length gene expression plasmid was used. Specifically, it is a reporter plasmid that can detect BMP signals first.
  • HepG2 available from ATCC
  • HepG2 available from ATCC
  • HepG2 available from ATCC
  • a human hepatoma cell line to produce a stable reporter gene introduction strain HepG2 (38_5).
  • a human full-length ALK gene expression plasmid hALKl / PEAK8
  • hALKl / HepG2 # 1 was obtained.
  • Plasmid (p (GCCG) 12-Luc / neo) was prepared according to the method described by Kusanagi et al. In Mol. Biol. Cell., 2000, 11 (2): 555-65.
  • Luciferase activity was measured at various concentrations against the above ALKl / HepG2 # 1 strain.
  • a chemiluminescent reagent (Steady Glo TM)
  • Example 4 6 Antitumor effect of N-terminal His-type mBMPlO complex on human pancreatic cancer (BXPC3) tumor model
  • the tumor model is 100 ⁇ l of a solution containing 4 x 10 6 human pancreatic cancer cell line BXPC3 (available from ATCC) per 100 1 (BALB- nu / nu: Japan Japan 1) and transplanted subcutaneously to the right ventral region.
  • BXPC3 human pancreatic cancer cell line
  • BMP10 protein is N-terminal His-type mBMPIO complex prepared at the time of use in PBS at dosages of 0.15, 0.5, 1.5, 5, and 5.0 mg / kg 3 times a week for 2 weeks. It was administered intravenously.
  • PBS solution containing Endotoxin (Nihon Seikagaku Co., Ltd.) in the same amount as Endotoxin contained in the administration solution of the highest dose administration group (5.0 mg / kg) was prepared and administered. .
  • the tumor model was obtained by cutting a tumor block of human endometrial cancer (available from ATCC) into a block of approximately 2 squares under physiological saline (Otsuka Pharmaceutical Co., Ltd., Japan).
  • CL-4570 (CLEA Japan, Japan) was used and transplanted subcutaneously into the right flank of nude mice (BALB-nu / nu: Nippon Chillarus-Ribaichi Japan).
  • grouping was performed using general-purpose grouping software (Visions, Japan) (5 animals per group). The day of grouping was defined as Dayl of administration start.
  • Administration BMP10 protein was N-terminal His-type mBMPIO complex prepared at the time of use in PBS and administered into the tail vein 3 times a week for 2 weeks at dosages of 0.5, 1.5 and 5.0 mg / kg.
  • a PBS solution containing Endotoxin (Nippon Seikagaku Corporation) in the same amount as Endotoxin contained in the administration solution of the highest dose administration group (5.0 mg / kg) was prepared and administered.
  • mouse BMP10 complex with N-terminal His tag sequence suppresses tumor growth of AN3CA in a dose-dependent manner, and mouse BMP10 complex may have tumor growth inhibitory activity (Fig. 2 2).
  • Example 48 Antitumor activity of N-terminal His-type mBMPIO complex against human glioma (U87MG) tumor model
  • the tumor model was a U2MG tumor block cut out into approximately 2mm square blocks under physiological saline (Otsuka Pharmaceutical Co., Ltd., Japan) and a cancer cell transplant needle CL-4570 (Japan Claire Co., Ltd., Japan) It was prepared by transplanting subcutaneously into the right flank of nude mice (BALB-nu / nu: Japan Japan Lurus-Ribaichi Co., Ltd.). When the tumor volume of transplant mouse has become the order of 10 3, using a general-purpose group divided into soft (Japanese stock company Visions), it was carried out grouping (five mice per group). The day of grouping was designated as Dayl of administration start.
  • BMP10 protein is N-terminal His-type mBMPIO complex prepared at the time of use in PBS at dosages of 0.15, 0.5, 1.5, 5.0 mg / kg 3 times a week for 2 weeks Meanwhile, it was administered via the tail vein.
  • a PBS solution containing Endotoxin (Nippon Seikagaku Corporation) in the same amount as Endotoxin contained in the administration solution of the highest dose administration group (5.0 mg / kg) was prepared. Administered.
  • the mouse BMP10 complex with N-terminal His tag sequence (N-terminal His-type mBMPlO complex) showed a tendency to suppress tumor growth of the U87MG strain at a dose of 0.5 mg / kg, and the mouse BMP10 complex The possibility of tumor growth inhibitory activity was suggested (Fig. 23).
  • tumor cell growth of solid cancer can be inhibited.
  • SEQ ID NOs: 1, 2, 7-: 1 2, 1 5, 1 6, 2 1-2-2, 2, 9, 30, 33-36 indicate the synthetic oligonucleotide sequences.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un agent thérapeutique pour le cancer, qui peut traiter un cancer solide ou une maladie ou un trouble associé avec le cancer solide sans induire d'effets secondaires indésirables. L'invention concerne spécifiquement une composition pharmaceutique pour le traitement et/ou la prévention du cancer, qui comprend la protéine BMP10, un acide nucléique codant pour la protéine BMP10, un vecteur d'expression qui porte un acide nucléique codant pour la protéine BMP10, ou une combinaison de deux ou plus d'entre eux en tant qu'ingrédient actif.
PCT/JP2008/073981 2007-12-28 2008-12-26 Procédé et composition pharmaceutique pour le traitement du cancer utilisant la protéine bmp10 WO2009084739A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2007341080 2007-12-28
JP2007-341080 2007-12-28
JP2008-244975 2008-09-24
JP2008244975 2008-09-24

Publications (1)

Publication Number Publication Date
WO2009084739A1 true WO2009084739A1 (fr) 2009-07-09

Family

ID=40824442

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2008/073981 WO2009084739A1 (fr) 2007-12-28 2008-12-26 Procédé et composition pharmaceutique pour le traitement du cancer utilisant la protéine bmp10

Country Status (1)

Country Link
WO (1) WO2009084739A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022092546A1 (fr) * 2020-10-30 2022-05-05 (의료)길의료재단 Composition pharmaceutique pour la prévention ou le traitement de maladies métaboliques contenant une protéine morphogénétique osseuse 10 en tant que principe actif

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008015383A2 (fr) * 2006-07-29 2008-02-07 University College Cardiff Consultants Limited Activité anticancéreuse des protéines bmp-9 et bmp-10 et leur utilisation dans les traitements du cancer

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008015383A2 (fr) * 2006-07-29 2008-02-07 University College Cardiff Consultants Limited Activité anticancéreuse des protéines bmp-9 et bmp-10 et leur utilisation dans les traitements du cancer

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DAVID, L ET AL.: "Identification of BMP9 and BMP10 as functional activators of the orphan activin receptor-like kinase 1 (ALK1) in endothelial cells", BLOOD, vol. 109, no. 5, 1 March 2007 (2007-03-01), pages 1953 - 1961, XP002490787, DOI: doi:10.1182/blood-2006-07-034124 *
UNGEFROREN, H ET AL.: "Antitumor activity of ALK1 in pancreatic carcinoma cells", INT. J. CANCER, vol. 120, no. 8, 15 April 2007 (2007-04-15), pages 1641 - 1651, XP002490786, DOI: doi:10.1002/ijc.22393 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022092546A1 (fr) * 2020-10-30 2022-05-05 (의료)길의료재단 Composition pharmaceutique pour la prévention ou le traitement de maladies métaboliques contenant une protéine morphogénétique osseuse 10 en tant que principe actif

Similar Documents

Publication Publication Date Title
US11234420B2 (en) Method for constructing PD-1 gene modified humanized animal model and use thereof
Aoki et al. Foxl1-expressing mesenchymal cells constitute the intestinal stem cell niche
CN104797936B (zh) 融合蛋白及其方法
Zhang et al. Haploinsufficiency of Klippel-Trenaunay syndrome gene Aggf1 inhibits developmental and pathological angiogenesis by inactivating PI3K and AKT and disrupts vascular integrity by activating VE-cadherin
CN108531487B (zh) 人源化sirpa基因改造动物模型的制备方法及应用
JP2009504183A5 (fr)
JP2009219499A (ja) 遺伝子破壊、それに関連する組成物および方法
EP3740246B9 (fr) Perturbation du complexe linc pour le traitement de laminopathies
CN111808882B (zh) Il7r基因人源化改造的动物模型的构建方法及其应用
KR20140050689A (ko) Pik3ca h1047r 녹-인 비인간 동물 유방암 모델
CN113710695A (zh) 低氧反应性嵌合抗原受体
JP2003531811A5 (fr)
JP2004154140A (ja) 血管形成及び心血管新生の促進又は阻害
WO2008075796A1 (fr) Agent pour encourager la récupération après une déplétion de globule sanguin
Beucher et al. The HASTER lncRNA promoter is a cis-acting transcriptional stabilizer of HNF1A
WO2009084738A1 (fr) Procédé et composition pharmaceutique pour le traitement du cancer utilisant la protéine bmp9
WO2006095846A1 (fr) Animal modele dans lequel l'evolution d'un etat pathologique peut etre observee en temps reel, gene chimere utilise pour ce faire et utilisation correspondante
WO2009084739A1 (fr) Procédé et composition pharmaceutique pour le traitement du cancer utilisant la protéine bmp10
KR20180066237A (ko) 항-암 및 항-염증 치료제 및 이의 방법
EP4130283A1 (fr) Construction d'acide nucléique pouvant mesurer une activité de recombinaison homologue, et son procédé d'utilisation
US7265260B2 (en) Transgenic non-human mammals expressing constitutively activated tyrosine kinase receptors
WO2010034845A1 (fr) Modèle de cancer de rongeur utilisé pour le polymorphisme du fgfr4 arg385 humain
US9695235B2 (en) Method for regulating cell proliferation
JP2018526005A (ja) 前立腺がんのげっ歯類モデル
WO2023072081A1 (fr) Animal non humain génétiquement modifié comportant un tgfbr2 humain ou chimérique

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08866222

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

NENP Non-entry into the national phase

Ref country code: JP

122 Ep: pct application non-entry in european phase

Ref document number: 08866222

Country of ref document: EP

Kind code of ref document: A1